# Installations
This includes the required installations for the first steps of the SwarmGenomics pipeline. For the later analyses, the installations will be provided in the corresponding instructions.
These instructions mainly use miniconda, but you may use other methods as you prefer. You may want to adapt certain installations as newer packages are released.

## Preprocessing
This includes all the installations for steps 1-3. 
### Miniconda3 
First we install miniconda3
```bash
# Download the software from the website
wget https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh 
bash Miniconda3-latest-Linux-x86_64.sh
#select "yes" for everything, and if you are working on a denbi VM, change the storage location to /vol/storage/miniconda3

# Activate conda
conda activate
```

### Conda installations
```bash
conda install bioconda::fastqc
conda install bioconda::bwa
conda install bioconda::bwa-mem2
conda install bioconda::vcftools
conda install conda-forge::r-splitstackshape
conda install bioconda::bedtools
conda install bioconda::tabix
conda install bioconda::samtools
conda install bioconda::trimmomatic
conda install bioconda::seqkit
conda install -c conda-forge ncurses
conda install -c bioconda htslib
```

### SRA tools
You may also download this on Conda, but make sure you get latest version.
```bash
# /vol/storage/software
wget https://ftp-trace.ncbi.nlm.nih.gov/sra/sdk/current/sratoolkit.current-centos_linux64.tar.gz
tar -xzf sratoolkit.current-centos_linux64.tar.gz
rm sratoolkit.current-centos_linux64.tar.gz
```
### Bcftools
```bash
# /vol/storage/software
wget https://github.com/samtools/bcftools/releases/download/1.19/bcftools-1.19.tar.bz2
tar -xjf bcftools-1.19.tar.bz2 
cd bcftools-1.19
./configure --prefix=/vol/storage/software/bcftools-1.19
make
rm /vol/storage/software/bcftools-1.19.tar.bz2
```
### Trimmomatics adapters
This will create a file with adapters for Trimmomatics.
```bash
# Create a directory for adapters
mkdir -p /vol/storage/software/trimmomatics
vim /vol/storage/software/trimmomatics/adapters.fa

# press i
# paste the sequences from github (e.g. NexteraPE-PE.fa, TruSeq3-PE-2.fa)
# https://github.com/timflutre/trimmomatic/tree/master/adapters
>PrefixPE/1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PrefixPE/2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE1
TACACTCTTTCCCTACACGACGCTCTTCCGATCT
>PE1_rc
AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
>PE2
GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
>PE2_rc
AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
>PrefixNX/1
AGATGTGTATAAGAGACAG
>PrefixNX/2
AGATGTGTATAAGAGACAG
>Trans1
TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG
>Trans1_rc
CTGTCTCTTATACACATCTGACGCTGCCGACGA
>Trans2
GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG
>Trans2_rc
CTGTCTCTTATACACATCTCCGAGCCCACGAGAC

# press esc
# type :wq!
```
## Genomic Modules
Below are all installations for genomic modules steps 4-12. 

### PSMC
```bash
# Clone the repository
git clone https://github.com/lh3/psmc.git

# Make psmc
cd psmc
make

# Make utils
cd utils
make
```
### R and R packages for plotting
```bash
# Install R
conda install r-base r-essentials
```
```r
# Open R
R

# Install R packages
install.packages(c("ggplot2", "dplyr", "gridExtra", "RColorBrewer", "patchwork", "data.table", "tidyr"))
```
### Mitochondrial Genome Reconstruction
```
# GetOrganelle installation
conda create -n getorganelle -c bioconda getorganelle

# Activate environment
conda activate getorganelle

# Install configuration
get_organelle_config.py -a animal_mt

# Deactivate
conda deactivate
```
### Phylogenetic Tree visualisation
```
sudo apt install ncbi-blast+
sudo apt install seqkit
sudo apt install mafft
sudo apt install fasttree

pip install toytree toyplot biopython
```
### NUMT Identification
```r
# R 
conda create -n r_env r-essentials r-base
conda activate r_env

# Blast
conda install bioconda::blast

# Bedtools (you should already have this installed)
conda install bioconda::bedtools

# Deactivate
conda deactivate
```
### Unmapped Reads
```bash

# Install Kraken2 (version 2.1.3) to its own environment called kraken
conda create -n kraken -c bioconda kraken2=2.1.3

# If you encounter an error with solving environment, try:
conda config --env --add channels conda-forge

# Activate kraken
conda activate kraken

#Install krakentools
conda install bioconda::krakentools
```
You will also need to create or download a database. You may choose one from https://benlangmead.github.io/aws-indexes/k2 which suits your needs. Here we will download the PlusPFP-16 database.
```bash
# Make a directory for the database
mkdir kraken_database

# Download the database in the directory
cd kraken_database
wget https://genome-idx.s3.amazonaws.com/kraken/k2_pluspf_16gb_20240112.tar.gz
tar -xvzf k2_pluspf_16gb_20240112.tar.gz
```
### Genome Visualisation

```bash
conda install bioconda::mosdepth
```bash

Circos software: 
```bash
# Change to the directory where you want to install Circos
# E.g. /vol/storage/software
cd /vol/storage/software

# Get the latest circos download from https://circos.ca/software/download/
wget --no-check-certificate https://circos.ca/distribution/circos-0.69-9.tgz
tar -xvzf circos-0.69-9.tgz
```

For more instructions on installation visit https://circos.ca/software/installation/
```bash
# Install dependencies
# Install libraries
sudo apt-get install -y libgd-dev

# Install Perl GD module with Conda
conda install -c conda-forge perl-gd

# Install perl-Params-Validate module with Conda
conda install -c conda-forge perl-params-validate

```
Install Perl modules
```perl
# Enter CPAN shell 
cpan

# Install modules
install Readonly
install Font::TTF::Font
install Math::Bezier
install Math::Round
install Config::General
install GD
install Set::IntSpan
install List::MoreUtils
install GD::Polyline
install Math::VecStat
install SVG
install Params::Validate
install Regexp::Common
install Text::Format
install Statistics::Basic

# To exit
exit
```
### Repeat Analysis
Change the installation locations accodingly.
```bash
# Install HMMER
cd /vol/storage/software
wget http://eddylab.org/software/hmmer/hmmer-3.3.2.tar.gz
tar -xzf hmmer-3.3.2.tar.gz
rm /vol/storage/software/hmmer-3.3.2.tar.gz
cd hmmer-3.3.2
./configure --prefix=/vol/storage/software/hmmer-3.3.2
make
make install

# Install RM BLAST
cd /vol/storage/software
wget http://www.repeatmasker.org/rmblast/rmblast-2.14.0+-x64-linux.tar.gz
tar -xzf rmblast-2.14.0+-x64-linux.tar.gz
rm rmblast-2.14.0+-x64-linux.tar.gz

# Install TRF
cd /vol/storage/software
wget https://github.com/Benson-Genomics-Lab/TRF/archive/refs/tags/v4.09.1.tar.gz
tar -xzf /vol/storage/software/v4.09.1.tar.gz
rm /vol/storage/software/v4.09.1.tar.gz
mkdir /vol/storage/software/TRF-4.09.1/build
cd /vol/storage/software/TRF-4.09.1/build 
/vol/storage/software/TRF-4.09.1/configure --prefix=/vol/storage/software/TRF-4.09.1
make
make install

# Install RepeatMasker
cd /vol/storage/software
wget https://www.repeatmasker.org/RepeatMasker/RepeatMasker-4.1.5.tar.gz
tar -xzf RepeatMasker-4.1.5.tar.gz
rm RepeatMasker-4.1.5.tar.gz

# Configure RepeatMasker
perl /vol/storage/software/RepeatMasker/configure

#Paths for RepeatMasker
/vol/storage/software/TRF-4.09.1/bin/trf
/vol/storage/software/rmblast-2.14.0/bin
/vol/storage/software/hmmer-3.3.2/bin

#Selections
Add a Search Engine:
   1. Crossmatch: [ Un-configured ]
   2. RMBlast: [ Configured ]
   3. HMMER3.1 & DFAM: [ Configured, Default ]
   4. ABBlast: [ Un-configured ]

   5. Done

# Install RECON
cd /vol/storage/software
wget http://www.repeatmasker.org/RepeatModeler/RECON-1.08.tar.gz
tar RECON-1.08.tar.gz
rm /vol/storage/software/RECON-1.08.tar.gz
cd /vol/storage/software/RECON-1.08/src
make
make install

# Install Ninja
cd /vol/storage/software
wget https://github.com/TravisWheelerLab/NINJA/archive/0.95-cluster_only.tar.gz
tar -xzf /vol/storage/software/0.95-cluster_only.tar.gz
rm /vol/storage/software/0.95-cluster_only.tar.gz
mv /vol/storage/software/NINJA-0.95-cluster_only/NINJA/Ninja_new /vol/storage/software/NINJA-0.95-cluster_only/NINJA/Ninja

# Install LTR Retriever
cd /vol/storage/software
wget https://github.com/oushujun/LTR_retriever/archive/v2.8.tar.gz
tar -xzf v2.8.tar.gz
rm v2.8.tar.gz

# Install Mafft
cd /vol/storage/software
wget https://mafft.cbrc.jp/alignment/software/mafft-7.505-with-extensions-src.tgz
tar -xzf /vol/storage/software/mafft-7.505-with-extensions-src.tgz
rm /vol/storage/software/mafft-7.505-with-extensions-src.tgz
cd /vol/storage/software/mafft-7.505-with-extensions/core
sed -i 's#PREFIX = /usr/local#PREFIX = /vol/storage/software/mafft-7.505-with-extensions#' /vol/storage/software/mafft-7.505-with-extensions/core/Makefile
sed -i 's#BINDIR = $(PREFIX)/bin#BINDIR = /vol/storage/software/mafft-7.505-with-extensions/bin#' /vol/storage/software/mafft-7.505-with-extensions/core/Makefile
make clean
make
make install

cd /vol/storage/software/mafft-7.505-with-extensions/extensions
sed -i 's#PREFIX = /usr/local#PREFIX = /vol/storage/software/mafft-7.505-with-extensions#' /vol/storage/software/mafft-7.505-with-extensions/extensions/Makefile
sed -i 's#BINDIR = $(PREFIX)/bin#BINDIR = /vol/storage/software/mafft-7.505-with-extensions/bin#' /vol/storage/software/mafft-7.505-with-extensions/extensions/Makefile
make clean
make 
make install

# Install CD-Hit
cd /vol/storage/software
wget https://github.com/weizhongli/cdhit/archive/refs/tags/V4.8.1.tar.gz
tar -xzf /vol/storage/software/V4.8.1.tar.gz
rm /vol/storage/software/V4.8.1.tar.gz
cd /vol/storage/software/cdhit-4.8.1
make 

# Install Genometools
cd /vol/storage/software
wget http://genometools.org/pub/genometools-1.6.2.tar.gz
tar -xzf /vol/storage/software/genometools-1.6.2.tar.gz
rm /vol/storage/software/genometools-1.6.2.tar.gz
cd /vol/storage/software/genometools-1.6.2
make prefix=/vol/storage/software/genometools-1.6.2 cairo=no

# Install RepeatModeler2
cd /vol/storage/software
wget http://www.repeatmasker.org/RepeatModeler/RepeatModeler-2.0.4.tar.gz
tar -xvf /vol/storage/software/RepeatModeler-2.0.4.tar.gz
rm /vol/storage/software/RepeatModeler-2.0.4.tar.gz
cd /vol/storage/software/RepeatModeler-2.0.4

# Install RepeatScout
cd /vol/storage/software
wget http://www.repeatmasker.org/RepeatScout-1.0.6.tar.gz
tar -xzf /vol/storage/software/RepeatScout-1.0.6.tar.gz
rm /vol/storage/software/RepeatScout-1.0.6.tar.gz
cd /vol/storage/software/RepeatScout-1.0.6
make

# Install USCS
rm -r /vol/storage/software/USCS
mkdir /vol/storage/software/USCS
cd /vol/storage/software/USCS
rsync -aP hgdownload.soe.ucsc.edu::genome/admin/exe/linux.x86_64/ ./

cpan install JSON
#yes
#sudo
cpan install File::Which
cpan install URI
cpan install Devel::Size
cpan install LWP::UserAgent
cd /vol/storage/software/RepeatModeler-2.0.4
perl ./configure

# Configure RepeatModeler2 with Paths w/ yes ("y") to using LTR Retriever
*/vol/storage/software/RepeatMasker
*/vol/storage/software/RECON-1.08/bin
*/vol/storage/software/RepeatScout-1.0.6
*/vol/storage/software/TRF-4.09.1/bin
*/vol/storage/software/cdhit-4.8.1
*/vol/storage/software/USCS
*/vol/storage/software/rmblast-2.14.0/bin
#yes
*/vol/storage/software/genometools-1.6.2/bin
*/vol/storage/software/LTR_retriever-2.8
*/vol/storage/software/mafft-7.505-with-extensions/bin
*/vol/storage/software/NINJA-0.95-cluster_only/NINJA
```