{
 "cells": [
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'A'"
      ]
     },
     "execution_count": 1,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "'A'"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'ACGT'"
      ]
     },
     "execution_count": 2,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "'ACGT'"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [],
   "source": [
    "st = 'ACGT'"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "4"
      ]
     },
     "execution_count": 4,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "len(st) # getting the length of a string"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "''"
      ]
     },
     "execution_count": 5,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "'' # empty string (epsilon)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "0"
      ]
     },
     "execution_count": 6,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "len('')"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'C'"
      ]
     },
     "execution_count": 7,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "import random\n",
    "random.choice('ACGT') # generating a random nucleotide"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'C'"
      ]
     },
     "execution_count": 8,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "random.choice('ACGT') # repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'T'"
      ]
     },
     "execution_count": 9,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "random.choice('ACGT') # repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'A'"
      ]
     },
     "execution_count": 10,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "random.choice('ACGT') # repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'G'"
      ]
     },
     "execution_count": 11,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "random.choice('ACGT') # repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'GTCACATAATGCTGTAGATTAAGCGAGAAGACCTTAGGTC'"
      ]
     },
     "execution_count": 12,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "# now I'll make a random nucleotide string by concatenating random nucleotides\n",
    "st = ''.join([random.choice('ACGT') for _ in range(40)])\n",
    "st"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 13,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'TC'"
      ]
     },
     "execution_count": 13,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[1:3] # substring, starting at position 1 and extending up to but not including position 3\n",
    "# note that the first position is numbered 0"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'GTC'"
      ]
     },
     "execution_count": 14,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[0:3] # prefix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'GTC'"
      ]
     },
     "execution_count": 15,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[:3] # another way of getting the prefix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'GTC'"
      ]
     },
     "execution_count": 16,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[len(st)-3:len(st)] # suffix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'GTC'"
      ]
     },
     "execution_count": 17,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[-3:] # another way of getting the suffix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 18,
   "metadata": {},
   "outputs": [],
   "source": [
    "st1, st2 = 'CAT', 'ATAC'"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'CAT'"
      ]
     },
     "execution_count": 19,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st1"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 20,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'ATAC'"
      ]
     },
     "execution_count": 20,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st2"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "'CATATAC'"
      ]
     },
     "execution_count": 21,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st1 + st2 # concatenation of 2 strings"
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Python 3",
   "language": "python",
   "name": "python3"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.6.2"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 1
}