{
 "cells": [
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "A"
      ]
     },
     "execution_count": 1,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "\"A\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "ACGT"
      ]
     },
     "execution_count": 2,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "\"ACGT\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [],
   "source": [
    "st := \"ACGT\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "4"
      ]
     },
     "execution_count": 4,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "len(st)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": []
     },
     "execution_count": 5,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "\"\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "0"
      ]
     },
     "execution_count": 6,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "len(\"\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "C"
      ]
     },
     "execution_count": 7,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "import \"math/rand\"\n",
    "st = \"ACGT\"\n",
    "string(st[rand.Intn(len(st))]) // generating a random nucleotide"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "T"
      ]
     },
     "execution_count": 8,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "string(st[rand.Intn(len(st))]) // repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "T"
      ]
     },
     "execution_count": 9,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "string(st[rand.Intn(len(st))]) // repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "T"
      ]
     },
     "execution_count": 10,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "string(st[rand.Intn(len(st))]) // repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "C"
      ]
     },
     "execution_count": 11,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "string(st[rand.Intn(len(st))]) // repeated invocations might yield different nucleotides"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "GCAAAGTGCAGTCCGTGAGTTTAGTCATTCACTCGCGGTC"
      ]
     },
     "execution_count": 12,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "// make random nucleotide string by concatenating random nucleotides\n",
    "import \"bytes\"\n",
    "var b bytes.Buffer\n",
    "for i := 0; i < 40; i++ {\n",
    "    b.WriteByte(st[rand.Intn(len(st))])\n",
    "}\n",
    "st = b.String()\n",
    "st"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 13,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "CA"
      ]
     },
     "execution_count": 13,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[1:3] // substring, starting at position 1 and extending up to but not including position 3\n",
    "// note that the first position is numbered 0"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "GCA"
      ]
     },
     "execution_count": 14,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[0:3] // prefix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "GCA"
      ]
     },
     "execution_count": 15,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[:3] // another way of getting the prefix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "GTC"
      ]
     },
     "execution_count": 16,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st[len(st)-3:len(st)] // suffix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {},
   "outputs": [
    {
     "ename": "ERROR",
     "evalue": "repl.go:1:5: negative slice index: -3 == Expr{Type: int, Value: -3}",
     "output_type": "error",
     "traceback": [
      "repl.go:1:5: negative slice index: -3 == Expr{Type: int, Value: -3}"
     ]
    }
   ],
   "source": [
    "st[-3:] // another way of getting the suffix of length 3"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 18,
   "metadata": {},
   "outputs": [],
   "source": [
    "st1, st2 := \"CAT\", \"ATAC\""
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "CAT"
      ]
     },
     "execution_count": 19,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st1"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 20,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "ATAC"
      ]
     },
     "execution_count": 20,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st2"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "CATATAC"
      ]
     },
     "execution_count": 21,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "st1 + st2 // concatenation of 2 strings"
   ]
  }
 ],
 "metadata": {
  "kernelspec": {
   "display_name": "Go",
   "language": "go",
   "name": "gophernotes"
  },
  "language_info": {
   "codemirror_mode": "",
   "file_extension": ".go",
   "mimetype": "",
   "name": "go",
   "nbconvert_exporter": "",
   "pygments_lexer": "",
   "version": "go1.11"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 2
}