{
 "cells": [
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "# This notebook shows rich jupyter representations of Dseqrecord and derived classes\n",
    "\n",
    "* Dseqrecord --> base class\n",
    "* GenbankRecord(Dseqrecord) --> read from Genbank link\n",
    "* GenbankFile(Dseqrecord) --> read from local file\n",
    "* Amplicon(Dseqrecord) --> PCR product\n",
    "* Contig(Dseqrecord) --> Produced through Assembly "
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 1,
   "metadata": {},
   "outputs": [],
   "source": [
    "try:\n",
    "    from pydna.readers import read\n",
    "    from pydna.parsers import parse_primers\n",
    "    from pydna.dseqrecord import Dseqrecord\n",
    "    from pydna.genbank import Genbank\n",
    "    from pydna.amplify import pcr\n",
    "    from pydna.assembly import Assembly\n",
    "except ImportError:\n",
    "    import sys, os\n",
    "\n",
    "    sys.path.append(os.pardir)\n",
    "    from pydna.readers import read\n",
    "    from pydna.parsers import parse_primers\n",
    "    from pydna.dseqrecord import Dseqrecord\n",
    "    from pydna.genbank import Genbank\n",
    "    from pydna.amplify import pcr\n",
    "    from pydna.assembly import Assembly"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Dseqrecord"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 2,
   "metadata": {},
   "outputs": [],
   "source": [
    "ldsr = Dseqrecord(\"aaa\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 3,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.dseqrecord.Dseqrecord"
      ]
     },
     "execution_count": 3,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(ldsr)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 4,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "Dseqrecord(-3)"
      ]
     },
     "execution_count": 4,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "ldsr"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 5,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "[Dseqrecord(-3), Dseqrecord(-3)]"
      ]
     },
     "execution_count": 5,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "[ldsr, ldsr]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 6,
   "metadata": {},
   "outputs": [],
   "source": [
    "cdsr = Dseqrecord(\"aaa\", circular=True)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 7,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.dseqrecord.Dseqrecord"
      ]
     },
     "execution_count": 7,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(cdsr)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 8,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "Dseqrecord(o3)"
      ]
     },
     "execution_count": 8,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cdsr"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 9,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "[Dseqrecord(o3), Dseqrecord(o3)]"
      ]
     },
     "execution_count": 9,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "[cdsr, cdsr]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 10,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "Dseqrecord(o3)"
      ]
     },
     "execution_count": 10,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cdsr.reverse_complement()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 11,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "[Dseqrecord(o3), Dseqrecord(o3)]"
      ]
     },
     "execution_count": 11,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "[cdsr.reverse_complement(), cdsr.reverse_complement()]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 12,
   "metadata": {},
   "outputs": [],
   "source": [
    "fromstring = read(\">string\\naaaa\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 13,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.dseqrecord.Dseqrecord"
      ]
     },
     "execution_count": 13,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(fromstring)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 14,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "Dseqrecord(-4)"
      ]
     },
     "execution_count": 14,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "fromstring"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 15,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "[Dseqrecord(-4), Dseqrecord(-4)]"
      ]
     },
     "execution_count": 15,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "[fromstring, fromstring]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 16,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "[Dseqrecord(-4), Dseqrecord(-4)]"
      ]
     },
     "execution_count": 16,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "[fromstring.reverse_complement(), fromstring.reverse_complement()]"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### GenbankRecord"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 17,
   "metadata": {},
   "outputs": [],
   "source": [
    "from pydna.genbankrecord import GenbankRecord"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 18,
   "metadata": {},
   "outputs": [],
   "source": [
    "# The GenbankRecord is not meant to be used directly\n",
    "gbr = GenbankRecord(\"aaa\", item=\"AccessionNumber\", start=1, stop=3, circular=True)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 19,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankrecord.GenbankRecord"
      ]
     },
     "execution_count": 19,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbr)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 20,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/AccessionNumber?from=1&to=3&strand=1' target='_blank'>AccessionNumber 1-3</a>"
      ],
      "text/plain": [
       "Gbnk(o3 AccessionNumber 1-3)"
      ]
     },
     "execution_count": 20,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "# This link is dead as expected\n",
    "gbr"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 21,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/AccessionNumber?from=1&to=3&strand=1' target='_blank'>AccessionNumber 1-3</a>"
      ]
     },
     "execution_count": 21,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr.hyperlink"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 22,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/AccessionNumber?from=1&to=3&strand=2' target='_blank'>AccessionNumber 1-3</a>"
      ],
      "text/plain": [
       "Gbnk(o3 AccessionNumber 1-3)"
      ]
     },
     "execution_count": 22,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr.reverse_complement()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 23,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/AccessionNumber?from=1&to=3&strand=2' target='_blank'>AccessionNumber 1-3</a>"
      ]
     },
     "execution_count": 23,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr.reverse_complement().hyperlink"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 24,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/AccessionNumber?from=1&to=3&strand=1' target='_blank'>AccessionNumber 1-3</a>"
      ]
     },
     "execution_count": 24,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr.reverse_complement().reverse_complement().hyperlink"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 25,
   "metadata": {},
   "outputs": [],
   "source": [
    "gb = Genbank(\"bjornjobb@gmail.com\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 26,
   "metadata": {},
   "outputs": [],
   "source": [
    "gbr2 = gb.nucleotide(\"E05006\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 27,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankrecord.GenbankRecord"
      ]
     },
     "execution_count": 27,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbr2)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 28,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/E05006?from=&to=&strand=1' target='_blank'>E05006</a>"
      ],
      "text/plain": [
       "Gbnk(-25 E05006)"
      ]
     },
     "execution_count": 28,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr2"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 29,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/E05006?from=&to=&strand=2' target='_blank'>E05006</a>"
      ],
      "text/plain": [
       "Gbnk(-25 E05006)"
      ]
     },
     "execution_count": 29,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr2.reverse_complement()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 30,
   "metadata": {},
   "outputs": [],
   "source": [
    "gbr3 = gb.nucleotide(\"E05006 REGION: 5..15\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 31,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankrecord.GenbankRecord"
      ]
     },
     "execution_count": 31,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbr3)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 32,
   "metadata": {},
   "outputs": [],
   "source": [
    "gbr4 = gb.nucleotide(\"E05006 REGION: complement(5..15)\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 33,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankrecord.GenbankRecord"
      ]
     },
     "execution_count": 33,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbr4)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 34,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/E05006 ?from=5&to=15&strand=2' target='_blank'>E05006  5-15</a>"
      ],
      "text/plain": [
       "Gbnk(-11 E05006  5-15)"
      ]
     },
     "execution_count": 34,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr4"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 35,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='https://www.ncbi.nlm.nih.gov/nuccore/E05006 ?from=5&to=15&strand=1' target='_blank'>E05006  5-15</a>"
      ],
      "text/plain": [
       "Gbnk(-11 E05006  5-15)"
      ]
     },
     "execution_count": 35,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbr4.reverse_complement()"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### GenbankFile"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 36,
   "metadata": {},
   "outputs": [],
   "source": [
    "from pydna.genbankfile import GenbankFile"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 37,
   "metadata": {},
   "outputs": [],
   "source": [
    "gbf = GenbankFile(\"aaa\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 38,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankfile.GenbankFile"
      ]
     },
     "execution_count": 38,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbf)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 39,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='None' target='_blank'>None</a><br>"
      ],
      "text/plain": [
       "File(id)(-3)"
      ]
     },
     "execution_count": 39,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "# The GenbankFile is not supposed to be used directly\n",
    "# The link below is dead as expected\n",
    "gbf"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 40,
   "metadata": {},
   "outputs": [],
   "source": [
    "gbf1 = read(\"sequence.gb\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 41,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankfile.GenbankFile"
      ]
     },
     "execution_count": 41,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbf1)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 42,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='sequence.gb' target='_blank'>sequence.gb</a><br>"
      ],
      "text/plain": [
       "File(E05006.1)(-25)"
      ]
     },
     "execution_count": 42,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbf1"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 43,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='sequence.gb' target='_blank'>sequence.gb</a><br>"
      ],
      "text/plain": [
       "File(E05006.1_rc)(-25)"
      ]
     },
     "execution_count": 43,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbf1.reverse_complement()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 44,
   "metadata": {},
   "outputs": [],
   "source": [
    "gbf2 = read(\"subfolder/sequence.gb\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 45,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.genbankfile.GenbankFile"
      ]
     },
     "execution_count": 45,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(gbf2)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 46,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='subfolder/sequence.gb' target='_blank'>subfolder/sequence.gb</a><br>"
      ],
      "text/plain": [
       "File(E05006.1)(-25)"
      ]
     },
     "execution_count": 46,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbf2"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 47,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<a href='subfolder/sequence.gb' target='_blank'>subfolder/sequence.gb</a><br>"
      ],
      "text/plain": [
       "File(E05006.1_rc)(-25)"
      ]
     },
     "execution_count": 47,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "gbf2.reverse_complement()"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Amplicon"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 48,
   "metadata": {},
   "outputs": [],
   "source": [
    "from pydna.amplicon import Amplicon"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 49,
   "metadata": {},
   "outputs": [],
   "source": [
    "# The Amplicon class is not meant to be used directly, but it is possible\n",
    "amp = Amplicon(\"aaa\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 50,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.amplicon.Amplicon"
      ]
     },
     "execution_count": 50,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(amp)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 51,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "Amplicon(3)"
      ],
      "text/plain": [
       "Amplicon(3)"
      ]
     },
     "execution_count": 51,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "amp"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 52,
   "metadata": {},
   "outputs": [],
   "source": [
    "primers = parse_primers(\n",
    "    '''\n",
    ">ForwardPrimer\n",
    "gctactacacacgtactgactg\n",
    ">ReversePrimer\n",
    "tgtggttactgactctatcttg '''\n",
    ")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 53,
   "metadata": {},
   "outputs": [],
   "source": [
    "temp = Dseqrecord(\"gctactacacacgtactgactg\" + \"gatc\" * 239 + \"caagatagagtcagtaaccaca\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 54,
   "metadata": {},
   "outputs": [],
   "source": [
    "prd = pcr(primers, temp)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 55,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.amplicon.Amplicon"
      ]
     },
     "execution_count": 55,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(prd)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 56,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "5gctactacacacgtactgactg...caagatagagtcagtaaccaca3\n",
       "                          ||||||||||||||||||||||\n",
       "                         3gttctatctcagtcattggtgt5\n",
       "5gctactacacacgtactgactg3\n",
       " ||||||||||||||||||||||\n",
       "3cgatgatgtgtgcatgactgac...gttctatctcagtcattggtgt5"
      ]
     },
     "execution_count": 56,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "prd.figure()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 57,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "|95°C|95°C               |    |tmf:62.4\n",
       "|____|_____          72°C|72°C|tmr:59.1\n",
       "|3min|30s  \\ 58.6°C _____|____|45s/kb\n",
       "|    |      \\______/ 0:45|5min|GC 49%\n",
       "|    |       30s         |    |1000bp"
      ]
     },
     "execution_count": 57,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "prd.program()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 58,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "(Amplicon(1000), Amplicon(1000))"
      ]
     },
     "execution_count": 58,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "(prd, prd)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 59,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "Amplicon(1000)"
      ],
      "text/plain": [
       "Amplicon(1000)"
      ]
     },
     "execution_count": 59,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "prd.reverse_complement()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 60,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "(Amplicon(1000), Amplicon(1000))"
      ]
     },
     "execution_count": 60,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "(prd.reverse_complement(), prd.reverse_complement())"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 61,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "5tgtggttactgactctatcttg...cagtcagtacgtgtgtagtagc3\n",
       "                          ||||||||||||||||||||||\n",
       "                         3gtcagtcatgcacacatcatcg5\n",
       "5tgtggttactgactctatcttg3\n",
       " ||||||||||||||||||||||\n",
       "3acaccaatgactgagatagaac...gtcagtcatgcacacatcatcg5"
      ]
     },
     "execution_count": 61,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "prd.reverse_complement().figure()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 62,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "|95°C|95°C               |    |tmf:59.1\n",
       "|____|_____          72°C|72°C|tmr:62.4\n",
       "|3min|30s  \\ 58.6°C _____|____|45s/kb\n",
       "|    |      \\______/ 0:45|5min|GC 49%\n",
       "|    |       30s         |    |1000bp"
      ]
     },
     "execution_count": 62,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "prd.reverse_complement().program()"
   ]
  },
  {
   "cell_type": "markdown",
   "metadata": {},
   "source": [
    "### Contig"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 63,
   "metadata": {},
   "outputs": [],
   "source": [
    "from pydna.contig import Contig"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 64,
   "metadata": {},
   "outputs": [],
   "source": [
    "# Contig is not meant to be used directly, but it is possible\n",
    "cnt = Contig(\"aaa\")"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 65,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.contig.Contig"
      ]
     },
     "execution_count": 65,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(cnt)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 66,
   "metadata": {},
   "outputs": [],
   "source": [
    "a = Dseqrecord(\"acgatgctatactaagCCCCtgtgctgtgctct\", name=\"SequenceA\")\n",
    "b = Dseqrecord(\"tgtgctgtgctctTTTTTTTtattctggctgtat\", name=\"SequenceB\")\n",
    "c = Dseqrecord(\"tattctggctgtatGGGGGtacgatgctatactaa\", name=\"SequenceC\")\n",
    "x = Assembly((a, b, c), limit=13)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 67,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "Assembly\n",
       "fragments..: 33bp 34bp 35bp\n",
       "limit(bp)..: 13\n",
       "G.nodes....: 6\n",
       "algorithm..: common_sub_strings"
      ]
     },
     "execution_count": 67,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "x"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 68,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.assembly.Assembly"
      ]
     },
     "execution_count": 68,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(x)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 69,
   "metadata": {},
   "outputs": [],
   "source": [
    "cnt = x.assemble_circular()[0]"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 70,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "pydna.contig.Contig"
      ]
     },
     "execution_count": 70,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "type(cnt)"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 71,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<pre> -|SequenceA|13\n",
       "|            \\/\n",
       "|            /\\\n",
       "|            13|SequenceB|14\n",
       "|                         \\/\n",
       "|                         /\\\n",
       "|                         14|SequenceC|15\n",
       "|                                      \\/\n",
       "|                                      /\\\n",
       "|                                      15-\n",
       "|                                         |\n",
       " -----------------------------------------</pre>"
      ],
      "text/plain": [
       "Contig(o60)"
      ]
     },
     "execution_count": 71,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cnt"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 72,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "|||||||||||||||\n",
       "acgatgctatactaagCCCCtgtgctgtgctct\n",
       "                    TGTGCTGTGCTCT\n",
       "                    tgtgctgtgctctTTTTTTTtattctggctgtat\n",
       "                                        TATTCTGGCTGTAT\n",
       "                                        tattctggctgtatGGGGGtacgatgctatactaa\n",
       "                                                            ACGATGCTATACTAA\n"
      ]
     },
     "execution_count": 72,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cnt.detailed_figure()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 73,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/html": [
       "<pre> -|SequenceC_rc|14\n",
       "|               \\/\n",
       "|               /\\\n",
       "|               14|SequenceB_rc|13\n",
       "|                               \\/\n",
       "|                               /\\\n",
       "|                               13|SequenceA_rc|15\n",
       "|                                               \\/\n",
       "|                                               /\\\n",
       "|                                               15-\n",
       "|                                                  |\n",
       " --------------------------------------------------</pre>"
      ],
      "text/plain": [
       "Contig(o60)"
      ]
     },
     "execution_count": 73,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cnt.reverse_complement()"
   ]
  },
  {
   "cell_type": "code",
   "execution_count": 74,
   "metadata": {},
   "outputs": [
    {
     "data": {
      "text/plain": [
       "|||||||||||||||\n",
       "ttagtatagcatcgtaCCCCCatacagccagaata\n",
       "                     ATACAGCCAGAATA\n",
       "                     atacagccagaataAAAAAAAagagcacagcaca\n",
       "                                          AGAGCACAGCACA\n",
       "                                          agagcacagcacaGGGGcttagtatagcatcgt\n",
       "                                                            TTAGTATAGCATCGT\n"
      ]
     },
     "execution_count": 74,
     "metadata": {},
     "output_type": "execute_result"
    }
   ],
   "source": [
    "cnt.reverse_complement().detailed_figure()"
   ]
  }
 ],
 "metadata": {
  "anaconda-cloud": {},
  "kernelspec": {
   "display_name": "Python [conda env:bjorn311]",
   "language": "python",
   "name": "conda-env-bjorn311-py"
  },
  "language_info": {
   "codemirror_mode": {
    "name": "ipython",
    "version": 3
   },
   "file_extension": ".py",
   "mimetype": "text/x-python",
   "name": "python",
   "nbconvert_exporter": "python",
   "pygments_lexer": "ipython3",
   "version": "3.11.0"
  }
 },
 "nbformat": 4,
 "nbformat_minor": 4
}