Kraken taxonomic sequence classification system
Version 2.1.6
Operating Manual
Kraken is a taxonomic sequence classifier that assigns taxonomic labels to DNA sequences. Kraken examines the k-mers within a query sequence and uses the information within those k-mers to query a database. That database maps k-mers to the lowest common ancestor (LCA) of all genomes known to contain a given k-mer.
The first version of Kraken used a large indexed and sorted list of k-mer/LCA pairs as its database. While fast, the large memory requirements posed some problems for users, and so Kraken 2 was created to provide a solution to those problems.
Kraken 2 differs from Kraken 1 in several important ways:
Because Kraken 2 only stores minimizers in its hash table, and k can be much larger than ℓ, only a small percentage of the possible ℓ-mers in a genomic library are actually deposited in the database. This creates a situation similar to the Kraken 1 “MiniKraken” databases; however, preliminary testing has shown the accuracy of a reduced Kraken 2 database to be quite similar to the full-sized Kraken 2 database, while Kraken 1’s MiniKraken databases often resulted in a substantial loss of per-read sensitivity.
If you use Kraken 2 in your own work, please cite either the Kraken 2 paper and/or the original Kraken paper as appropriate. Thank you!
Disk space: Construction of a Kraken 2 standard database requires approximately 100 GB of disk space. A test on 01 Jan 2018 of the default installation showed 42 GB of disk space was used to store the genomic library files, 26 GB was used to store the taxonomy information from NCBI, and 29 GB was used to store the Kraken 2 compact hash table.
Like in Kraken 1, we strongly suggest against using NFS storage to store the Kraken 2 database if at all possible.
Memory: To run efficiently, Kraken 2 requires
enough free memory to hold the database (primarily the hash table) in
RAM. While this can be accomplished with a ramdisk, Kraken 2 will by
default load the database into process-local RAM; the
--memory-mapping switch to kraken2 will avoid
doing so. The default database size is 29 GB (as of Jan. 2018), and you
will need slightly more than that in RAM if you want to build the
default database.
Dependencies: Kraken 2 currently makes extensive use of Linux utilities such as sed, find, and wget. Many scripts are written using the Bash shell, and the main scripts are written using Perl. Core programs needed to build the database and run the classifier are written in C++11, and need to be compiled using a somewhat recent version of g++ that will support C++11. Multithreading is handled using OpenMP. Downloads of NCBI data are performed by wget and rsync. Most Linux systems will have all of the above listed programs and development libraries available either by default or via package download.
Unlike Kraken 1, Kraken 2 does not use an external k-mer counter. However, by default,
Kraken 2 will attempt to use the dustmasker or
segmasker programs provided as part of NCBI’s BLAST suite
to mask low-complexity regions (see Masking of Low-complexity
Sequences).
MacOS NOTE: MacOS and other non-Linux operating systems are not explicitly supported by the developers, and MacOS users should refer to the Kraken-users group for support in installing the appropriate utilities to allow for full operation of Kraken 2. We will attempt to use MacOS-compliant code when possible, but development and testing time is at a premium and we cannot guarantee that Kraken 2 will install and work to its full potential on a default installation of MacOS.
In particular, we note that the default MacOS X installation of GCC does not have support for OpenMP. Without OpenMP, Kraken 2 is limited to single-threaded operation, resulting in slower build and classification runtimes.
Network connectivity: Kraken 2’s standard
database build and download commands expect unfettered FTP and rsync
access to the NCBI FTP server. If you’re working behind a proxy, you may
need to set certain environment variables (such as
ftp_proxy or RSYNC_PROXY) in order to get
these commands to work properly.
Kraken 2’s scripts default to using rsync for most downloads;
however, you may find that your network situation prevents use of rsync.
In such cases, you can try the --use-ftp option to
kraken2-build to force the downloads to occur via
FTP.
MiniKraken: At present, users with low-memory
computing environments can replicate the “MiniKraken” functionality of
Kraken 1 in two ways: first, by increasing the value of k with respect to ℓ (using the --kmer-len
and --minimizer-len options to kraken2-build);
and secondly, through downsampling of minimizers (from both the database
and query sequences) using a hash function. This second option is
performed if the --max-db-size option to
kraken2-build is used; however, the two options are not
mutually exclusive. In a difference from Kraken 1, Kraken 2 does not
require building a full database and then shrinking it to obtain a
reduced database.
To begin using Kraken 2, you will first need to install it, and then either download or create a database.
Kraken 2 consists of two main scripts (kraken2 and
kraken2-build), along with several programs and smaller
scripts. As part of the installation process, all scripts and programs
are installed in the same directory. After installation, you can move
the main scripts elsewhere, but moving the other scripts and programs
requires editing the scripts and changing the $KRAKEN2_DIR
variables in the main scripts.
Once an install directory is selected, you need to run the following command in the directory where you extracted the Kraken 2 source:
./install_kraken2.sh $KRAKEN2_DIR
(Replace $KRAKEN2_DIR above with the directory where you
want to install Kraken 2’s programs/scripts.)
The install_kraken2.sh script should compile all of
Kraken 2’s code and setup your Kraken 2 program directory. Installation
is successful if you see the message
“Kraken 2 installation complete.”
Once installation is complete, you may want to copy the main Kraken 2
scripts into a directory found in your PATH variable (e.g.,
“$HOME/bin”):
cp $KRAKEN2_DIR/kraken2{,-build,-inspect} $HOME/bin
After installation, you’re ready to either create or download a database.
k2k2 is a new wrapper script that will eventually replace
the Perl and Shell scripts that support the Kraken 2 binaries.
k2 supports all the command line options of the original
scripts and adds some new features that will be documented below. We
wrote k2 to be a more portable and extensible replacement
to the existing scripts. Portable because k2 relies soley
on the Python 3 standard library, and therefore has no need external
utilities such as find or rsync whose command
lines can differ between operating systems. Extensible because Python
has a vast standard library that allows us to easily add new features
without the need for external dependencies. For users concerned that
k2 will run slower or be less reliable without these
external tools we have gone to great lengths to address such
concerns.
We know that downloading files from NCBI has been a major pain-point
for most users. k2 utlitizes HTTP for most of its
downloading which is more reliable than FTP, multi-threading and
multi-processing capabilities to speed up downloads, checksumming for
fast resuming of failed downloads and automatically retries failed
downloads.
k2 logs almost everything that it does making it easy
for users to know exactly what is happening after issuing a command. We
also provide progress bars where necessary so users can keep track of
the progress of long running jobs. Logs are printed to
stderr by default but can also be sent to a file using the
--log option.
Below is a synopsis of the sub-commands and options that
k2 supports. We will also highlight the differences of each
mode from the original scripts.
Starting in version 2.17.0 k2 can now classify across
multiple databases. This feature currently supports NCBI only, but will
be expanded to support special databases such as GTDB as well. We
currently do not have any intentions of supporting mixing databases such
as GTDB and NCBI.
Below is an example of a command that uses multi-database classification and the corresponding output:
k2 classify --db archaea,viral,univec --output output.txt --threads 9 --unclassified-out unclassified.fasta --classified-out 'classified.fasta' --report report.txt reads.fna
[INFO - 2025-11-04 15:38:04,747]: Creating merged taxonomy
[INFO - 2025-11-04 15:38:04,751]: Sanity checking taxonomies
[INFO - 2025-11-04 15:38:18,875]: Finished sanity checking taxonomies
[INFO - 2025-11-04 15:38:27,290]: Finished creating and loading merged taxonomy
[INFO - 2025-11-04 15:38:27,298]: Running classification job for database /kraken2/archaea
[INFO - 2025-11-04 15:39:02,406]: Finished running classification job for database /kraken2/archaea
[INFO - 2025-11-04 15:39:02,406]: Running classification job for database /kraken2/viral
[INFO - 2025-11-04 15:39:30,435]: Finished running classification job for database /kraken2/viral
[INFO - 2025-11-04 15:39:30,436]: Running classification job for database /kraken2/univec
[INFO - 2025-11-04 15:39:44,036]: Finished running classification job for database /kraken2/univec
[INFO - 2025-11-04 15:39:44,036]: Merging output files
[INFO - 2025-11-04 15:40:21,853]: Merge progress: 100% [=============================>]
Finished merging output files
[INFO - 2025-11-04 15:40:22,896]: Writing (un)classified sequences to file
[INFO - 2025-11-04 15:41:16,948]: Finished writing (un)classified sequences to file
[INFO - 2025-11-04 15:41:16,948]: Generating report file
[INFO - 2025-11-04 15:41:16,977]: Finished generating report file
Multi-database classification is carried out in the following way: 1)
k2 will check the nodes.dmp files of each of the databases
specified to make sure that the taxonomies are consistent. The process
will terminate if there are inconsistencies. 2) k2 will
then merge taxo.k2d of each database to create a unified
taxonomy. 3) The input files provided will be classified using each of
the databases provided with outputs saved a temporary file generated by
k2. 4) k2 will then conduct of pair-wise merge
like so: * if the sequence was unclassified in both files it will remain
unclassified * if the the sequence was classified in either one of the
files the classified output is chosen * if the sequence was classified
in both files then k2 will determine the final taxonomy by
doing a run-length-like expansion of the taxonomies identified and
finding the LCA of those taxonomies. These new LCAs will then be used to
determine the final tax ID assigned to a sequence * the merged output is
saved to a file which is then merged with the next classification output
file until all output files haved been classified * the final merged
file is then renamed to filename provided to the `--output
command line option. 5) If the --report argument is
provided a report file is generated as if the reads were classified
using a single unified database. MPA report style is not currently
supported, but can easily be generated via simple text processing.
N.B. --report-minimizer-data,
--use-mpa-style are not supported when using this mode.
k2 build --help
usage: k2 build [-h] --db PATHNAME [--standard | --special {greengenes,rdp,silva,gtdb}]
[--gtdb-files GTDB_FILES [GTDB_FILES ...]] [--gtdb-use-ncbi-taxonomy]
[--gtdb-server GTDB_SERVER] [--no-masking] [--masker-threads K2MASK_THREADS]
[--kmer-len INT] [--minimizer-len INT] [--minimizer-spaces INT] [--threads INT]
[--load-factor FLOAT (0,1]] [--fast-build] [--max-db-size SIZE] [--skip-maps]
[--protein] [--block-size INT] [--sub-block-size INT] [--minimum-bits-for-taxid INT] [--log FILENAME]
optional arguments:
-h, --help show this help message and exit
--db PATHNAME Pathname to database folder where building will take place.
--kmer-len INT K-mer length in bp/aa
--minimizer-len INT Minimizer length in bp/aa
--minimizer-spaces INT
Number of characters in minimizer that are ignored in
comparisons
--threads INT Number of threads
--load-factor FLOAT (0,1]
Proportion of the hash table to be populated (default:
0.7)
--fast-build Do not require database to be deterministically built
when using multiple threads. This is faster, but does
introduce variability in minimizer/LCA pairs.
--max-db-size SIZE Maximum number of bytes for Kraken 2 hash table; if
the estimator determines more would normally be
needed, the reference library will be downsampled to
fit
--skip-maps Avoids downloading accession number to taxid maps
--protein Build a protein database for translated search
--block-size INT Read block size (default: 16384)
--sub-block-size INT Read subblock size
--minimum-bits-for-taxid INT
Bit storage requested for taxid
--log FILENAME Specify a log file (default: stderr)
special:
--standard Make standard database which includes: archaea,
bacteria, human, plasmid, UniVec_Core, and viral.
--special {greengenes,rdp,silva,gtdb}
Build special database. RDP is currently unavailable
as URLs no longer work.
--gtdb-files GTDB_FILES [GTDB_FILES ...]
A list of files or regex matching the files needed to
build the special database.
--gtdb-use-ncbi-taxonomy
Use NCBI tax IDs and taxonomy tree when building GTDB database
--gtdb-server GTDB_SERVER
The GTDB server to use (default: data.ace.uq.edu.au)
--no-masking Avoid masking low-complexity sequences prior to
building database.
--masker-threads K2MASK_THREADS
Number of threads used by k2mask during masking
process (default: 4)
The following changes have been made to special databases:
--gtdb-files flag.The --max-db-size option supports sizes as either
integers or units of measurement such “10GiB”, “4TB”, “10 gebibytes”, “4
terabytes”.
k2 inspect --help
usage: k2 inspect [-h] --db PATHNAME [--threads THREADS] [--skip-counts]
[--use-mpa-style] [--report-zero-counts] [--log FILENAME]
[--output FILENAME] [--memory-mapping]
optional arguments:
-h, --help show this help message and exit
--db PATHNAME Pathname to Kraken2 database
--threads THREADS Number of threads
--skip-counts Only print database summary statistics
--use-mpa-style Format output like Kraken 1's kraken-mpa-report
--report-zero-counts Report counts for ALL taxa, even if counts are zero
--log FILENAME Specify a log filename (default: stderr)
--output FILENAME, --out FILENAME
Write inspect output to FILENAME (default: stdout)
--memory-mapping Avoids loading entire database into RAM
Adds support of the --memory-mapping and
--threads options which allows for faster inspection of
large indexes.
k2 classify --help
usage: k2 classify [-h] --db PATHNAME [--threads INT] [--quick]
[--unclassified-out FILENAME] [--classified-out FILENAME]
[--output FILENAME] [--confidence CONFIDENCE]
[--minimum-base-quality INT] [--report REPORT]
[--use-mpa-style] [--report-zero-counts]
[--report-minimizer-data] [--memory-mapping]
[--paired | --interleaved] [--use-names]
[--minimum-hit-groups INT] [--log FILENAME]
filenames [filenames ...]
positional arguments:
filenames Filenames to be classified, supports bz2, gzip, and xz
optional arguments:
-h, --help show this help message and exit
--db PATHNAME Pathname to Kraken2 database(s). Multiple databases are specified as a comma- separated list with no spaces.
--threads INT Number of threads
--use-daemon Spawn a background process that keeps any loaded indexes in memory. Subsequent invokations of classify with
this option will skip the index loading process and immediately start classifying reads. If a new index is
specified that index will also be persisted. Use k2 clean --stop-daemon to stop the background process.
--quick Quick operation (use first hit or hits)
--unclassified-out FILENAME
Print unclassified sequences to filename
--classified-out FILENAME
Print classified sequences to filename
--output FILENAME Print output to file (default: stdout) "-" will
suppress normal output
--confidence CONFIDENCE
confidence score threshold (default: 0.0); must be in
[0,1]
--minimum-base-quality INT
Minimum base quality used in classification
--report REPORT Print a report with aggregate counts/clade to file
--use-mpa-style With --report, format report output like Kraken 1's
kraken-mpa-report
--report-zero-counts With --report, report counts for ALL taxa, even if
counts are zero
--report-minimizer-data
With --report, report minimizer and distinct minimizer
count information in addition to normal Kraken report
--memory-mapping Avoids loading entire database into RAM
--paired The filenames provided have paired-end reads
--interleaved The filenames provided have paired-end reads
--use-names Print scientific names instead of just taxids
--minimum-hit-groups INT
Minimum number of hit groups (overlapping k-mers
sharing the same minimizer) needed to make a call
(default 2)
--log FILENAME Specify a log filename (default: stderr)
classify can read input files compressed with
gzip, bzip, and xz.
zstd is not yet supported since it not yet included in the
Python standard library.
k2 download-library --help
usage: k2 download-library [-h] --db PATHNAME --library LIBRARY
[--assembly-source {refseq,genbank,all}]
[--assembly-levels {chromosome,complete_genome,scaffold,contig} [{chromosome,complete_genome,scaffold,contig} ...]]
[--has-annotation] [--protein] [--log FILENAME]
[--threads THREADS]
[--no-masking | --masker-threads K2MASK_THREADS]
optional arguments:
-h, --help show this help message and exit
--db PATHNAME Pathname to Kraken2 database
--library LIBRARY, --taxid LIBRARY, --project LIBRARY, --accession LIBRARY
Name of library to download
--assembly-source {refseq,genbank,all}
Download RefSeq (GCF_) or GenBank (GCA_) genome
assemblies or both (default RefSeq)
--resume Resume fetching the files needed for a library, skipping files
that have already been downloaded
--assembly-levels {chromosome,complete_genome,scaffold,contig} [{chromosome,complete_genome,scaffold,contig} ...]
Only return genome assemblies that have one of the
specified assembly levels (default chromosome and
complete genome)
--has-annotation Return only annotated genome assemblies (default
false)
--blast-volumes BLAST_VOLUMES
A comma separated list of the blast volume numbers to download.
Ranges are also accepted in the forms start..end, start-end,
start:end, ranges are inclusive (default: all volumes)
--protein Files being added are for a protein database
--log FILENAME Specify a log filename (default stderr)
--threads THREADS The number of threads/processes k2 uses when
downloading and processing library files.
--no-masking Avoid asking low-complexity sequences prior to
building; masking requires k2mask or segmasker to be
installed
--masker-threads K2MASK_THREADS
Number of threads used by k2mask during masking
process (default: 4)
k2 uses this mode to download files from NCBI. The
--library option can takes the name of a:
k2 adds support for
vertebrateother, vertebratemammalian,
mitochondrion, invertebrate, plastid RefSeq collectionsWhen a taxid, accession or project ID is specified k2
will leverage the NCBI
Dataset API to find the related accessions. Additional options such
as --assembly-levels, --has-annotation,
--assembly-source, can be used as filters to further narrow
the accessions that k2 will download.
Downloads can be sped up using the --threads flag which
will cause files to be downloaded in parallel. Please be advised
that large thread counts place a burden on the NCBI
servers and can result in the client being forcefully kicked
off. Please apply discretion when using this flag.
After the files have been downloaded k2 will decompress
files, mask the sequences if the --no-masking flag is not
specified, assign taxids and finally concatenate the files into the
library.fna or library.faa file. These steps
also utilize the --threads flag to speed up processing. kraken
2 v2.1.3 shipped with a new multi-threaded genomic masker,
k2mask that replaces NCBI’s dustmasker. The
--masker-threads option can be used to specify the number
of threads that k2mask uses.
k2 download-taxonomy --help
usage: k2 download-taxonomy [-h] --db PATHNAME [--protein] [--skip-maps]
[--log FILENAME]
optional arguments:
-h, --help show this help message and exit
--db PATHNAME Pathname to Kraken2 database
--protein Files being added are for a protein database
--skip-maps Avoids downloading accession number to taxid maps
--log FILENAME Specify a log filename (default: stderr)
Like download-library previously discussed,
download-taxonomy has also been parallelized to download
and decompress the WGS and GB accession to tax ID map files in parallel.
However a --threads flag is not necessary for this mode
since the number of files that will be downloaded is capped at 2.
k2 add-to-library --help
usage: k2 add-to-library [-h] --db PATHNAME [--threads THREADS] --file FILES
[FILES ...] [--protein] [--log FILENAME]
[--no-masking | --masker-threads K2MASK_THREADS]
optional arguments:
-h, --help show this help message and exit
--db PATHNAME Pathname to Kraken2 database
--threads THREADS The number of threads/processes k2 uses when adding
library files.
--file FILES [FILES ...], --files FILES [FILES ...]
Pathname or patterns of file(s) to be added to
library. Supported pattern are as follows: ? - A
question-mark is a pattern that shall match any
character. * - An asterisk is a pattern that shall
match multiple characters. [ - The open bracket shall
introduce a pattern bracket expression. ** - will
match any files and zero or more directories,
subdirectories and symbolic links to directories.
--protein Files being added are for a protein database
--log FILENAME Specify a log filename (default: stderr)
--no-masking Avoid asking low-complexity sequences prior to
building; masking requires k2mask or segmasker to be
installed
--masker-threads K2MASK_THREADS
Number of threads used by k2mask during masking
process (default: 4)
This mode also offers a --threads option which comes in
handy when adding a large number of files. The --files
option takes the path of one or more files to be added or a file pattern
that makes use of the following :
When a file is added to a library k2 will first
calculate the MD5 sum of the file. The hash will be appended to the
basename of the prelim_map.txt and the
library.fna files and added.txt file will be
populated with the original file path and its hash. k2 will
also utilize the hash to skip duplicate additions. If the user removes a
file that was added, added.txt has to be updated
accordingly.
k2 clean --help
usage: k2 clean [-h] (--stop-daemon | --db PATHNAME) [--log FILENAME] [--pattern SHELL_REGEX]
options:
-h, --help show this help message and exit
required:
Arguments required by the cleaner
--stop-daemon Stop a running background process
--db PATHNAME Pathname to Kraken2 database
options:
options for cleaning temporary files
--log FILENAME Specify a log filename (default: stderr)
--pattern SHELL_REGEX
Files that match this regular expression will be deleted. ? - A question-mark is a pattern that shall match
any character. * - An asterisk is a pattern that shall match multiple characters. [ - The open bracket shall
introduce a pattern bracket expression. ** - will match any files and zero or more directories, subdirectories
and symbolic links to directories.
The clean command removes unwanted files in a database. If a pattern
is not specified clean will remove all intermediate files
used to build the index leaving behind only the *.k2d
files. If users wants to delete specific files the
--pattern option can be specified which supports 19.1.6 similar to --files flag of
add-to-library
A Kraken 2 database is a directory containing at least 3 files:
hash.k2d: Contains the minimizer to taxon mappingsopts.k2d: Contains information about the options used
to build the databasetaxo.k2d: Contains taxonomy information used to build
the databaseNone of these three files are in a human-readable format. Other files may also be present as part of the database build process, and can, if desired, be removed after a successful build of the database.
In interacting with Kraken 2, you should not have to directly reference any of these files, but rather simply provide the name of the directory in which they are stored. Kraken 2 allows both the use of a standard database as well as custom databases; these are described in the sections Standard Kraken 2 Database and Custom Databases below, respectively.
To create the standard Kraken 2 database, you can use the following command:
kraken2-build --standard --db $DBNAME
(Replace “$DBNAME” above with your preferred database
name/location. Please note that the database will use approximately 100
GB of disk space during creation, with the majority of that being
reference sequences or taxonomy mapping information that can be removed
after the build.)
This will download NCBI taxonomic information, as well as the complete genomes in RefSeq for the bacterial, archaeal, and viral domains, along with the human genome and a collection of known vectors (UniVec_Core). After downloading all this data, the build process begins; this can be the most time-consuming step. If you have multiple processing cores, you can run this process with multiple threads, e.g.:
kraken2-build --standard --threads 24 --db $DBNAME
Using 32 threads on an AWS EC2 r4.8xlarge instance with 16 dual-core hyperthreaded 2.30 GHz CPUs and 244 GB of RAM, the build process took approximately 35 minutes in Jan. 2018.
The build process itself has two main steps, each of which requires passing over the contents of the reference library:
(There is one other preliminary step where sequence IDs are mapped to taxonomy IDs, but this is usually a rather quick process and is mostly handled during library downloading.)
Unlike Kraken 1’s build process, Kraken 2 does not perform checkpointing after the estimation step. This is because the estimation step is dependent on the selected k and ℓ values, and if the population step fails, it is likely because k needs to be increased (reducing the overall memory requirements).
To classify a set of sequences, use the kraken2
command:
kraken2 --db $DBNAME seqs.fa
Output will be sent to standard output by default. The files
containing the sequences to be classified should be specified on the
command line. Sequences can also be provided through standard input
using the special filename /dev/fd/0.
The kraken2 program allows several different
options:
Multithreading: Use the
--threads NUM switch to use multiple threads.
Quick operation: Rather than searching all ℓ-mers in a sequence, stop
classification after the first database hit; use --quick to
enable this mode.
Hit group threshold: The option
--minimum-hit-groups will allow you to require multiple hit
groups (a group of overlapping k-mers that share a common minimizer that
is found in the hash table) be found before declaring a sequence
classified, which can be especially useful with custom databases when
testing to see if sequences either do or do not belong to a particular
genome.
Sequence filtering: Classified or unclassified
sequences can be sent to a file for later processing, using the
--classified-out and --unclassified-out
switches, respectively.
Output redirection: Output can be directed using
standard shell redirection (| or >), or
using the --output switch.
Compressed input: Kraken 2 can handle gzip and
bzip2 compressed files as input by specifying the proper switch of
--gzip-compressed or
--bzip2-compressed.
Input format auto-detection: If regular files
(i.e., not pipes or device files) are specified on the command line as
input, Kraken 2 will attempt to determine the format of your input prior
to classification. You can disable this by explicitly specifying
--gzip-compressed or --bzip2-compressed as
appropriate. Note that use of the character device file
/dev/fd/0 to read from standard input (aka
stdin) will not allow
auto-detection.
Paired reads: Kraken 2 provides an enhancement
over Kraken 1 in its handling of paired read data. Rather than needing
to concatenate the pairs together with an N character
between the reads, Kraken 2 is able to process the mates individually
while still recognizing the pairing information. Using the
--paired option to kraken2 will indicate to
kraken2 that the input files provided are paired read data,
and data will be read from the pairs of files concurrently.
Usage of --paired also affects the
--classified-out and --unclassified-out
options; users should provide a # character in the
filenames provided to those options, which will be replaced by
kraken2 with “_1” and “_2” with
mates spread across the two files appropriately. For example:
kraken2 --paired --classified-out cseqs#.fq seqs_1.fq seqs_2.fq
will put the first reads from classified pairs in
cseqs_1.fq, and the second reads from those pairs in
cseqs_2.fq.
To get a full list of options, use kraken2 --help.
Each sequence (or sequence pair, in the case of paired reads) classified by Kraken 2 results in a single line of output. Kraken 2’s output lines contain five tab-delimited fields; from left to right, they are:
“C”/“U”: a one letter code indicating that the sequence was either classified or unclassified.
The sequence ID, obtained from the FASTA/FASTQ header.
The taxonomy ID Kraken 2 used to label the sequence; this is 0 if the sequence is unclassified.
The length of the sequence in bp. In the case of paired read data, this will be a string containing the lengths of the two sequences in bp, separated by a pipe character, e.g. “98|94”.
A space-delimited list indicating the LCA mapping of each k-mer in the sequence(s). For example, “562:13 561:4 A:31 0:1 562:3” would indicate that:
Note that paired read data will contain a “|:|” token in
this list to indicate the end of one read and the beginning of
another.
When Kraken 2 is run against a protein database (see Translated Search), the LCA hitlist will
contain the results of querying all six frames of each sequence. Reading
frame data is separated by a “-:-” token.
Kraken 1 offered a kraken-translate and
kraken-report script to change the output into different
formats. Through the use of kraken2 --use-names, Kraken 2
will replace the taxonomy ID column with the scientific name and the
taxonomy ID in parenthesis (e.g., “Bacteria (taxid 2)” instead of “2”),
yielding similar functionality to Kraken 1’s
kraken-translate script. The sample report functionality
now exists as part of the kraken2 script, with the use of
the --report option; the sample report formats are
described below.
Like Kraken 1, Kraken 2 offers two formats of sample-wide results. Kraken 2’s standard sample report format is tab-delimited with one line per taxon. The fields of the output, from left-to-right, are as follows:
The scientific names are indented using space, according to the tree structure specified by the taxonomy.
By default, taxa with no reads assigned to (or under) them will not
have any output produced. However, if you wish to have all taxa
displayed, you can use the --report-zero-counts switch to
do so. This can be useful if you are looking to do further downstream
analysis of the reports, and want to compare samples. Sorting by the
taxonomy ID (using sort -k5,5n) can provide a consistent
line ordering between reports.
In addition, we also provide the option --use-mpa-style
that can be used in conjunction with --report. This option
provides output in a format similar to MetaPhlAn’s output. The output
with this option provides one taxon per line, with a lowercase version
of the rank codes in Kraken 2’s standard sample report format (except
for ‘U’ and ‘R’), two underscores, and the scientific name of the taxon
(e.g., “d__Viruses”). The full taxonomy of each taxon (at the eight
ranks considered) is given, with each rank’s name separated by a pipe
character (e.g., “d__Viruses|o_Caudovirales”). Following this version of
the taxon’s scientific name is a tab and the number of fragments
assigned to the clade rooted at that taxon.
Kraken 2 allows users to perform a six-frame translated search, similar to the well-known BLASTX program. To do this, Kraken 2 uses a reduced 15 amino acid alphabet and stores amino acid minimizers in its database. LCA results from all 6 frames are combined to yield a set of LCA hits, which is then resolved in the same manner as in Kraken’s normal operation.
To build a protein database, the --protein option should
be given to kraken2-build (either along with
--standard, or with all steps if building a custom
database).
We realize the standard database may not suit everyone’s needs. Kraken 2 also allows creation of customized databases.
To build a custom database:
Install a taxonomy. Usually, you will just use the NCBI taxonomy, which you can easily download using:
kraken2-build --download-taxonomy --db $DBNAME
This will download the accession number to taxon maps, as well as the
taxonomic name and tree information from NCBI. These files can be found
in $DBNAME/taxonomy/ . If you need to modify the taxonomy,
edits can be made to the names.dmp and
nodes.dmp files in this directory; you may also need to
modify the *.accession2taxid files appropriately.
Some of the standard sets of genomic libraries have taxonomic
information associated with them, and don’t need the accession number to
taxon maps to build the database successfully. These libraries include
all those available through the --download-library option
(see next point), except for the plasmid and non-redundant
databases. If you are not using custom sequences (see the
--add-to-library option) and are not using one of the
plasmid or non-redundant database libraries, you may want
to skip downloading of the accession number to taxon maps. This can be
done by passing --skip-maps to the
kraken2-build --download-taxonomy command.
Install one or more reference libraries. Several sets of standard
genomes/proteins are made easily available through
kraken2-build:
archaea: RefSeq complete archaeal genomes/proteinsbacteria: RefSeq complete bacterial
genomes/proteinsplasmid: RefSeq plasmid nucleotide/protein
sequencesviral: RefSeq complete viral genomes/proteinshuman: GRCh38 human genome/proteinsfungi: RefSeq complete fungal genomes/proteinsplant: RefSeq complete plant genomes/proteinsprotozoa: RefSeq complete protozoan
genomes/proteinsnr: NCBI non-redundant protein databasent: NCBI non-redundant nucleotide databaseUniVec: NCBI-supplied database of vector, adapter,
linker, and primer sequences that may be contaminating sequencing
projects and/or assembliesUniVec_Core: A subset of UniVec chosen to minimize
false positive hits to the vector databaseTo download and install any one of these, use the
--download-library switch, e.g.:
kraken2-build --download-library bacteria --db $DBNAME
Multiple libraries can be downloaded into a database prior to
building by issuing multiple
kraken2-build --download-library commands, e.g.:
kraken2-build --download-library archaea --db $DBNAME
kraken2-build --download-library viral --db $DBNAME
The above commands would prepare a database that would contain
archaeal and viral genomes; the --build option (see below)
will still need to be used after downloading these libraries to actually
build the database, however.
(Note that downloading nr requires use of the
--protein option, and that UniVec and
UniVec_Core are incompatible with the
--protein option.)
Other genomes can also be added, but such genomes must meet certain requirements:
> and the
first whitespace character on the header line) must contain either an
NCBI accession number to allow Kraken 2 to lookup the correct taxa, or
an explicit assignment of the taxonomy ID using
kraken:taxid (see below).Sequences not downloaded from NCBI may need their taxonomy
information assigned explicitly. This can be done using the string
kraken:taxid|XXX in the sequence ID, with XXX
replaced by the desired taxon ID. For example, to put a known adapter
sequence in taxon 32630 (“synthetic construct”), you could use the
following:
>sequence16|kraken:taxid|32630 Adapter sequence
CAAGCAGAAGACGGCATACGAGATCTTCGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA
The kraken:taxid string must begin the sequence ID or be
immediately preceded by a pipe character (|). Explicit
assignment of taxonomy IDs in this manner will override the accession
number mapping provided by NCBI.
If your genomes meet the requirements above, then you can add each
sequence to your database’s genomic library using the
--add-to-library switch, e.g.:
kraken2-build --add-to-library chr1.fa --db $DBNAME
kraken2-build --add-to-library chr2.fa --db $DBNAME
Note that if you have a list of files to add, you can do something
like this in bash:
for file in chr*.fa
do
kraken2-build --add-to-library $file --db $DBNAME
done
Or even add all *.fa files found in the directory
genomes:
find genomes/ -name '*.fa' -print0 | xargs -0 -I{} -n1 kraken2-build --add-to-library {} --db $DBNAME
(You may also find the -P option to xargs
useful to add many files in parallel if you have multiple
processors.)
Once your library is finalized, you need to build the database. This can be done with the command:
kraken2-build --build --db $DBNAME
The --threads option is also helpful here to reduce
build time.
By default, the values of k
and ℓ are 35 and 31,
respectively (or 15 and 12 for protein databases). These values can be
explicitly set with the --kmer-len and
--minimizer-len options, however. Note that the minimizer
length must be no more than 31 for nucleotide databases, and 15 for
protein databases. Additionally, the minimizer length ℓ must be no more than the k-mer length. There is no upper
bound on the value of k, but
sequences less than k bp in
length cannot be classified.
Kraken 2 also utilizes a simple spaced seed approach to increase accuracy. A number s < ℓ/4 can be chosen, and s positions in the minimizer will be masked out during all comparisons. Masked positions are chosen to alternate from the second-to-last position in the minimizer; e.g., s = 5 and ℓ = 31 will result in masking out the 0 positions shown here:
111 1111 1111 1111 1111 1101 0101 0101
By default, s = 7 for
nucleotide databases, and s =
0 for protein databases. This can be changed using the
--minimizer-spaces option along with the
--build task of kraken2-build.
A full list of options for kraken2-build can be obtained
using kraken2-build --help.
After building a database, if you want to reduce the disk usage of
the database, you can use the --clean option for
kraken2-build to remove intermediate files from the
database directory.
Low-complexity sequences, e.g. “ACACACACACACACACACACACACAC”, are known to occur in many different organisms and are typically less informative for use in alignments; the BLAST programs often mask these sequences by default. Using this masking can help prevent false positives in Kraken 2’s results, and so we have added this functionality as a default option to Kraken 2’s library download/addition process.
Kraken 2 uses two programs to perform low-complexity sequence
masking, both available from NCBI: dustmasker, for
nucleotide sequences, and segmasker, for amino acid
sequences. These programs are available as part of the NCBI BLAST+
suite. If these programs are not installed on the local system and in
the user’s PATH when trying to use kraken2-build, the
database build will fail. Users who do not wish to install these
programs can use the --no-masking option to
kraken2-build in conjunction with any of the
--download-library, --add-to-library, or
--standard options; use of the --no-masking
option will skip masking of low-complexity sequences during the build of
the Kraken 2 database.
To support some common use cases, we provide the ability to build Kraken 2 databases using data from various external databases. These external databases may not follow the NCBI taxonomy, and so we’ve provided mechanisms to automatically create a taxonomy that will work with Kraken 2 (although such taxonomies may not be identical to NCBI’s).
To build one of these “special” Kraken 2 databases, use the following command:
kraken2-build --db $DBNAME --special TYPE
where the TYPE string is one of the database names
listed below.
At present, the “special” Kraken 2 database support we provide is limited to pre-packaged solutions for some public 16S sequence databases, but this may grow in the future.
For targeted 16S sequencing projects, a normal Kraken 2 database using whole genome data may use more resources than necessary. A Kraken 2 database created from a well-curated genomic library of just 16S data can provide both a more efficient solution as well as a more accurate set of predictions for such projects. We provide support for building Kraken 2 databases from three publicly available 16S databases:
greengenes), using all available 16S
data.rdp), using the bacterial and archaeal 16S data.silva), using the Small subunit NR99 sequence
set.Note that these databases may have licensing restrictions regarding
their data, and it is your responsibility to ensure you are in
compliance with those restrictions; please visit the databases’ websites
for further details. The kraken2-build script only uses
publicly available URLs to download data and then converts that data
into a form compatible for use with Kraken 2.
Furthermore, if you use one of these databases in your research, please visit the corresponding database’s website to determine the appropriate and up-to-date citation.
At present, we have not yet developed a confidence score with a
probabilistic interpretation for Kraken 2. However, we have developed a
simple scoring scheme that has yielded good results for us, and we’ve
made that available in Kraken 2 through use of the
--confidence option to kraken2. The approach
we use allows a user to specify a threshold score in the [0,1] interval;
the classifier then will adjust labels up the tree until the label’s
score (described below) meets or exceeds that threshold. If a label at
the root of the taxonomic tree would not have a score exceeding the
threshold, the sequence is called unclassified by Kraken 2 when this
threshold is applied.
A sequence label’s score is a fraction C/Q, where C is the number of k-mers mapped to LCA values in the clade rooted at the label, and Q is the number of k-mers in the sequence that lack an ambiguous nucleotide (i.e., they were queried against the database). Consider the example of the LCA mappings in Kraken 2’s output given earlier:
“562:13 561:4 A:31 0:1 562:3” would indicate that:
In this case, ID #561 is the parent node of #562. Here, a label of
#562 for this sequence would have a score of C/Q = (13+3)/(13+4+1+3) = 16/21. A
label of #561 would have a score of C/Q = (13+4+3)/(13+4+1+3) = 20/21. If
a user specified a --confidence threshold over 16/21, the
classifier would adjust the original label from #562 to #561; if the
threshold was greater than 20/21, the sequence would become
unclassified.
The kraken2-inspect script allows users to gain
information about the content of a Kraken 2 database. The output format
of kraken2-inspect is identical to the reports generated
with the --report option to kraken2. Instead
of reporting how many reads in input data classified to a given taxon or
clade, as kraken2’s --report option would, the
kraken2-inspect script will report the number of minimizers
in the database that are mapped to the various taxa/clades. For example,
the first five lines of kraken2-inspect’s output on an
example database might look like this:
$ kraken2-inspect --db EXAMPLE_DB | head -5
100.00% 1770368409 1581179 R 1 root
96.50% 1708407622 58003 R1 131567 cellular organisms
91.28% 1615910070 985309 D 2 Bacteria
43.89% 777062062 1312736 P 1224 Proteobacteria
18.62% 329590216 555667 C 1236 Gammaproteobacteria
This output indicates that 555667 of the minimizers in the database
map directly to the Gammaproteobacteria class (taxid #1236), and
329590216 (18.62%) of the database’s minimizers map to a taxon in the
clade rooted at Gammaproteobacteria. For more information on
kraken2-inspect’s options, use its --help
option.
The KrakenUniq project extended Kraken 1 by, among other things, reporting an estimate of the number of distinct k-mers associated with each taxon in the input sequencing data. This allows users to better determine if Kraken’s classifications are due to reads distributed throughout a reference genome, or due to only a small segment of a reference genome (and therefore likely false positive).
Thanks to the generosity of KrakenUniq’s developer Florian Breitwieser in allowing parts of the KrakenUniq source code to be licensed under Kraken 2’s MIT license, this distinct counting estimation is now available in Kraken 2. Development work by Martin Steinegger and Ben Langmead helped bring this functionality to Kraken 2.
At present, this functionality is an optional experimental feature – meaning that we may later alter it in a way that is not backwards compatible with previous versions of the feature.
To use this functionality, simply run the kraken2 script
with the additional --report-minimizer-data flag along with
--report, e.g.:
kraken2 --db $DBNAME --report k2_report.txt --report-minimizer-data \
--output k2_output.txt sequence_data.fq
This will put the standard Kraken 2 output (formatted as described in
Standard Kraken Output
Format) in k2_output.txt and the report information in
k2_report.txt. Within the report file, two additional
columns will be present, e.g.:
normal report format:
36.40 182 182 S2 211044 Influenza A virus (A/Puerto Rico/8/1934(H1N1))
modified report format:
36.40 182 182 1688 18 S2 211044 Influenza A virus (A/Puerto Rico/8/1934(H1N1))
In this modified report format, the two new columns are the fourth and fifth, respectively representing the number of minimizers found to be associated with a taxon in the read sequences (1688), and the estimate of the number of distinct minimizers associated with a taxon in the read sequence data (18). This would indicate that although 182 reads were classified as belonging to H1N1 influenza, only 18 distinct minimizers led to those 182 classifications.
The format with the --report-minimizer-data flag, then,
is similar to that described in Sample Report Output Format, but
slightly different. The fields in this new format, from left-to-right,
are:
We decided to make this an optional feature so as not to break existing software that processes Kraken 2’s standard report format. However, this new format can be converted to the standard report format with the command:
cut -f1-3,6-8 k2_new_report.txt > k2_std_report.txt
As noted above, this is an experimental feature. We intend to continue development on this feature, and may change the new format and/or its information if we determine it to be necessary.
For background on the data structures used in this feature and their interaction with Kraken, please read the KrakenUniq paper, and please cite that paper if you use this functionality as part of your work.
The kraken2 and kraken2-inspect scripts
supports the use of some environment variables to help in reducing
command line lengths:
KRAKEN2_NUM_THREADS: if the
--threads option is not supplied to kraken2,
then the value of this variable (if it is set) will be used as the
number of threads to run kraken2. (This variable does not
affect kraken2-inspect.)
KRAKEN2_DB_PATH: much like the
PATH variable is used for executables by your shell,
KRAKEN2_DB_PATH is a colon-separated list of directories
that will be searched for the database you name if the named database
does not have a slash (/) character. By default, Kraken 2
assumes the value of this variable is “.” (i.e., the
current working directory). This variable can be used to create one (or
more) central repositories of Kraken databases in a multi-user system.
Example usage in bash:
export KRAKEN2_DB_PATH="/home/user/my_kraken2_dbs:/data/kraken2_dbs:"
This will cause three directories to be searched, in this order:
/home/user/my_kraken2_dbs/data/kraken2_dbsKRAKEN2_DB_PATH
string)The search for a database will stop when a name match is found; if
two directories in the KRAKEN2_DB_PATH have databases with
the same name, the directory of the two that is searched first will have
its database selected.
If the above variable and value are used, and the databases
/data/kraken2_dbs/mainDB and ./mainDB are
present, then
kraken2 --db mainDB sequences.fa
will classify sequences.fa using
/data/kraken_dbs/mainDB; if instead you wanted to use the
mainDB present in the current directory, you would need to
specify a directory path to that database in order to circumvent
searching, e.g.:
kraken2 --db ./mainDB sequences.fa
Note that the KRAKEN2_DB_PATH directory list can be
skipped by the use of any absolute (beginning with /) or
relative pathname (including at least one /) as the
database name.
KRAKEN2_DEFAULT_DB: if no database
is supplied with the --db option, the database named in
this variable will be used instead. Using this variable, you can avoid
using --db if you only have a single database that you
usually use, e.g. in bash:
export KRAKEN2_DEFAULT_DB="/home/user/kraken2db"
kraken2 sequences.fa > kraken2.output
This will classify sequences.fa using the
/home/user/kraken2db database.
Note that the value of KRAKEN2_DEFAULT_DB will also be
interpreted in the context of the value of KRAKEN2_DB_PATH
if you don’t set KRAKEN2_DEFAULT_DB to an absolute or
relative pathname. Given the earlier example in this section, the
following:
export KRAKEN2_DEFAULT_DB="mainDB"
kraken2 sequences.fa
will use /data/kraken_dbs/mainDB to classify
sequences.fa.