Introduction ============ Kraken is a taxonomic sequence classifier that assigns taxonomic labels to DNA sequences. Kraken examines the $k$-mers within a query sequence and uses the information within those $k$-mers to query a database. That database maps $k$-mers to the lowest common ancestor (LCA) of all genomes known to contain a given $k$-mer. The first version of [Kraken] used a large indexed and sorted list of $k$-mer/LCA pairs as its database. While fast, the large memory requirements posed some problems for users, and so Kraken 2 was created to provide a solution to those problems. [Kraken 2] differs from Kraken 1 in several important ways: 1. Only minimizers of the $k$-mers in the query sequences are used as database queries. Similarly, only minimizers of the $k$-mers in the reference sequences in the database's genomic library are stored in the database. We will also refer to the minimizers as $\ell$-mers, where $\ell \leq k$. All $k$-mers are considered to have the same LCA as their minimizer's database LCA value. 2. Kraken 2 uses a compact hash table that is a probabilistic data structure. This means that occasionally, database queries will fail by either returning the wrong LCA, or by not resulting in a search failure when a queried minimizer was never actually stored in the database. By incurring the risk of these false positives in the data structure, Kraken 2 is able to achieve faster speeds and lower memory requirements. Users should be aware that database false positive errors occur in less than 1% of queries, and can be compensated for by use of confidence scoring thresholds. 3. Kraken 2 has the ability to build a database from amino acid sequences and perform a translated search of the query sequences against that database. 4. Kraken 2 utilizes spaced seeds in the storage and querying of minimizers to improve classification accuracy. 5. Kraken 2 provides support for "special" databases that are not based on NCBI's taxonomy. These are currently limited to three popular 16S databases. Because Kraken 2 only stores minimizers in its hash table, and $k$ can be much larger than $\ell$, only a small percentage of the possible $\ell$-mers in a genomic library are actually deposited in the database. This creates a situation similar to the Kraken 1 "MiniKraken" databases; however, preliminary testing has shown the accuracy of a reduced Kraken 2 database to be quite similar to the full-sized Kraken 2 database, while Kraken 1's MiniKraken databases often resulted in a substantial loss of per-read sensitivity. If you use Kraken 2 in your own work, please cite either the [Kraken 2 paper] and/or the original [Kraken paper] as appropriate. Thank you! [Kraken]: https://ccb.jhu.edu/software/kraken/ [Kraken 2]: https://ccb.jhu.edu/software/kraken2/ [Kraken paper]: https://genomebiology.biomedcentral.com/articles/10.1186/gb-2014-15-3-r46 [Kraken 2 paper]: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-019-1891-0 System Requirements =================== * **Disk space**: Construction of a Kraken 2 standard database requires approximately 100 GB of disk space. A test on 01 Jan 2018 of the default installation showed 42 GB of disk space was used to store the genomic library files, 26 GB was used to store the taxonomy information from NCBI, and 29 GB was used to store the Kraken 2 compact hash table. Like in Kraken 1, we strongly suggest against using NFS storage to store the Kraken 2 database if at all possible. * **Memory**: To run efficiently, Kraken 2 requires enough free memory to hold the database (primarily the hash table) in RAM. While this can be accomplished with a ramdisk, Kraken 2 will by default load the database into process-local RAM; the `--memory-mapping` switch to `kraken2` will avoid doing so. The default database size is 29 GB (as of Jan. 2018), and you will need slightly more than that in RAM if you want to build the default database. * **Dependencies**: Kraken 2 currently makes extensive use of Linux utilities such as sed, find, and wget. Many scripts are written using the Bash shell, and the main scripts are written using Perl. Core programs needed to build the database and run the classifier are written in C++11, and need to be compiled using a somewhat recent version of g++ that will support C++11. Multithreading is handled using OpenMP. Downloads of NCBI data are performed by wget and rsync. Most Linux systems will have all of the above listed programs and development libraries available either by default or via package download. Unlike Kraken 1, Kraken 2 does not use an external $k$-mer counter. However, by default, Kraken 2 will attempt to use the `dustmasker` or `segmasker` programs provided as part of NCBI's BLAST suite to mask low-complexity regions (see [Masking of Low-complexity Sequences]). **MacOS NOTE:** MacOS and other non-Linux operating systems are *not* explicitly supported by the developers, and MacOS users should refer to the Kraken-users group for support in installing the appropriate utilities to allow for full operation of Kraken 2. We will attempt to use MacOS-compliant code when possible, but development and testing time is at a premium and we cannot guarantee that Kraken 2 will install and work to its full potential on a default installation of MacOS. In particular, we note that the default MacOS X installation of GCC does not have support for OpenMP. Without OpenMP, Kraken 2 is limited to single-threaded operation, resulting in slower build and classification runtimes. * **Network connectivity**: Kraken 2's standard database build and download commands expect unfettered FTP and rsync access to the NCBI FTP server. If you're working behind a proxy, you may need to set certain environment variables (such as `ftp_proxy` or `RSYNC_PROXY`) in order to get these commands to work properly. Kraken 2's scripts default to using rsync for most downloads; however, you may find that your network situation prevents use of rsync. In such cases, you can try the `--use-ftp` option to `kraken2-build` to force the downloads to occur via FTP. * **MiniKraken**: At present, users with low-memory computing environments can replicate the "MiniKraken" functionality of Kraken 1 in two ways: first, by increasing the value of $k$ with respect to $\ell$ (using the `--kmer-len` and `--minimizer-len` options to `kraken2-build`); and secondly, through downsampling of minimizers (from both the database and query sequences) using a hash function. This second option is performed if the `--max-db-size` option to `kraken2-build` is used; however, the two options are not mutually exclusive. In a difference from Kraken 1, Kraken 2 does not require building a full database and then shrinking it to obtain a reduced database. Installation ============ To begin using Kraken 2, you will first need to install it, and then either download or create a database. Kraken 2 consists of two main scripts (`kraken2` and `kraken2-build`), along with several programs and smaller scripts. As part of the installation process, all scripts and programs are installed in the same directory. After installation, you can move the main scripts elsewhere, but moving the other scripts and programs requires editing the scripts and changing the `$KRAKEN2_DIR` variables in the main scripts. Once an install directory is selected, you need to run the following command in the directory where you extracted the Kraken 2 source: ./install_kraken2.sh $KRAKEN2_DIR (Replace `$KRAKEN2_DIR` above with the directory where you want to install Kraken 2's programs/scripts.) The `install_kraken2.sh` script should compile all of Kraken 2's code and setup your Kraken 2 program directory. Installation is successful if you see the message "`Kraken 2 installation complete.`" Once installation is complete, you may want to copy the main Kraken 2 scripts into a directory found in your `PATH` variable (e.g., "`$HOME/bin`"): cp $KRAKEN2_DIR/kraken2{,-build,-inspect} $HOME/bin After installation, you're ready to either create or download a database. ## Introducing `k2` `k2` is a new wrapper script that will eventually replace the Perl and Shell scripts that support the Kraken 2 binaries. `k2` supports all the command line options of the original scripts and adds some new features that will be documented below. We wrote `k2` to be a more portable and extensible replacement to the existing scripts. Portable because `k2` relies soley on the Python 3 standard library, and therefore has no need external utilities such as `find` or `rsync` whose command lines can differ between operating systems. Extensible because Python has a vast standard library that allows us to easily add new features without the need for external dependencies. For users concerned that `k2` will run slower or be less reliable without these external tools we have gone to great lengths to address such concerns. We know that downloading files from NCBI has been a major pain-point for most users. `k2` utlitizes HTTP for most of its downloading which is more reliable than FTP, multi-threading and multi-processing capabilities to speed up downloads, checksumming for fast resuming of failed downloads and automatically retries failed downloads. `k2` logs almost everything that it does making it easy for users to know exactly what is happening after issuing a command. We also provide progress bars where necessary so users can keep track of the progress of long running jobs. Logs are printed to `stderr` by default but can also be sent to a file using the `--log` option. Below is a synopsis of the sub-commands and options that `k2` supports. We will also highlight the differences of each mode from the original scripts. ### NEW classify across multiple NCBI databases Starting in version 2.17.0 `k2` can now classify across multiple databases. This feature currently supports NCBI only, but will be expanded to support special databases such as GTDB as well. We currently do not have any intentions of supporting mixing databases such as GTDB and NCBI. Below is an example of a command that uses multi-database classification and the corresponding output: ```text k2 classify --db archaea,viral,univec --output output.txt --threads 9 --unclassified-out unclassified.fasta --classified-out 'classified.fasta' --report report.txt reads.fna [INFO - 2025-11-04 15:38:04,747]: Creating merged taxonomy [INFO - 2025-11-04 15:38:04,751]: Sanity checking taxonomies [INFO - 2025-11-04 15:38:18,875]: Finished sanity checking taxonomies [INFO - 2025-11-04 15:38:27,290]: Finished creating and loading merged taxonomy [INFO - 2025-11-04 15:38:27,298]: Running classification job for database /kraken2/archaea [INFO - 2025-11-04 15:39:02,406]: Finished running classification job for database /kraken2/archaea [INFO - 2025-11-04 15:39:02,406]: Running classification job for database /kraken2/viral [INFO - 2025-11-04 15:39:30,435]: Finished running classification job for database /kraken2/viral [INFO - 2025-11-04 15:39:30,436]: Running classification job for database /kraken2/univec [INFO - 2025-11-04 15:39:44,036]: Finished running classification job for database /kraken2/univec [INFO - 2025-11-04 15:39:44,036]: Merging output files [INFO - 2025-11-04 15:40:21,853]: Merge progress: 100% [=============================>] Finished merging output files [INFO - 2025-11-04 15:40:22,896]: Writing (un)classified sequences to file [INFO - 2025-11-04 15:41:16,948]: Finished writing (un)classified sequences to file [INFO - 2025-11-04 15:41:16,948]: Generating report file [INFO - 2025-11-04 15:41:16,977]: Finished generating report file ``` Multi-database classification is carried out in the following way: 1) `k2` will check the nodes.dmp files of each of the databases specified to make sure that the taxonomies are consistent. The process will terminate if there are inconsistencies. 2) `k2` will then merge `taxo.k2d` of each database to create a unified taxonomy. 3) The input files provided will be classified using each of the databases provided with outputs saved a temporary file generated by `k2`. 4) `k2` will then conduct of pair-wise merge like so: * if the sequence was unclassified in both files it will remain unclassified * if the the sequence was classified in either one of the files the classified output is chosen * if the sequence was classified in both files then `k2` will determine the final taxonomy by doing a run-length-like expansion of the taxonomies identified and finding the LCA of those taxonomies. These new LCAs will then be used to determine the final tax ID assigned to a sequence * the merged output is saved to a file which is then merged with the next classification output file until all output files haved been classified * the final merged file is then renamed to filename provided to the ``--output` command line option. 5) If the `--report` argument is provided a report file is generated as if the reads were classified using a single unified database. MPA report style is not currently supported, but can easily be generated via simple text processing. *N.B.* `--report-minimizer-data`, `--use-mpa-style` are not supported when using this mode. ### build ```text k2 build --help usage: k2 build [-h] --db PATHNAME [--standard | --special {greengenes,rdp,silva,gtdb}] [--gtdb-files GTDB_FILES [GTDB_FILES ...]] [--gtdb-use-ncbi-taxonomy] [--gtdb-server GTDB_SERVER] [--no-masking] [--masker-threads K2MASK_THREADS] [--kmer-len INT] [--minimizer-len INT] [--minimizer-spaces INT] [--threads INT] [--load-factor FLOAT (0,1]] [--fast-build] [--max-db-size SIZE] [--skip-maps] [--protein] [--block-size INT] [--sub-block-size INT] [--minimum-bits-for-taxid INT] [--log FILENAME] optional arguments: -h, --help show this help message and exit --db PATHNAME Pathname to database folder where building will take place. --kmer-len INT K-mer length in bp/aa --minimizer-len INT Minimizer length in bp/aa --minimizer-spaces INT Number of characters in minimizer that are ignored in comparisons --threads INT Number of threads --load-factor FLOAT (0,1] Proportion of the hash table to be populated (default: 0.7) --fast-build Do not require database to be deterministically built when using multiple threads. This is faster, but does introduce variability in minimizer/LCA pairs. --max-db-size SIZE Maximum number of bytes for Kraken 2 hash table; if the estimator determines more would normally be needed, the reference library will be downsampled to fit --skip-maps Avoids downloading accession number to taxid maps --protein Build a protein database for translated search --block-size INT Read block size (default: 16384) --sub-block-size INT Read subblock size --minimum-bits-for-taxid INT Bit storage requested for taxid --log FILENAME Specify a log file (default: stderr) special: --standard Make standard database which includes: archaea, bacteria, human, plasmid, UniVec_Core, and viral. --special {greengenes,rdp,silva,gtdb} Build special database. RDP is currently unavailable as URLs no longer work. --gtdb-files GTDB_FILES [GTDB_FILES ...] A list of files or regex matching the files needed to build the special database. --gtdb-use-ncbi-taxonomy Use NCBI tax IDs and taxonomy tree when building GTDB database --gtdb-server GTDB_SERVER The GTDB server to use (default: data.ace.uq.edu.au) --no-masking Avoid masking low-complexity sequences prior to building database. --masker-threads K2MASK_THREADS Number of threads used by k2mask during masking process (default: 4) The following changes have been made to special databases: - **GTDB:** Support for building GTDB databases has been added. Files needed for the building the database can be specified using `--gtdb-files` flag. - **RDB:** RDB has been deprecated because the FTP server is no longer functional. - **SILVA:** SILVA has been updated to the version of [138.2](https://ftp.arb-silva.de/release_138.2/) The `--max-db-size` option supports sizes as either integers or units of measurement such "10GiB", "4TB", "10 gebibytes", "4 terabytes". ``` ### inspect k2 inspect --help usage: k2 inspect [-h] --db PATHNAME [--threads THREADS] [--skip-counts] [--use-mpa-style] [--report-zero-counts] [--log FILENAME] [--output FILENAME] [--memory-mapping] optional arguments: -h, --help show this help message and exit --db PATHNAME Pathname to Kraken2 database --threads THREADS Number of threads --skip-counts Only print database summary statistics --use-mpa-style Format output like Kraken 1's kraken-mpa-report --report-zero-counts Report counts for ALL taxa, even if counts are zero --log FILENAME Specify a log filename (default: stderr) --output FILENAME, --out FILENAME Write inspect output to FILENAME (default: stdout) --memory-mapping Avoids loading entire database into RAM Adds support of the `--memory-mapping` and `--threads` options which allows for faster inspection of large indexes. ### classify ```text k2 classify --help usage: k2 classify [-h] --db PATHNAME [--threads INT] [--quick] [--unclassified-out FILENAME] [--classified-out FILENAME] [--output FILENAME] [--confidence CONFIDENCE] [--minimum-base-quality INT] [--report REPORT] [--use-mpa-style] [--report-zero-counts] [--report-minimizer-data] [--memory-mapping] [--paired | --interleaved] [--use-names] [--minimum-hit-groups INT] [--log FILENAME] filenames [filenames ...] positional arguments: filenames Filenames to be classified, supports bz2, gzip, and xz optional arguments: -h, --help show this help message and exit --db PATHNAME Pathname to Kraken2 database(s). Multiple databases are specified as a comma- separated list with no spaces. --threads INT Number of threads --use-daemon Spawn a background process that keeps any loaded indexes in memory. Subsequent invokations of classify with this option will skip the index loading process and immediately start classifying reads. If a new index is specified that index will also be persisted. Use k2 clean --stop-daemon to stop the background process. --quick Quick operation (use first hit or hits) --unclassified-out FILENAME Print unclassified sequences to filename --classified-out FILENAME Print classified sequences to filename --output FILENAME Print output to file (default: stdout) "-" will suppress normal output --confidence CONFIDENCE confidence score threshold (default: 0.0); must be in [0,1] --minimum-base-quality INT Minimum base quality used in classification --report REPORT Print a report with aggregate counts/clade to file --use-mpa-style With --report, format report output like Kraken 1's kraken-mpa-report --report-zero-counts With --report, report counts for ALL taxa, even if counts are zero --report-minimizer-data With --report, report minimizer and distinct minimizer count information in addition to normal Kraken report --memory-mapping Avoids loading entire database into RAM --paired The filenames provided have paired-end reads --interleaved The filenames provided have paired-end reads --use-names Print scientific names instead of just taxids --minimum-hit-groups INT Minimum number of hit groups (overlapping k-mers sharing the same minimizer) needed to make a call (default 2) --log FILENAME Specify a log filename (default: stderr) ``` `classify` can read input files compressed with `gzip`, `bzip`, and `xz`. `zstd` is not yet supported since it not yet included in the Python standard library. ### download-library ```text k2 download-library --help usage: k2 download-library [-h] --db PATHNAME --library LIBRARY [--assembly-source {refseq,genbank,all}] [--assembly-levels {chromosome,complete_genome,scaffold,contig} [{chromosome,complete_genome,scaffold,contig} ...]] [--has-annotation] [--protein] [--log FILENAME] [--threads THREADS] [--no-masking | --masker-threads K2MASK_THREADS] optional arguments: -h, --help show this help message and exit --db PATHNAME Pathname to Kraken2 database --library LIBRARY, --taxid LIBRARY, --project LIBRARY, --accession LIBRARY Name of library to download --assembly-source {refseq,genbank,all} Download RefSeq (GCF_) or GenBank (GCA_) genome assemblies or both (default RefSeq) --resume Resume fetching the files needed for a library, skipping files that have already been downloaded --assembly-levels {chromosome,complete_genome,scaffold,contig} [{chromosome,complete_genome,scaffold,contig} ...] Only return genome assemblies that have one of the specified assembly levels (default chromosome and complete genome) --has-annotation Return only annotated genome assemblies (default false) --blast-volumes BLAST_VOLUMES A comma separated list of the blast volume numbers to download. Ranges are also accepted in the forms start..end, start-end, start:end, ranges are inclusive (default: all volumes) --protein Files being added are for a protein database --log FILENAME Specify a log filename (default stderr) --threads THREADS The number of threads/processes k2 uses when downloading and processing library files. --no-masking Avoid asking low-complexity sequences prior to building; masking requires k2mask or segmasker to be installed --masker-threads K2MASK_THREADS Number of threads used by k2mask during masking process (default: 4) ``` `k2` uses this mode to download files from NCBI. The `--library` option can takes the name of a: - **genome library:** in addition to the libraries already supported `k2` adds support for vertebrateother, vertebratemammalian, mitochondrion, invertebrate, plastid RefSeq collections - **genome taxon:** numerical ID or common or scientific name - **genome accession:** e.g. GCF000001635.27 (Mouse) - **genome project ID:** bioproject identifier e.g. PRJNA31257 (Human Genome Project) When a taxid, accession or project ID is specified `k2` will leverage the [NCBI Dataset API](https://www.ncbi.nlm.nih.gov/datasets/docs/v2/api/rest-api/) to find the related accessions. Additional options such as `--assembly-levels`, `--has-annotation`, `--assembly-source`, can be used as filters to further narrow the accessions that `k2` will download. Downloads can be sped up using the `--threads` flag which will cause files to be downloaded in parallel. **Please be advised that large** **thread counts place a burden on the NCBI servers and can result in the client being forcefully kicked off**. Please apply discretion when using this flag. After the files have been downloaded `k2` will decompress files, mask the sequences if the `--no-masking` flag is not specified, assign taxids and finally concatenate the files into the `library.fna` or `library.faa` file. These steps also utilize the `--threads` flag to speed up processing. [kraken 2 v2.1.3](https://github.com/DerrickWood/kraken2/releases/tag/v2.1.3) shipped with a new multi-threaded genomic masker, `k2mask` that replaces NCBI's `dustmasker`. The `--masker-threads` option can be used to specify the number of threads that `k2mask` uses. ### download-taxonomy ```text k2 download-taxonomy --help usage: k2 download-taxonomy [-h] --db PATHNAME [--protein] [--skip-maps] [--log FILENAME] optional arguments: -h, --help show this help message and exit --db PATHNAME Pathname to Kraken2 database --protein Files being added are for a protein database --skip-maps Avoids downloading accession number to taxid maps --log FILENAME Specify a log filename (default: stderr) ``` Like `download-library` previously discussed, `download-taxonomy` has also been parallelized to download and decompress the WGS and GB accession to tax ID map files in parallel. However a `--threads` flag is not necessary for this mode since the number of files that will be downloaded is capped at 2. ### add-to-library ```text k2 add-to-library --help usage: k2 add-to-library [-h] --db PATHNAME [--threads THREADS] --file FILES [FILES ...] [--protein] [--log FILENAME] [--no-masking | --masker-threads K2MASK_THREADS] optional arguments: -h, --help show this help message and exit --db PATHNAME Pathname to Kraken2 database --threads THREADS The number of threads/processes k2 uses when adding library files. --file FILES [FILES ...], --files FILES [FILES ...] Pathname or patterns of file(s) to be added to library. Supported pattern are as follows: ? - A question-mark is a pattern that shall match any character. * - An asterisk is a pattern that shall match multiple characters. [ - The open bracket shall introduce a pattern bracket expression. ** - will match any files and zero or more directories, subdirectories and symbolic links to directories. --protein Files being added are for a protein database --log FILENAME Specify a log filename (default: stderr) --no-masking Avoid asking low-complexity sequences prior to building; masking requires k2mask or segmasker to be installed --masker-threads K2MASK_THREADS Number of threads used by k2mask during masking process (default: 4) ``` This mode also offers a `--threads` option which comes in handy when adding a large number of files. The `--files` option takes the path of one or more files to be added or a file pattern that makes use of the following : - **?:** Matches a single character - **\*:** Matches zero or more characters - **[:** Matches any character in the bracket - **\*\*:** Matches any file or any number of directories leading up to a file When a file is added to a library `k2` will first calculate the MD5 sum of the file. The hash will be appended to the basename of the `prelim_map.txt` and the `library.fna` files and `added.txt` file will be populated with the original file path and its hash. `k2` will also utilize the hash to skip duplicate additions. If the user removes a file that was added, `added.txt` has to be updated accordingly. ### clean ```text k2 clean --help usage: k2 clean [-h] (--stop-daemon | --db PATHNAME) [--log FILENAME] [--pattern SHELL_REGEX] options: -h, --help show this help message and exit required: Arguments required by the cleaner --stop-daemon Stop a running background process --db PATHNAME Pathname to Kraken2 database options: options for cleaning temporary files --log FILENAME Specify a log filename (default: stderr) --pattern SHELL_REGEX Files that match this regular expression will be deleted. ? - A question-mark is a pattern that shall match any character. * - An asterisk is a pattern that shall match multiple characters. [ - The open bracket shall introduce a pattern bracket expression. ** - will match any files and zero or more directories, subdirectories and symbolic links to directories. ``` The clean command removes unwanted files in a database. If a pattern is not specified `clean` will remove all intermediate files used to build the index leaving behind only the `*.k2d` files. If users wants to delete specific files the `--pattern` option can be specified which supports [19.1.6](#org1344408) similar to `--files` flag of `add-to-library` Kraken 2 Databases ================== A Kraken 2 database is a directory containing at least 3 files: * `hash.k2d`: Contains the minimizer to taxon mappings * `opts.k2d`: Contains information about the options used to build the database * `taxo.k2d`: Contains taxonomy information used to build the database None of these three files are in a human-readable format. Other files may also be present as part of the database build process, and can, if desired, be removed after a successful build of the database. In interacting with Kraken 2, you should not have to directly reference any of these files, but rather simply provide the name of the directory in which they are stored. Kraken 2 allows both the use of a standard database as well as custom databases; these are described in the sections [Standard Kraken 2 Database] and [Custom Databases] below, respectively. Standard Kraken 2 Database ========================== To create the standard Kraken 2 database, you can use the following command: kraken2-build --standard --db $DBNAME (Replace "`$DBNAME`" above with your preferred database name/location. Please note that the database will use approximately 100 GB of disk space during creation, with the majority of that being reference sequences or taxonomy mapping information that can be removed after the build.) This will download NCBI taxonomic information, as well as the complete genomes in RefSeq for the bacterial, archaeal, and viral domains, along with the human genome and a collection of known vectors (UniVec_Core). After downloading all this data, the build process begins; this can be the most time-consuming step. If you have multiple processing cores, you can run this process with multiple threads, e.g.: kraken2-build --standard --threads 24 --db $DBNAME Using 32 threads on an AWS EC2 r4.8xlarge instance with 16 dual-core hyperthreaded 2.30 GHz CPUs and 244 GB of RAM, the build process took approximately 35 minutes in Jan. 2018. The build process itself has two main steps, each of which requires passing over the contents of the reference library: 1. **Estimation** of the capacity needed in the Kraken 2 compact hash table. This uses a low-memory method to reliably estimate the number of minimizers present in the reference library given the selected parameters $k$ and $\ell$. 2. **Population** of the hash table (and conversion of the taxonomy to an internal format). This step is a second pass over the reference library to find minimizers and then place them in the database. (There is one other preliminary step where sequence IDs are mapped to taxonomy IDs, but this is usually a rather quick process and is mostly handled during library downloading.) Unlike Kraken 1's build process, Kraken 2 does not perform checkpointing after the estimation step. This is because the estimation step is dependent on the selected $k$ and $\ell$ values, and if the population step fails, it is likely because $k$ needs to be increased (reducing the overall memory requirements). Classification ============== To classify a set of sequences, use the `kraken2` command: kraken2 --db $DBNAME seqs.fa Output will be sent to standard output by default. The files containing the sequences to be classified should be specified on the command line. Sequences can also be provided through standard input using the special filename `/dev/fd/0`. The `kraken2` program allows several different options: * **Multithreading**: Use the `--threads NUM` switch to use multiple threads. * **Quick operation**: Rather than searching all $\ell$-mers in a sequence, stop classification after the first database hit; use `--quick` to enable this mode. * **Hit group threshold**: The option `--minimum-hit-groups` will allow you to require multiple hit groups (a group of overlapping k-mers that share a common minimizer that is found in the hash table) be found before declaring a sequence classified, which can be especially useful with custom databases when testing to see if sequences either do or do not belong to a particular genome. * **Sequence filtering**: Classified or unclassified sequences can be sent to a file for later processing, using the `--classified-out` and `--unclassified-out` switches, respectively. * **Output redirection**: Output can be directed using standard shell redirection (`|` or `>`), or using the `--output` switch. * **Compressed input**: Kraken 2 can handle gzip and bzip2 compressed files as input by specifying the proper switch of `--gzip-compressed` or `--bzip2-compressed`. * **Input format auto-detection**: If regular files (i.e., not pipes or device files) are specified on the command line as input, Kraken 2 will attempt to determine the format of your input prior to classification. You can disable this by explicitly specifying `--gzip-compressed` or `--bzip2-compressed` as appropriate. Note that use of the character device file `/dev/fd/0` to read from standard input (aka `stdin`) will **not** allow auto-detection. * **Paired reads**: Kraken 2 provides an enhancement over Kraken 1 in its handling of paired read data. Rather than needing to concatenate the pairs together with an `N` character between the reads, Kraken 2 is able to process the mates individually while still recognizing the pairing information. Using the `--paired` option to `kraken2` will indicate to `kraken2` that the input files provided are paired read data, and data will be read from the pairs of files concurrently. Usage of `--paired` also affects the `--classified-out` and `--unclassified-out` options; users should provide a `#` character in the filenames provided to those options, which will be replaced by `kraken2` with "`_1`" and "`_2`" with mates spread across the two files appropriately. For example: kraken2 --paired --classified-out cseqs#.fq seqs_1.fq seqs_2.fq will put the first reads from classified pairs in `cseqs_1.fq`, and the second reads from those pairs in `cseqs_2.fq`. To get a full list of options, use `kraken2 --help`. Output Formats ============== Standard Kraken Output Format ----------------------------- Each sequence (or sequence pair, in the case of paired reads) classified by Kraken 2 results in a single line of output. Kraken 2's output lines contain five tab-delimited fields; from left to right, they are: 1. "C"/"U": a one letter code indicating that the sequence was either classified or unclassified. 2. The sequence ID, obtained from the FASTA/FASTQ header. 3. The taxonomy ID Kraken 2 used to label the sequence; this is 0 if the sequence is unclassified. 4. The length of the sequence in bp. In the case of paired read data, this will be a string containing the lengths of the two sequences in bp, separated by a pipe character, e.g. "98|94". 5. A space-delimited list indicating the LCA mapping of each $k$-mer in the sequence(s). For example, "562:13 561:4 A:31 0:1 562:3" would indicate that: - the first 13 $k$-mers mapped to taxonomy ID #562 - the next 4 $k$-mers mapped to taxonomy ID #561 - the next 31 $k$-mers contained an ambiguous nucleotide - the next $k$-mer was not in the database - the last 3 $k$-mers mapped to taxonomy ID #562 Note that paired read data will contain a "`|:|`" token in this list to indicate the end of one read and the beginning of another. When Kraken 2 is run against a protein database (see [Translated Search]), the LCA hitlist will contain the results of querying all six frames of each sequence. Reading frame data is separated by a "`-:-`" token. Kraken 1 offered a `kraken-translate` and `kraken-report` script to change the output into different formats. Through the use of `kraken2 --use-names`, Kraken 2 will replace the taxonomy ID column with the scientific name and the taxonomy ID in parenthesis (e.g., "Bacteria (taxid 2)" instead of "2"), yielding similar functionality to Kraken 1's `kraken-translate` script. The sample report functionality now exists as part of the `kraken2` script, with the use of the `--report` option; the sample report formats are described below. Sample Report Output Format --------------------------- Like Kraken 1, Kraken 2 offers two formats of sample-wide results. Kraken 2's standard sample report format is tab-delimited with one line per taxon. The fields of the output, from left-to-right, are as follows: 1. Percentage of fragments covered by the clade rooted at this taxon 2. Number of fragments covered by the clade rooted at this taxon 3. Number of fragments assigned directly to this taxon 4. A rank code, indicating (U)nclassified, (R)oot, (D)omain, (K)ingdom, (P)hylum, (C)lass, (O)rder, (F)amily, (G)enus, or (S)pecies. Taxa that are not at any of these 10 ranks have a rank code that is formed by using the rank code of the closest ancestor rank with a number indicating the distance from that rank. E.g., "G2" is a rank code indicating a taxon is between genus and species and the grandparent taxon is at the genus rank. 5. NCBI taxonomic ID number 6. Indented scientific name The scientific names are indented using space, according to the tree structure specified by the taxonomy. By default, taxa with no reads assigned to (or under) them will not have any output produced. However, if you wish to have all taxa displayed, you can use the `--report-zero-counts` switch to do so. This can be useful if you are looking to do further downstream analysis of the reports, and want to compare samples. Sorting by the taxonomy ID (using `sort -k5,5n`) can provide a consistent line ordering between reports. In addition, we also provide the option `--use-mpa-style` that can be used in conjunction with `--report`. This option provides output in a format similar to MetaPhlAn's output. The output with this option provides one taxon per line, with a lowercase version of the rank codes in Kraken 2's standard sample report format (except for 'U' and 'R'), two underscores, and the scientific name of the taxon (e.g., "d__Viruses"). The full taxonomy of each taxon (at the eight ranks considered) is given, with each rank's name separated by a pipe character (e.g., "d__Viruses|o_Caudovirales"). Following this version of the taxon's scientific name is a tab and the number of fragments assigned to the clade rooted at that taxon. Translated Search ================= Kraken 2 allows users to perform a six-frame translated search, similar to the well-known BLASTX program. To do this, Kraken 2 uses a reduced 15 amino acid alphabet and stores amino acid minimizers in its database. LCA results from all 6 frames are combined to yield a set of LCA hits, which is then resolved in the same manner as in Kraken's normal operation. To build a protein database, the `--protein` option should be given to `kraken2-build` (either along with `--standard`, or with all steps if building a custom database). Custom Databases ================ We realize the standard database may not suit everyone's needs. Kraken 2 also allows creation of customized databases. To build a custom database: 1. Install a taxonomy. Usually, you will just use the NCBI taxonomy, which you can easily download using: kraken2-build --download-taxonomy --db $DBNAME This will download the accession number to taxon maps, as well as the taxonomic name and tree information from NCBI. These files can be found in `$DBNAME/taxonomy/` . If you need to modify the taxonomy, edits can be made to the `names.dmp` and `nodes.dmp` files in this directory; you may also need to modify the `*.accession2taxid` files appropriately. Some of the standard sets of genomic libraries have taxonomic information associated with them, and don't need the accession number to taxon maps to build the database successfully. These libraries include all those available through the `--download-library` option (see next point), except for the `plasmid` and non-redundant databases. If you are not using custom sequences (see the `--add-to-library` option) and are not using one of the `plasmid` or non-redundant database libraries, you may want to skip downloading of the accession number to taxon maps. This can be done by passing `--skip-maps` to the `kraken2-build --download-taxonomy` command. 2. Install one or more reference libraries. Several sets of standard genomes/proteins are made easily available through `kraken2-build`: - `archaea`: RefSeq complete archaeal genomes/proteins - `bacteria`: RefSeq complete bacterial genomes/proteins - `plasmid`: RefSeq plasmid nucleotide/protein sequences - `viral`: RefSeq complete viral genomes/proteins - `human`: GRCh38 human genome/proteins - `fungi`: RefSeq complete fungal genomes/proteins - `plant`: RefSeq complete plant genomes/proteins - `protozoa`: RefSeq complete protozoan genomes/proteins - `nr`: NCBI non-redundant protein database - `nt`: NCBI non-redundant nucleotide database - `UniVec`: NCBI-supplied database of vector, adapter, linker, and primer sequences that may be contaminating sequencing projects and/or assemblies - `UniVec_Core`: A subset of UniVec chosen to minimize false positive hits to the vector database To download and install any one of these, use the `--download-library` switch, e.g.: kraken2-build --download-library bacteria --db $DBNAME Multiple libraries can be downloaded into a database prior to building by issuing multiple `kraken2-build --download-library` commands, e.g.: kraken2-build --download-library archaea --db $DBNAME kraken2-build --download-library viral --db $DBNAME The above commands would prepare a database that would contain archaeal and viral genomes; the `--build` option (see below) will still need to be used after downloading these libraries to actually build the database, however. (Note that downloading `nr` requires use of the `--protein` option, and that `UniVec` and `UniVec_Core` are incompatible with the `--protein` option.) Other genomes can also be added, but such genomes must meet certain requirements: - Sequences must be in a FASTA file (multi-FASTA is allowed) - Each sequence's ID (the string between the `>` and the first whitespace character on the header line) must contain either an NCBI accession number to allow Kraken 2 to lookup the correct taxa, or an explicit assignment of the taxonomy ID using `kraken:taxid` (see below). Sequences not downloaded from NCBI may need their taxonomy information assigned explicitly. This can be done using the string `kraken:taxid|XXX` in the sequence ID, with `XXX` replaced by the desired taxon ID. For example, to put a known adapter sequence in taxon 32630 ("synthetic construct"), you could use the following: >sequence16|kraken:taxid|32630 Adapter sequence CAAGCAGAAGACGGCATACGAGATCTTCGAGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA The `kraken:taxid` string must begin the sequence ID or be immediately preceded by a pipe character (`|`). Explicit assignment of taxonomy IDs in this manner will override the accession number mapping provided by NCBI. If your genomes meet the requirements above, then you can add each sequence to your database's genomic library using the `--add-to-library` switch, e.g.: kraken2-build --add-to-library chr1.fa --db $DBNAME kraken2-build --add-to-library chr2.fa --db $DBNAME Note that if you have a list of files to add, you can do something like this in `bash`: for file in chr*.fa do kraken2-build --add-to-library $file --db $DBNAME done Or even add all `*.fa` files found in the directory `genomes`: `find genomes/ -name '*.fa' -print0 | xargs -0 -I{} -n1 kraken2-build --add-to-library {} --db $DBNAME` (You may also find the `-P` option to `xargs` useful to add many files in parallel if you have multiple processors.) 3. Once your library is finalized, you need to build the database. This can be done with the command: kraken2-build --build --db $DBNAME The `--threads` option is also helpful here to reduce build time. By default, the values of $k$ and $\ell$ are 35 and 31, respectively (or 15 and 12 for protein databases). These values can be explicitly set with the `--kmer-len` and `--minimizer-len` options, however. Note that the minimizer length must be no more than 31 for nucleotide databases, and 15 for protein databases. Additionally, the minimizer length $\ell$ must be no more than the $k$-mer length. There is no upper bound on the value of $k$, but sequences less than $k$ bp in length cannot be classified. Kraken 2 also utilizes a simple spaced seed approach to increase accuracy. A number $s$ < $\ell$/4 can be chosen, and $s$ positions in the minimizer will be masked out during all comparisons. Masked positions are chosen to alternate from the second-to-last position in the minimizer; e.g., $s$ = 5 and $\ell$ = 31 will result in masking out the 0 positions shown here: 111 1111 1111 1111 1111 1101 0101 0101 By default, $s$ = 7 for nucleotide databases, and $s$ = 0 for protein databases. This can be changed using the `--minimizer-spaces` option along with the `--build` task of `kraken2-build`. A full list of options for `kraken2-build` can be obtained using `kraken2-build --help`. After building a database, if you want to reduce the disk usage of the database, you can use the `--clean` option for `kraken2-build` to remove intermediate files from the database directory. Masking of Low-complexity Sequences =================================== Low-complexity sequences, e.g. "ACACACACACACACACACACACACAC", are known to occur in many different organisms and are typically less informative for use in alignments; the BLAST programs often mask these sequences by default. Using this masking can help prevent false positives in Kraken 2's results, and so we have added this functionality as a default option to Kraken 2's library download/addition process. Kraken 2 uses two programs to perform low-complexity sequence masking, both available from NCBI: `dustmasker`, for nucleotide sequences, and `segmasker`, for amino acid sequences. These programs are available as part of the NCBI BLAST+ suite. If these programs are not installed on the local system and in the user's PATH when trying to use `kraken2-build`, the database build will fail. Users who do not wish to install these programs can use the `--no-masking` option to `kraken2-build` in conjunction with any of the `--download-library`, `--add-to-library`, or `--standard` options; use of the `--no-masking` option will skip masking of low-complexity sequences during the build of the Kraken 2 database. Special Databases ================= To support some common use cases, we provide the ability to build Kraken 2 databases using data from various external databases. These external databases may not follow the NCBI taxonomy, and so we've provided mechanisms to automatically create a taxonomy that will work with Kraken 2 (although such taxonomies may not be identical to NCBI's). To build one of these "special" Kraken 2 databases, use the following command: kraken2-build --db $DBNAME --special TYPE where the `TYPE` string is one of the database names listed below. At present, the "special" Kraken 2 database support we provide is limited to pre-packaged solutions for some public 16S sequence databases, but this may grow in the future. 16S Databases ------------- For targeted 16S sequencing projects, a normal Kraken 2 database using whole genome data may use more resources than necessary. A Kraken 2 database created from a well-curated genomic library of just 16S data can provide both a more efficient solution as well as a more accurate set of predictions for such projects. We provide support for building Kraken 2 databases from three publicly available 16S databases: * [Greengenes] (Kraken 2 database name: `greengenes`), using all available 16S data. * [RDP] (Kraken 2 database name: `rdp`), using the bacterial and archaeal 16S data. * [SILVA] (Kraken 2 database name: `silva`), using the Small subunit NR99 sequence set. Note that these databases may have licensing restrictions regarding their data, and it is your responsibility to ensure you are in compliance with those restrictions; please visit the databases' websites for further details. The `kraken2-build` script only uses publicly available URLs to download data and then converts that data into a form compatible for use with Kraken 2. Furthermore, if you use one of these databases in your research, please visit the corresponding database's website to determine the appropriate and up-to-date citation. [Greengenes]: http://greengenes.lbl.gov/ [RDP]: http://rdp.cme.msu.edu/ [SILVA]: http://www.arb-silva.de/ Confidence Scoring ================== At present, we have not yet developed a confidence score with a probabilistic interpretation for Kraken 2. However, we have developed a simple scoring scheme that has yielded good results for us, and we've made that available in Kraken 2 through use of the `--confidence` option to `kraken2`. The approach we use allows a user to specify a threshold score in the [0,1] interval; the classifier then will adjust labels up the tree until the label's score (described below) meets or exceeds that threshold. If a label at the root of the taxonomic tree would not have a score exceeding the threshold, the sequence is called unclassified by Kraken 2 when this threshold is applied. A sequence label's score is a fraction $C$/$Q$, where $C$ is the number of $k$-mers mapped to LCA values in the clade rooted at the label, and $Q$ is the number of $k$-mers in the sequence that lack an ambiguous nucleotide (i.e., they were queried against the database). Consider the example of the LCA mappings in Kraken 2's output given earlier: "562:13 561:4 A:31 0:1 562:3" would indicate that: * the first 13 $k$-mers mapped to taxonomy ID #562 * the next 4 $k$-mers mapped to taxonomy ID #561 * the next 31 $k$-mers contained an ambiguous nucleotide * the next $k$-mer was not in the database * the last 3 $k$-mers mapped to taxonomy ID #562 In this case, ID #561 is the parent node of #562. Here, a label of #562 for this sequence would have a score of $C$/$Q$ = (13+3)/(13+4+1+3) = 16/21. A label of #561 would have a score of $C$/$Q$ = (13+4+3)/(13+4+1+3) = 20/21. If a user specified a `--confidence` threshold over 16/21, the classifier would adjust the original label from #562 to #561; if the threshold was greater than 20/21, the sequence would become unclassified. Inspecting a Kraken 2 Database's Contents ========================================= The `kraken2-inspect` script allows users to gain information about the content of a Kraken 2 database. The output format of `kraken2-inspect` is identical to the reports generated with the `--report` option to `kraken2`. Instead of reporting how many reads in input data classified to a given taxon or clade, as `kraken2`'s `--report` option would, the `kraken2-inspect` script will report the number of minimizers in the database that are mapped to the various taxa/clades. For example, the first five lines of `kraken2-inspect`'s output on an example database might look like this: $ kraken2-inspect --db EXAMPLE_DB | head -5 100.00% 1770368409 1581179 R 1 root 96.50% 1708407622 58003 R1 131567 cellular organisms 91.28% 1615910070 985309 D 2 Bacteria 43.89% 777062062 1312736 P 1224 Proteobacteria 18.62% 329590216 555667 C 1236 Gammaproteobacteria This output indicates that 555667 of the minimizers in the database map directly to the Gammaproteobacteria class (taxid #1236), and 329590216 (18.62%) of the database's minimizers map to a taxon in the clade rooted at Gammaproteobacteria. For more information on `kraken2-inspect`'s options, use its `--help` option. Distinct minimizer count information ==================================== The [KrakenUniq] project extended Kraken 1 by, among other things, reporting an estimate of the number of distinct k-mers associated with each taxon in the input sequencing data. This allows users to better determine if Kraken's classifications are due to reads distributed throughout a reference genome, or due to only a small segment of a reference genome (and therefore likely false positive). Thanks to the generosity of KrakenUniq's developer Florian Breitwieser in allowing parts of the KrakenUniq source code to be licensed under Kraken 2's MIT license, this distinct counting estimation is now available in Kraken 2. Development work by Martin Steinegger and Ben Langmead helped bring this functionality to Kraken 2. At present, this functionality is an optional *experimental feature* -- meaning that we may later alter it in a way that is not backwards compatible with previous versions of the feature. To use this functionality, simply run the `kraken2` script with the additional `--report-minimizer-data` flag along with `--report`, e.g.: kraken2 --db $DBNAME --report k2_report.txt --report-minimizer-data \ --output k2_output.txt sequence_data.fq This will put the standard Kraken 2 output (formatted as described in [Standard Kraken Output Format]) in `k2_output.txt` and the report information in `k2_report.txt`. Within the report file, two additional columns will be present, e.g.: **normal report format**: 36.40 182 182 S2 211044 Influenza A virus (A/Puerto Rico/8/1934(H1N1)) **modified report format**: 36.40 182 182 1688 18 S2 211044 Influenza A virus (A/Puerto Rico/8/1934(H1N1)) In this modified report format, the two new columns are the fourth and fifth, respectively representing the number of minimizers found to be associated with a taxon in the read sequences (1688), and the estimate of the number of distinct minimizers associated with a taxon in the read sequence data (18). This would indicate that although 182 reads were classified as belonging to H1N1 influenza, only 18 distinct minimizers led to those 182 classifications. The format with the `--report-minimizer-data` flag, then, is similar to that described in [Sample Report Output Format], but slightly different. The fields in this new format, from left-to-right, are: 1. Percentage of fragments covered by the clade rooted at this taxon 2. Number of fragments covered by the clade rooted at this taxon 3. Number of fragments assigned directly to this taxon 4. Number of minimizers in read data associated with this taxon (**new**) 5. An estimate of the number of distinct minimizers in read data associated with this taxon (**new**) 6. A rank code, indicating (U)nclassified, (R)oot, (D)omain, (K)ingdom, (P)hylum, (C)lass, (O)rder, (F)amily, (G)enus, or (S)pecies. Taxa that are not at any of these 10 ranks have a rank code that is formed by using the rank code of the closest ancestor rank with a number indicating the distance from that rank. E.g., "G2" is a rank code indicating a taxon is between genus and species and the grandparent taxon is at the genus rank. 7. NCBI taxonomic ID number 8. Indented scientific name We decided to make this an optional feature so as not to break existing software that processes Kraken 2's standard report format. However, this new format can be converted to the standard report format with the command: cut -f1-3,6-8 k2_new_report.txt > k2_std_report.txt As noted above, this is an *experimental feature*. We intend to continue development on this feature, and may change the new format and/or its information if we determine it to be necessary. For background on the data structures used in this feature and their interaction with Kraken, please read the [KrakenUniq paper], and please cite that paper if you use this functionality as part of your work. [KrakenUniq]: https://github.com/fbreitwieser/krakenuniq [KrakenUniq paper]: https://genomebiology.biomedcentral.com/articles/10.1186/s13059-018-1568-0 Kraken 2 Environment Variables ============================== The `kraken2` and `kraken2-inspect` scripts supports the use of some environment variables to help in reducing command line lengths: * **`KRAKEN2_NUM_THREADS`**: if the `--threads` option is not supplied to `kraken2`, then the value of this variable (if it is set) will be used as the number of threads to run `kraken2`. (This variable does not affect `kraken2-inspect`.) * **`KRAKEN2_DB_PATH`**: much like the `PATH` variable is used for executables by your shell, `KRAKEN2_DB_PATH` is a colon-separated list of directories that will be searched for the database you name if the named database does not have a slash (`/`) character. By default, Kraken 2 assumes the value of this variable is "`.`" (i.e., the current working directory). This variable can be used to create one (or more) central repositories of Kraken databases in a multi-user system. Example usage in bash: export KRAKEN2_DB_PATH="/home/user/my_kraken2_dbs:/data/kraken2_dbs:" This will cause three directories to be searched, in this order: 1) `/home/user/my_kraken2_dbs` 2) `/data/kraken2_dbs` 3) the current working directory (caused by the empty string as the third colon-separated field in the `KRAKEN2_DB_PATH` string) The search for a database will stop when a name match is found; if two directories in the `KRAKEN2_DB_PATH` have databases with the same name, the directory of the two that is searched first will have its database selected. If the above variable and value are used, and the databases `/data/kraken2_dbs/mainDB` and `./mainDB` are present, then kraken2 --db mainDB sequences.fa will classify `sequences.fa` using `/data/kraken_dbs/mainDB`; if instead you wanted to use the `mainDB` present in the current directory, you would need to specify a directory path to that database in order to circumvent searching, e.g.: kraken2 --db ./mainDB sequences.fa Note that the `KRAKEN2_DB_PATH` directory list can be skipped by the use of any absolute (beginning with `/`) or relative pathname (including at least one `/`) as the database name. * **`KRAKEN2_DEFAULT_DB`**: if no database is supplied with the `--db` option, the database named in this variable will be used instead. Using this variable, you can avoid using `--db` if you only have a single database that you usually use, e.g. in bash: export KRAKEN2_DEFAULT_DB="/home/user/kraken2db" kraken2 sequences.fa > kraken2.output This will classify `sequences.fa` using the `/home/user/kraken2db` database. Note that the value of `KRAKEN2_DEFAULT_DB` will also be interpreted in the context of the value of `KRAKEN2_DB_PATH` if you don't set `KRAKEN2_DEFAULT_DB` to an absolute or relative pathname. Given the earlier example in this section, the following: export KRAKEN2_DEFAULT_DB="mainDB" kraken2 sequences.fa will use `/data/kraken_dbs/mainDB` to classify `sequences.fa`.