# DNABERT-2: Efficient Foundation Model and Benchmark for Multi-Species Genome The repo contains: 1. The official implementation of [DNABERT-2: Efficient Foundation Model and Benchmark for Multi-Species Genome](https://arxiv.org/abs/2306.15006) 2. Genome Understanding Evaluation (GUE): a comprehensize benchmark containing 28 datasets for multi-species genome understanding benchmark. ## Contents - [1. Introduction](#1-introduction) - [2. Model and Data](#2-model-and-data) - [3. Setup Environment](#3-setup-environment) - [4. Quick Start](#4-quick-start) - [5. Pre-Training](#5-pre-training) - [6. Finetune](#6-finetune) - [7. Citation](#7-citation) ## Update (2025/12/09) We introduced GenomeOcean, a generative foundation model to uncover the genomic manifold. Please check it out [here](https://www.biorxiv.org/content/10.1101/2025.01.30.635558v2) if you are interested. ## Update (2024/02/14) We publish DNABERT-S, a foundation model based on DNABERT-2 specifically designed for generating DNA embedding that naturally clusters and segregates genome of different species in the embedding space. Please check it out [here](https://github.com/Zhihan1996/DNABERT_S) if you are interested. ## 1. Introduction DNABERT-2 is a foundation model trained on large-scale multi-species genome that achieves the state-of-the-art performance on $28$ tasks of the GUE benchmark. It replaces k-mer tokenization with BPE, positional embedding with Attention with Linear Bias (ALiBi), and incorporate other techniques to improve the efficiency and effectiveness of DNABERT. ## 2. Model and Data The pre-trained models is available at Huggingface as `zhihan1996/DNABERT-2-117M`. [Link to HuggingFace ModelHub](https://huggingface.co/zhihan1996/DNABERT-2-117M). [Link For Direct Downloads](). ### 2.1 GUE: Genome Understanding Evaluation GUE is a comprehensive benchmark for genome understanding consising of $28$ distinct datasets across $7$ tasks and $4$ species. GUE can be download [here]([https://drive.google.com/file/d/1GRtbzTe3UXYF1oW27ASNhYX3SZ16D7N2/view?usp=sharing](https://drive.google.com/file/d/1uOrwlf07qGQuruXqGXWMpPn8avBoW7T-/view?usp=sharing)). Statistics and model performances on GUE is shown as follows: ![GUE](figures/GUE.png) ![Performance](figures/Performance.png) ## 3. Setup environment # create and activate virtual python environment conda create -n dna python=3.8 conda activate dna # (optional if you would like to use flash attention) # install triton from source git clone https://github.com/openai/triton.git; cd triton/python; pip install cmake; # build-time dependency pip install -e . # install required packages python3 -m pip install -r requirements.txt ## 4. Quick Start Our model is easy to use with the [transformers](https://github.com/huggingface/transformers) package. To load the model from huggingface (version 4.28): ```python import torch from transformers import AutoTokenizer, AutoModel tokenizer = AutoTokenizer.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True) model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True) ``` To load the model from huggingface (version > 4.28): ```python from transformers.models.bert.configuration_bert import BertConfig config = BertConfig.from_pretrained("zhihan1996/DNABERT-2-117M") model = AutoModel.from_pretrained("zhihan1996/DNABERT-2-117M", trust_remote_code=True, config=config) ``` To calculate the embedding of a dna sequence ``` dna = "ACGTAGCATCGGATCTATCTATCGACACTTGGTTATCGATCTACGAGCATCTCGTTAGC" inputs = tokenizer(dna, return_tensors = 'pt')["input_ids"] hidden_states = model(inputs)[0] # [1, sequence_length, 768] # embedding with mean pooling embedding_mean = torch.mean(hidden_states[0], dim=0) print(embedding_mean.shape) # expect to be 768 # embedding with max pooling embedding_max = torch.max(hidden_states[0], dim=0)[0] print(embedding_max.shape) # expect to be 768 ``` ## 5. Pre-Training We used and slightly modified the MosaicBERT implementation for DNABERT-2 https://github.com/mosaicml/examples/tree/main/examples/benchmarks/bert . You should be able to replicate the model training following the instructions. Or you can use the run_mlm.py at https://github.com/huggingface/transformers/tree/main/examples/pytorch/language-modeling by importing the BertModelForMaskedLM from https://huggingface.co/zhihan1996/DNABERT-2-117M/blob/main/bert_layers.py. It should produce a very similar model. The training data is available [here](https://drive.google.com/file/d/1dSXJfwGpDSJ59ry9KAp8SugQLK35V83f/view?usp=sharing.). ## 6. Finetune ### 6.1 Evaluate models on GUE Please first download the GUE dataset from [here](https://drive.google.com/file/d/1uOrwlf07qGQuruXqGXWMpPn8avBoW7T-/view?usp=sharing). Then run the scripts to evaluate on all the tasks. Current script is set to use `DataParallel` for training on 4 GPUs. If you have different number of GPUs, please change the `per_device_train_batch_size` and `gradient_accumulation_steps` accordingly to adjust the global batch size to 32 to replicate the results in the paper. If you would like to perform distributed multi-gpu training (e.g., with `DistributedDataParallel`), simply change `python` to `torchrun --nproc_per_node ${n_gpu}`. ``` export DATA_PATH=/path/to/GUE #(e.g., /home/user) cd finetune # Evaluate DNABERT-2 on GUE sh scripts/run_dnabert2.sh DATA_PATH # Evaluate DNABERT (e.g., DNABERT with 3-mer) on GUE # 3 for 3-mer, 4 for 4-mer, 5 for 5-mer, 6 for 6-mer sh scripts/run_dnabert1.sh DATA_PATH 3 # Evaluate Nucleotide Transformers on GUE # 0 for 500m-1000g, 1 for 500m-human-ref, 2 for 2.5b-1000g, 3 for 2.5b-multi-species sh scripts/run_nt.sh DATA_PATH 0 ``` ### 6.2 Fine-tune DNABERT2 on your own datasets Here we provide an example of fine-tuning DNABERT2 on your own datasets. #### 6.2.1 Format your dataset First, please generate 3 `csv` files from your dataset: `train.csv`, `dev.csv`, and `test.csv`. In the training process, the model is trained on `train.csv` and is evaluated on the `dev.csv` file. After the training if finished, the checkpoint with the smallest loss on the `dev.csv `file is loaded and be evaluated on `test.csv`. If you do not have a validation set, please just make the `dev.csv` and `test.csv` the same. Please see the `sample_data` folder for an sample of data format. Each file should be in the same format, with the first row as document head named `sequence, label`. Each following row should contain a DNA sequence and a numerical label concatenated by a `,` (e.g., `ACGTCAGTCAGCGTACGT, 1 `). Then, you are able to finetune DNABERT-2 on your own dataset with the following code: ``` cd finetune export DATA_PATH=$path/to/data/folder # e.g., ./sample_data export MAX_LENGTH=100 # Please set the number as 0.25 * your sequence length. # e.g., set it as 250 if your DNA sequences have 1000 nucleotide bases # This is because the tokenized will reduce the sequence length by about 5 times export LR=3e-5 # Training use DataParallel python train.py \ --model_name_or_path zhihan1996/DNABERT-2-117M \ --data_path ${DATA_PATH} \ --kmer -1 \ --run_name DNABERT2_${DATA_PATH} \ --model_max_length ${MAX_LENGTH} \ --per_device_train_batch_size 8 \ --per_device_eval_batch_size 16 \ --gradient_accumulation_steps 1 \ --learning_rate ${LR} \ --num_train_epochs 5 \ --fp16 \ --save_steps 200 \ --output_dir output/dnabert2 \ --evaluation_strategy steps \ --eval_steps 200 \ --warmup_steps 50 \ --logging_steps 100 \ --overwrite_output_dir True \ --log_level info \ --find_unused_parameters False # Training use DistributedDataParallel (more efficient) export num_gpu=4 # please change the value based on your setup torchrun --nproc_per_node=${num_gpu} train.py \ --model_name_or_path zhihan1996/DNABERT-2-117M \ --data_path ${DATA_PATH} \ --kmer -1 \ --run_name DNABERT2_${DATA_PATH} \ --model_max_length ${MAX_LENGTH} \ --per_device_train_batch_size 8 \ --per_device_eval_batch_size 16 \ --gradient_accumulation_steps 1 \ --learning_rate ${LR} \ --num_train_epochs 5 \ --fp16 \ --save_steps 200 \ --output_dir output/dnabert2 \ --evaluation_strategy steps \ --eval_steps 200 \ --warmup_steps 50 \ --logging_steps 100 \ --overwrite_output_dir True \ --log_level info \ --find_unused_parameters False ``` ## 7. Citation If you have any question regarding our paper or codes, please feel free to start an issue or email Zhihan Zhou (zhihanzhou2020@u.northwestern.edu). If you use DNABERT-2 in your work, please kindly cite our paper: **DNABERT-2** ``` @misc{zhou2023dnabert2, title={DNABERT-2: Efficient Foundation Model and Benchmark For Multi-Species Genome}, author={Zhihan Zhou and Yanrong Ji and Weijian Li and Pratik Dutta and Ramana Davuluri and Han Liu}, year={2023}, eprint={2306.15006}, archivePrefix={arXiv}, primaryClass={q-bio.GN} } ``` **DNABERT** ``` @article{ji2021dnabert, author = {Ji, Yanrong and Zhou, Zhihan and Liu, Han and Davuluri, Ramana V}, title = "{DNABERT: pre-trained Bidirectional Encoder Representations from Transformers model for DNA-language in genome}", journal = {Bioinformatics}, volume = {37}, number = {15}, pages = {2112-2120}, year = {2021}, month = {02}, issn = {1367-4803}, doi = {10.1093/bioinformatics/btab083}, url = {https://doi.org/10.1093/bioinformatics/btab083}, eprint = {https://academic.oup.com/bioinformatics/article-pdf/37/15/2112/50578892/btab083.pdf}, } ```