openapi: 3.1.0 info: title: Aclid API description: 'The Aclid API is organized around REST. Our API has predictable resource-oriented URLs, returns JSON-encoded responses, and uses standard HTTP response codes and authentication. You can use the Aclid API in test mode, which doesn''t affect your live data. The API key you use to authenticate the request determines whether the request is live mode or test mode.' version: 2.2.1 servers: - url: https://api.aclid.bio description: 'Aclid production API host, as published in the Authentication section of the Aclid API reference (curl example: https://api.aclid.bio/v2/screens)' paths: /v2/screen_fasta: post: summary: Initiate Screen (FASTA File Upload) description: 'Initiate a pathogen screen. Input is a file (`Content-Type: multipart/form-data`), in either FASTA or FASTQ format. Files which are not valid FASTA or FASTQ will be rejected. FASTA sequences must each be at least 30 base pairs in length. (FASTQ sequences may be any non-zero length.) Total base pair count, across all sequences, may not exceed 1,000,000,000.' operationId: handle_v2_screen_fasta_v2_screen_fasta_post parameters: - name: content-type in: header required: true schema: type: string title: Content-Type requestBody: required: true content: multipart/form-data: schema: $ref: '#/components/schemas/Body_handle_v2_screen_fasta_v2_screen_fasta_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportsResponse' '303': description: Request was previously cached using the same idempotence key '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screen_csv: post: summary: Initiate Screen (CSV File Upload) description: 'Initiate a pathogen screen. Input is a CSV file (`Content-Type: multipart/form-data`) that has the following format: ``` name,sequence cholera toxin A2 [Vibrio cholerae],ATGAGCAACACCTGCGACGAGAAGACCCAGAGCCTGGGCGTGAAGTTCCTGGACGAGTACCAGAGCAAGGTGAAGCGGCAGTACTTCAG ``` (This example shows only one sequence, but you may pass in more than one.) Sequences must each be at least 30 base pairs in length. Total base pair count, across all sequences, cannot exceed 1,000,000,000.' operationId: handle_v2_screen_csv_v2_screen_csv_post parameters: - name: content-type in: header required: true schema: type: string title: Content-Type requestBody: required: true content: multipart/form-data: schema: $ref: '#/components/schemas/Body_handle_v2_screen_csv_v2_screen_csv_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportsResponse' '303': description: Request was previously cached using the same idempotence key '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screen_file: post: summary: Initiate Screen (FASTA File Upload) description: '`/screen_file` has been deprecated in favor of `/screen_fasta`. Please use that instead.' operationId: handle_v2_screen_fasta_v2_screen_file_post deprecated: true parameters: - name: content-type in: header required: true schema: type: string title: Content-Type requestBody: required: true content: multipart/form-data: schema: $ref: '#/components/schemas/Body_handle_v2_screen_fasta_v2_screen_file_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportsResponse' '303': description: Request was previously cached using the same idempotence key '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screen: post: summary: Initiate Screen (FASTA File Upload) description: '`/screen` has been deprecated in favor of `/screen_fasta`. Please use that instead.' operationId: handle_v2_screen_fasta_v2_screen_post deprecated: true parameters: - name: content-type in: header required: true schema: type: string title: Content-Type requestBody: required: true content: multipart/form-data: schema: $ref: '#/components/schemas/Body_handle_v2_screen_fasta_v2_screen_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportsResponse' '303': description: Request was previously cached using the same idempotence key '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screen_inline: post: summary: Initiate Screen (Inline) description: "Initiate a pathogen screen.\n\nSequences must each be at least 30 base pairs in length.\nTotal base pair\ \ count, across all sequences, cannot exceed 1,000,000,000.\n\nInput is a JSON request (`Content-Type: application/json`)\ \ that has the following body format:\n```\n{\n \"name\": \"Screen for order #123456\",\n \"sequences\": [\n \ \ {\n \"name\": \"cholera toxin A2 [Vibrio cholerae]\",\n \"sequence\": \"ATGAGCAACACCTGCGACGAGAAGACCCAGAGCCTGGGCGTGAAGTTCCTGGACGAGTACCAGAGCAAGGTGAAGCGGCAGTACTTCAG\"\ \n }\n ]\n}\n```\n\n(This example shows only one sequence, but you may pass in more than one.)" operationId: Initiate_Screen__Inline__v2_screen_inline_post parameters: - name: content-type in: header required: true schema: type: string title: Content-Type requestBody: required: true content: application/json: schema: $ref: '#/components/schemas/Body_Initiate_Screen__Inline__v2_screen_inline_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportsResponse' '303': description: Request was previously cached using the same idempotence key '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screens: get: summary: List Screens description: 'Return a list of recent screens. Screens will include summary data. Please refer to this list of compliance reason codes.' operationId: List_Screens_v2_screens_get parameters: - name: limit in: query required: false schema: type: integer maximum: 100 minimum: 10 description: Limit on the number of items returned per page. title: Limit description: Limit on the number of items returned per page. - name: screen_id in: query required: false schema: type: array items: type: string description: Limit items to specific screen_ids. title: Screen Id description: Limit items to specific screen_ids. - name: status in: query required: false schema: type: array items: $ref: '#/components/schemas/ScreenStatus' title: Filter by status description: Filter by status default: - queued - running - succeeded - failed - archived description: Filter by status - name: name in: query required: false schema: type: array items: type: string title: Filter by name description: Filter by name description: Filter by name - name: expand in: query required: false schema: type: boolean title: Expand description: Expand the response with additional screen data default: false description: Expand the response with additional screen data - name: cursor in: query required: false schema: type: string title: Cursor description: A cursor for use in pagination description: A cursor for use in pagination - name: created_after in: query required: false schema: type: string format: date-time title: Created After description: Filter to include only reports created after this datetime description: Filter to include only reports created after this datetime - name: regulatory_status in: query required: false schema: type: array items: $ref: '#/components/schemas/RegulatoryStatus' title: Regulatory Status description: Filter by one or more regulatory statuses description: Filter by one or more regulatory statuses - name: verification_status in: query required: false schema: type: array items: $ref: '#/components/schemas/VerificationStatus' title: Verification Status description: Filter by one or more verification statuses description: Filter by one or more verification statuses - name: decision_status in: query required: false schema: type: array items: $ref: '#/components/schemas/DecisionStatus' title: Decision Status description: Filter by one or more decision statuses description: Filter by one or more decision statuses - name: search_str in: query required: false schema: type: string title: Search by name description: Search by name description: Search by name responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportsResponse' '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screens/names: get: summary: List Screen Names description: Return all screen names for the authenticated customer, removing duplicates. operationId: List_Screen_Names_v2_screens_names_get responses: '200': description: Successful Response content: application/json: schema: items: type: string type: array title: Response List Screen Names V2 Screens Names Get tags: - Endpoints /v2/screens/{id}/stream: get: summary: Stream Screen description: Return a pre-signed URL to a JSON/CSV file to stream a large screening result. operationId: Stream_Screen_v2_screens__id__stream_get parameters: - name: id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Id responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/StreamReportResponse' '204': description: Screen Not Ready '404': description: Screen Not Found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screens/{id}: get: summary: Retrieve Screen Summary description: 'Return summary data for a previously submitted screen. Please refer to this list of compliance reason codes.' operationId: Retrieve_Screen_Summary_v2_screens__id__get parameters: - name: id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Id responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/ReportMetadata' '404': description: Screen Not Found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screens/{id}/details: get: summary: Retrieve Screen Details description: 'Return detailed data for a previously submitted screen, including match and assessment data. Until the screen is completed, this endpoint will return an HTTP 204. Please refer to this list of compliance reason codes.' operationId: Retrieve_Screen_Details_v2_screens__id__details_get parameters: - name: id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Id - name: max_match_count_per_region in: query required: false schema: type: integer description: How many matches, at most, to return for each query. min: 1 max: 250 default: 25 title: Max Match Count Per Region description: How many matches, at most, to return for each query. responses: '200': description: Successful Response content: application/json: schema: type: object additionalProperties: $ref: '#/components/schemas/MatchGroup' title: Response Retrieve Screen Details V2 Screens Id Details Get '204': description: Screen Not Ready '404': description: Screen Not Found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/verifications/{screen_id}: get: summary: Retrieve Verification description: Return data for a previously submitted verification. operationId: Retrieve_Verification_v2_verifications__screen_id__get parameters: - name: screen_id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Screen Id responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/Followup' '404': description: Verification Not Found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/notes: post: summary: Create Or Update A Note operationId: Create_or_Update_a_Note_v2_notes_post parameters: - name: content-type in: header required: true schema: type: string title: Content-Type requestBody: required: true content: application/json: schema: $ref: '#/components/schemas/Body_Create_or_Update_a_Note_v2_notes_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/Note' '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/screens/{screen_id}/notes: get: summary: List Screen Notes description: Returns a list of your screen notes. operationId: List_Screen_Notes_v2_screens__screen_id__notes_get parameters: - name: screen_id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Screen Id responses: '200': description: Successful Response content: application/json: schema: type: array items: $ref: '#/components/schemas/Note' title: Response List Screen Notes V2 Screens Screen Id Notes Get '404': description: Note Not Found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/verification_url/: post: summary: Create Verification Url description: 'Create a verification URL to verify orders using an embedded integration or a flow hosted by Aclid. Provide a `screen_id` obtained by first calling one of the Initiate Screen endpoints. The response will include a URL that can be shared with a customer to submit additional information for an order. Embedded Integration The embedded flow is a drop-in module that lets you verify orders within your web page. The flow securely collects and verifies compliance information without redirecting away from your website. 1. Confirm with the Aclid team that your website is in our allow lists. 2. Load the Aclid client in your application. ``` ``` 3. Create a verification URL using this endpoint. 4. Initialize the verification in whichever way is appropriate for your application. ``` Aclid.showEmbeddedVerification(({ verificationUrl: string, onSuccess: function }) ``` Hosted Flow Integration The hosted flow allows allows your team to verify orders through Aclid without spending time on development. It is hosted by Aclid but its branding and theming is fully customizable. 1. Create a verification URL using this endpoint and optionally provide a `redirect_url` to redirect users back to your website after verification. 2. Redirect from your website to the URL created in step 1.' operationId: Create_Verification_URL_v2_verification_url__post requestBody: content: application/json: schema: $ref: '#/components/schemas/Body_Create_Verification_URL_v2_verification_url__post' required: true responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/FollowupURLCreateResponse' '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/customers: get: summary: List Customers description: Returns a list of your customers. The customers are returned sorted by creation date, with the most recent customers appearing first. operationId: List_customers_v2_customers_get parameters: - name: search_str in: query required: false schema: type: string title: Search description: Search by name or company description: Search by name or company - name: status_filter in: query required: false schema: type: array items: type: string title: Status description: Filter by customer status default: [] description: Filter by customer status - name: decision_status in: query required: false schema: type: array items: type: string title: Decision Status description: Filter by customer status default: [] description: Filter by customer status - name: page_index in: query required: false schema: type: integer default: 1 title: Page Index responses: '200': description: Successful Response content: application/json: schema: type: array items: $ref: '#/components/schemas/CustomerScreen' title: Response List Customers V2 Customers Get '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints post: summary: Create Customer description: Creates the customer and initiates a sanction and watchlist screen. operationId: Create_customer_v2_customers_post requestBody: required: true content: application/json: schema: $ref: '#/components/schemas/Body_Create_customer_v2_customers_post' responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/SanctionScreenCreateResponse' '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/customers/{requester_id}: get: summary: Retrieve Customer description: Returns customer data. operationId: Retrieve_customer_v2_customers__requester_id__get parameters: - name: requester_id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Requester Id responses: '200': description: Successful Response content: application/json: schema: $ref: '#/components/schemas/CustomerScreen' '404': description: Customer not found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints /v2/customers/{requester_id}/notes: get: summary: List Customer Notes description: Returns a list of your customer notes. operationId: List_Customer_Notes_v2_customers__requester_id__notes_get parameters: - name: requester_id in: path required: true schema: type: string minLength: 5 maxLength: 36 title: Requester Id responses: '200': description: Successful Response content: application/json: schema: type: array items: $ref: '#/components/schemas/CustomerNote' title: Response List Customer Notes V2 Customers Requester Id Notes Get '404': description: Customer not found '422': description: Validation Error content: application/json: schema: $ref: '#/components/schemas/HTTPValidationError' tags: - Endpoints components: schemas: Body_Create_Verification_URL_v2_verification_url__post: properties: screen_id: type: string title: Screen Id description: The screen id for which you want to create a verification. redirect_url: type: string title: Redirect Url description: The URL to redirect to after verification is completed. type: object required: - screen_id title: Body_Create_Verification_URL_v2_verification_url__post Body_Create_customer_v2_customers_post: properties: name: type: string title: Name company: type: string title: Company address: type: string title: Address country: type: string title: Country screen_id: type: string title: Screen Id type: object required: - name - company title: Body_Create_customer_v2_customers_post Body_Create_or_Update_a_Note_v2_notes_post: properties: screen_id: type: string title: Screen Id content: title: Content type: - string - 'null' note_id: title: Note Id type: - string - 'null' decision_status: anyOf: - $ref: '#/components/schemas/DecisionStatus' - type: 'null' type: object required: - screen_id title: Body_Create_or_Update_a_Note_v2_notes_post Body_Initiate_Screen__Inline__v2_screen_inline_post: properties: name: title: Upload Name description: A display label that's useful for you to identify this screen. Unused by Aclid. examples: - 'Order #123456' type: - string - 'null' maxLength: 100 sequences: items: $ref: '#/components/schemas/ScreenInputSequence' type: array title: Sequences idempotence_key: title: Idempotence Key description: Optional. Within any 24-hour window, the first screen request with a given idempotence key will be processed normally. However, subsequent screen requests (within 24 hours) with the same idempotence key will not be re-assessed. Instead, those subsequent requests will be redirected (HTTP 303) to the original screen's summary. examples: - 4202ba63-5122-4904-b2d8-a3cbf81692de type: - string - 'null' maxLength: 60 asynchronous: type: boolean title: Asynchronous description: Set asynchronous to false for real-time screening results default: true verification_success_url: title: Verification Success Url description: URL to redirect to after verification is completed type: - string - 'null' frameworks: title: Frameworks description: "Default: `['us_ccl_export_control', 'eu_dual_use_export_control', 'us_select_agent', 'us_screening_framework']`.\n\ \nList of frameworks to screen sequences against.\n\n Please refer to [this](#tag/Compliance-Reason-Codes) list\ \ of available frameworks. Reach out to us if you'd like to add a framework not currently available in the list\ \ above or if you'd like to use custom criteria exclusive to your account." type: - array - 'null' items: type: string requester_id: title: The associated requester id for this screen. type: - string - 'null' maxLength: 100 sequence_type: $ref: '#/components/schemas/SequenceType' title: Sequence Type description: 'The type of the submitted sequences: `nucleotide` (default) or `amino_acid`. All sequences in a single screen must be of the same type.' default: nucleotide type: object required: - sequences title: Body_Initiate_Screen__Inline__v2_screen_inline_post Body_handle_v2_screen_csv_v2_screen_csv_post: properties: file: type: string contentMediaType: application/octet-stream title: CSV File description: A valid CSV sequence file name: title: Upload Name description: A display label that's useful for you to identify this screen. Unused by Aclid. examples: - 'Order #123456' type: - string - 'null' maxLength: 100 idempotence_key: title: Idempotence Key description: Optional. Within any 24-hour window, the first screen request with a given idempotence key will be processed normally. However, subsequent screen requests (within 24 hours) with the same idempotence key will not be re-assessed. Instead, those subsequent requests will be redirected (HTTP 303) to the original screen's summary. examples: - 4202ba63-5122-4904-b2d8-a3cbf81692de type: - string - 'null' maxLength: 100 asynchronous: type: boolean title: Asynchronous description: Set asynchronous to false to wait for real-time response default: true verification_success_url: title: Verification Success Url description: URL to redirect to after verification is completed type: - string - 'null' frameworks[]: title: Frameworks[] description: "Default: \n\nframeworks[]=us_ccl_export_control\n\nframeworks[]=eu_dual_use_export_control\n\nframeworks[]=us_select_agent\n\ \nframeworks[]=us_screening_framework\n\nList of frameworks to screen sequences against.\n\n Please refer to [this](#tag/Compliance-Reason-Codes)\ \ list of available frameworks. Reach out to us if you'd like to add a framework not currently available in the\ \ list above or if you'd like to use custom criteria exclusive to your account." type: - array - 'null' items: type: string requester_id: title: The associated requester id for this screen. type: - string - 'null' maxLength: 100 sequence_type: $ref: '#/components/schemas/SequenceType' title: Sequence Type description: 'The type of the submitted sequences: `nucleotide` (default) or `amino_acid`. All sequences in a single screen must be of the same type.' default: nucleotide type: object required: - file title: Body_handle_v2_screen_csv_v2_screen_csv_post Body_handle_v2_screen_fasta_v2_screen_fasta_post: properties: file: type: string contentMediaType: application/octet-stream title: FASTA/FASTQ File description: A valid FASTA or FASTQ file name: title: Upload Name description: A display label that's useful for you to identify this screen. Unused by Aclid. examples: - 'Order #123456' type: - string - 'null' maxLength: 100 idempotence_key: title: Idempotence Key description: Optional. Within any 24-hour window, the first screen request with a given idempotence key will be processed normally. However, subsequent screen requests (within 24 hours) with the same idempotence key will not be re-assessed. Instead, those subsequent requests will be redirected (HTTP 303) to the original screen's summary. examples: - 4202ba63-5122-4904-b2d8-a3cbf81692de type: - string - 'null' maxLength: 100 asynchronous: type: boolean title: Asynchronous description: Set asynchronous to false to wait for real-time response default: true verification_success_url: title: Verification Success Url description: URL to redirect to after verification is completed type: - string - 'null' frameworks[]: title: Frameworks[] description: "Default: \n\nframeworks[]=us_ccl_export_control\n\nframeworks[]=eu_dual_use_export_control\n\nframeworks[]=us_select_agent\n\ \nframeworks[]=us_screening_framework\n\nList of frameworks to screen sequences against.\n\n Please refer to [this](#tag/Compliance-Reason-Codes)\ \ list of available frameworks. Reach out to us if you'd like to add a framework not currently available in the\ \ list above or if you'd like to use custom criteria exclusive to your account." type: - array - 'null' items: type: string requester_id: title: The associated requester id for this screen. type: - string - 'null' maxLength: 100 sequence_type: $ref: '#/components/schemas/SequenceType' title: Sequence Type description: 'The type of the submitted sequences: `nucleotide` (default) or `amino_acid`. All sequences in a single screen must be of the same type.' default: nucleotide type: object required: - file title: Body_handle_v2_screen_fasta_v2_screen_fasta_post Body_handle_v2_screen_fasta_v2_screen_file_post: properties: file: type: string contentMediaType: application/octet-stream title: FASTA/FASTQ File description: A valid FASTA or FASTQ file name: title: Upload Name description: A display label that's useful for you to identify this screen. Unused by Aclid. examples: - 'Order #123456' type: - string - 'null' maxLength: 100 idempotence_key: title: Idempotence Key description: Optional. Within any 24-hour window, the first screen request with a given idempotence key will be processed normally. However, subsequent screen requests (within 24 hours) with the same idempotence key will not be re-assessed. Instead, those subsequent requests will be redirected (HTTP 303) to the original screen's summary. examples: - 4202ba63-5122-4904-b2d8-a3cbf81692de type: - string - 'null' maxLength: 100 asynchronous: type: boolean title: Asynchronous description: Set asynchronous to false to wait for real-time response default: true verification_success_url: title: Verification Success Url description: URL to redirect to after verification is completed type: - string - 'null' frameworks[]: title: Frameworks[] description: "Default: \n\nframeworks[]=us_ccl_export_control\n\nframeworks[]=eu_dual_use_export_control\n\nframeworks[]=us_select_agent\n\ \nframeworks[]=us_screening_framework\n\nList of frameworks to screen sequences against.\n\n Please refer to [this](#tag/Compliance-Reason-Codes)\ \ list of available frameworks. Reach out to us if you'd like to add a framework not currently available in the\ \ list above or if you'd like to use custom criteria exclusive to your account." type: - array - 'null' items: type: string requester_id: title: The associated requester id for this screen. type: - string - 'null' maxLength: 100 sequence_type: $ref: '#/components/schemas/SequenceType' title: Sequence Type description: 'The type of the submitted sequences: `nucleotide` (default) or `amino_acid`. All sequences in a single screen must be of the same type.' default: nucleotide type: object required: - file title: Body_handle_v2_screen_fasta_v2_screen_file_post Body_handle_v2_screen_fasta_v2_screen_post: properties: file: type: string contentMediaType: application/octet-stream title: FASTA/FASTQ File description: A valid FASTA or FASTQ file name: title: Upload Name description: A display label that's useful for you to identify this screen. Unused by Aclid. examples: - 'Order #123456' type: - string - 'null' maxLength: 100 idempotence_key: title: Idempotence Key description: Optional. Within any 24-hour window, the first screen request with a given idempotence key will be processed normally. However, subsequent screen requests (within 24 hours) with the same idempotence key will not be re-assessed. Instead, those subsequent requests will be redirected (HTTP 303) to the original screen's summary. examples: - 4202ba63-5122-4904-b2d8-a3cbf81692de type: - string - 'null' maxLength: 100 asynchronous: type: boolean title: Asynchronous description: Set asynchronous to false to wait for real-time response default: true verification_success_url: title: Verification Success Url description: URL to redirect to after verification is completed type: - string - 'null' frameworks[]: title: Frameworks[] description: "Default: \n\nframeworks[]=us_ccl_export_control\n\nframeworks[]=eu_dual_use_export_control\n\nframeworks[]=us_select_agent\n\ \nframeworks[]=us_screening_framework\n\nList of frameworks to screen sequences against.\n\n Please refer to [this](#tag/Compliance-Reason-Codes)\ \ list of available frameworks. Reach out to us if you'd like to add a framework not currently available in the\ \ list above or if you'd like to use custom criteria exclusive to your account." type: - array - 'null' items: type: string requester_id: title: The associated requester id for this screen. type: - string - 'null' maxLength: 100 sequence_type: $ref: '#/components/schemas/SequenceType' title: Sequence Type description: 'The type of the submitted sequences: `nucleotide` (default) or `amino_acid`. All sequences in a single screen must be of the same type.' default: nucleotide type: object required: - file title: Body_handle_v2_screen_fasta_v2_screen_post CustomerNote: properties: note_id: type: string title: Note Id created_at: type: string format: date-time title: Created At note_content: title: Note Content type: - string - 'null' decision_status: anyOf: - $ref: '#/components/schemas/DecisionStatus' - type: 'null' type: object required: - note_id - created_at title: CustomerNote CustomerScreen: properties: name: title: Name type: - string - 'null' address: title: Address type: - string - 'null' company: title: Company type: - string - 'null' created_at: type: string format: date-time title: Created At status: title: Status type: - string - 'null' requester_id: type: string title: Requester Id decision_status: $ref: '#/components/schemas/DecisionStatus' sanctions_count: title: Sanctions Count type: - integer - 'null' kyc_latest: title: Kyc Latest type: - string - 'null' format: date-time kyc_flags_count: title: Kyc Flags Count type: - integer - 'null' type: object required: - created_at - requester_id - decision_status title: CustomerScreen DecisionStatus: type: string enum: - awaiting - approved - rejected - escalated title: DecisionStatus Finding: properties: reason_code: title: Reason Code type: - string - 'null' regulatory_status: $ref: '#/components/schemas/RegulatoryStatus' material: title: Material type: - string - 'null' type: object required: - regulatory_status title: Finding Followup: properties: metadata: type: string title: Metadata examples: - '{"research_purpose": "The Research Purpose is this", "contact_name": "The Contact Name", "contact_email": "someone@email.com"}' created_at: type: integer title: Created At examples: - 1620060337 completed_at: type: integer title: Completed At examples: - 1620060337 documentation_url: title: Documentation Url examples: - https://aclid.bio/somefile.pdf type: - string - 'null' grant_docs: items: $ref: '#/components/schemas/GrantDoc' type: array title: Grant Docs type: object required: - created_at - grant_docs title: Followup FollowupURLCreateResponse: properties: url: type: string title: Url examples: - https://verify.aclid.bio/?access_token=aclid-access-1234 type: object required: - url title: FollowupURLCreateResponse FunSoC: properties: name: type: string title: Name description: type: string title: Description type: object required: - name - description title: FunSoC GeneOntology: properties: name: type: string title: Name definition: type: string title: Definition type: object required: - name - definition title: GeneOntology GrantDoc: properties: id: type: string title: Id grant_id: type: string title: Grant Id start_date: title: Start Date examples: - 1620060337 type: - string - 'null' format: date-time end_date: title: End Date examples: - 1620060337 type: - string - 'null' format: date-time office_agency_name: title: Office Agency Name type: - string - 'null' recipient_name: title: Recipient Name type: - string - 'null' recipient_address: title: Recipient Address type: - string - 'null' description: title: Description type: - string - 'null' type: object required: - id - grant_id - start_date - end_date title: GrantDoc HTTPValidationError: properties: detail: items: $ref: '#/components/schemas/ValidationError' type: array title: Detail type: object title: HTTPValidationError Match: properties: query: type: string title: Query qstart: type: integer title: Query Start qend: type: integer title: Query End qlen: title: Query Length type: - integer - 'null' sseqid: type: string title: Subject Sequence ID sstart: type: integer title: Subject Start send: type: integer title: Subject End slen: type: integer title: Subject Length length: type: integer title: Length evalue: type: number title: E-value bitscore: type: number title: Bit-score taxid: type: integer title: Taxonomy ID organism: type: string title: Organism gene: title: Gene type: - string - 'null' function: title: Function type: - string - 'null' go: items: $ref: '#/components/schemas/GeneOntology' type: array title: Gene Ontology funsocs: items: $ref: '#/components/schemas/FunSoC' type: array title: Functional Sequences of Concern pident: type: number title: Percent Identity qcov: type: number title: Query Coverage scov: type: number title: Subject Coverage findings: additionalProperties: $ref: '#/components/schemas/Finding' type: object title: Regulatory Concerns description: Map of regulatory concerns for an alignment. See compliance reason codes above. regulatory_status: $ref: '#/components/schemas/RegulatoryStatus' title: Regulatory Status pathogenesis: type: boolean title: Pathogenesis housekeeping: type: boolean title: Housekeeping type: object required: - query - qstart - qend - qlen - sseqid - sstart - send - slen - length - evalue - bitscore - taxid - organism - go - funsocs - pident - qcov - scov - findings - regulatory_status - pathogenesis - housekeeping title: Match MatchGroup: properties: matches: items: $ref: '#/components/schemas/Match' type: array title: Alignments description: List of alignments to each sequence. findings: title: Regulatory Concerns description: Map of regulatory concerns for an alignment. See compliance reason codes above. type: - object - 'null' additionalProperties: $ref: '#/components/schemas/Finding' regulatory_status: anyOf: - $ref: '#/components/schemas/RegulatoryStatus' - type: 'null' title: Regulatory Status description: Summary of the regulatory concerns. Use this field to quickly determine whether a compliance action is needed. type: object required: - matches - findings - regulatory_status title: MatchGroup MaterialSummary: properties: control_type: title: Control Type description: type of controlled material eg. virus type: - string - 'null' coverage: title: Coverage description: Coverage of this material in the regulatory status type: - number - 'null' unique_coverage: title: Unique Coverage description: Coverage of this material from sequences unique to this material type: - number - 'null' total_sequences: type: integer title: Total Sequence description: Total sequences for this material in the regulatory status risk_factors: anyOf: - $ref: '#/components/schemas/RiskFactors' - type: 'null' title: Risk Factors description: Risk indicators computed from hits associated with this material type: object required: - total_sequences title: MaterialSummary Note: properties: note_id: type: string title: Note Id created_by: type: string title: Created By created_at: type: integer title: Created At examples: - 1620060337 note_content: title: Note Content type: - string - 'null' decision_status: anyOf: - $ref: '#/components/schemas/DecisionStatus' - type: 'null' type: object required: - note_id - created_by - created_at title: Note RegulatoryStatus: type: string enum: - controlled - not_controlled title: RegulatoryStatus ReportMetadata: properties: id: type: string maxLength: 40 minLength: 5 title: Screen ID description: Unique indentifier for this screen. examples: - 230408145715_yPSG4Ery name: title: Screen Name description: User provided identifier for this screen. type: - string - 'null' maxLength: 100 user: type: string title: User ID description: The ID of the user that initiated this screen. examples: - ash.braxton@reallygreatlab.com verification_completed_at: title: Verification Completed Date type: - string - 'null' format: date-time verification_url: title: Verification URL type: - string - 'null' created: type: integer title: Created description: Specifies the time this screen was created in epoch format. updated: title: Updated description: Specifies the time this screen was updated in epoch format. type: - integer - 'null' status: $ref: '#/components/schemas/ScreenStatus' title: Status description: Indicates the status or state of the screen. length: title: Query Length description: Cumulative length of all sequences in the screen. type: - integer - 'null' match_count: title: Alignment Count description: Cumulative number of alignments to all sequences in the screen. type: - integer - 'null' findings: title: Regulatory Concerns description: Map of regulatory concerns for the screen. See compliance reason codes above. type: - object - 'null' additionalProperties: $ref: '#/components/schemas/Finding' regulatory_status: anyOf: - $ref: '#/components/schemas/RegulatoryStatus' - type: 'null' title: Regulatory Status description: Summary of the regulatory concerns. Use this field to quickly determine whether a compliance action is needed. sequences: title: Sequences description: Sequences of the screen. type: - object - 'null' additionalProperties: $ref: '#/components/schemas/MatchGroup' version: title: Version description: Version of our internal screening tool used to generate this report. type: - string - 'null' verification_status: anyOf: - $ref: '#/components/schemas/VerificationStatus' - type: 'null' title: Verification Status description: Status of the verification process. decision_status: anyOf: - $ref: '#/components/schemas/DecisionStatus' - type: 'null' title: Decision Status description: Acceptance status of a screen. material_summary: title: Material Summary description: Summary of top materials in a screen type: - object - 'null' additionalProperties: $ref: '#/components/schemas/MaterialSummary' material_count: title: Controlled Material Count description: Number of unique controlled materials in a screen type: - integer - 'null' request_frameworks: title: Request Frameworks description: List of frameworks requested in the screen. type: - array - 'null' items: type: string type: object required: - id - user - created - status - findings - regulatory_status title: ReportMetadata ReportsResponse: properties: items: items: $ref: '#/components/schemas/ReportMetadata' type: array title: Items next_cursor: title: Next Cursor type: - string - 'null' type: object required: - items title: ReportsResponse RiskFactors: properties: distant_matches: type: boolean title: Only Distant Matches description: All hits for this material are below 60% similarity poorly_characterized: type: boolean title: Poorly Characterized Matches description: No hits for this material have functional annotation data close_match: type: boolean title: Close Sequence Match description: At least one hit for this material is 80% similarity or higher virulence: type: boolean title: Key Virulence Protein Covered description: At least one hit for this material is linked to a pathogenesis-associated gene type: object required: - distant_matches - poorly_characterized - close_match - virulence title: RiskFactors SanctionScreenCreateResponse: properties: requester_id: type: string title: Requester Id status: type: string title: Status type: object required: - requester_id - status title: SanctionScreenCreateResponse ScreenInputSequence: properties: name: type: string maxLength: 200 minLength: 1 title: Unique sequence name examples: - cholera toxin A2 [Vibrio cholerae] sequence: type: string minLength: 30 title: Sequence examples: - ATGAGCAACACCTGCGACGAGAAGACCCAGAGCCTGGGCGTGAAGTTCCTGGACGAGTACCAGAGCAAGGTGAAGCGGCAGTACTTCAG type: object required: - name - sequence title: ScreenInputSequence ScreenStatus: type: string enum: - pending_upload - queued - running - succeeded - failed - deleted - archived title: ScreenStatus SequenceType: type: string enum: - nucleotide - amino_acid title: SequenceType StreamReportResponse: properties: url: type: string title: Url type: object required: - url title: StreamReportResponse ValidationError: properties: loc: items: anyOf: - type: string - type: integer type: array title: Location msg: type: string title: Message type: type: string title: Error Type input: title: Input ctx: type: object title: Context type: object required: - loc - msg - type title: ValidationError VerificationStatus: type: string enum: - submitted - partially_submitted - missing_verification - not_required title: VerificationStatus tags: - name: Authentication description: "Aclid uses API keys to authenticate requests. You can view your API key on your profile in\nthe Aclid Dashboard.\n\nYour API keys are used for billing and authentication, so be sure to keep\ \ them secure! Do not share\nyour secret API keys in publicly accessible areas such as GitHub or client-side code.\n\n\ Authentication to the API is performed via the HTTP Authorization request header. Provide your API\nkey as the request\ \ header value.\n\nAll API requests must be made over HTTPS. Calls made over plain HTTP will fail. API requests\nwithout\ \ authentication will also fail.\n\n##### Bash Example\n```bash\nAUTH_TOKEN='eyJhbGciOiJSUzI1NiIsImtpZCI6...'\ncurl --header\ \ \"Authorization: ${AUTH_TOKEN}\" https://api.aclid.bio/v2/screens\n```\n\n##### Python Example\n```python\nimport httpx\ \ # or requests\n\nheaders = {\n \"Authorization\": \"eyJhbGciOiJSUzI1NiIsImtpZCI6...\",\n}\nresponse = httpx.get(\"\ https://api.aclid.bio/v2/screens\", headers=headers)\n```" - name: Endpoints - name: Compliance Reason Codes description: 'Aclid''s compliance assessment service detects the following regulatory concerns. Each framework below lists the reason codes that may appear on a finding, along with a description of the concern and the associated compliance guidance. ### Common Exemption Reason Codes This is a set of reason codes common to all frameworks in Aclid''s platform that describe exemptions for matching criteria. | Reason Code | Description | Compliance | | --- | --- | --- | | `housekeeping` | This gene is specific to a listed bacterium or fungus, but the gene is typically regarded as housekeeping or metabolic. | This gene is specific to a listed bacterium or fungus, but the gene is typically regarded as housekeeping or metabolic. | | `unspecific` | This gene is not specific to a listed agent. | This gene is not specific to a listed agent. | | `match_window_below_threshold` | This gene is below the 16 amino acid or 50 base pair threshold window. | This gene is below the 16 amino acid or 50 base pair threshold window. | ### US Commerce Control List [`us_ccl_export_control`] The US Commerce Control List is a list of items that are subject to the export control authority of the Department of Commerce''s Bureau of Industry and Security (BIS). If you''re shipping materials from the US to locations outside the US or non-US persons, you must determine whether the material requires an export license before shipment. | Reason Code | Description | Compliance | | --- | --- | --- | | `toxin` | This gene encodes a controlled toxin or subunit. If shipping outside the US or to non-US persons, must file for an export license. | This gene encodes a controlled toxin or subunit. If shipping outside the US or to non-US persons, must file a classification request or export license. | | `virus` | This gene is specific to a controlled virus. If shipping outside the US or to non-US persons, must file for an export license. | This gene is specific to a controlled virus. A classification request or export license is only required for viral sequences when shipping to states or persons from states that are not participants of Australia Group. | | `pathogenic` | This gene is specific to a controlled agent. The gene represents a "significant hazard to human, animal, or plant health" or "could endow or enhance pathogenicity." If shipping outside the US or to non-US persons, must file for an export license. | This gene is specific to a controlled agent. The gene represents a "significant hazard to human, animal, or plant health" or "could endow or enhance pathogenicity". A classification request or export license is only required for pathogen sequences when shipping to states or persons from states that are not participants of Australia Group. | | `specific` | This gene is specific to a controlled bacterium or fungus. The gene is not typically regarded as housekeeping or metabolic. If shipping outside the US or to non-US persons, requires further investigation of function. This sequence may require a classification request from a US export authority. | This gene is specific to a controlled agent. The gene is not typically regarded as housekeeping or metabolic. This sequence may require a classification request or export license when shipping to states or persons from states that are not participants of Australia Group. | ### EU Dual-Use Export Control List [`eu_dual_use_export_control`] The EU Dual-Use Export Control List is a list of items that are subject to export control under Regulation (EU) 2021/821. If you''re shipping materials from the EU to locations outside the EU or non-EU persons, you must determine whether the material requires an export license before shipment. | Reason Code | Description | Compliance | | --- | --- | --- | | `toxin` | This gene encodes a controlled toxin or subunit. If shipping outside the EU or to non-EU persons, must file for an export license. | This gene encodes a controlled toxin or subunit. If shipping outside the EU or to non-EU persons, must file a classification request or export license. | | `virus` | This gene is specific to a controlled virus. If shipping outside the EU or to non-EU persons, must file for an export license. | This gene is specific to a controlled virus. If shipping outside the EU or to non-EU persons, must file a classification request or export license. | | `pathogenic` | This gene is specific to a controlled agent. The gene represents a "significant hazard to human, animal, or plant health" or "could endow or enhance pathogenicity". If shipping outside the EU or to non-EU persons, must file for an export license. | This gene is specific to a controlled agent. The gene represents a "significant hazard to human, animal, or plant health" or "could endow or enhance pathogenicity". If shipping outside the EU or to non-EU persons, must file a classification request or export license. | | `specific` | This gene is specific to a controlled bacterium or fungus. The gene is not typically regarded as housekeeping or metabolic. If shipping outside the EU or to non-EU persons, requires further investigation of function. This sequence may require a classification request from an EU export authority. | This gene is specific to a controlled agent. The gene is not typically regarded as housekeeping or metabolic. If shipping outside the EU or to non-EU persons, requires further investigation of function. This sequence may require a classification request or export license from an EU export authority. | ### US Federal Select Agent Program [`us_select_agent`] The US Federal Select Agent Program oversees the possession, use, and transfer of select agents and toxins, which pose a threat to public, animal, or plant health. If you''re shipping materials within the US, you must determine whether the material requires a certificate of registration issued by the US Department of Health and Human Services Secretary and Administrator. | Reason Code | Description | Compliance | | --- | --- | --- | | `toxin` | This gene encodes a select toxin or subunit. If shipping to the US or within, recipient must provide a certificate of registration issued by the US Department of Health and Human Services Secretary and Administrator. | This gene encodes a select toxin or subunit. If shipping to the US or within, recipient must provide a certificate of registration issued by the US Department of Health and Human Services Secretary and Administrator. | | `virus` | This gene is derived from a select agent virus. The Federal Select Agent Program only requires registrations for positive strand RNA forms of select agent viral genomes. | This gene is derived from a select agent virus. The Federal Select Agent Program only requires registrations for positive strand RNA forms of select agent viral genomes. | | `agent` | This gene is derived from a select agent bacterium or fungus. The Federal Select Agent Program does not require registrations for nucleic acids derived from select agent bacteria or fungi. | This gene is derived from a select agent bacterium or fungus. The Federal Select Agent Program does not require registrations for nucleic acids derived from select agent bacteria or fungi. | ### US Screening Framework [`us_screening_framework`] The US Screening Framework is a biosecurity policy that outlines requirements for providers and distributors of synthetic DNA and RNA. If you''re shipping materials to researchers or institutions receiving US federal funding, you must comply with the US Screening Framework''s requirements for screening sequences of concern (SoCs) and verifying customer legitimacy. | Reason Code | Description | Compliance | | --- | --- | --- | | `toxin` | This gene encodes a select or controlled toxin or subunit. The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | This gene encodes a select or controlled toxin or subunit. The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | | `virus` | This gene is specific to a select, controlled, or warning virus. The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | This gene is specific to a select, controlled, or warning virus. The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | | `pathogenic` | This gene is derived from a select, controlled, or warning agent. The gene represents a "significant hazard to human, animal, or plant health" or "could endow or enhance pathogenicity". The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | This gene is derived from a select, controlled, or warning agent. The gene represents a "significant hazard to human, animal, or plant health" or "could endow or enhance pathogenicity". The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | | `specific` | This gene is derived from a select, controlled, or warning agent. The gene is not typically regarded as housekeeping or metabolic. The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | This gene is derived from a select, controlled, or warning agent. The gene is not typically regarded as housekeeping or metabolic. The US Department of Health and Human Services identifies this as a "sequence of concern" and recommends follow-up screening. | ### NIH Recombinant DNA Guidelines [`nih_recombinant_dna_guidelines`] The US National Institutes of Health (NIH) DNA Guidelines are a biosafety best practice and mandatory set of rules that govern safe conduct of research with recombinant DNA at institutions receiving NIH funding. | Reason Code | Description | Compliance | | --- | --- | --- | | `risk_group_1` | Any gene from an agent that is not associated with disease in healthy adult humans. | This construct is not associated with disease in healthy adult humans and does not require additional considerations or special handling, equipment, or facilities. | | `risk_group_2` | Any gene from an agent that is associated with human disease which is rarely serious and for which preventive therapeutic interventions are often available. | This construct is associated with Risk Group 2 and may require special handling, equipment, or facilities. Constructs associated with Risk Groups 2-4 should be reviewed according to the NIH Recombinant DNA Guidelines to identify precautionary operating procedures or mitigations. | | `risk_group_3` | Any gene from an agent that is associated with serious or lethal human disease for which preventive or therapeutic interventions may be available (high individual risk but low community risk). | This construct is associated with Risk Group 3 and may require special handling, equipment, or facilities. Constructs associated with Risk Groups 2-4 should be reviewed according to the NIH Recombinant DNA Guidelines to identify precautionary operating procedures or mitigations. | | `risk_group_4` | Any gene from an agent that is likely to cause serious or lethal human disease for which preventive or therapeutic interventions are not usually available (high individual risk and high community risk). | This construct is associated with Risk Group 4 and may require special handling, equipment, or facilities. Constructs associated with Risk Groups 2-4 should be reviewed according to the NIH Recombinant DNA Guidelines to identify precautionary operating procedures or mitigations. | ### EU Directive 2000/54/EC [`eu_directive_2000_54_ec`] EU Directive 2000/54/EC is legislation that protects workers from risks related to exposure to biological agents at work. The directive outlines policies that employers in the EU must implement as part of conducting work involving biological hazards including risk assessments, prevention and control, information and training, health surveillance of workers, and notifications to authorities. | Reason Code | Description | Compliance | | --- | --- | --- | | `risk_group_1` | Any gene from an agent that is unlikely to cause human disease. | This construct is unlikely to cause human disease and does not require additional considerations or special handling, equipment, or facilities. | | `risk_group_2` | Any gene from an agent that can cause human disease and might be a hazard to workers; it is unlikely to spread to the community; there is usually effective prophylaxis or treatment available. | This construct is associated with Risk Group 2 and may require special handling, equipment, or facilities. Constructs associated with Risk Groups 2-4 should be reviewed according to the NIH Recombinant DNA Guidelines to identify precautionary operating procedures or mitigations. | | `risk_group_3` | Any gene from an agent that can cause severe human disease and present a serious hazard to workers; it may present a risk of spreading to the community, but there is usually effective prophylaxis or treatment available. | This construct is associated with Risk Group 3 and may require special handling, equipment, or facilities. Constructs associated with Risk Groups 2-4 should be reviewed according to the NIH Recombinant DNA Guidelines to identify precautionary operating procedures or mitigations. | | `risk_group_4` | Any gene from an agent that causes severe human disease and is a serious hazard to workers; it may present a high risk of spreading to the community; there is usually no effective prophylaxis or treatment available. | This construct is associated with Risk Group 4 and may require special handling, equipment, or facilities. Constructs associated with Risk Groups 2-4 should be reviewed according to the NIH Recombinant DNA Guidelines to identify precautionary operating procedures or mitigations. | ### The Central Committee on Biological Safety (ZKBS) – Oncogenes [`zkbs_oncogenes`] The Central Committee on Biological Safety (ZKBS) is an expert panel established by German law for evaluating risks of genetically modified organisms to humans, animals, and the environment. This is the commission''s database for cellular and viral genes / nucleic acids that have been evaluated for oncogenic potential. | Reason Code | Description | Compliance | | --- | --- | --- | | `oncogene` | This nucleic acid segment has homology to a known oncogene with neoplastic transforming potential. | Review this nucleic acid segment''s homology to oncogenes, mutations of homologous oncogenes, and ability to silence homologous oncogenes to identify precautionary operating measures or mitigations. | | `shrna_sirna_oncogene` | This nucleic acid segment has homology to a known oncogene with neoplastic transforming potential when silenced. | Review this nucleic acid segment''s homology to oncogenes, mutations of homologous oncogenes, and ability to silence homologous oncogenes to identify precautionary operating measures or mitigations. | | `mutant_oncogene` | This nucleic acid segment has homology to a known oncogene with neoplastic transforming potential when mutated. | Review this nucleic acid segment''s homology to oncogenes, mutations of homologous oncogenes, and ability to silence homologous oncogenes to identify precautionary operating measures or mitigations. | | `activated_mutant_oncogene` | This nucleic acid segment has homology to a known oncogene with neoplastic transforming potential when mutated with increased activity. | Review this nucleic acid segment''s homology to oncogenes, mutations of homologous oncogenes, and ability to silence homologous oncogenes to identify precautionary operating measures or mitigations. | | `deactivated_mutant_oncogene` | This nucleic acid segment has homology to a known oncogene with neoplastic transforming potential when mutated with decreased activity. | Review this nucleic acid segment''s homology to oncogenes, mutations of homologous oncogenes, and ability to silence homologous oncogenes to identify precautionary operating measures or mitigations. | | `exon_9_mutated_oncogene` | This nucleic acid segment has homology to a known oncogene with neoplastic transforming potential when mutated in the exon-9 region. | Review this nucleic acid segment''s homology to oncogenes, mutations of homologous oncogenes, and ability to silence homologous oncogenes to identify precautionary operating measures or mitigations. | ### USDA APHIS VS-Regulated Livestock and Poultry Pathogens [`usda_vs`] The USDA APHIS Veterinary Services (VS) regulates the importation and interstate transport of livestock and poultry pathogens. Researchers and importers must apply for Organisms and Vectors (OV) permits to handle these biological materials. USDA Veterinary Services provides a Permitting Assistant (VSPA) for determining import and transit requirements located here | Reason Code | Description | Compliance | | ----- | --- | --- | | `Regulated pathogen` | This construct is associated with a Veterinary Services (VS) regulated livestock or poultry pathogen and may require filing a VS 16-3 Form for import or interstate transport. | Review constructs associated with Veterinary Services (VS) regulated livestock or poultry pathogens and use the VS Permitting Assistant (VSPA) to determine requirements for transport. | | `Potentially regulated` | This construct is associated with a genus of Veterinary Services (VS) regulated livestock or poultry pathogens. The genus may contain both pathogenic and nonpathogenic species and may require filing a VS 16-3 Form for import or interstate transport. | Review constructs associated with Veterinary Services (VS) regulated livestock or poultry pathogens and use the VS Permitting Assistant (VSPA) to determine requirements for transport. | | `Regulated arthropod vector` | This construct is associated with a Veterinary Services (VS) regulated livestock or poultry arthropod vector and may require filing a VS 16-3 Form for import or interstate transport. | Review constructs associated with Veterinary Services (VS) regulated livestock or poultry arthropod vectors and use the VS Permitting Assistant (VSPA) to determine requirements for transport. | | `Select agent` | This construct may be regulated by the US Federal Select Agent Program (FSAP). If the construct doesn''t meet requirements for registration with US FSAP, filing a Veterinary Services (VS) 16-3 Form may be required for import or interstate transport. | Review constructs associated with the US Federal Select Agent Program (FSAP) first to determine authority for transport. If this construct does not meet requirements for registration with US FSAP, use the VS Permitting Assistant (VSPA) to determine requirements for transport. | ' x-tagGroups: - name: Getting Started tags: - Authentication - name: API tags: - Endpoints - name: Reference tags: - Compliance Reason Codes