openapi: 3.0.1 info: license: name: Apache 2.0 url: http://www.apache.org/licenses/LICENSE-2.0.html title: Benchling AA Sequences Tasks API version: 2.0.0 description: 'AA Sequences are the working units of cells that make everything run (they help make structures, catalyze reactions and allow for signaling - a kind of internal cell communication). On Benchling, these are comprised of a string of amino acids and collections of other attributes, such as annotations. ' servers: - url: /api/v2 security: - oAuth: [] - basicApiKeyAuth: [] tags: - description: ' Endpoints that perform expensive computations launch long-running tasks. These endpoints return the task ID (a UUID) in the response body. After launching a task, periodically invoke the [Get a task](#/Tasks/getTask) endpoint with the task UUID (e.g., every 10 seconds), until the status is no longer RUNNING. You can access a task for up to 30 minutes after its completion, after which its data will no longer be available. ' name: Tasks paths: /tasks/{task_id}: get: description: Get a task by id operationId: getTask parameters: - description: UUID of the task example: f438d656-c2c3-40a4-b3fd-d7e58db78242 in: path name: task_id required: true schema: type: string responses: '200': content: application/json: examples: AA Sequences - Bulk Create: $ref: '#/components/examples/BulkOperateAaSequencesTaskResponse' AA Sequences - Bulk Update: $ref: '#/components/examples/BulkOperateAaSequencesTaskResponse' AA Sequences - Find Matching Region: $ref: '#/components/examples/AaSequencesFindMatchingRegionTaskResponse' Audit - Export Audit Log: $ref: '#/components/examples/AuditLogTaskResponse' Containers - Bulk Create: $ref: '#/components/examples/BulkOperateContainersTaskResponse' Containers - Bulk Update: $ref: '#/components/examples/BulkOperateContainersTaskResponse' Containers - Transfers: $ref: '#/components/examples/TransfersTaskResponse' Custom Entities - Bulk Create: $ref: '#/components/examples/BulkOperateCustomEntitiesTaskResponse' Custom Entities - Bulk Update: $ref: '#/components/examples/BulkOperateCustomEntitiesTaskResponse' DNA Alignments - Create Consensus Alignment: $ref: '#/components/examples/DnaCreateAlignmentTaskResponse' DNA Alignments - Create Template Alignment: $ref: '#/components/examples/DnaCreateAlignmentTaskResponse' DNA Oligos - Bulk Create: $ref: '#/components/examples/BulkOperateDnaOligosTaskResponse' DNA Oligos - Bulk Update: $ref: '#/components/examples/BulkOperateDnaOligosTaskResponse' DNA Sequences - Auto Annotate: $ref: '#/components/examples/EmptySuccessTaskResponse' DNA Sequences - Autofill Parts: $ref: '#/components/examples/EmptySuccessTaskResponse' DNA Sequences - Autofill Transcriptions: $ref: '#/components/examples/EmptySuccessTaskResponse' DNA Sequences - Autofill Translations: $ref: '#/components/examples/EmptySuccessTaskResponse' DNA Sequences - Bulk Create: $ref: '#/components/examples/BulkOperateDnaSequencesTaskResponse' DNA Sequences - Bulk Update: $ref: '#/components/examples/BulkOperateDnaSequencesTaskResponse' Exports - Export Item: $ref: '#/components/examples/ExportsTaskResponse' Features - Bulk Create: $ref: '#/components/examples/BulkOperateFeaturesTaskResponse' Lab Automation - Generate Input: $ref: '#/components/examples/AIGGenerateInputTaskResponse' Lab Automation - Process Output: $ref: '#/components/examples/AOPProcessOutputTaskResponse' RNA Oligos - Bulk Create: $ref: '#/components/examples/BulkOperateRnaOligosTaskResponse' RNA Oligos - Bulk Update: $ref: '#/components/examples/BulkOperateRnaOligosTaskResponse' RNA Sequences - Auto Annotate: $ref: '#/components/examples/EmptySuccessTaskResponse' RNA Sequences - Autofill Parts: $ref: '#/components/examples/EmptySuccessTaskResponse' RNA Sequences - Autofill Translations: $ref: '#/components/examples/EmptySuccessTaskResponse' RNA Sequences - Bulk Create: $ref: '#/components/examples/BulkOperateRnaSequencesTaskResponse' RNA Sequences - Bulk Update: $ref: '#/components/examples/BulkOperateRnaSequencesTaskResponse' Registry - Bulk Register Entities: $ref: '#/components/examples/EmptySuccessTaskResponse' Task Failed: $ref: '#/components/examples/TaskFailed' Task Failed (Bulk): $ref: '#/components/examples/BulkTaskFailed' Task Running: $ref: '#/components/examples/TaskRunning' schema: oneOf: - $ref: '#/components/schemas/AsyncTask' - $ref: '#/components/schemas/CreateTemplateAlignmentAsyncTask' - $ref: '#/components/schemas/CreateConsensusAlignmentAsyncTask' - $ref: '#/components/schemas/CreateNucleotideTemplateAlignmentAsyncTask' - $ref: '#/components/schemas/CreateNucleotideConsensusAlignmentAsyncTask' - $ref: '#/components/schemas/BulkCreateDnaSequencesAsyncTask' - $ref: '#/components/schemas/BulkUpdateDnaSequencesAsyncTask' - $ref: '#/components/schemas/BulkCreateRnaSequencesAsyncTask' - $ref: '#/components/schemas/BulkUpdateRnaSequencesAsyncTask' - $ref: '#/components/schemas/AutofillPartsAsyncTask' - $ref: '#/components/schemas/AutofillTranscriptionsAsyncTask' - $ref: '#/components/schemas/AutofillTranslationsAsyncTask' - $ref: '#/components/schemas/BulkRegisterEntitiesAsyncTask' - $ref: '#/components/schemas/BulkCreateDnaOligosAsyncTask' - $ref: '#/components/schemas/BulkUpdateDnaOligosAsyncTask' - $ref: '#/components/schemas/BulkCreateRnaOligosAsyncTask' - $ref: '#/components/schemas/BulkCreateAaSequencesAsyncTask' - $ref: '#/components/schemas/BulkCreateCustomEntitiesAsyncTask' - $ref: '#/components/schemas/BulkUpdateCustomEntitiesAsyncTask' - $ref: '#/components/schemas/BulkCreateContainersAsyncTask' - $ref: '#/components/schemas/BulkUpdateContainersAsyncTask' - $ref: '#/components/schemas/BulkUpdateAaSequencesAsyncTask' - $ref: '#/components/schemas/BulkUpdateRnaOligosAsyncTask' - $ref: '#/components/schemas/TransfersAsyncTask' - $ref: '#/components/schemas/AOPProcessOutputAsyncTask' - $ref: '#/components/schemas/AIGGenerateInputAsyncTask' - $ref: '#/components/schemas/ExportsAsyncTask' - $ref: '#/components/schemas/ExportAuditLogAsyncTask' - $ref: '#/components/schemas/BulkCreateFeaturesAsyncTask' - $ref: '#/components/schemas/FindMatchingRegionsAsyncTask' - $ref: '#/components/schemas/FindMatchingRegionsDnaAsyncTask' description: OK '404': content: application/json: schema: $ref: '#/components/schemas/NotFoundError' description: Not Found summary: Get a task by id tags: - Tasks components: schemas: Primer: properties: bases: readOnly: true type: string bindPosition: readOnly: true type: integer color: readOnly: true type: string end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer name: readOnly: true type: string oligoId: type: string overhangLength: readOnly: true type: integer start: description: 0-based inclusive start index. type: integer strand: example: 1 type: integer type: object DeprecatedContainerVolumeForResponse: allOf: - $ref: '#/components/schemas/ContainerQuantity' - description: 'The deprecated "volume" type key in API responses can also contain non-volume quantities for back-compatibility purposes. Use the "quantity" type key instead. ' ExperimentalWellRole: properties: group: type: integer primaryRole: enum: - SAMPLE - CONTROL - STANDARD - BLANK type: string subrole: nullable: true type: string type: object ArchiveRecord: properties: reason: example: Made in error type: string type: object BulkUpdateAaSequencesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: AaSequences: items: $ref: '#/components/schemas/AaSequence' type: array type: object type: object type: object CreateNucleotideTemplateAlignmentAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: $ref: '#/components/schemas/NucleotideAlignment' type: object type: object FieldType: enum: - dna_sequence_link - aa_sequence_link - custom_entity_link - entity_link - mixture_link - molecule_link - dropdown - part_link - translation_link - aa_part_link - base_molecule_link - blob_link - text - long_text - batch_link - storage_link - entry_link - assay_request_link - assay_result_link - assay_run_link - boolean - float - integer - datetime - date - json type: string MixtureWithEntityType: allOf: - $ref: '#/components/schemas/Mixture' - properties: entityType: enum: - mixture type: string type: object type: object NucleotideAlignmentSummary: properties: apiURL: description: The canonical url of the Alignment in the API. example: https://benchling.com/api/v2/alignments/seqanl_6ZVdX98t format: uri type: string createdAt: description: DateTime the Alignment was created format: date-time type: string id: example: seqanl_6ZVdX98t type: string modifiedAt: description: DateTime the Alignment was last modified format: date-time type: string name: type: string referenceSequenceId: description: The ID of the template or consensus Sequence associated with the Alignment example: seq_MYmsnS1u type: string webURL: description: The Benchling web UI url to view the Alignment format: uri type: string type: object ContainerLabels: properties: barcode: example: VIAL001 type: string id: example: cnt_12345 type: string name: example: My Container type: string type: object AutofillPartsAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: {} type: object type: object AaSequenceSummary: properties: entityType: enum: - aa_sequence type: string id: example: prtn_ObbdtGhC type: string type: deprecated: true type: string type: object DnaSequenceTranscription: properties: end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer sequenceId: description: Linked RNA sequence ID. example: seq_VfVOART1 type: string start: description: 0-based inclusive start index. type: integer strand: example: 1 maximum: 1 minimum: -1 type: integer type: object FeatureBase: properties: color: description: The color of the annotations generated by the feature. Must be a valid hex string example: '#F58A5E' type: string featureLibraryId: description: The id of the feature library the feature belongs to example: featlib_19kd9aDq type: string featureType: description: 'The type of feature, like gene, promoter, etc. Note: This is an arbitrary string, not an enum ' nullable: true type: string name: description: The name of the feature type: string pattern: description: The pattern used for matching during auto-annotation. type: string type: object BulkUpdateRnaOligosAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: rnaOligos: items: $ref: '#/components/schemas/RnaOligo' type: array type: object type: object type: object Batch: additionalProperties: false properties: archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true createdAt: description: DateTime at which the the result was created format: date-time readOnly: true type: string creator: allOf: - $ref: '#/components/schemas/UserSummary' readOnly: true defaultConcentration: $ref: '#/components/schemas/Measurement' entity: discriminator: mapping: aa_sequence: '#/components/schemas/AaSequenceSummary' custom_entity: '#/components/schemas/CustomEntitySummary' dna_sequence: '#/components/schemas/DnaSequenceSummary' propertyName: entityType oneOf: - $ref: '#/components/schemas/DnaSequenceSummary' - $ref: '#/components/schemas/AaSequenceSummary' - $ref: '#/components/schemas/CustomEntitySummary' fields: $ref: '#/components/schemas/Fields' id: example: bat_UOIr8IjL readOnly: true type: string modifiedAt: format: date-time readOnly: true type: string name: type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true readOnly: true title: SchemaProperty webURL: readOnly: true type: string type: object RnaSequenceWithEntityType: allOf: - $ref: '#/components/schemas/RnaSequence' - properties: entityType: enum: - rna_sequence type: string type: object type: object BulkCreateRnaSequencesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: rnaSequences: items: $ref: '#/components/schemas/RnaSequence' type: array type: object type: object type: object NotFoundError: properties: error: allOf: - $ref: '#/components/schemas/BaseError' - properties: invalidId: type: string type: enum: - invalid_request_error type: string type: object AutofillTranscriptionsAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: {} type: object type: object MixtureMeasurementUnits: enum: - nL - uL - mL - L - g - kg - mg - ug - Units example: L nullable: true type: string Container: properties: archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true readOnly: true barcode: nullable: true type: string checkoutRecord: allOf: - $ref: '#/components/schemas/CheckoutRecord' readOnly: true contents: items: $ref: '#/components/schemas/ContainerContent' readOnly: true type: array createdAt: format: date-time readOnly: true type: string creator: allOf: - $ref: '#/components/schemas/UserSummary' readOnly: true fields: $ref: '#/components/schemas/Fields' id: example: con_ZBL9QQWD readOnly: true type: string modifiedAt: format: date-time readOnly: true type: string name: type: string parentStorageId: nullable: true type: string parentStorageSchema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true readOnly: true projectId: nullable: true type: string quantity: $ref: '#/components/schemas/ContainerQuantity' restrictedSampleParties: items: anyOf: - $ref: '#/components/schemas/UserSummary' - $ref: '#/components/schemas/TeamSummary' type: array restrictionStatus: allOf: - $ref: '#/components/schemas/SampleRestrictionStatus' role: allOf: - $ref: '#/components/schemas/ExperimentalWellRole' nullable: true sampleOwners: items: anyOf: - $ref: '#/components/schemas/UserSummary' - $ref: '#/components/schemas/TeamSummary' type: array schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true readOnly: true volume: $ref: '#/components/schemas/DeprecatedContainerVolumeForResponse' webURL: readOnly: true type: string type: object BulkUpdateCustomEntitiesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: customEntities: items: $ref: '#/components/schemas/CustomEntity' type: array type: object type: object type: object AaSequence: properties: aliases: description: Array of aliases items: type: string type: array aminoAcids: description: Amino acids of the AA sequence. example: IKTATARRELAETSWTGDRLWGFSDNWAPALRRPSPSALGK type: string annotations: description: Array of annotation objects on the AA sequence. items: $ref: '#/components/schemas/AaAnnotation' type: array apiURL: description: The canonical url of the AA Sequence in the API. example: https://benchling.com/api/v2/aa-sequences/prtn_7nMBOMm0 format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array createdAt: description: DateTime the AA sequence was created. format: date-time readOnly: true type: string creator: $ref: '#/components/schemas/UserSummary' customFields: allOf: - $ref: '#/components/schemas/CustomFields' description: Custom fields set on the AA sequence. entityRegistryId: description: Registry ID of the AA sequence if registered. nullable: true type: string fields: $ref: '#/components/schemas/Fields' folderId: description: ID of the folder that contains the AA sequence. nullable: true type: string id: description: ID of the AA sequence. example: prtn_ObbdtGhC type: string length: description: Number of amino acids in the AA sequence. type: integer modifiedAt: description: DateTime the AA sequence was last modified. format: date-time readOnly: true type: string name: description: Name of the AA sequence. type: string registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: description: Registry the AA sequence is registered in. nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true url: description: The path of the web URL, omitting the tenant domain type: string webURL: description: URL of the AA sequence. example: https://benchling.com/benchling/f/lib_55UxcIps-registry/prtn_7nMBOMm0-kedchain11/edit" format: uri readOnly: true type: string type: object CustomEntity: properties: aliases: items: example: sBN000 type: string type: array apiURL: description: The canonical url of the Custom Entity in the API. example: https://benchling.com/api/v2/custom-entities/bfi_xCUXNVyG format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array createdAt: example: '2017-04-18T05:54:56.247545+00:00' format: date-time readOnly: true type: string creator: allOf: - $ref: '#/components/schemas/UserSummary' - readOnly: true customFields: $ref: '#/components/schemas/CustomFields' entityRegistryId: example: sBN000 nullable: true type: string fields: $ref: '#/components/schemas/Fields' folderId: example: lib_R8KcsjhW nullable: true type: string id: example: bfi_xCUXNVyG type: string modifiedAt: example: '2017-04-18T05:55:48.685345+00:00' format: date-time readOnly: true type: string name: example: sBN000 type: string registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: example: src_NetYd96a nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' example: id: ts_EM122lfJ name: Strain nullable: true url: description: The path of the web URL, omitting the tenant domain type: string webURL: example: https://benchling.com/benchling/f/R8KcsjhW-academic-registry/bfi-xCUXNVyG-sbn000/edit readOnly: true type: string type: object RnaOligoWithEntityType: allOf: - $ref: '#/components/schemas/RnaOligo' - properties: entityType: enum: - rna_oligo type: string type: object type: object TeamSummary: allOf: - type: object - properties: id: type: string name: type: string - example: id: team_5cjIguqc name: Elion's Team AaSequenceWithEntityType: allOf: - $ref: '#/components/schemas/AaSequence' - properties: entityType: enum: - aa_sequence type: string type: object type: object Blob: properties: id: description: The universally unique identifier (UUID) for the blob. example: c33fe52d-fe6a-4c98-adcd-211bdf6778f7 format: uuid type: string mimeType: description: eg. application/jpeg example: text/csv maxLength: 100 type: string name: description: Name of the blob example: MyInstrumentInputFile.csv maxLength: 1000 type: string type: description: 'One of RAW_FILE or VISUALIZATION. If VISUALIZATION, the blob may be displayed as an image preview. ' enum: - RAW_FILE - VISUALIZATION type: string uploadStatus: enum: - IN_PROGRESS - COMPLETE - ABORTED type: string type: object RnaSequencePart: allOf: - $ref: '#/components/schemas/NucleotideSequencePart' - properties: strand: example: 1 maximum: 1 minimum: 1 type: integer type: object CustomEntityWithEntityType: allOf: - $ref: '#/components/schemas/CustomEntity' - properties: entityType: enum: - custom_entity type: string type: object type: object CustomField: properties: value: type: string type: object AutomationOutputProcessor: allOf: - $ref: '#/components/schemas/AutomationFile' - properties: apiURL: description: The canonical url of the Automation Output Processor in the API. example: https://benchling.com/api/v2/automation-output-processors/aop_C3wGA9HF format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true completeWithErrors: description: Specifies whether file processing should complete with errors. False means any error in output file processing will result in no actions being committed. True means that if row-level errors occur, then failing rows and their errors will be saved to errorFile, and actions from successful rows will be committed. type: boolean createdAt: description: DateTime the Automation Output Processor was created format: date-time type: string errorFile: allOf: - $ref: '#/components/schemas/Blob' nullable: true id: example: aop_C3wGA9HF type: string modifiedAt: description: DateTime the Automation Output Processor was last modified format: date-time type: string progressStats: $ref: '#/components/schemas/AutomationProgressStats' transforms: items: allOf: - $ref: '#/components/schemas/LabAutomationTransform' nullable: true type: array type: object EntityOrInaccessibleResource: oneOf: - $ref: '#/components/schemas/Entity' - $ref: '#/components/schemas/InaccessibleResource' type: object SequenceFeatureCustomField: description: A name and value pair associated with a sequence feature (annotation or translation). For genbank imports, these are the qualifiers associated with each feature. properties: name: description: Name of the custom field type: string value: description: Value of the custom field type: string type: object Entity: discriminator: mapping: aa_sequence: '#/components/schemas/AaSequenceWithEntityType' custom_entity: '#/components/schemas/CustomEntityWithEntityType' dna_oligo: '#/components/schemas/DnaOligoWithEntityType' dna_sequence: '#/components/schemas/DnaSequenceWithEntityType' mixture: '#/components/schemas/MixtureWithEntityType' molecule: '#/components/schemas/MoleculeWithEntityType' rna_oligo: '#/components/schemas/RnaOligoWithEntityType' rna_sequence: '#/components/schemas/RnaSequenceWithEntityType' propertyName: entityType oneOf: - $ref: '#/components/schemas/DnaSequenceWithEntityType' - $ref: '#/components/schemas/RnaSequenceWithEntityType' - $ref: '#/components/schemas/AaSequenceWithEntityType' - $ref: '#/components/schemas/MixtureWithEntityType' - $ref: '#/components/schemas/DnaOligoWithEntityType' - $ref: '#/components/schemas/RnaOligoWithEntityType' - $ref: '#/components/schemas/MoleculeWithEntityType' - $ref: '#/components/schemas/CustomEntityWithEntityType' type: object AaAnnotation: properties: color: type: string end: description: 0-based exclusive end index. The end of the AA sequence is always represented as 0. type: integer id: example: prtnann_o7zMPG0P type: string name: maxLength: 255 type: string notes: example: Cong et al Science. 2013 Jan 3. maxLength: 10000 type: string start: description: 0-based inclusive start index. type: integer type: example: Site maxLength: 255 type: string type: object SampleRestrictionStatus: enum: - RESTRICTED - UNRESTRICTED - NOT_APPLICABLE type: string SequenceFeatureBase: properties: color: description: Hex color code used when displaying this feature in the UI. example: '#F58A5E' type: string customFields: items: $ref: '#/components/schemas/SequenceFeatureCustomField' maxItems: 100 type: array name: maxLength: 2048 type: string notes: example: Cong et al Science. 2013 Jan 3. maxLength: 10000 type: string type: object IngredientMeasurementUnits: enum: - nL - uL - mL - L - mg - g - kg - ug - Units - Cells - mol - mmol - umol example: mL nullable: true type: string AOPProcessOutputAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: $ref: '#/components/schemas/AutomationOutputProcessor' type: object type: object CreateTemplateAlignmentAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: $ref: '#/components/schemas/DnaAlignment' type: object type: object BulkCreateFeaturesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: features: items: $ref: '#/components/schemas/Feature' type: array type: object type: object type: object CustomEntitySummary: properties: entityType: enum: - custom_entity type: string id: example: bfi_xCUXNVyG type: string type: deprecated: true type: string type: object Feature: allOf: - $ref: '#/components/schemas/FeatureBase' - properties: id: description: The id of the feature example: feat_4YVqX98z type: string matchType: description: The match type of the feature. Used to determine how auto-annotate matches are made. enum: - nucleotide - protein type: string description: A feature from a feature library type: object BulkRegisterEntitiesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: {} type: object type: object RnaSequence: properties: aliases: items: type: string type: array alignmentIds: description: API IDs of Nucleotide Alignments involving the RNA sequence items: type: string type: array annotations: items: $ref: '#/components/schemas/RnaAnnotation' type: array apiURL: description: The canonical url of the RNA Sequence in the API. example: https://benchling.com/api/v2/rna-sequences/seq_asZya4lk format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array bases: type: string createdAt: format: date-time readOnly: true type: string creator: $ref: '#/components/schemas/UserSummary' customFields: $ref: '#/components/schemas/CustomFields' customNotation: description: Representation of the RNA Sequence in the custom notation specified in the request. Null if no notation was specified. nullable: true type: string customNotationName: description: Name of the custom notation specified in the request. Null if no notation was specified. nullable: true type: string entityRegistryId: nullable: true type: string fields: $ref: '#/components/schemas/Fields' folderId: nullable: true type: string helm: description: Representation of the RNA Sequence in HELM syntax, including any chemical modifications. example: RNA1{r(A)p.r(C)[Ssp].r(U)p.r(U)p.r(U)p.r(U)p.r(U)p}$$$$V2.0 nullable: true type: string id: type: string isCircular: example: false type: boolean length: type: integer modifiedAt: format: date-time readOnly: true type: string name: type: string parts: items: $ref: '#/components/schemas/RnaSequencePart' type: array primers: items: $ref: '#/components/schemas/Primer' type: array registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true translations: items: $ref: '#/components/schemas/Translation' type: array url: description: The path of the web URL, omitting the tenant domain type: string webURL: readOnly: true type: string type: object RnaAnnotation: allOf: - $ref: '#/components/schemas/SequenceFeatureBase' - properties: end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer start: description: 0-based inclusive start index. type: integer strand: example: 1 maximum: 1 minimum: 0 type: integer type: type: string type: object ContainerContent: properties: batch: allOf: - $ref: '#/components/schemas/BatchOrInaccessibleResource' nullable: true concentration: $ref: '#/components/schemas/Measurement' entity: allOf: - $ref: '#/components/schemas/EntityOrInaccessibleResource' nullable: true type: object DnaSequence: properties: aliases: items: type: string type: array annotations: items: $ref: '#/components/schemas/DnaAnnotation' type: array apiURL: description: The canonical url of the DNA Sequence in the API. example: https://benchling.com/api/v2/dna-sequences/seq_asQya4lk format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array bases: type: string createdAt: format: date-time readOnly: true type: string creator: $ref: '#/components/schemas/UserSummary' customFields: $ref: '#/components/schemas/CustomFields' dnaAlignmentIds: description: API IDs of Nucleotide Alignments involving the RNA sequence items: type: string type: array entityRegistryId: nullable: true type: string fields: $ref: '#/components/schemas/Fields' folderId: nullable: true type: string id: type: string isCircular: type: boolean length: type: integer modifiedAt: format: date-time readOnly: true type: string name: type: string parts: items: $ref: '#/components/schemas/DnaSequencePart' type: array primers: items: $ref: '#/components/schemas/Primer' type: array registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true transcriptions: items: $ref: '#/components/schemas/DnaSequenceTranscription' type: array translations: items: $ref: '#/components/schemas/Translation' type: array url: description: The path of the web URL, omitting the tenant domain type: string webURL: readOnly: true type: string type: object AlignedSequence: properties: bases: example: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG type: string dnaSequenceId: deprecated: true example: seq_MYmsnS1u nullable: true type: string name: example: Gene001 type: string pairwiseIdentity: description: 'Fraction of bases between trimStart and trimEnd that match the template bases. Only present for Template Alignments; Will be empty for Consensus Alignments. ' example: 0.505 format: float type: number sequenceId: example: seq_MYmsnS1u nullable: true type: string trimEnd: example: 60 type: integer trimStart: example: 0 type: integer type: object SchemaSummary: properties: id: type: string name: type: string type: object Molecule: additionalProperties: false properties: aliases: description: Array of aliases. items: type: string type: array apiURL: description: The canonical url of the Molecule in the API. format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array canonicalizedSmiles: description: The canonicalized chemical structure in SMILES format. example: Nc1nc(=O)n([H])cc1C1CC1 type: string createdAt: description: DateTime the Molecule was created. format: date-time readOnly: true type: string creator: $ref: '#/components/schemas/UserSummary' customFields: allOf: - $ref: '#/components/schemas/CustomFields' description: Custom fields set on the Molecule. entityRegistryId: description: Registry ID of the Molecule if registered. nullable: true type: string fields: $ref: '#/components/schemas/Fields' folderId: description: ID of the folder that contains the Molecule. nullable: true type: string id: description: ID of the Molecule. example: mol_bhuDUw9D type: string modifiedAt: description: DateTime the Molecule was last modified. format: date-time readOnly: true type: string name: description: Name of the Molecule. type: string originalSmiles: description: The original chemical structure supplied by the user in SMILES format. Null if the user did not originally supply SMILES. example: Nc1nc(=O)n([H])cc1C1CC1 nullable: true type: string registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: description: Registry the Molecule is registered in. nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true webURL: description: URL of the Molecule. example: https://benchling.com/benchling/f/lib_R8KcsjhW-molecules/mol_xCUXNVyG-molecule1/edit format: uri readOnly: true type: string type: object BulkCreateAaSequencesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: aaSequences: items: $ref: '#/components/schemas/AaSequence' type: array type: object type: object type: object DnaSequenceWithEntityType: allOf: - $ref: '#/components/schemas/DnaSequence' - properties: entityType: enum: - dna_sequence type: string type: object type: object ContainerQuantity: description: Quantity of a container, well, or transfer. Supports mass, volume, and other quantities. properties: units: enum: - L - mL - uL - nL - pL - gal (US) - qt (US) - pt (US) - kg - g - mg - ug - ng - pg - lb - oz - mol - mmol - umol - nmol - pmol - cells - (x10^3) cells - (x10^4) cells - (x10^5) cells - (x10^6) cells - (x10^7) cells - (x10^8) cells - (x10^9) cells - items - units - null example: mL nullable: true type: string value: example: 10 nullable: true type: number type: object Fields: additionalProperties: $ref: '#/components/schemas/Field' type: object BulkCreateDnaSequencesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: dnaSequences: items: $ref: '#/components/schemas/DnaSequence' type: array type: object type: object type: object NucleotideAlignment: allOf: - $ref: '#/components/schemas/NucleotideAlignmentSummary' - properties: alignedSequences: items: $ref: '#/components/schemas/AlignedNucleotideSequence' type: array type: object type: object BulkCreateRnaOligosAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: rnaOligos: items: $ref: '#/components/schemas/RnaOligo' type: array type: object type: object type: object Measurement: properties: units: description: Can only be null if value is also null nullable: true type: string value: description: Can only be null if units is also null nullable: true type: number required: - value - units type: object NucleotideSequencePart: properties: end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer sequenceId: example: seq_VfVOART1 type: string start: description: 0-based inclusive start index. type: integer type: object DnaOligoWithEntityType: allOf: - $ref: '#/components/schemas/DnaOligo' - properties: entityType: enum: - dna_oligo type: string type: object type: object ExportsAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: additionalProperties: false properties: downloadURL: format: uri type: string type: object type: object type: object BaseError: properties: message: type: string type: type: string userMessage: type: string type: object RnaOligo: allOf: - $ref: '#/components/schemas/Oligo' - properties: annotations: description: Annotations on the Oligo. items: $ref: '#/components/schemas/RnaAnnotation' type: array apiURL: example: https://benchling.com/api/v2/rna-oligos/seq_bhuDUw9D type: string bases: example: ACUUUUU type: string customNotation: description: Representation of the oligo in the custom notation specified in the request. Null if no notation was specified. nullable: true type: string customNotationName: description: Name of the custom notation specified in the request. Null if no notation was specified. nullable: true type: string helm: description: Representation of the oligo in HELM syntax, including any chemical modifications example: RNA1{r(A)p.r(C)[Ssp].r(U)p.r(U)p.r(U)p.r(U)p.r(U)p}$$$$V2.0 type: string nucleotideType: example: RNA type: string FindMatchingRegionsAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: aaSequenceMatches: items: properties: matchingAASequenceIds: items: type: string type: array targetAASequenceId: type: string type: object type: array type: object type: object type: object BulkCreateContainersAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: containers: items: $ref: '#/components/schemas/Container' type: array type: object type: object type: object AIGGenerateInputAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: $ref: '#/components/schemas/AutomationInputGenerator' type: object type: object MoleculeWithEntityType: allOf: - $ref: '#/components/schemas/Molecule' - properties: entityType: enum: - molecule type: string type: object type: object PartySummary: properties: handle: type: string id: type: string name: type: string type: object DnaSequencePart: allOf: - $ref: '#/components/schemas/NucleotideSequencePart' - properties: strand: example: 1 maximum: 1 minimum: -1 type: integer type: object CheckoutRecord: description: ' *assignee field* is set if status is "RESERVED" or "CHECKED_OUT", or null if status is "AVAILABLE". *comment field* is set when container was last reserved, checked out, or checked into. *modifiedAt field* is the date and time when container was last checked out, checked in, or reserved ' properties: assignee: nullable: true oneOf: - $ref: '#/components/schemas/UserSummary' - $ref: '#/components/schemas/TeamSummary' comment: type: string modifiedAt: format: date-time type: string status: enum: - AVAILABLE - RESERVED - CHECKED_OUT type: string type: object CustomFields: additionalProperties: $ref: '#/components/schemas/CustomField' example: Legacy ID: value: STR100 type: object AlignedNucleotideSequence: properties: bases: example: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG type: string dnaSequenceId: deprecated: true example: seq_MYmsnS1u nullable: true type: string name: example: Gene001 type: string pairwiseIdentity: description: 'Fraction of bases between trimStart and trimEnd that match the template bases. Only present for Template Alignments; Will be empty for Consensus Alignments. ' example: 0.505 format: float type: number sequenceId: example: seq_MYmsnS1u nullable: true type: string trimEnd: example: 60 type: integer trimStart: example: 0 type: integer type: object AutomationFile: properties: assayRunId: example: 588aca02-1a20-4b94-a40f-b3f3a0081749 type: string automationFileConfig: properties: name: example: MyInstrumentName type: string type: object file: allOf: - $ref: '#/components/schemas/Blob' nullable: true id: type: string status: enum: - SUCCEEDED - FAILED - NOT_STARTED - RUNNING type: string type: object AutomationInputGenerator: allOf: - $ref: '#/components/schemas/AutomationFile' - properties: apiURL: description: The canonical url of the Automation Input Generator in the API. example: https://benchling.com/api/v2/automation-input-generators/aif_C3wGA9HF format: uri readOnly: true type: string createdAt: description: DateTime the Automation Input Generator was last modified format: date-time readOnly: true type: string id: example: aif_C3wGA9HF type: string modifiedAt: description: DateTime the Automation Input Generator was last modified format: date-time readOnly: true type: string transforms: items: allOf: - $ref: '#/components/schemas/LabAutomationTransform' nullable: true type: array type: object InaccessibleResource: additionalProperties: false properties: inaccessibleId: type: string resourceType: enum: - inaccessible_resource type: string type: description: 'The type of this inaccessible item. Example values: "custom_entity", "container", "plate", "dna_sequence" ' example: custom_entity type: string type: object EntityLabels: properties: entityRegistryId: example: REAG000 nullable: true type: string id: example: bfi_12345 type: string name: example: Deionized Water type: string type: object LabAutomationTransform: properties: apiURL: description: The canonical url of the transform in the API. format: uri readOnly: true type: string blobId: format: uuid nullable: true type: string customTransformId: format: uuid nullable: true type: string errors: $ref: '#/components/schemas/LabAutomationBenchlingAppErrors' id: type: string inputGeneratorId: nullable: true type: string modifiedAt: description: DateTime the transform was last modified. format: date-time readOnly: true type: string outputProcessorId: nullable: true type: string status: enum: - NOT_STARTED - RUNNING - FAILED - SUCCEEDED type: string type: object BulkUpdateDnaSequencesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: dnaSequences: items: $ref: '#/components/schemas/DnaSequence' type: array type: object type: object type: object FindMatchingRegionsDnaAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: dnaSequenceMatches: items: properties: matchingDnaSequenceIds: items: type: string type: array targetDnaSequenceId: type: string type: object type: array type: object type: object type: object CreateNucleotideConsensusAlignmentAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: $ref: '#/components/schemas/NucleotideAlignment' type: object type: object BulkCreateDnaOligosAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: dnaOligos: items: $ref: '#/components/schemas/DnaOligo' type: array type: object type: object type: object AutofillTranslationsAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: {} type: object type: object DnaAnnotation: allOf: - $ref: '#/components/schemas/SequenceFeatureBase' - properties: end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer start: description: 0-based inclusive start index. type: integer strand: maximum: 1 minimum: -1 type: integer type: type: string type: object DnaOligo: allOf: - $ref: '#/components/schemas/Oligo' - properties: annotations: description: Annotations on the Oligo. items: $ref: '#/components/schemas/DnaAnnotation' type: array apiURL: example: https://benchling.com/api/v2/dna-oligos/seq_bhuDUw9D type: string bases: example: ACTTTTT type: string customNotation: description: Representation of the oligo in the custom notation specified in the request. Null if no notation was specified. nullable: true type: string customNotationName: description: Name of the custom notation specified in the request. Null if no notation was specified. nullable: true type: string helm: description: Representation of the oligo in HELM syntax, including any chemical modifications example: RNA1{d(A)p.d(C)[Ssp].d(T)p.d(T)p.d(T)p.d(T)p.d(T)p}$$$$V2.0 type: string DnaAlignmentSummary: properties: apiURL: description: The canonical url of the DNA Alignment in the API. example: https://benchling.com/api/v2/dna-alignments/seqanl_6ZVdX98t format: uri type: string createdAt: description: DateTime the DNA Alignment was created format: date-time type: string id: example: seqanl_6ZVdX98t type: string modifiedAt: description: DateTime the DNA Alignment was last modified format: date-time type: string name: type: string referenceSequenceId: description: The ID of the template or consensus DNA Sequence associated with the DNA Alignment example: seq_MYmsnS1u type: string webURL: description: The Benchling web UI url to view the DNA Alignment format: uri type: string type: object TransfersAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: destinationContainers: items: $ref: '#/components/schemas/Container' type: array type: object type: object type: object UserSummary: allOf: - $ref: '#/components/schemas/PartySummary' - example: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur Mixture: properties: aliases: items: example: FRM000 type: string type: array allowMeasuredIngredients: description: Derived from the mixture's schema. readOnly: true type: boolean amount: description: The positive numerical amount value of this mixture in string format (to preserve full precision). Pair with `units`. Supports scientific notation (1.23e4). example: '123' type: string apiURL: description: The canonical url of the Mixture in the API. example: https://benchling.com/api/v2/mixtures/mxt_xCUXNVyG format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array createdAt: example: '2017-04-18T05:54:56.247545+00:00' format: date-time readOnly: true type: string creator: allOf: - $ref: '#/components/schemas/UserSummary' - readOnly: true customFields: $ref: '#/components/schemas/CustomFields' entityRegistryId: example: FRM000 nullable: true type: string fields: allOf: - $ref: '#/components/schemas/Fields' description: Mixtures can have up to one parent mixture field. folderId: example: lib_R8KcsjhW nullable: true type: string id: example: mxt_xCUXNVyG type: string ingredients: description: List of ingredients on this mixture. items: $ref: '#/components/schemas/Ingredient' type: array modifiedAt: example: '2017-04-18T05:55:48.685345+00:00' format: date-time readOnly: true type: string name: example: FRM000 type: string registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: example: src_NetYd96a nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' example: id: ts_EM122lfJ name: Prep units: $ref: '#/components/schemas/MixtureMeasurementUnits' webURL: example: https://benchling.com/benchling/f/R8KcsjhW-academic-registry/mxt-xCUXNVyG-sbn000/edit readOnly: true type: string type: object DnaSequenceSummary: properties: entityType: enum: - dna_sequence type: string id: example: seq_ObbdtGhC type: string type: deprecated: true type: string type: object Translation: allOf: - $ref: '#/components/schemas/SequenceFeatureBase' - properties: aminoAcids: readOnly: true type: string coerceStartCodonToMethionine: default: false description: Whether to override the translation of the start codon to Methionine. Has no effect when the start codon already translates to Methionine. type: boolean end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer geneticCode: default: STANDARD description: The genetic code to use when translating the nucleotide sequence into amino acids. enum: - STANDARD - VERTEBRATE_MITOCHONDRIAL - YEAST_MITOCHONDRIAL - MOLD_PROTOZOAN_COELENTERATE_MITOCHONDRIAL_MYCOPLASMA_SPIROPLASMA - INVERTEBRATE_MITOCHONDRIAL - CILIATE_DASYCLADACEAN_HEXAMITA_NUCLEAR - ECHINODERM_FLATWORM_MITOCHONDRIAL - EUPLOTID_NUCLEAR - BACTERIAL_ARCHAEAL_PLANT_PLASTID - ALTERNATIVE_YEAST_NUCLEAR - ASCIDIAN_MITOCHONDRIAL - ALTERNATIVE_FLATWORM_MITOCHONDRIAL - CHLOROPHYCEAN_MITOCHONDRIAL - TREMATODE_MITOCHONDRIAL - SCENEDESMUS_OBLIQUUS_MITOCHONDRIAL - THRAUSTOCHYTRIUM_MITOCHONDRIAL - RHABDOPLEURIDAE_MITOCHONDRIAL - CANDIDATE_DIVISION_SR1_GRACILIBACTERIA - PACHYSOLEN_TANNOPHILUS_NUCLEAR - MESODINIUM_NUCLEAR - PERITRICH_NUCLEAR - CEPHALODISCIDAE_MITOCHONDRIAL_UAA_TYR type: string regions: items: properties: end: description: 0-based exclusive end index. The end of the sequence is always represented as 0. type: integer start: description: 0-based inclusive start index. type: integer type: object type: array start: description: 0-based inclusive start index. type: integer strand: example: 1 type: integer type: object Field: properties: displayValue: nullable: true readOnly: true type: string isMulti: readOnly: true type: boolean textValue: example: Amp nullable: true readOnly: true type: string type: allOf: - $ref: '#/components/schemas/FieldType' readOnly: true value: description: 'For single link fields, use the id of the item you want to link (eg. "seq_jdf8BV24"). For multi-link fields, use an array of ids of the items you want to link (eg. ["seq_jdf8BV24"]) ' nullable: true oneOf: - type: string - type: boolean - type: number - type: object - items: type: string type: array required: - value type: object AsyncTask: properties: errors: oneOf: - description: 'Present only when status is FAILED for a bulk task. Contains information about the individual errors in the bulk task. ' items: type: object type: array - description: 'Present only when status is FAILED for a bulk task. Contains information about the individual errors in the bulk task. ' type: object message: description: Present only when status is FAILED. Contains information about the error. type: string response: description: Present only when status is SUCCEEDED. response can be empty if there is no data to be returned. type: object status: description: The current state of the task. enum: - RUNNING - SUCCEEDED - FAILED type: string required: - status type: object AutomationProgressStats: description: Processing progress information. properties: rowsFailed: type: integer rowsSucceeded: type: integer rowsUnprocessed: type: integer type: object BatchOrInaccessibleResource: oneOf: - $ref: '#/components/schemas/Batch' - $ref: '#/components/schemas/InaccessibleResource' DnaAlignment: allOf: - $ref: '#/components/schemas/DnaAlignmentSummary' - properties: alignedSequences: items: $ref: '#/components/schemas/AlignedSequence' type: array type: object type: object LabAutomationBenchlingAppErrors: properties: topLevelErrors: items: properties: errorMessage: type: string type: object type: array type: object Oligo: discriminator: mapping: DNA: DnaOligo RNA: RnaOligo propertyName: nucleotideType properties: aliases: description: Array of aliases items: type: string type: array apiURL: description: The canonical url of the Oligo in the API. format: uri readOnly: true type: string archiveRecord: allOf: - $ref: '#/components/schemas/ArchiveRecord' nullable: true authors: items: $ref: '#/components/schemas/UserSummary' type: array bases: description: Base pairs of the Oligo. example: ACTTTTT type: string createdAt: description: DateTime the Oligo was created. format: date-time readOnly: true type: string creator: $ref: '#/components/schemas/UserSummary' customFields: allOf: - $ref: '#/components/schemas/CustomFields' description: Custom fields set on the Oligo. entityRegistryId: description: Registry ID of the Oligo if registered. nullable: true type: string fields: $ref: '#/components/schemas/Fields' folderId: description: ID of the folder that contains the Oligo. nullable: true type: string id: description: ID of the Oligo. example: seq_bhuDUw9D type: string length: description: Number of bases in the Oligo. type: integer modifiedAt: description: DateTime the Oligo was last modified. format: date-time readOnly: true type: string name: description: Name of the Oligo. type: string nucleotideType: description: Nucleotide type of the Oligo. enum: - DNA - RNA type: string registrationOrigin: allOf: - $ref: '#/components/schemas/RegistrationOrigin' nullable: true readOnly: true registryId: description: Registry the Oligo is registered in. nullable: true type: string schema: allOf: - $ref: '#/components/schemas/SchemaSummary' nullable: true webURL: description: URL of the Oligo. example: https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit format: uri readOnly: true type: string type: object ExportAuditLogAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: additionalProperties: false properties: downloadURL: format: uri type: string type: object type: object type: object RegistrationOrigin: properties: originEntryId: nullable: true readOnly: true type: string registeredAt: format: date-time readOnly: true type: string type: object BulkUpdateContainersAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: containers: items: $ref: '#/components/schemas/Container' type: array type: object type: object type: object BulkUpdateRnaSequencesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: rnaSequences: items: $ref: '#/components/schemas/RnaSequence' type: array type: object type: object type: object BulkUpdateDnaOligosAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: dnaOligos: items: $ref: '#/components/schemas/DnaOligo' type: array type: object type: object type: object CreateConsensusAlignmentAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: $ref: '#/components/schemas/DnaAlignment' type: object type: object Ingredient: properties: amount: description: 'The amount value of this ingredient in its mixture, in string format (to preserve full precision). Pair with `units`. Supports scientific notation (1.23e4). One ingredient on this mixture can have an amount value of `"QS"`. ' example: '12' nullable: true type: string catalogIdentifier: example: DION_004 nullable: true type: string componentEntity: allOf: - $ref: '#/components/schemas/EntityLabels' - description: The entity that uniquely identifies this component. componentLotContainer: allOf: - $ref: '#/components/schemas/ContainerLabels' description: The container representing the component lot for this ingredient. This is only present if the mixture schema supports component lots in "inventory" format. nullable: true componentLotEntity: allOf: - $ref: '#/components/schemas/EntityLabels' description: The entity representing the component lot for this ingredient. This is only present if the mixture schema supports component lots in "inventory" format. nullable: true componentLotText: description: Text representing the component lot for this ingredient. This is only present if the mixture schema supports component lots in "text" format. example: DION_004-source_001 nullable: true type: string hasParent: type: boolean notes: nullable: true type: string targetAmount: description: The target amount for this ingredient such that this ingredient's proportion in its mixture would preserve the equivalent ingredient's proportion in the parent mixture. Pair with `units`. example: '123' nullable: true readOnly: true type: string units: $ref: '#/components/schemas/IngredientMeasurementUnits' type: object BulkCreateCustomEntitiesAsyncTask: allOf: - $ref: '#/components/schemas/AsyncTask' - additionalProperties: false properties: response: properties: customEntities: items: $ref: '#/components/schemas/CustomEntity' type: array type: object type: object type: object examples: AaSequencesFindMatchingRegionTaskResponse: value: response: aaSequenceMatches: - matchingAASequenceIds: - prtn_TIIi7lto - prtn_0qTaIIDE targetAASequenceId: prtn_W1Qh8teE status: SUCCEEDED DnaCreateAlignmentTaskResponse: value: response: alignedSequences: - bases: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG dnaSequenceId: seq_MYmsnS1u name: Gene001 sequenceId: seq_MYmsnS1u trimEnd: 60 trimStart: 0 apiURL: https://benchling.com/api/v2/dna-alignments/seqanl_6ZVdX98t createdAt: '2021-07-13T12:59:51.903Z' id: seqanl_6ZVdX98t modifiedAt: '2021-07-13T12:59:51.903Z' name: Example alignment webURL: https://benchling.com/benchling/f/lib_Fy2C0HOl-example/seq_UpzwvUug-consensus/edit?alignment=seqanl_6ZVdX98t status: SUCCEEDED BulkOperateCustomEntitiesTaskResponse: value: response: customEntities: - aliases: - sBN000 apiURL: https://benchling.com/api/v2/custom-entities/bfi_xCUXNVyG archiveRecord: reason: Made in error authors: - handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur createdAt: '2021-07-14T07:34:25.156Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: prtn_ObbdtGhC modifiedAt: '2021-07-14T07:34:25.157Z' name: sBN000 registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-14T07:34:25.157Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema webURL: https://benchling.com/benchling/f/R8KcsjhW-academic-registry/bfi-xCUXNVyG-sbn000/edit status: SUCCEEDED BulkOperateAaSequencesTaskResponse: value: response: aaSequences: - aliases: - Example alias aminoAcids: IKTATARRELAETSWTGDRLWGFSDNWAPALRRPSPSALGK annotations: - color: '#85DAE9' end: 10 id: prtnann_o7zMPG0P name: Example annotation start: 0 apiURL: https://benchling.com/api/v2/aa-sequences/prtn_7nMBOMm0 archiveRecord: reason: Made in error createdAt: '2021-07-14T07:34:25.156Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: prtn_ObbdtGhC length: 0 modifiedAt: '2021-07-14T07:34:25.157Z' name: Example AA Sequence registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-14T07:34:25.157Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema webURL: https://benchling.com/benchling/f/lib_55UxcIps-registry/prtn_7nMBOMm0-kedchain11/edit" status: SUCCEEDED BulkOperateDnaSequencesTaskResponse: value: response: dnaSequences: - aliases: - Example alias annotations: - color: '#85DAE9' end: 10 name: Example annotation start: 0 strand: 0 type: Example annotation type apiURL: https://benchling.com/api/v2/dna-sequences/seq_asQya4lk archiveRecord: reason: Made in error bases: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG createdAt: '2021-07-13T13:16:44.315Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: - additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: seq_asQya4lk isCircular: true length: 0 modifiedAt: '2021-07-13T13:16:44.315Z' name: Example sequence primers: - bases: CATCG bindPosition: 0 color: '#F58A5E' end: 5 name: Example primer oligoId: seq_HJyE332n overhangLength: 0 start: 0 strand: -1 registrationOrigin: originEntryId: ent_a0SApq3z registeredAt: '2021-07-13T13:16:44.315Z' registryId: src_ae40j3TZ schema: id: ts_n4l12nf0 name: Example schema translations: - aminoAcids: KK end: 0 regions: - end: 0 start: 0 start: 0 strand: 1 webURL: https://benchling.com/benchling/f/lib_zky83cLg-computed-fields/seq_mnY8u4bs-chain-1/edit status: SUCCEEDED TaskRunning: value: status: RUNNING BulkOperateContainersTaskResponse: value: response: containers: - archiveRecord: reason: Made in error barcode: 201006-005 checkoutRecord: assignee: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur comment: Example comment modifiedAt: '2021-07-14T12:27:27.917Z' status: AVAILABLE contents: - batch: archiveRecord: reason: Made in error createdAt: '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur entity: aliases: - Example alias annotations: [] apiURL: https://benchling.com/api/v2/dna-sequences/seq_asQya4lk archiveRecord: reason: Made in error bases: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG createdAt: '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_hBHqKbzE id: seq_bhuDUw9D isCircular: true length: 0 modifiedAt: '2021-07-14T12:27:27.917Z' name: Example entity primers: [] registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-14T07:34:25.157Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema translations: [] webURL: https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 id: bat_UOIr8IjL modifiedAt: '2021-07-14T12:27:27.917Z' name: Example Batch schema: id: ts_DaiFhsNA name: Example Schema webURL: https://benchling.com/benchling/f/lib_55UxcIps-registry/bfi_YtegMKkT-batch-test/edit concentration: units: uM value: 5 entity: aliases: - Example alias annotations: [] apiURL: https://benchling.com/api/v2/dna-sequences/seq_asQya4lk archiveRecord: reason: Made in error bases: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG createdAt: '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: seq_bhuDUw9D isCircular: true length: 0 modifiedAt: '2021-07-14T12:27:27.917Z' name: Example entity primers: [] registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-14T07:34:25.157Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema translations: [] webURL: https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit createdAt": '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 id: con_ZBL9QQWD modifiedAt: '2021-07-14T12:27:27.917Z' name: Example container parentStorageId: loc_MmtNUQIA parentStorageSchema: id: locsch_ToRk7Elm name: Building projectId: src_1m4443Ek quantity: units: mL value: 10 schema: id: ts_DaiFhsNA name: Example Schema volume: units: mL value: 10 webURL: https://benchling.com/samples/containers/con_FzQ1stz9 status: SUCCEEDED AuditLogTaskResponse: value: response: downloadURL: https://benchling-temp.s3.amazonaws.com/exports/dHJgG40awwbze7a6jhaoShaqwGGpgyb1atUD4f16/entry_audit_log_etr_Fr35NTqk_doe_04Dec2024.csv?response-content-disposition=attachment&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=ASIASZPD3ICD3FJP5KAL%2F20241204%2Fus-west-2%2Fs3%2Faws4_request&X-Amz-Date=20241204T194928Z&X-Amz-Expires=86400&X-Amz-SignedHeaders=host&X-Amz-Security-Token=IQo...&X-Amz-Signature=5ce237d862201e1bba540fac126852f4b1568cfa829d59618c80370a4fa58931 status: SUCCEEDED EmptySuccessTaskResponse: value: response: {} status: SUCCEEDED BulkOperateRnaOligosTaskResponse: value: response: rnaOligos: - aliases: - Example alias apiURL: https://benchling.com/api/v2/rna-oligos/seq_bhuDUw9 archiveRecord: reason: Made in error bases: ACUUUUU createdAt: '2021-07-13T21:00:49.245Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: seq_bhuDUw9D length: 0 modifiedAt: '2021-07-13T21:00:49.245Z' name: Example RNA Oligo nucleotideType: DNA registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-13T21:00:49.245Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema webURL: https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit status: SUCCEEDED ExportsTaskResponse: value: response: downloadURL: https://benchling-temp.s3.amazonaws.com/benchling-temp/RShkPPS0dj1jsn1LKnbpl7mz421kne52Ndp8UJnB/capillary/export_items/etr_HzOyiNj8.zip?response-content-disposition=attachment&X-Amz-Algorithm=AWS4-HMAC-SHA256&X-Amz-Credential=ASIAVNBDYFYCFXORLN46%2F20210714%2Fus-east-1%2Fs3%2Faws4_request&X-Amz-Date=20210714T144850Z&X-Amz-Expires=86400&X-Amz-SignedHeaders=host&X-Amz-Security-Token=IQoJb3JpZ2luX2VjEB4aCXVzLWVhc3QtMSJSDNU1IHZ81FpESNaiQLue6l%2Bjz04FWk7fNUhMxiEbLYCt5LDNAiEAhNbTM9EdeAuxlj4svhS01NmwRJZTyF3Bjzr%2BhK22ACcq%2BQMIFxAAGrebNzE1ODk2NTYwNjgiDHKa3fq33iZwsM1KdCrWA8dnOWQ1%2FXsYrrbzk7cCID6qPA%2F3MQH%2F7FaQoMCUvXj06aeH6RhMD5WZyqoaISBr%2FP4FUua%2B%2FFSdAW8UoFpur0IvkSFTi472CA7hfGmgcjspBdsTCrOA8R1ofgscYwOvGcFreenw5l1VhXZDSeXLC9yLJXPBWFzeup8uRyNXQFIHFcmNHvsLiLMUTY0S5eEBc5Zn9SAaWOcm4OGjAurpUJqpTTPOAu5VZOT2d1K2XMy%2FoH7x01Xf0MRIEd0yfyOLK60dhngbaey39vw1wMfPOm3JBvOyVdhGg1WR2sRF1RG10t7dI7iIO2Y4Z3Yb9w%2FdQhlafF8Ss45YtRRv2RRtzfpwoWE846At1pWvhP0tA0I1bhtehd6Upk%2F0iLehO5JWUiYqz1oMfefdZa30JAS9UNdKNqqsX8%2FjhAR9Ff09xKzOD%2FXzqeZwTT0EWtG6hqerKX9%2B%2BULfjB%2F44t3FjL5pRXrxRDIy0uZVI3qhjoRot5Nf7Lm9edccJJ%2BaujnHOMd96mxEcB584VO6eb63I99geVmNO%2FGpuuBvMxf2oV4AN83BEKipJEM3K4OYFI5VASfcTx2V3nMILj8FMKATYEWPYns0KxMuEpQ0Nf7dSSEiFKIfQ1px5iEvMKfPu4cGOqUBUaO0C2gNEeOUs8Fy4ci2hsLw4MW7jVnT5jLEQd2BB44hZzqkMvmeOYeiTxQB%2FgBpqAC%2FfZRF2Am3nCyLaADQYGpRhpg0QFRkBH8ukSxqOx%2BwLvLAV537t5AfFLcqjar4C9a0DXO9hgWfF3yY6HISlZ4NE9VGXei1wqy7i5ZDcbP1%2FlfWqH6LspK2rMJGgAlJthf7De%2BlQ5yJmYW%2FH7KG5eC%2Fu2MV&X-Amz-Signature=b08cad199962bcdc6d0b4b5d2409e90b67a4484ae554ce843f537d1d471ea70d status: SUCCEEDED BulkOperateDnaOligosTaskResponse: value: response: dnaOligos: - aliases: - Example alias apiURL: https://benchling.com/api/v2/dna-oligos/seq_bhuDUw9D archiveRecord: reason: Made in error bases: ACTTTTT createdAt: '2021-07-13T21:00:49.245Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: seq_bhuDUw9D length: 0 modifiedAt: '2021-07-13T21:00:49.245Z' name: Example DNA Oligo nucleotideType: DNA registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-13T21:00:49.245Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema webURL: https://benchling.com/benchling/f/lib_hBHqKbzE-oligos/seq_bhuDUw9D-test-oligo-abc/edit status: SUCCEEDED BulkTaskFailed: value: errors: index: 0 message: Invalid field value message: Your request was invalid. status: FAILED TaskFailed: value: message: Alignment not found. status: FAILED BulkOperateRnaSequencesTaskResponse: value: response: rnaSequences: - aliases: - Example alias annotations: - color: '#85DAE9' end: 10 name: Example annotation start: 0 strand: 0 type: Example annotation type apiURL: https://benchling.com/api/v2/rna-sequences/seq_asQya4lk archiveRecord: reason: Made in error bases: GUAGCAAAGANUAGUAGCCAGCUGUGAUAAAUGUCAGCUAAAAGGGGAAGCCAUG createdAt: '2021-07-13T13:16:44.315Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: - additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: rna_sequence_link value: seq_jdf8BV24 folderId: lib_mrZWMrft id: seq_asQya4lk isCircular: false length: 55 modifiedAt: '2021-07-13T13:16:44.315Z' name: Example rna sequence primers: - bases: CAUCG bindPosition: 0 color: '#F58A5E' end: 5 name: Example primer oligoId: seq_HJyE332n overhangLength: 0 start: 0 strand: 1 registrationOrigin: originEntryId: ent_a0SApq3z registeredAt: '2021-07-13T13:16:44.315Z' registryId: src_ae40j3TZ schema: id: ts_n4l12nf0 name: Example schema translations: - aminoAcids: KK end: 0 regions: - end: 0 start: 0 start: 0 strand: 1 webURL: https://benchling.com/benchling/f/lib_zky83cLg-example/seq_mnY8u4bs-chain-1/edit status: SUCCEEDED AOPProcessOutputTaskResponse: value: response: apiURL: https://benchling.com/api/v2/automation-output-processors/aop_C3wGA9HF archiveRecord: reason: Made in error assayRunId: 588aca02-1a20-4b94-a40f-b3f3a0081749 automationFileConfig: name: MyInstrumentName file: id: c33fe52d-fe6a-4c98-adcd-211bdf6778f7 mimeType: text/csv name: MyInstrumentInputFile.csv type: RAW_FILE uploadStatus: IN_PROGRESS id: aop_C3wGA9HF status: SUCCEEDED status: SUCCEEDED BulkOperateFeaturesTaskResponse: value: response: features: - color: '#75C6A9' featureLibraryId: featlib_cWYhFmxq featureType: promoter id: feat_XhYjGBpFoZ4wVary matchType: nucleotide name: lacZalpha promoter pattern: ggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccga status: SUCCEEDED AIGGenerateInputTaskResponse: value: response: apiURL: https://benchling.com/api/v2/automation-input-generators/aif_C3wGA9HF assayRunId: 588aca02-1a20-4b94-a40f-b3f3a0081749 automationFileConfig: name: MyInstrumentName file: id: c33fe52d-fe6a-4c98-adcd-211bdf6778f7 mimeType: text/csv name: MyInstrumentInputFile.csv type: RAW_FILE uploadStatus: IN_PROGRESS id: aif_C3wGA9HF status: SUCCEEDED status: SUCCEEDED TransfersTaskResponse: value: response: destinationContainers: - archiveRecord: reason: Made in error barcode: 201006-005 checkoutRecord: assignee: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur comment: Example comment modifiedAt: '2021-07-14T12:27:27.917Z' status: AVAILABLE contents: - batch: archiveRecord: reason: Made in error createdAt: '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur entity: aliases: - Example alias annotations: [] apiURL: https://benchling.com/api/v2/dna-sequences/seq_asQya4lk archiveRecord: reason: Made in error bases: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG createdAt: '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_hBHqKbzE id: seq_bhuDUw9D isCircular: true length: 0 modifiedAt: '2021-07-14T12:27:27.917Z' name: Example entity primers: [] registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-14T07:34:25.157Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema translations: [] webURL: https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 id: bat_UOIr8IjL modifiedAt: '2021-07-14T12:27:27.917Z' name: Example Batch schema: id: ts_DaiFhsNA name: Example Schema webURL: https://benchling.com/benchling/f/lib_55UxcIps-registry/bfi_YtegMKkT-batch-test/edit concentration: units: uM value: 5 entity: aliases: - Example alias annotations: [] apiURL: https://benchling.com/api/v2/dna-sequences/seq_asQya4lk archiveRecord: reason: Made in error bases: GTAGCAAAGANTAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGGGAAGCCATG createdAt: '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur customFields: Legacy ID: value: STR100 entityRegistryId: sBN000 fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 folderId: lib_mrZWMrft id: seq_bhuDUw9D isCircular: true length: 0 modifiedAt: '2021-07-14T12:27:27.917Z' name: Example entity primers: [] registrationOrigin: originEntryId: etr_3wievUIJ registeredAt: '2021-07-14T07:34:25.157Z' registryId: src_NetYd96a schema: id: ts_DaiFhsNA name: Example Schema translations: [] webURL: https://benchling.com/benchling/f/lib_hBHqKbzE-seqs/seq_bhuDUw9D-example-entity/edit createdAt": '2021-07-14T12:27:27.917Z' creator: handle: lpasteur id: ent_a0SApq3z name: Louis Pasteur fields: additionalProp1: displayValue: Amp isMulti: true textValue: Amp type: dna_sequence_link value: - seq_jdf8BV24 id: con_ZBL9QQWD modifiedAt: '2021-07-14T12:27:27.917Z' name: Example container parentStorageId: loc_MmtNUQIA parentStorageSchema: id: locsch_ToRk7Elm name: Building projectId: src_1m4443Ek quantity: units: mL value: 10 schema: id: ts_DaiFhsNA name: Example Schema volume: units: mL value: 10 webURL: https://benchling.com/samples/containers/con_FzQ1stz9 status: SUCCEEDED securitySchemes: basicApiKeyAuth: description: Use issued API key for standard access to the API scheme: basic type: http basicClientIdSecretAuth: description: Auth used as part of client credentials OAuth flow prior to receiving a bearer token. scheme: basic type: http oAuth: description: OAuth2 Client Credentials flow intended for service access flows: clientCredentials: scopes: {} tokenUrl: /api/v2/token type: oauth2 externalDocs: description: Additional API Documentation url: https://docs.benchling.com