openapi: 3.0.0 info: title: Labguru Antibodies Genes API description: "Labguru API is a JSON / REST based API, get started by reviewing the documentation below or code samples.
\n Join our dedicated [Slack channel](https://join.slack.com/t/labgurus/shared_invite/zt-199glfagl-QZQ_bKl7vLAi8CQSuNrRug)\n to be in direct contact with our API team and be informed about the latest updates.
\n ***[API introduction and overview](https://help.labguru.com/en/articles/6149483-api-introduction-and-overview)***" version: v1 tags: - name: Genes paths: /api/v1/genes: post: summary: Create a gene tags: - Genes description: 'Create a gene. ' parameters: [] responses: '201': description: OK '422': description: Invalid request '401': description: 'Error: Unauthorized' requestBody: content: application/json: schema: $ref: '#/components/schemas/createGene' required: true get: summary: List all genes in your account tags: - Genes parameters: - name: token in: query required: true schema: type: string - name: page in: query description: The default call is with page = 1 schema: type: integer - name: meta in: query description: Show summarized data information - true/false schema: type: string description: 'List all genes. ' responses: '200': description: OK '404': description: Not found /api/v1/genes/{id}: put: summary: Update gene tags: - Genes description: 'Update a gene. ' parameters: - name: id in: path required: true description: The ID of the gene schema: type: integer responses: '200': description: OK '422': description: Invalid request '401': description: 'Error: Unauthorized' requestBody: content: application/json: schema: $ref: '#/components/schemas/updateGene' required: true get: summary: Get gene by id tags: - Genes parameters: - name: token in: query required: true schema: type: string - name: id in: path required: true description: The ID of the gene schema: type: integer description: 'Get a gene by ID. ' responses: '200': description: OK '404': description: Not found components: schemas: updateGene: allOf: - $ref: '#/components/schemas/GeneBaseRequest' createGene: allOf: - $ref: '#/components/schemas/GeneBaseRequest' - type: object properties: item: type: object required: - title GeneBaseRequest: type: object required: - token properties: token: type: string example: YOUR TOKEN IS HERE item: type: object properties: title: type: string description: The name of the gene alternative_name: type: string description: Alternative gene name. expression_location: type: string description: Location of gene expression. pathway: type: string description: Involved metabolic pathway. sequence: type: string description: Gene sequence. example: ACTGACGACATGGTTCTGACCTGA owner_id: type: integer description: id of the owner - by default it's your member id source: type: string description: The origin or source from which the gene was obtained. description: type: string description: Detailed gene information.