BioPythonUtils ============== [BioPython](http://biopython.org) Utilities for [Sublime Text 3](http://www.sublimetext.com/3). ### Install Install BioPythonUtils using [Package Control](https://sublime.wbond.net). If you don't have Package Control see https://sublime.wbond.net. The [BioPython](http://biopython.org) 1.68 code is bundled with this package, you do not need to install it. ### Configure Add your email address and [BLAST](http://blast.ncbi.nlm.nih.gov/Blast.cgi) defaults to your Settings file. ~~~~ { "email_for_eutils": "bio@bioteam.net", "entrez_retmax": 1000, "remote_blast_app": "blastp", "remote_blast_db": "nr", "remote_blast_format": "Text" } ~~~~ The email address is required if you want to download from [NCBI](http://www.ncbi.nlm.nih.gov) using [EUtils](http://www.ncbi.nlm.nih.gov/books/NBK25500). ### Commands First select the relevant text, then run a command in the Tools -> BioPythonUtils menu. * "Translate" * "Get Sequences by Search" * "Get Sequences by Id" * "Get Sequences by Taxon" * "Remote BLAST" * "Genbank To Fasta" #### "Translate" Translates the selected text, which can be 1 or more entries in Fasta format or 1 or more entries of plain text. For example: ~~~~ >2 atgctatcaatcgcgattctgcttctgctaatagcagagggctcctctcaaaattacaca ggaaatcctgtgatatgcctggggcaccatgctgtgtccaatgggacaatggtgaaaacc >1 atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc ~~~~ or: ~~~~ atgctatcaatcacgattctgttcctgctcatagcagagggctcctctcagaattacaca gggaatcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacc atgctgtcaatcacgattctgttggtgctcatagcagagggctcctctcagaattacacg gggagtcctgtgatatgcctgggacatcatgctgtatccaatgggacaatggtgaaaacg ~~~~ Translation starts at the first codon and continues to the last, regardless of stop codons. #### "Get Sequences by Search" Queries [NCBI Nucleotide](https://www.ncbi.nlm.nih.gov/nucleotide/) using [Entrez](https://www.ncbi.nlm.nih.gov/books/NBK184582/) search service and the selected text and downloads the sequence results in GenBank format. For example: ~~~~ human[ORGN] AND AKT1[GENE] ~~~~ The default maximum number of records downloaded is 20, if you want more than 20 set the value in your "Settings - User" file ("entrez_retmax"). #### "Get Sequences by Id" Downloads sequence from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected ids. Ids can be delimited by commas, returns, or space. For example: ~~~~ KC781785 2 ~~~~ or: ~~~~ 2 KC781786 ~~~~ or: ~~~~ 284218, 203807 ~~~~ #### "Get Sequences by Taxon" Downloads a taxon as GenBank format entries from [NCBI](http://www.ncbi.nlm.nih.gov) using the selected [NCBI Taxonomy](http://www.ncbi.nlm.nih.gov/taxonomy) ids. Ids can be delimited by commas, returns, or space. #### "Remote BLAST" Sends the selected Fasta format or "plain" sequence(s) to the [BLAST server at NCBI](http://blast.ncbi.nlm.nih.gov/Blast.cgi) and retrieves the results. You can set the application, database, and result format using the Command Palette. You can also set some default values in your "Settings - User" file ("remote_blast_app", "remote_blast_format"). Note that the available databases change depending on the BLAST application. #### "Genbank To Fasta" Creates Fasta format records from the selection, 1 or more GenBank format records. ### Issues The interaction between the plugin and various services at NCBI are synchronized, so Sublime Text is unusable while the queries ("Get Sequences*", "Remote BLAST") are running.