The Evidence & Conclusion Ontology (ECO) describes types of scientific evidence within the biological research domain that arise from laboratory experiments, computational methods, literature curation, or other means. Evidence & Conclusion Ontology (ECO) 12:08:2021 11:18 eco ECO (https://github.com/evidenceontology/evidenceontology) is released into the public domain under CC0 1.0 Universal (CC0 1.0). Anyone is free to copy, modify, or distribute the work, even for commercial purposes, without asking permission. Please see the Public Domain Dedication (https://creativecommons.org/publicdomain/zero/1.0/) for an easy-to-read description of CC0 1.0 or the full legal code (https://creativecommons.org/publicdomain/zero/1.0/legalcode) for more detailed information. To get a sense of why ECO is CC0 as opposed to licensed under CC-BY, please read this thoughtful discussion (https://github.com/OBOFoundry/OBOFoundry.github.io/issues/285) on the OBO Foundry GitHub site. has GO evidence code A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold. example of usage The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. definition Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people term editor formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007 definition source The 'term requester' can credit the person, organization or project who request the ontology term.,The name of the person, project, or organization that motivated inclusion of an ontology term by requesting its addition. IAO ontology term requester Grouping classes used by GO go_groupings GO biological process terms should be used in the GO with/from field valid_with_biological_process GO cellular component terms should be used in the GO with/from field valid_with_cellular_component Chemical entity IDs should be used in the GO with/from field valid_with_chemical_entity Gene IDs should be used in the GO with/from field valid_with_gene GO molecular function terms should be used in the GO with/from field valid_with_molecular_function Protein IDs should be used in the GO with/from field valid_with_protein Protein complex IDs should be used in the GO with/from field valid_with_protein_complex Transcript IDs should be used in the GO with/from field valid_with_transcript description title license subset_property auto-generated-by created_by creation_date date default-namespace has_alternative_id has_broad_synonym database_cross_reference has_exact_synonym has_narrow_synonym has_obo_format_version has_obo_namespace has_related_synonym id in_subset is_inferred saved-by shorthand a core relation that holds between a part and its whole part_of part of part of a core relation that holds between a whole and its part has_part has part has part realized in realizes preceded by precedes A relation connecting a piece of evidence to an assertion method, where that assertion method is supported by the evidence. mchibucos 2010-12-09T05:00:20Z ECO:9000000 eco used_in used_in In the future we may use a more generic relation with weaker domain and range constraints taken from IAO, RO or OBI. used_in A relation connecting a piece of evidence to an assertion method, where that assertion method is supported by the evidence. GOC:cjm ECO:9000001 eco uses uses uses has measurement unit label is_about is a (currently) primitive relation that relates an information artifact to an entity. is about m is a quality measurement of q at t when q is a quality there is a measurement process p that has specified output m, a measurement datum, that is about q is quality measurement of relates a process to a time-measurement-datum that represents the duration of the process is duration of inverse of the relation of is quality measurement of is quality measured as A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of. has_specified_input A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of. is_specified_input_of A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of. has_specified_output c is_manufactured_by o means that there was a process p in which c was built in which a person, or set of people or machines did the work(bore the "Manufacturer Role", and those people/and or machines were members or of directed by the organization to do this. is_manufactured_by A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of. is_specified_output_of This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process. achieves_planned_objective the relation of the cells in the finger of the skin to the finger, in which an indeterminate number of grains are parts of the whole by virtue of being grains in a collective that is part of the whole, and in which removing one granular part does not nec- essarily damage or diminish the whole. Ontological Whether there is a fixed, or nearly fixed number of parts - e.g. fingers of the hand, chambers of the heart, or wheels of a car - such that there can be a notion of a single one being missing, or whether, by contrast, the number of parts is indeterminate - e.g., cells in the skin of the hand, red cells in blood, or rubber molecules in the tread of the tire of the wheel of the car. has grain A relation between an organisation or person and a material entity who owned or has license to the material entity and there was a legal transfer of ownership or licensing of the material entity to the current owner. supplies A relation between a material entity and an organisation or person who owned or has license to the material entity and there was a legal transfer of ownership or licensing of the material entity to the current owner. has_supplier This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process. objective_achieved_by A relation between an information content entity and a value specification that specifies its value. has value specification A relationship between two material entities that form a complex based on a selective, non-covalent interaction. bound_to a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence inheres in a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence bearer of a relation between a continuant and a process, in which the continuant is somehow involved in the process participates in a relation between a process and a continuant, in which the continuant is somehow involved in the process has participant A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants. is concretized as A relationship between a specifically dependent continuant and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. Multiple specifically dependent continuants can concretize the same generically dependent continuant. concretizes a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence function of a relation between a quality and an independent continuant (the bearer), in which the quality specifically depends on the bearer for its existence quality of a relation between a role and an independent continuant (the bearer), in which the role specifically depends on the bearer for its existence role of a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence has function a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence has quality a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence has role A relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence has disposition a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity derives from a relation between two distinct material entities, the old entity and the new entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity derives into a relation between two independent continuants, the location and the target, in which the target is entirely within the location location of a relation between two independent continuants, the target and the location, in which the target is entirely within the location located in immediately preceded by immediately precedes regulates regulates negatively_regulates negatively regulates positively_regulates positively regulates temporal relation is member of is a mereological relation between a item and a collection. member of has member is a mereological relation between a collection and an item. has member has measurement value A relation between a value specification and a number that quantifies it. has specified numeric value A relation between a value specification and a literal. has specified value entity An entity that exists in full at any time in which it exists at all, persists through time while maintaining its identity and has no temporal parts. continuant An entity that has temporal parts and that happens, unfolds or develops through time. occurrent A continuant that is a bearer of quality and realizable entity entities, in which other entities inhere and which itself cannot inhere in anything. independent continuant An occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. process disposition A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances. realizable entity quality A continuant that inheres in or is borne by other entities. Every instance of A requires some specific instance of B which must always be the same. specifically dependent continuant A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts. role site A continuant that is dependent on one or other independent continuant bearers. For every instance of A requires some instance of (an independent continuant type) B but which instance of B serves can change from time to time. generically dependent continuant function An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time. material entity immaterial entity An adenosine 5'-phosphate in which the 5'-phosphate is a triphosphate group. It is involved in the transportation of chemical energy during metabolic pathways. ATP Amide derived from two or more amino carboxylic acid molecules (the same or different) by formation of a covalent bond from the carbonyl carbon of one to the nitrogen atom of another with formal loss of water. The term is usually applied to structures formed from alpha-amino acids, but it includes those derived from any amino carboxylic acid. X = OH, OR, NH2, NHR, etc. peptide High molecular weight, linear polymers, composed of nucleotides containing deoxyribose and linked by phosphodiester bonds; DNA contain the genetic information of organisms. deoxyribonucleic acid Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity. molecular entity cytochalasin A member of the class of acrylamides that results from the formal condensation of acrylic acid with ammonia. acrylamide A chemical entity constituting the smallest component of an element having the chemical properties of the element. atom A macromolecule made up of nucleotide units and hydrolysable into certain pyrimidine or purine bases (usually adenine, cytosine, guanine, thymine, uracil), D-ribose or 2-deoxy-D-ribose and phosphoric acid. nucleic acid High molecular weight, linear polymers, composed of nucleotides containing ribose and linked by phosphodiester bonds; RNA is central to the synthesis of proteins. ribonucleic acid A macromolecule is a molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass. macromolecule double-stranded DNA A pyrimidine 2'-deoxyribonucleoside compound having 5-bromouracil as the nucleobase. 5-bromo-2'-deoxyuridine A synthetic radioactive isotope of chromium having a half-life of 27.7 days and decaying by electron capture with emission of gamma rays (0.32 MeV); it is used to label red blood cells for measurement of mass or volume, survival time, and sequestration studies, for the diagnosis of gastrointestinal bleeding, and to label platelets to study their survival. chromium-51 Thymidine linked to the radioisotope tritium. Used to label DNA in the study of cellular and viral DNA synthesis. tritiated thymidine Any type of microscopy where the specimen can be made to fluoresce (emit energy as visible light) by illuminating it with light of specific wavelengths. These specimens are called fluorophores. fluorescence microscopy Microscopy where the specimen is illuminated with visible light and a system of lenses is used to produce an image. light microscopy A material entity of anatomical origin (part of or deriving from an organism) that has as its parts a maximally connected cell compartment surrounded by a plasma membrane. cell cell A cell in vitro that is or has been maintained or propagated as part of a cell culture. cultured cell A lymphocyte of B lineage with the phenotype CD19-positive, CD20-positive, and capable of B cell mediated immunity. B cell A lymphocyte is a leukocyte commonly found in the blood and lymph that has the characteristics of a large nucleus, a neutral staining cytoplasm, and prominent heterochromatin. lymphocyte A cell in vitro that has undergone physical changes as a consequence of a deliberate and specific experimental procedure. experimentally modified cell in vitro A leukocyte with a single non-segmented nucleus in the mature form. mononuclear cell A type of information that is used to support an assertion. eco evidence code evidence_code ECO:0000000 evidence A type of information that is used to support an assertion. ECO:MCC A type of curator inference where conclusions are drawn based on the background scientific knowledge of the curator. eco ECO:0000001 inference from background scientific knowledge A type of curator inference where conclusions are drawn based on the background scientific knowledge of the curator. ECO:SN A type of experimental evidence resulting from the direct measurement of some aspect of a biological feature. ECO:0005006 eco ECO:0000002 direct assay evidence A type of experimental evidence resulting from the direct measurement of some aspect of a biological feature. ECO:SN A type of direct assay evidence based on reconstructing a biological sample from its disassociated state to its original state. eco ECO:0000003 reconstitution assay evidence A type of direct assay evidence based on reconstructing a biological sample from its disassociated state to its original state. ECO:KAV PMID:26029343 A type of fractionation evidence where sub-cellular components are separated based on their physical properties such as density in a sucrose density gradient. eco cell fractionation ECO:0000004 If using this term for Gene Ontology annotation, it would be used most typically for annotations to the cellular component ontology. cell fractionation evidence A type of fractionation evidence where sub-cellular components are separated based on their physical properties such as density in a sucrose density gradient. ECO:KIM TAIR:TED A type of protein assay evidence where the catalytic activity of an enzyme is determined. ECO:0005001 MI:0415 enzyme assay evidence eco enzyme assays ECO:0000005 enzymatic activity assay evidence A type of protein assay evidence where the catalytic activity of an enzyme is determined. url:http://www.sciencedirect.com/science/article/pii/S2213020914000068 MI:0415 enzymatic study A type of evidence resulting from manipulation of variables in order to discover cause and effect. ECO:0005023 eco ECO:0000006 experimental evidence A type of evidence resulting from manipulation of variables in order to discover cause and effect. url:http://holah.co.uk/page/experimental/ true A type of protein detection assay evidence where a fluorescently labeled antibody is used to detect the presence or localization of a biomolecule within a cell. eco immunofluorescence ECO:0000007 immunofluorescence evidence A type of protein detection assay evidence where a fluorescently labeled antibody is used to detect the presence or localization of a biomolecule within a cell. ECO:MCC TAIR:TED The 10 previously identified GlnR-regulated genes were all confirmed to be under GlnR control during nitrogen stress (i.e. differential expression in the wild type compared to the DeltaglnR mutant), but in addition a total of 392 genes were significantly up-regulated and 291 significantly down regulated (Additional file 1: Table S1). This indicates that GlnR mediates (directly or indirectly) the expression of over 680 genes. A type of experimental evidence that is based on characterization of gene expression. eco ECO:0000008 Use this evidence type when the annotation is inferred from the timing or location of expression of a gene. It may be difficult to determine whether the expression pattern truly indicates that a gene plays a role in a given process. expression pattern evidence The 10 previously identified GlnR-regulated genes were all confirmed to be under GlnR control during nitrogen stress (i.e. differential expression in the wild type compared to the DeltaglnR mutant), but in addition a total of 392 genes were significantly up-regulated and 291 significantly down regulated (Additional file 1: Table S1). This indicates that GlnR mediates (directly or indirectly) the expression of over 680 genes. PMID:23642041 A type of experimental evidence that is based on characterization of gene expression. ECO:MCC GO:IEP A type of expression pattern evidence where abundance of a transcript is analyzed. ECO:0000048 transcript expression level evidence transcriptomics evidence eco ECO:0000009 transcript expression evidence A type of expression pattern evidence where abundance of a transcript is analyzed. ECO:RCT In the BL21(DE3)(pJS429) cells, the levels of ClpP2s and VapC10 remained unchanged over a 2-hour period of translation arrest, but the VapB10 level showed to be decreased with a half-life (Figure 7C) similar to that observed in the strain BL21(DE3)(pJS883) (Figure 7B). These indicate that ClpXP2s could degrade VapB10 regardless of the presence or absence of VapC10. A type of expression pattern evidence resulting from protein abundance quantification techniques. ECO:0000046 protein expression level evidence eco ECO:0000010 protein expression evidence In the BL21(DE3)(pJS429) cells, the levels of ClpP2s and VapC10 remained unchanged over a 2-hour period of translation arrest, but the VapB10 level showed to be decreased with a half-life (Figure 7C) similar to that observed in the strain BL21(DE3)(pJS883) (Figure 7B). These indicate that ClpXP2s could degrade VapB10 regardless of the presence or absence of VapC10. PMID:24260461 A type of expression pattern evidence resulting from protein abundance quantification techniques. NBK:22011 PMC:4029002 url:http://www.informatics.jax.org/glossary/gain-of-function url:https://www.thermofisher.com/us/en/home/life-science/protein-biology/protein-biology-learning-center/protein-biology-resource-library/pierce-protein-methods/overview-protein-expression-systems.html A type of experimental phenotypic evidence resulting from the effect that a given gene has on another gene or genes, and the products. TAIR:TED eco ECO:0000011 genetic interaction evidence A type of experimental phenotypic evidence resulting from the effect that a given gene has on another gene or genes, and the products. ECO:RCT PMID:11822023 In addition, complementation of the ompR mutation in strain AR6 with plasmid pBR3 resulted in an increase in beta-galactosidase activity (1303 +- 80 Miller units), indicating that the His-tagged OmpR protein, expressed from the gene introduced in trans, was able to positively regulate flhDC expression. Trans-complementation of fimR on pDL276 (pHR6) in strain DeltafimR harboring pfim(445 b)-cat restored wild-type pfim expression (Figure S1). Taken together, pfim is negatively regulated by FimR. A type of genetic interaction evidence where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background. eco functional complementation ECO:0000012 functional complementation evidence In addition, complementation of the ompR mutation in strain AR6 with plasmid pBR3 resulted in an increase in beta-galactosidase activity (1303 +- 80 Miller units), indicating that the His-tagged OmpR protein, expressed from the gene introduced in trans, was able to positively regulate flhDC expression. PMID:20830609 Trans-complementation of fimR on pDL276 (pHR6) in strain DeltafimR harboring pfim(445 b)-cat restored wild-type pfim expression (Figure S1). Taken together, pfim is negatively regulated by FimR. PMID:23823757 A type of genetic interaction evidence where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background. PMID:27403640 A type of functional complementation evidence resulting from the introduction of a transgene to prevent, or "rescue" an organism from a condition. eco ECO:0000013 transgenic rescue experiment evidence A type of functional complementation evidence resulting from the introduction of a transgene to prevent, or "rescue" an organism from a condition. url:http://www.mdpi.com/1420-3049/19/9/13932/pdf url:http://www.nature.com/gt/journal/v11/n15/full/3302282a.html Indeed, the GroEL protein appears to be more abundant in the LM3 wild type strain compared to the LM3-2 mutant strain, suggesting the involvement of the CcpA protein in the positive regulation of its expression. A type of experimental phenotypic evidence in which an observable phenotypic difference results from a change or mutation in DNA. eco ECO:0000015 Note that mutations need not be negative. Changes to DNA sequence (mutations) may be detrimental, have no impact, or be beneficial. The allele that encodes the phenotype most common in a particular natural population is referred to as the wild type allele, while any other form of that allele is known as the mutant form. mutant phenotype evidence Indeed, the GroEL protein appears to be more abundant in the LM3 wild type strain compared to the LM3-2 mutant strain, suggesting the involvement of the CcpA protein in the positive regulation of its expression. PMID:17129387 A type of experimental phenotypic evidence in which an observable phenotypic difference results from a change or mutation in DNA. GO:IMP A type of mutant phenotype evidence where a phenotype is associated with altered gene product which lacks the molecular function of the wild-type gene. eco ECO:0000016 loss-of-function mutant phenotype evidence A type of mutant phenotype evidence where a phenotype is associated with altered gene product which lacks the molecular function of the wild-type gene. SO:0002054 A type of experimental phenotypic evidence where a transgenic strain carrying the construct of a promoter cDNA fusion in which a gene of interest is driven by a defined promoter or enhancer is ectopically expressed in the defined pattern to characterize potential cellular properties and functions of a protein of interest. eco analysis of overexpression/ectopic expression phenotype ECO:0000017 ectopic expression evidence A type of experimental phenotypic evidence where a transgenic strain carrying the construct of a promoter cDNA fusion in which a gene of interest is driven by a defined promoter or enhancer is ectopically expressed in the defined pattern to characterize potential cellular properties and functions of a protein of interest. PMID:10948520 PMID:19301619 A type of mutant phenotype evidence where a phenotype is observed while expressing an anti-sense version of a gene product in a wild-type (for that gene product) background. eco anti-sense experiments ECO:0000018 anti-sense experiment evidence A type of mutant phenotype evidence where a phenotype is observed while expressing an anti-sense version of a gene product in a wild-type (for that gene product) background. ECO:SN A type of mutant phenotype evidence where an RNA construct is introduced into a cell and the expression of the gene bearing its complementary sequence is suppressed. eco RNAi experiment ECO:0000019 RNAi evidence A type of mutant phenotype evidence where an RNA construct is introduced into a cell and the expression of the gene bearing its complementary sequence is suppressed. ECO:MCC A type of direct assay evidence based on the inhibition of the molecular function of a protein. specific protein inhibition evidence eco ECO:0000020 protein inhibition evidence A type of direct assay evidence based on the inhibition of the molecular function of a protein. ECO:MCC A type of experimental evidence that is based on characterization of an interaction between a gene product and another molecule. ECO:0005025 MI:0045 eco ECO:0000021 Molecules interacted with might include protein, nucleic acid, ion, or complex. physical interaction evidence A type of experimental evidence that is based on characterization of an interaction between a gene product and another molecule. ECO:SN MI:0045 experimental interaction detection A type of physical interaction evidence where a cellular component subunit is isolated as part of purification of its larger complex. MI:0025 eco co-purification ECO:0000022 co-purification evidence A type of physical interaction evidence where a cellular component subunit is isolated as part of purification of its larger complex. TAIR:TED MI:0025 copurification A type of physical interaction evidence that depends on the strength of the interaction between two entities. MI:0400 ligand binding evidence eco ECO:0000023 affinity evidence A type of physical interaction evidence that depends on the strength of the interaction between two entities. ECO:MCC PSI-MI:MI:0400 MI:0400 affinity technology A type of affinity evidence resulting from the binding of a molecule to a protein or protein complex. eco ECO:0000024 protein binding evidence A type of affinity evidence resulting from the binding of a molecule to a protein or protein complex. GO:0005515 url:https://en.wikipedia.org/wiki/Mutation A type of protein binding evidence where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein. DisProt:FedericaQuaglia MI:0090 bait-prey protein pull-down evidence eco ECO:0000025 Typically enzymes which confer resistance to antibiotics, such as Dihydrofolate reductase or Beta-lactamase, or proteins that give colorimetric or fluorescent signals are used. The Bait protein is generally the protein under study and the methods are readily adaptable to highthroughput mode. bait-prey hybrid interaction evidence A type of protein binding evidence where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein. ECO:MCC PSI-MI:MI:0090 MI:0090 protein complementation assay A type of experimental genomic evidence resulting from a process in which single stranded nucleic acids are allowed to interact so that complexes, or hybrids, are formed by molecules with sufficiently similar, complementary sequences. eco ECO:0000026 This term has been made obsolete with the clean up of experimental genomic evidence branch. nucleic acid hybridization evidence true A type of experimental genomic evidence resulting from a process in which single stranded nucleic acids are allowed to interact so that complexes, or hybrids, are formed by molecules with sufficiently similar, complementary sequences. OBI:0302903 The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30). A type of similarity evidence based on structural similarity of an annotated gene or gene product to another gene or group of genes. eco ECO:0000027 For GO annotation, in the case of a single gene, an accession for the related gene's sequence is entered in the evidence_with field. structural similarity evidence The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30). PMID:24260461 A type of similarity evidence based on structural similarity of an annotated gene or gene product to another gene or group of genes. ECO:MCC TAIR:TED A CRP box-like sequence was found in the promoter-proximate region of sycO-ypkA-yopJ [4], indicating the direct association of CRP with the sycO-ypkA-yopJ promoter region. To identify further CopR target genes, the binding motif TGAAGATTTnnTGAAGATTT was used to search for similar sequences in the whole C. glutamicum genome using the ERGO (TM) bioinformatics suite (Integrated Genomics, Illinois, USA) allowing four mutations, no deletions and no insertions. 46 hits were found, but only in six cases the putative CopR binding site was located in intergenic regions up to 200 bp upstream of the start codon of the neighbouring gene (cg1336, cg2976, cg3187, cg3337, cg3357 and cg0414). A type of match to sequence model evidence that is based on the presence of a recognized domain or motif in a gene product's (usually protein) primary sequence. eco recognized domains ECO:0000028 motif similarity evidence A CRP box-like sequence was found in the promoter-proximate region of sycO-ypkA-yopJ [4], indicating the direct association of CRP with the sycO-ypkA-yopJ promoter region. PMID:19703315 To identify further CopR target genes, the binding motif TGAAGATTTnnTGAAGATTT was used to search for similar sequences in the whole C. glutamicum genome using the ERGO (TM) bioinformatics suite (Integrated Genomics, Illinois, USA) allowing four mutations, no deletions and no insertions. 46 hits were found, but only in six cases the putative CopR binding site was located in intergenic regions up to 200 bp upstream of the start codon of the neighbouring gene (cg1336, cg2976, cg3187, cg3337, cg3357 and cg0414). PMID:21799779 A type of match to sequence model evidence that is based on the presence of a recognized domain or motif in a gene product's (usually protein) primary sequence. ECO:SN A type of match to sequence model evidence resulting from a positive match of a protein, or set of proteins to a predictive model (signature) in the InterPro database. eco ECO:0000029 match to InterPro member signature evidence A type of match to sequence model evidence resulting from a positive match of a protein, or set of proteins to a predictive model (signature) in the InterPro database. PMC:2686546 url:http://www.ncbi.nlm.nih.gov/mesh?term=Nucleic+Acid+Hybridization ISA A type of BLAST evidence that is used in a manual assertion. eco curated BLAST analysis ECO:0000030 BLAST evidence used in manual assertion true A type of BLAST evidence that is used in a manual assertion. ECO:MCC ISA A type of protein BLAST evidence that is used in a manual assertion. GO_REF:0000012 GO_REF:0000027 eco curated protein BLAST analysis ECO:0000031 protein BLAST evidence used in manual assertion true A type of protein BLAST evidence that is used in a manual assertion. ECO:SN GO_REF:0000012 Pairwise alignment (TIGR) GO_REF:0000027 BLAST search criteria for ISS assignment in PAMGO_GAT ISA A type of nucleotide BLAST evidence that is used in a manual assertion. eco curated nucleic acid BLAST analysis ECO:0000032 nucleotide BLAST evidence used in manual assertion true A type of nucleotide BLAST evidence that is used in a manual assertion. ECO:SN A type of author statement in which the author makes a statement that is not supported by information in that particular publication, but rather can be traced to a reference cited by that publication. eco traceable author statement ECO:0000033 author statement supported by traceable reference A type of author statement in which the author makes a statement that is not supported by information in that particular publication, but rather can be traced to a reference cited by that publication. ECO:RCT GO:TAS A type of author statement that is not associated with results presented or a cited reference. eco non-traceable author statement ECO:0000034 author statement without traceable support A type of author statement that is not associated with results presented or a cited reference. ECO:SN An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources. eco ECO:0000035 An assertion of "no evidence data found" carries the assumption that a more-or-less exhaustive search has been conducted. no evidence data found An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources. ECO:SN eco ECO:0000037 The evidence not_recorded appears in some legacy annotations; it should not be used for new annotations. not_recorded true A type of functional complementation evidence resulting from the introduction of nucleic acids, which are not permanently incorporated into the genome, to temporarily prevent, or "rescue" an organism from a condition. eco ECO:0000038 transient rescue experiment evidence A type of direct assay evidence resulting from determining the presence, abundance, structure, function, or activity of proteins. ECO:0005022 eco ECO:0000039 protein assay evidence true A type of direct assay evidence resulting from determining the presence, abundance, structure, function, or activity of proteins. PMID:18429326 A type of affinity evidence resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody. ECO:0005018 eco ECO:0000040 immunological assay evidence A type of affinity evidence resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody. ERO:0001362 url:http://www.ncbi.nlm.nih.gov/books/NBK21589/,http://cores.ucsf.edu/protein-assay.html A type of evidence resulting from comparing likeness of distinct biological entities. IS eco inferred from similarity ECO:0000041 similarity evidence A type of evidence resulting from comparing likeness of distinct biological entities. ECO:SN A type of mutant phenotype evidence resulting from an altered gene product which possesses a new molecular function or a new pattern of gene expression. gain-of-function mutant phenotype evidence eco ECO:0000042 gain-of-function mutant phenotypic evidence A type of mutant phenotype evidence resulting from an altered gene product which possesses a new molecular function or a new pattern of gene expression. SO:0002053 url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3614608/ A type of similarity based on biomolecular sequence. eco ECO:0000044 A sequence similarity analysis may involve a gene or a gene product, and it could be based on similarity to a single other gene or to a group of other genes. sequence similarity evidence A type of similarity based on biomolecular sequence. ECO:MCC TAIR:TED A type of protein expression evidence that accounts for the position of RNA translation to a protein product ranging in scale from differing tissues to regions of an anatomical structure. eco ECO:0000045 spatial pattern of protein expression evidence A type of transcript expression evidence that accounts for the position of transcription ranging in scale from the position of genes on the chromosome to differing tissues to regions of an anatomical structure. eco ECO:0000047 spatial pattern of transcript expression evidence A type of expression pattern evidence that is based on the expression pattern of a reporter gene. eco expression of a reporter gene ECO:0000049 reporter gene assay evidence A type of expression pattern evidence that is based on the expression pattern of a reporter gene. TAIR:TED A type of experimental phenotypic evidence based on an authors phenotypic description of a species (or higher-level group), which explicitly references an observation made of a voucher specimen (a specimen with a permanent museum catalog). IVS voucher specimen analysis evidence eco ECO:0000050 voucher specimen phenotypic analysis evidence A type of experimental phenotypic evidence based on an authors phenotypic description of a species (or higher-level group), which explicitly references an observation made of a voucher specimen (a specimen with a permanent museum catalog). TAIR:TED A type of similarity based on genotype without respect to expression. IGTS eco inferred from genetic similarity ECO:0000051 A genetic similarity analysis might consider genetic markers, polymorphisms, alleles, or other characteristics sometimes considered as part of the field of traditional genetics. Although an attempt has been made to treat as distinct the concepts of "genetic", "genotypic", "genomic", and "sequence", there is considerable overlap in usage throughout the field of biology. genetic similarity evidence A type of similarity based on genotype without respect to expression. ECO:MCC PhenoScape:IGTS A type of genetic interaction evidence resulting from a second mutation that either suppresses or enhances the phenotype expressed from an original mutation. TAIR:TED suppressor/enhancer interaction evidence eco 'traditional' genetic interactions (e.g. suppressors, synthetic lethals) ECO:0000052 suppressor/enhancer interaction phenotypic evidence A type of genetic interaction evidence resulting from a second mutation that either suppresses or enhances the phenotype expressed from an original mutation. url:http://biorxiv.org/content/early/2015/10/03/021592 url:http://www.wormbook.org/chapters/www:geneticsuppression/geneticsuppression.html IEA A type of automatically integrated combinatorial evidence that is used in an automatic assertion. ECO:0000246 TAIR:TED eco ECO:0000053 Combinatorial analyses could include experimental or computational results. Examples include: (i) large-scale experiment such as a genome-wide two-hybrid or genome-wide synthetic interactions; (ii) integration of large-scale data sets of various types; and (iii) text-based-computation, e.g. text-mining. For simple sequence comparisons, one should use the sequence similarity analysis evidence type. For microarray results alone, expression pattern analysis is appropriate; whereas, large-scale computational analysis should be used when microarray results are combined with the results of other types of large-scale experiments. automatically integrated combinatorial evidence used in automatic assertion true true A type of automatically integrated combinatorial evidence that is used in an automatic assertion. ECO:MCC ECO:RCT In the hns slyA double mutant, hlyE expression was twofold greater than in the parent, and slightly higher than the hns single mutant, suggesting that slyA has a small negative effect on hlyE expressionin the absence of H-NS. A type of mutant phenotype evidence resulting from an experiment typically constructed to determine if two different genes have an observable genetic interaction (functional connection) as the result of a mutation occurring in the alleles of the two genes of interest. double mutant phenotype evidence eco double mutant analysis ECO:0000054 double mutant phenotypic evidence In the hns slyA double mutant, hlyE expression was twofold greater than in the parent, and slightly higher than the hns single mutant, suggesting that slyA has a small negative effect on hlyE expressionin the absence of H-NS. PMID:17892462 A type of mutant phenotype evidence resulting from an experiment typically constructed to determine if two different genes have an observable genetic interaction (functional connection) as the result of a mutation occurring in the alleles of the two genes of interest. ECO:RCT PMID:18305163 eco ECO:0000055 This general 'array experiment' term should not be used - replace with the specific type of array (e.g. ECO:0000097, ECO:0000062, ECO:0000104, etc.) array experiment evidence true A type of genetic interaction evidence resulting from the suppression of one allelic effect by an allele at another genetic locus. epistatic interaction evidence eco epistatic interactions ECO:0000056 Epistasis' can be used in different contexts in different areas of genetics. It is sometimes used to mean 'genetic interaction', whereas other times it may be specific to mutations that block the effects of other mutations. epistatic interaction phenotypic evidence A type of genetic interaction evidence resulting from the suppression of one allelic effect by an allele at another genetic locus. PMID:18852697 A type of similarity based on the expression of a genotype in an environment. IPTS phenotype similarity evidence eco inferred from phenotypic similarity ECO:0000057 Phenotype is defined as the outcome of the expression of a genotype in a given environment. A comparison might involve whole organisms or sub-parts of organisms. phenotypic similarity evidence A type of similarity based on the expression of a genotype in an environment. ECO:MCC PhenoScape:IPTS S. lividans AdpA directly regulates at least the six AdpA-dependent genes listed above and identified by microarrays and qRT-PCR analysis. To identify the regulon of the response regulator CopR, the transcriptome of the DeltacopRS deletion mutant was compared to that of the wild type using DNA microarrays. For cells grown in standard CGXII medium (1.25 microM CuSO4), no significant gene expression differences were observed, indicating that the CopRS two-component system is not active under this condition (data not shown). A type of transcript expression evidence resulting from simultaneous profiling of the expression levels of thousands of genes in a single experiment allowing analysis of genes and their networks. ECO:0000356 differential gene expression evidence from microarray experiment eco ECO:0000058 expression microarray evidence S. lividans AdpA directly regulates at least the six AdpA-dependent genes listed above and identified by microarrays and qRT-PCR analysis. PMID:24694298 To identify the regulon of the response regulator CopR, the transcriptome of the DeltacopRS deletion mutant was compared to that of the wild type using DNA microarrays. For cells grown in standard CGXII medium (1.25 microM CuSO4), no significant gene expression differences were observed, indicating that the CopRS two-component system is not active under this condition (data not shown). PMID:21799779 A type of transcript expression evidence resulting from simultaneous profiling of the expression levels of thousands of genes in a single experiment allowing analysis of genes and their networks. url:http://www.illumina.com/techniques/microarrays/gene-expression-arrays.html url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2435252/ A type of experimental evidence that is based on an observable characteristic trait, which is the result of the expression of an organisms genotype in an environment. ECO:0000014 ECO:0005017 eco inferred from phenotype ECO:0000059 Observable characteristic traits can be morphology, development, behavior, biochemical or physiological properties, etc. experimental phenotypic evidence A type of experimental evidence that is based on an observable characteristic trait, which is the result of the expression of an organisms genotype in an environment. ECO:SN A type of phenotypic similarity evidence based on the similarity of stucture locations or arrangements. IPS eco ECO:0000060 positional similarity evidence A type of phenotypic similarity evidence based on the similarity of stucture locations or arrangements. TAIR:TED A type of phenotypic evidence that is based on a gene product that is associated with a quantitative trait locus, but has not been cloned. QTL analysis evidence eco quantitative trait analysis ECO:0000061 quantitative trait analysis evidence A type of phenotypic evidence that is based on a gene product that is associated with a quantitative trait locus, but has not been cloned. TAIR:TED A type of expression microarray evidence where expression level is quantified by sample biotin-labeled cRNA (transcribed from an unknown RNA sample) hybridized to DNA oligonuclotides immoblized on a solid surface. genomic microarray evidence eco ECO:0000062 cRNA to DNA expression microarray evidence A type of expression microarray evidence where expression level is quantified by sample biotin-labeled cRNA (transcribed from an unknown RNA sample) hybridized to DNA oligonuclotides immoblized on a solid surface. url:https://link.springer.com/chapter/10.1007/978-94-017-9716-0_30 A type of phenotypic similarity evidence based on the similarity of the histological makeup of structures. ICS eco ECO:0000063 compositional similarity evidence A type of phenotypic similarity evidence based on the similarity of the histological makeup of structures. TAIR:TED A type of functional complementation evidence that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene. eco functional complementation in heterologous system ECO:0000064 functional complementation in heterologous system evidence A type of functional complementation evidence that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene. TAIR:TED A type of bait-prey hybrid interaction evidence that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors. MI:0432 eco yeast one-hybrid assay ECO:0000066 The assay involves screening a library of candidate proteins for the ability bind to a target, cis-regulatory element or any other short, DNA binding sequence placed 5' to a yeast reporter gene (TAIR:TED). yeast one-hybrid evidence A type of bait-prey hybrid interaction evidence that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors. ECO:MCC PSI-MI:MI:0432 TAIR:TED MI:0432 one hybrid A type of phenotypic similarity evidence based on the similarity of embryological or post-embryonic orgin of structures. IDS eco ECO:0000067 developmental similarity evidence A type of phenotypic similarity evidence based on the similarity of embryological or post-embryonic orgin of structures. TAIR:TED A type of bait-prey hybrid interaction evidence that is based on detection of protein-protein interaction by activation of a yeast reporter gene after a bait protein fused to a DNA-binding domain (which has been transfected into a yeast cell) is used to screen a cDNA library of clones fused to an activation domain. eco yeast two-hybrid assay ECO:0000068 yeast 2-hybrid evidence A type of bait-prey hybrid interaction evidence that is based on detection of protein-protein interaction by activation of a yeast reporter gene after a bait protein fused to a DNA-binding domain (which has been transfected into a yeast cell) is used to screen a cDNA library of clones fused to an activation domain. PMID:12734586 A type of in vitro methylation assay evidence where methylation-sensitive restriction enzymes are utilized to compare differential methylation between two samples by first shearing DNA, followed by end-blunting, ligation of linkers, methylation sensitive restriction, PCR using linker primers, dye labeling and relative quantification of methylated DNA fragments by two-colored array hybridization to a CpG island microarray for visual assessment. ECO:0000065 CpG island microarray evidence eco ECO:0000069 Color is indicative of methylation status - be it hypo- (pseudo-green), hyper- (pseudo-red), or equal methylation (pseudo-yellow). differential methylation hybridization evidence A type of in vitro methylation assay evidence where methylation-sensitive restriction enzymes are utilized to compare differential methylation between two samples by first shearing DNA, followed by end-blunting, ligation of linkers, methylation sensitive restriction, PCR using linker primers, dye labeling and relative quantification of methylated DNA fragments by two-colored array hybridization to a CpG island microarray for visual assessment. PMID:18987809 A type of immunoprecipitation evidence that involves precipitating two or more proteins via binding to an antibody specific to a single protein, followed by protein identification. MI:0019 eco co-immunoprecipitation ECO:0000070 If performing GO annotation, the interacting protein is referenced in the evidence_with column. co-immunoprecipitation evidence A type of immunoprecipitation evidence that involves precipitating two or more proteins via binding to an antibody specific to a single protein, followed by protein identification. ECO:MCC MI:0019 coimmunoprecipitation A type of phenotypic similarity evidence based on the similarity of shape, structure, or configuration in structures. IMS eco ECO:0000071 morphological similarity evidence A type of phenotypic similarity evidence based on the similarity of shape, structure, or configuration in structures. TAIR:TED eco ECO:0000072 Sos-recruitment assay evidence true A type of experimental evidence that is based on the characterization of an attribute of the genome underlying a gene product. inferred from genomic analysis eco ECO:0000073 This term has been made obsolete with the clean up of experimental genomic evidence branch. experimental genomic evidence true A type of experimental evidence that is based on the characterization of an attribute of the genome underlying a gene product. ECO:MCC A type of protein fragment functional complementation evidence that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein. MI:0112 eco split-ubiquitin assay ECO:0000074 The bait protein is fused to the C-terminal ubiquitin (Cub) domain followed by a reporter protein, and the prey protein is fused to a mutated N terminal ubiquitin (NubG) domain. If bait and prey interact, their interaction brings the NubG and Cub domains close enough to reconstitute.TAIR:TED split-ubiquitin functional complementation evidence A type of protein fragment functional complementation evidence that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein. PMID:15064465 MI:0112 ubiquitin reconstruction A type of phenotypic similarity evidence that is based on the categorization of genes by the similarity of expression profiles. IGES eco ECO:0000075 gene expression similarity evidence A type of phenotypic similarity evidence that is based on the categorization of genes by the similarity of expression profiles. PMID:19958477 A type of physical interaction evidence that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes. MI:0047 eco far-Western analysis ECO:0000076 The interacting protein is referenced in the evidence_with column. far-Western blotting evidence A type of physical interaction evidence that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes. PMID:18079728 A type of in vitro methylation assay evidence resulting from initial modification of DNA by sodium bisulfite, converting all unmethylated cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA. MS-PCR MSP methylation-specific PCR evidence eco ECO:0000077 The product is the amplification of existing sequences - i.e. more DNA that can be further processed e.g. sequenced, DNA fingerprinting. methylation-specific polymerase chain reaction evidence A type of in vitro methylation assay evidence resulting from initial modification of DNA by sodium bisulfite, converting all unmethylated cytosines to uracil, and subsequent amplification with primers specific for methylated versus unmethylated DNA. PMC:38513 PMID:8790415 A type of DNA detection assay evidence that is based on detection of a specific DNA sequence by hybridization of labeled probes to any immobilized DNA fragment with sequence similarity. Southern blot eco Southern blotting ECO:0000078 The DNA fragments are prepared through gel electrophoresis then transferred to a filter membrane. southern hybridization evidence A type of DNA detection assay evidence that is based on detection of a specific DNA sequence by hybridization of labeled probes to any immobilized DNA fragment with sequence similarity. PMID:18432697 A type of affinity evidence that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bound compound. MI:0004 eco affinity chromatography ECO:0000079 "Used when an annotation is made based on affinity chromatography, which is a selective separation technique by which a compound (e.g., an antibody) is immobilized on a polymeric matrix and used to bind selectively other compounds. Following removal of the unattached components, the bound compound is displaced by changing the concentration of protons, salts, or cofactors in the eluent" (from original definition by TAIR:TED). Types of highly specific interaction might include those of antigen and antibody, enzyme and substrate, or receptor and ligand. affinity chromatography evidence A type of affinity evidence that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bound compound. ECO:MCC TAIR:TED MI:0004 affinity chromatography technology Comparative phylogenomics along with MLST (multilocus sequence typing) and whole genome sequecing has shown that ribotype 078 lineage is different than other C. difficile lineages [22]. A type of similarity that indicates common ancestry. IP eco ECO:0000080 phylogenetic evidence Comparative phylogenomics along with MLST (multilocus sequence typing) and whole genome sequecing has shown that ribotype 078 lineage is different than other C. difficile lineages [22]. PMID:24713082 A type of similarity that indicates common ancestry. ECO:MCC PhenoScape:IP IP PhenoScape:IP A type of motif similarity evidence that is based on detection of a targeting sequence in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence. eco targeting sequence prediction ECO:0000081 targeting sequence prediction evidence A type of motif similarity evidence that is based on detection of a targeting sequence in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence. ECO:RCT TAIR:TED A type of experimental genomic evidence where DNA polymerase is used to synthesize new strand of DNA complementary to the offered template strand. PCR evidence eco ECO:0000082 This term has been made obsolete because PCR is not evidence. The children have been appropriately placed under other parents. polymerase chain reaction evidence true A type of experimental genomic evidence where DNA polymerase is used to synthesize new strand of DNA complementary to the offered template strand. OBI:0000415 A type of motif similarity evidence that is based on detection of one, or more, transmembrane domains in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence. eco transmembrane domain prediction ECO:0000083 transmembrane domain prediction evidence A type of motif similarity evidence that is based on detection of one, or more, transmembrane domains in the primary sequence of a protein through computational prediction and/or a manual examination of the sequence. ECO:RCT TAIR:TED A type of genomic context evidence in which a gene product's identity is supported on the basis of the identity of neighboring genes. mgiglio 2009-03-20T11:55:18Z GO_REF:0000025 inferred from genome cluster eco ICL ECO:0000084 Genomic cluster analyses include synteny and operon structure. gene neighbors evidence A type of genomic context evidence in which a gene product's identity is supported on the basis of the identity of neighboring genes. ECO:MCC GOC:MG GO_REF:0000025 Operon structure as IGC evidence A type of protein binding evidence that involves precipitation of a multivalent antigen by a bivalent antibody for protein isolation. CollecTF eco immunoprecipitation ECO:0000085 Transcription factors isolated in this way can be incubated with a radiolabeled probe to demonstrate binding. immunoprecipitation evidence A type of protein binding evidence that involves precipitation of a multivalent antigen by a bivalent antibody for protein isolation. ECO:MCC ECO:SW TAIR:TED A type of in vitro methylation assay evidence resulting from a genome-wide estimate of DNA methylation by differential enzymatic digestion of genomic DNA with methylation-sensitive and methylation-insensitive isoschizomers, followed by restrained PCR amplification of sequences methylated at both ends and resolving the PCR products in a denaturing polyacrylamide-sequencing gel to generate fingerprints that consist of multiple anonymous bands that represent the DNA methylome of the cell. AIMS eco ECO:0000086 The bands can be individually isolated and characterized which leads to the identification of hypo- and hypermethylation events. amplification of intermethylated sites evidence A type of in vitro methylation assay evidence resulting from a genome-wide estimate of DNA methylation by differential enzymatic digestion of genomic DNA with methylation-sensitive and methylation-insensitive isoschizomers, followed by restrained PCR amplification of sequences methylated at both ends and resolving the PCR products in a denaturing polyacrylamide-sequencing gel to generate fingerprints that consist of multiple anonymous bands that represent the DNA methylome of the cell. PMID:18987810 url:https://www.ncbi.nlm.nih.gov/probe/docs/techpcr/ A type of microscopy evidence where antibodies are used to detect the location of molecules or other structures within cells or tissues. eco immunolocalization ECO:0000087 immunolocalization evidence A type of microscopy evidence where antibodies are used to detect the location of molecules or other structures within cells or tissues. ECO:MCC ECO:SN A type of evidence that is based on a combination of experimental evidences or existing models of that system in a related species used for the reconstruction of a biological system. mgiglio 2009-03-20T12:00:17Z eco ISR inferred from system reconstruction ECO:0000088 The biological system in question might be a multi-step process or pathway or a physical complex comprising several components. The components in the experimental evidence can come from the same species or a mix of species. The experimental evidences may be only partial or weak. biological system reconstruction evidence A type of evidence that is based on a combination of experimental evidences or existing models of that system in a related species used for the reconstruction of a biological system. ECO:MCC GOC:mg A type of DNA detection assay evidence resulting from the use of restriction enzymes for direct end-labeling of DNA (creating landmarks), followed by high-resolution two-dimensional electrophoresis to visualize the landmarks. SIB:PG ECO:0001125 RLGS evidence restriction landmark genome scanning evidence eco ECO:0000089 restriction landmark genomic scanning evidence A type of DNA detection assay evidence resulting from the use of restriction enzymes for direct end-labeling of DNA (creating landmarks), followed by high-resolution two-dimensional electrophoresis to visualize the landmarks. PMID:8388788 A type of immunolocalization evidence where the antibodies are labeled with colloidal gold particles whose location is then detected via microscopy. eco immunogold labelling ECO:0000090 immunogold labelling evidence A type of immunolocalization evidence where the antibodies are labeled with colloidal gold particles whose location is then detected via microscopy. ECO:MCC A type of immunolocalization evidence in which recombinant proteins fused with epitopes are recognized by antibodies. eco immunolocalization of epitope-tagged protein ECO:0000092 epitope-tagged protein immunolocalization evidence A type of immunolocalization evidence in which recombinant proteins fused with epitopes are recognized by antibodies. TAIR:TED A type of DNA detection assay evidence evidence where gene sequence or variation is determined or detected by fluorescently-labeled DNA fragments hybridized to sequence-specific oligonucleotides immobilized on an array. DNA microarray oligonucleotide microarray evidence SNP array evidence single nucleotide polymorphism array evidence eco ECO:0000093 array-based sequence capture evidence A type of DNA detection assay evidence evidence where gene sequence or variation is determined or detected by fluorescently-labeled DNA fragments hybridized to sequence-specific oligonucleotides immobilized on an array. PMID:21049075 eco ECO:0000094 The children of 'biological assay evidence' have been moved under 'direct assay evidence', and this term has been deprecated with no children left. biological assay evidence true A type of cell growth assay evidence that measures one or more aspects of cell growth over a specified time period to indicate an induced or repressed regulatory effect. mchibucos 2014-10-15T00:58:50Z eco growth curve analysis ECO:0000095 Cell growth aspects can include growth rate and extent of growth. A cell growth curve acts as a natural reporter. cell growth regulation assay evidence A type of cell growth assay evidence that measures one or more aspects of cell growth over a specified time period to indicate an induced or repressed regulatory effect. ECO:SW PomBase:MAH Each of the promoter-proximal regions of qrr2 - 4 was subjected to EMSA with the purified His-OpaR protein (Fig. 6b). The results showed that His-OpaR was able to bind to each of the three DNA fragments tested in a dose-dependent manner in vitro. A type of affinity evidence based on an electrophoretic mobility shift of macromolecules, where proteins, nucleic acids, or both, are combined and the resulting mixtures are electrophoresed under native conditions through polyacrylamide or agarose gel to detect interactions/complexes between proteins and/or nucleic acid. CollecTF MI:0413 EMSA: electrophoretic mobility shift assay eco Gel retardation assay electrophoretic mobility shift assay ECO:0000096 EMSA is often used for assessing TF-binding with fluorophore labelling. Protein-nucleic acid complexes generally migrate at a slower rate than the corresponding non-bonded nucleic acid. electrophoretic mobility shift assay evidence Each of the promoter-proximal regions of qrr2 - 4 was subjected to EMSA with the purified His-OpaR protein (Fig. 6b). The results showed that His-OpaR was able to bind to each of the three DNA fragments tested in a dose-dependent manner in vitro. PMID:22506036 A type of affinity evidence based on an electrophoretic mobility shift of macromolecules, where proteins, nucleic acids, or both, are combined and the resulting mixtures are electrophoresed under native conditions through polyacrylamide or agarose gel to detect interactions/complexes between proteins and/or nucleic acid. ECO:KIM ECO:SW PMID:17703195 TAIR:TED MI:0413 electrophoretic mobility shift assay Gel retardation assay PMID:17703195 A type of expression microarray evidence where expression level is quantified by fluroescently-labeled cDNA (reverse transcribed from an unknown RNA sample) hybridized to DNA immobilized on a solid surface. CollecTF ECO:0001041 ECO:0005524 eco DNA microarray RNA microarray ECO:0000097 cDNA to DNA expression microarray evidence A type of expression microarray evidence where expression level is quantified by fluroescently-labeled cDNA (reverse transcribed from an unknown RNA sample) hybridized to DNA immobilized on a solid surface. ECO:RCT A type of nucleic acid hybridization evidence based on localization of a specific segment of DNA or RNA by the application of a complementary strand of nucleic acid to which a reporter molecule is attached. eco in situ hybridization ECO:0000098 This term has been made obsolete with the clean up of experimental genomic evidence branch. obsolete in situ hybridization evidence true A type of nucleic acid hybridization evidence based on localization of a specific segment of DNA or RNA by the application of a complementary strand of nucleic acid to which a reporter molecule is attached. url:https://www.ncbi.nlm.nih.gov/probe/docs/techish/ A type of direct assay evidence resulting from the separation of various cell components while preserving their individual functions. eco ECO:0000100 fractionation evidence A type of direct assay evidence resulting from the separation of various cell components while preserving their individual functions. NBK:26936 url:https://www.ncbi.nlm.nih.gov/books/NBK26936/ A type of cRNA to DNA expression microarray evidence resulting from the use of a proprietary Affymetrix GeneChip System for analyzing complex genetic information. Affymetrix array experiment evidence eco ECO:0000101 Affymetrix GeneChip evidence A type of cRNA to DNA expression microarray evidence resulting from the use of a proprietary Affymetrix GeneChip System for analyzing complex genetic information. ERO:0001265 A type of fractionation evidence resulting from a protein fractionated with other compounds, factors, or macromolecules. eco co-fractionation ECO:0000102 co-fractionation evidence A type of fractionation evidence resulting from a protein fractionated with other compounds, factors, or macromolecules. TAIR:TED A type of expression microarray evidence where expression levels are quantified by hybridization of fluorescently-labeled DNA to cDNA (reverse transcribed from an unknown RNA sample) immobilized on a solid surface. REM evidence RNA expression microarray evidence microarray RNA expression level evidence eco transcript levels (e.g. microarray data) ECO:0000104 REM is a 'reverse-format' microarray, where the unknown sample is immoblized to a surface and known DNA is hybridized to that. DNA to cDNA expression microarray evidence A type of expression microarray evidence where expression levels are quantified by hybridization of fluorescently-labeled DNA to cDNA (reverse transcribed from an unknown RNA sample) immobilized on a solid surface. ECO:RCT PMID:15329382 REM is a 'reverse-format' microarray, where the unknown sample is immoblized to a surface and known DNA is hybridized to that. PMID:15329382 A type of cDNA to DNA expression microarray evidence resulting from the use of a proprietary NimbleGen array to measure expression levels. eco ECO:0000105 Nimblegen array evidence A type of cDNA to DNA expression microarray evidence resulting from the use of a proprietary NimbleGen array to measure expression levels. PMID:15607417 url:https://roche-biochem.jp/pdf/products/microarray/user_guide/SeqCap/SeqCap_UserGuide_Delivery_ver3.0.pdf Northern blot analysis indicated that there was one major band of 1.5-kb (which was used for the stability determination) and two other minor bands of approximately 3.0- and 6.0-kb, which constituted less than 5% of the total signal (Fig. 1C), suggesting that other genes may be cotranscribed along with SMU.1882. A type of transcript expression evidence based on electrophoresis and probing to determine levels of RNA expression using a complementary hybridization probe on the separated RNA samples. CollecTF RNA blot evidence northern assay evidence eco transcript levels (e.g. Northerns) ECO:0000106 northern blot evidence Northern blot analysis indicated that there was one major band of 1.5-kb (which was used for the stability determination) and two other minor bands of approximately 3.0- and 6.0-kb, which constituted less than 5% of the total signal (Fig. 1C), suggesting that other genes may be cotranscribed along with SMU.1882. PMID:21124877 A type of transcript expression evidence based on electrophoresis and probing to determine levels of RNA expression using a complementary hybridization probe on the separated RNA samples. ECO:SW TAIR:TED Taken together, the results of the RT-PCR analyses and the reporter fusion assays indicate that expression of SMU.1882 is up regulated in the presence of CovR. The RT-PCR assay indicated that the sycO, ypkA and yopJ genes (designated as pCD12, pCD13 and pCD14 in Y. pestis 91001 [19], respectively) were transcribed as a single primary RNA (Fig. 1), and thereby these three genes constituted a single operon in Y. pestis Microtus strain 201. Using reverse transcription-PCR, we found that primers designed to span the intergenic regions between zur and the znuC homolog, as well as znuC and znuB homolog each generated a PCR product (Figure 2A). This indicated that these genes were transcribed on the same mRNA. A type of RNA detection assay evidence where an RNA transcript is reverse transcribed into cDNA and amplified to qualitatively detect gene expression. CollecTF ECO:0000108 reverse transcription polymerase chain reaction transcription evidence RT-PCR eco transcript levels (e.g. RT-PCR) ECO:0000109 The starting product for PCR, and therefore amplification volume, is directly correlated to the transcription rate. reverse transcription polymerase chain reaction evidence Taken together, the results of the RT-PCR analyses and the reporter fusion assays indicate that expression of SMU.1882 is up regulated in the presence of CovR. PMID:21124877 The RT-PCR assay indicated that the sycO, ypkA and yopJ genes (designated as pCD12, pCD13 and pCD14 in Y. pestis 91001 [19], respectively) were transcribed as a single primary RNA (Fig. 1), and thereby these three genes constituted a single operon in Y. pestis Microtus strain 201. PMID:19703315 Using reverse transcription-PCR, we found that primers designed to span the intergenic regions between zur and the znuC homolog, as well as znuC and znuB homolog each generated a PCR product (Figure 2A). This indicated that these genes were transcribed on the same mRNA. PMID:24086521 A type of RNA detection assay evidence where an RNA transcript is reverse transcribed into cDNA and amplified to qualitatively detect gene expression. ECO:SW PMID:11013345 PMID:12901609 fur RPAs were performed on RNA isolated from each strain, and an increase in fur expression was seen for G27, 26695, and the Fur swap strain under iron-depletion shock conditions while little to no increase was seen under iron-limited growth conditions (Fig. 4D and data not shown). This data shows that Fur autoregulation is consistent in each strain and further supports the notion that the AA difference in Fur is not responsible for the difference in sodB regulation between G27 and 26695. A type of nuclease protection assay evidence where mRNA is hybridized with radiolabeled RNA probes after which RNAse is added to digest the unbound, nonresistant single-stranded overhang regions, later the remaining probe target hybrids are purified and resolved on denaturing polyacrylamide gel, and quantified by autoradiography. CollecTF ribonuclease protection assay RPA eco RNA protection assay RNAse protection assay ECO:0000110 RNA protection assay evidence fur RPAs were performed on RNA isolated from each strain, and an increase in fur expression was seen for G27, 26695, and the Fur swap strain under iron-depletion shock conditions while little to no increase was seen under iron-limited growth conditions (Fig. 4D and data not shown). This data shows that Fur autoregulation is consistent in each strain and further supports the notion that the AA difference in Fur is not responsible for the difference in sodB regulation between G27 and 26695. PMID:19399190 A type of nuclease protection assay evidence where mRNA is hybridized with radiolabeled RNA probes after which RNAse is added to digest the unbound, nonresistant single-stranded overhang regions, later the remaining probe target hybrids are purified and resolved on denaturing polyacrylamide gel, and quantified by autoradiography. ECO:SW PMID:23457339 TAIR:TED When we determined the proteolysis role of Lons in VapBC10 proteins by Western blot analysis using the strains BL21(DE3)(pJS882) and BL21(DE3)(pJS427), the levels of VapB10 and VapC10 remained stable over the course of translation inhibition (Figure 7D and E). Thus, Lon could not degrade VapBC10 proteins, consistent with our drop growth evidence (Figure 6B). A type of protein expression evidence where proteins are separated using gel electrophoresis, blotted onto a membrane, and probed with an antibody that can be detected via light or radioactive emission. CollecTF ECO:0005602 protein expression level evidence based on western blot eco Western blot expression analysis protein immunoblot protein levels (e.g. Western blots) ECO:0000112 Western blot is used for protein detection and analysis. A mixed protein sample is separated through polyacrylamide gel electrophoresis then transferred to a membrane, such as polyvinylidene fluoride (PVDF), and labeled with protein-specific antibodies. qualitative western immunoblotting evidence When we determined the proteolysis role of Lons in VapBC10 proteins by Western blot analysis using the strains BL21(DE3)(pJS882) and BL21(DE3)(pJS427), the levels of VapB10 and VapC10 remained stable over the course of translation inhibition (Figure 7D and E). Thus, Lon could not degrade VapBC10 proteins, consistent with our drop growth evidence (Figure 6B). PMID:24260461 A type of protein expression evidence where proteins are separated using gel electrophoresis, blotted onto a membrane, and probed with an antibody that can be detected via light or radioactive emission. ECO:SW PMID:23050259 TAIR:TED A type of protein expression evidence where a protein of interest is isolated on the basis of its hybridization to an antibody raised to a homologous protein. eco expression library screening ECO:0000114 expression library screen evidence A type of protein expression evidence where a protein of interest is isolated on the basis of its hybridization to an antibody raised to a homologous protein. ECO:MCC TAIR:TED A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue is compared to another cell type or tissue when mRNA from each sample is reverse transcribed, labeled, and hybridized to a cDNA library to compare hybridization patterns. eco differential hybridization ECO:0000116 Differential hybridization identifies differentially expressed cloned genes. Two different mRNA-derived probes are used to demonstrate RNA expression under a specific condition. differential hybridization evidence A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue is compared to another cell type or tissue when mRNA from each sample is reverse transcribed, labeled, and hybridized to a cDNA library to compare hybridization patterns. PMID:14668817 A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue are compared to another cell type or tissue when denatured ds-cDNA from the two samples are hybridized, and the common sequences are 'subtracted'. eco subtractive hybridization ECO:0000118 Subtractive hybridization is used for isolation and identification of transcripts involving the removal of any sequences present in the control from the test probe to detect only transcripts present in the sample. The method is PCR-based for the comparison of two cDNA libraries. subtractive hybridization evidence A type of nucleic acid hybridization evidence in which preferential or exclusive expression of genes in one cell type or tissue are compared to another cell type or tissue when denatured ds-cDNA from the two samples are hybridized, and the common sequences are 'subtracted'. PMID:11298187 In contrast, when RpoQ was overexpressed in either the wild type or the DeltalitR mutant, both were essentially nonmotile (Fig. 7), suggesting that quorum signaling regulates motility, at least in part, through an RpoQ mechanism downstream of LitR. A type of experimental phenotypic evidence in which a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product. eco analysis of overexpression/ectopic expression phenotype ECO:0000120 over expression analysis evidence In contrast, when RpoQ was overexpressed in either the wild type or the DeltalitR mutant, both were essentially nonmotile (Fig. 7), suggesting that quorum signaling regulates motility, at least in part, through an RpoQ mechanism downstream of LitR. PMID:22233679 A type of experimental phenotypic evidence in which a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product. PMID:22419077 A type of localization evidence where sub-cellular localization of a protein is determined. eco ECO:0000122 protein localization evidence A type of localization evidence where sub-cellular localization of a protein is determined. GO:0008104 url:http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0019937 A type of protein localization evidence resulting from the fusion of a protein of interest to a labeling protein which has enzymatic activity or fluorescence properties. eco ECO:0000124 fusion protein localization evidence A type of protein localization evidence resulting from the fusion of a protein of interest to a labeling protein which has enzymatic activity or fluorescence properties. MI:0240 A type of fusion protein localization evidence resulting from the labeling of a protein of interest with green fluorescent protein (GFP) from the jellyfish Aequorea victoria. GFP fusion protein localization evidence eco localization of GFP/YFP fusion protein ECO:0000126 green fluorescent protein fusion protein localization evidence A type of fusion protein localization evidence resulting from the labeling of a protein of interest with green fluorescent protein (GFP) from the jellyfish Aequorea victoria. PMID:9759496 A type of fusion protein localization evidence resulting from the labeling of a protein of interest with yellow fluorescent protein (YFP), which was created by mutating green fluorescent protein (GFP) of the Aequorea victoria. YFP fusion protein localization evidence eco localization of GFP/YFP fusion protein ECO:0000128 yellow fluorescent protein fusion protein localization evidence A type of fusion protein localization evidence resulting from the labeling of a protein of interest with yellow fluorescent protein (YFP), which was created by mutating green fluorescent protein (GFP) of the Aequorea victoria. MI:0368 url:http://www.jbc.org/content/276/31/29188.long A type of fusion protein localization evidence resulting from the targeted insertion of the beta-glucuronidase (GUS) coding gene as a reporter gene for the localization of a particular gene product. GUS fusion protein localization evidence GUS staining evidence eco localization of GUS fusion protein ECO:0000130 beta-glucuronidase fusion protein localization evidence A type of fusion protein localization evidence resulting from the targeted insertion of the beta-glucuronidase (GUS) coding gene as a reporter gene for the localization of a particular gene product. ECO:RCT A type of fusion protein localization evidence resulting from the targeted insertion of the beta-galactosidase coding gene (lacZ) into a specific gene to create a beta-galactosidase-tagged fusion protein. LacZ fusion protein localization evidence eco ECO:0000132 beta-galactosidase fusion protein localization evidence A type of fusion protein localization evidence resulting from the targeted insertion of the beta-galactosidase coding gene (lacZ) into a specific gene to create a beta-galactosidase-tagged fusion protein. PMID:23681629 A type of direct assay evidence resulting from the activity assessment of transport proteins. eco transport assay ECO:0000134 transport assay evidence A type of direct assay evidence resulting from the activity assessment of transport proteins. PMID:18401524 A type of affinity evidence resulting from the binding of a molecule to a nucleic acid. eco ECO:0000136 nucleic acid binding evidence A type of affinity evidence resulting from the binding of a molecule to a nucleic acid. GO:0003676 A type of nucleic acid binding evidence resulting from an enzyme displaying binding activity to specific ribohomopolymer. eco ribohomopolymer binding assay ECO:0000138 ribohomopolymer binding assay evidence A type of nucleic acid binding evidence resulting from an enzyme displaying binding activity to specific ribohomopolymer. PMC:102612 A type of chromatography evidence that uses a thin layer of adsorbent (such as silica gel, alumina, or cellulose) on a flat, inert substrate. TLC evidence eco thin layer chromatography ECO:0000140 thin layer chromatography evidence A type of chromatography evidence that uses a thin layer of adsorbent (such as silica gel, alumina, or cellulose) on a flat, inert substrate. ECO:MCC A type of protein binding evidence resulting from a metal ion binding to a protein at a specific binding site. eco ECO:0000142 protein:ion binding evidence A type of protein binding evidence resulting from a metal ion binding to a protein at a specific binding site. PMID:2377604 A type of nucleic acid binding evidence in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins. eco Southwestern analysis ECO:0000144 Southwestern blot evidence A type of nucleic acid binding evidence in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins. ECO:RCT TAIR:TED A type of nucleic acid binding evidence in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins. eco Northwestern analysis ECO:0000146 Northwestern blot evidence A type of nucleic acid binding evidence in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins. ECO:RCT TAIR:TED eco ECO:0000148 in vitro binding evidence true As shown in Fig. 5, addition of reconstituted RNA polymerase holoenzyme, but not the core enzyme, generated expected size bands of 193-nt and 158-nt when P1882 and Pami, respectively, were used as template (lanes 2 and 7). However, the addition of CovR did not lead to any observable increase in transcription from P1882. A type of reconstitution assay evidence resulting from the use of reconstituted polymerase transcription systems to investigate RNA synthesis. eco in vitro reconstitution assay with recombinant protein ECO:0000150 in vitro transcription reconstitution assay evidence As shown in Fig. 5, addition of reconstituted RNA polymerase holoenzyme, but not the core enzyme, generated expected size bands of 193-nt and 158-nt when P1882 and Pami, respectively, were used as template (lanes 2 and 7). However, the addition of CovR did not lead to any observable increase in transcription from P1882. PMID:21124877 A type of reconstitution assay evidence resulting from the use of reconstituted polymerase transcription systems to investigate RNA synthesis. PMID:9237163 A type of in vitro transcription reconstitution assay evidence resulting from the use of recombinant proteins in preparation of a fully-defined transcription system. eco in vitro reconstitution assay with recombinant protein ECO:0000152 in vitro recombinant protein transcription reconstitution assay evidence A type of in vitro transcription reconstitution assay evidence resulting from the use of recombinant proteins in preparation of a fully-defined transcription system. PMID:9237165 A type of protein expression evidence where a gene from one cell is inserted into a cell that does not typically contain that gene and heterologous protein expression is assessed. eco protein expression in heterologous system ECO:0000154 heterologous protein expression evidence A type of protein expression evidence where a gene from one cell is inserted into a cell that does not typically contain that gene and heterologous protein expression is assessed. ECO:KAV A type of fractionation evidence resulting from the isolation of a single type of protein from a complex mixture. eco ECO:0000156 protein separation evidence A type of fractionation evidence resulting from the isolation of a single type of protein from a complex mixture. ERO:0000526 A type of protein separation evidence that is followed by direct protein sequencing whereby a protein's amino acid sequence is determined experimentally by Edman degradation or by mass spectrometry. eco protein separation and direct sequencing ECO:0000158 protein separation followed by direct sequencing evidence A type of protein separation evidence which then utilizes the screening and identification of small-molecules that bind to proteins. eco protein separation and fragment identification ECO:0000160 protein separation followed by fragment identification evidence A type of protein separation evidence which then utilizes the screening and identification of small-molecules that bind to proteins. https://pubs.acs.org/doi/10.1021/bi3005126 https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5632530/ A type of transport assay evidence in which the uptake mechanism of a transporter is investigated in a cell that does not normally express that protein. eco uptake assay in heterologous system ECO:0000162 The transporter is a recombinant protein. heterologous system uptake evidence A type of transport assay evidence in which the uptake mechanism of a transporter is investigated in a cell that does not normally express that protein. ECO:RCT doi:10.1146/annurev.pp.46.060195.002223 A type of direct assay evidence where electrical properties of cells or tissues are studied. eco ECO:0000164 The scale of electrophysiology assays can range from small, e.g. a single ion channel, to large, e.g. an entire organ such as a heart. electrophysiology assay evidence A type of direct assay evidence where electrical properties of cells or tissues are studied. ECO:KAV A type of voltage clamp recording evidence which involves using two electrodes inserted into a large cell (often a xenopus oocyte) where one electrode is used to measure the internal potential (voltage) of the cell and the other electrode is used to clamp the current. eco two-electrode voltage clamp technique ECO:0000166 two-electrode voltage clamp recording evidence A type of voltage clamp recording evidence which involves using two electrodes inserted into a large cell (often a xenopus oocyte) where one electrode is used to measure the internal potential (voltage) of the cell and the other electrode is used to clamp the current. ECO:SN PMID:23529422 A type of direct assay evidence resulting from the detection and quantification of transcribed RNA. eco ECO:0000168 transcription assay evidence A type of direct assay evidence resulting from the detection and quantification of transcribed RNA. MeSH:D014158 url:https://bmcmolbiol.biomedcentral.com/articles/10.1186/1471-2199-15-7 A type of transcription assay evidence in which sequence-specific binding proteins that increase transcription of a specific target gene or genes are identified, quantified, and/or analyzed. eco transcriptional activation assay ECO:0000170 transcriptional activation assay evidence A type of transcription assay evidence in which sequence-specific binding proteins that increase transcription of a specific target gene or genes are identified, quantified, and/or analyzed. url:http://smcg.ccg.unam.mx/enp-unam/05-TranscripYRegulacion/transcription.pdf A type of experimental phenotypic evidence in which the biochemical aspect of a mutation is analyzed. eco analysis of biochemical trait ECO:0000172 For example, the accumulation of a biosynthetic intermediate. biochemical trait analysis evidence A type of experimental phenotypic evidence in which the biochemical aspect of a mutation is analyzed. ECO:RCT A type of mutant phenotype evidence in which the physiological response of a mutant when presented with an external stimulus is determined. eco analysis of physiological response ECO:0000174 Examples include: abnormal growth of the root in response to gravity, delay in flowering in response to varying light conditions. mutant physiological response evidence A type of mutant phenotype evidence in which the physiological response of a mutant when presented with an external stimulus is determined. ECO:RCT A type of mutant phenotype evidence in which traits arising from a mutation are visually examined. eco analysis of visible trait ECO:0000176 mutant visible phenotype evidence A type of mutant phenotype evidence in which traits arising from a mutation are visually examined. ECO:RCT A type of similarity evidence in which the location of the gene within the genome provides insight into the gene's function or evolutionary insight. eco ECO:0000177 This type of evidence might include identity of neighboring genes, operon structure, synteny, phylogenetic analysis, or other whole-genome analysis. genomic context evidence A type of similarity evidence in which the location of the gene within the genome provides insight into the gene's function or evolutionary insight. PMID:10958625 PMID:21609955 A type of direct assay evidence resulting from a sample of microorganisms or living tissue grown in a medium. eco ECO:0000178 in vivo assay evidence A type of direct assay evidence resulting from a sample of microorganisms or living tissue grown in a medium. ECO:RCT url:https://www.cancer.gov/publications/dictionaries/cancer-terms?cdrid=46352 A type of experimental evidence arising from the investigation of an animal model system. eco ECO:0000179 animal model system study evidence A type of experimental evidence arising from the investigation of an animal model system. ECO:MCC A type of experimental evidence arising from a controlled investigation that uses human subjects. eco ECO:0000180 clinical study evidence A type of experimental evidence arising from a controlled investigation that uses human subjects. ECO:MCC A type of direct assay evidence resulting from a process performed outside the living organism, where the components of an organism have been isolated from their usual biological context, to permit a more detailed or more convenient analysis in an artificial setting. ECO:0005013 eco ECO:0000181 in vitro assay evidence A type of direct assay evidence resulting from a process performed outside the living organism, where the components of an organism have been isolated from their usual biological context, to permit a more detailed or more convenient analysis in an artificial setting. ECO:RCT url:https://www.cancer.gov/publications/dictionaries/cancer-terms?cdrid=45733 eco ECO:0000182 Use ECO:0001563 (cell growth assay evidence) in place of this term. in vitro culture assay evidence true A type of direct assay evidence resulting from studies in which cytoplasmic and/or nuclear cellular components from resting, nonstimulated cells, are isolated by ultracentrifugation to provide molecular machinery that can be used in reactions in the absence of many of the other cellular components for the purpose of in vitro protein synthesis, transcription, DNA replication, etc. in vitro assay eco ECO:0000183 cell-free assay evidence A type of direct assay evidence resulting from studies in which cytoplasmic and/or nuclear cellular components from resting, nonstimulated cells, are isolated by ultracentrifugation to provide molecular machinery that can be used in reactions in the absence of many of the other cellular components for the purpose of in vitro protein synthesis, transcription, DNA replication, etc. PMID:18453125 A type of protein inhibition evidence and enzymatic acitivty evidence where the protein under study is an enzyme. eco ECO:0000184 enzyme inhibition evidence A type of protein inhibition evidence and enzymatic acitivty evidence where the protein under study is an enzyme. ECO:MCC A type of sequence similarity evidence in which an annotation is made based on a manually-reviewed or published sequence alignment mchibucos 2010-03-18T12:21:31Z ECO:00000057 eco ECO:0000200 Such alignments may be pairwise alignments or multiple alignments. sequence alignment evidence A type of sequence similarity evidence in which an annotation is made based on a manually-reviewed or published sequence alignment url:http://www.geneontology.org/GO.evidence.shtml A type of sequence similarity evidence in which orthology is established by multiple criteria, including amino acid and/or nucleotide sequence comparisons and one or more of the following: phylogenetic analysis, coincident expression, conserved map location, functional complementation, immunological cross-reaction, similarity in subcellular localization, subunit structure, substrate specificity, and response to specific inhibitors. mchibucos 2010-03-18T12:30:06Z ECO:00000060 eco ortholog evidence ECO:0000201 Orthology is a relationship between genes in different species indicating that the genes derive from a common ancestor. sequence orthology evidence A type of sequence similarity evidence in which orthology is established by multiple criteria, including amino acid and/or nucleotide sequence comparisons and one or more of the following: phylogenetic analysis, coincident expression, conserved map location, functional complementation, immunological cross-reaction, similarity in subcellular localization, subunit structure, substrate specificity, and response to specific inhibitors. url:http://www.geneontology.org/GO.evidence.shtml A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program. A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model. mchibucos 2010-03-18T12:32:30Z ECO:00000063 eco ECO:0000202 Used when evidence from any kind of statistical model of a sequence or group of sequences is used to make a prediction about the function of a protein or RNA. Examples of relevant evidence are: Hidden Markov Models, PROSITE motifs, and tools such as tRNASCAN. match to sequence model evidence A putative rho-independent terminator sequence (GCCTGACTACATAGATGTCAGGC) was identified at position 402-bp downstream of SMU.1882 by TransTerm (transterm.dev.java.net) program. PMID:21124877 A type of sequence similarity evidence in which the function of a gene product is predicted based on a sequence-based statistical model. ECO:MCC url:http://www.geneontology.org/GO.evidence.shtml An assertion method that does not involve human review. mchibucos 2010-03-18T12:36:04Z ECO:00000067 eco ECO:0000203 An automatic assertion is based on computationally generated information that is not reviewed by a person prior to making the assertion. For example, one common type of automatic assertion involves creating an association of evidence with an entity based on commonness of attributes of that entity and another entity for which an assertion already exists. The commonness is determined algorithmically. automatic assertion An assertion method that does not involve human review. ECO:MCC A documented statement evidence that is based on an assertion by the author of a paper, which is read by a curator. mchibucos 2010-06-21T11:17:21Z ECO:0007010 eco ECO:0000204 author statement A documented statement evidence that is based on an assertion by the author of a paper, which is read by a curator. ECO:MCC A type of inferential evidence that is based on a conclusion drawn by a curator. mchibucos 2010-08-18T05:55:12Z eco ECO:0000205 curator inference A type of inferential evidence that is based on a conclusion drawn by a curator. ECO:MCC A type of pairwise sequence alignment evidence obtained with basic local alignment search tool (BLAST). mchibucos 2010-08-06T04:48:24Z eco ECO:0000206 BLAST evidence A type of pairwise sequence alignment evidence obtained with basic local alignment search tool (BLAST). ECO:MCC A type of BLAST evidence in which nucleotide sequences are aligned. mchibucos 2010-08-06T04:49:58Z eco ECO:0000207 nucleotide BLAST evidence A type of BLAST evidence in which nucleotide sequences are aligned. ECO:MCC Blast search of S. meliloti genome for homologues of X. campestris Ohr protein revealed two paralogues, SMa2389 and SMc00040, showing 52 and 57% identity respectively with Ohr of X. campestris. A type of BLAST evidence in which amino acid or translated nucleotide sequences are aligned. mchibucos 2010-08-06T04:50:45Z eco ECO:0000208 protein BLAST evidence Blast search of S. meliloti genome for homologues of X. campestris Ohr protein revealed two paralogues, SMa2389 and SMc00040, showing 52 and 57% identity respectively with Ohr of X. campestris. PMID:21569462 A type of BLAST evidence in which amino acid or translated nucleotide sequences are aligned. ECO:MCC IEA A type of BLAST evidence that is used in an automatic assertion. mchibucos 2010-08-06T04:55:21Z eco ECO:0000209 BLAST evidence used in automatic assertion true A type of BLAST evidence that is used in an automatic assertion. ECO:MCC IEA A type of nucleotide BLAST evidence that is used in an automatic assertion. mchibucos 2010-08-06T05:09:51Z eco ECO:0000210 nucleotide BLAST evidence used in automatic assertion true A type of nucleotide BLAST evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein BLAST evidence that is used in an automatic assertion. mchibucos 2010-08-06T05:11:04Z eco ECO:0000211 protein BLAST evidence used in automatic assertion true A type of protein BLAST evidence that is used in an automatic assertion. ECO:RCT A type of evidence in which at least two distinct types of evidence have been integrated. mchibucos 2010-08-06T05:24:57Z ECO:0000036 ECO:0000043 eco inferred from in-silico analysis ECO:0000212 A key aspect of this type of evidence is that two or more pieces of information are combined to generate an emergent type of evidence not possible with the constituent pieces of evidence alone. A combinatorial analysis typically involves incorporation of different types of evidence. combinatorial evidence A type of evidence in which at least two distinct types of evidence have been integrated. ECO:MCC ECO:RCT IEA A type of combinatorial analysis that is used in an automatic assertion. mchibucos 2010-08-06T05:28:33Z eco inferred from in-silico analysis ECO:0000213 Combinatorial analyses could include experimental or computational results. Examples include: (i) large-scale experiment such as a genome-wide two-hybrid or genome-wide synthetic interactions; (ii) integration of large-scale data sets of various types; and (iii) text-based-computation, e.g. text-mining. For simple sequence comparisons, one should use the sequence similarity analysis evidence type. For microarray results alone, expression pattern analysis is appropriate; whereas, large-scale computational analysis should be used when microarray results are combined with the results of other types of large-scale experiments. combinatorial evidence used in automatic assertion true A type of combinatorial analysis that is used in an automatic assertion. ECO:MCC A type of phylogenetic evidence whereby an aspect of an ancestral gene is inferred through the characterization of an aspect of a descendant gene. mchibucos 2010-10-05T11:16:50Z eco ECO:0000214 This type of evidence can be used in support of both positive and "not" GO annotations. It should be used to annotate ancestral genes but not extant ones. biological aspect of descendant evidence A type of phylogenetic evidence whereby an aspect of an ancestral gene is inferred through the characterization of an aspect of a descendant gene. ECO:MCC A type of phylogenetic evidence characterized by long phylogenetic tree branch lengths following a duplication event. mchibucos 2010-10-05T03:41:34Z eco ECO:0000215 Long branch lengths indicate that descendant sequences may have acquired different or additional functions than the ancestral sequence. rapid divergence from ancestral sequence evidence A type of phylogenetic evidence characterized by long phylogenetic tree branch lengths following a duplication event. ECO:MCC A type of phylogenetic evidence characterized by the absence of key sequence residues. mchibucos 2010-10-05T03:43:17Z eco ECO:0000216 The loss of certain residues important for function can indicate that a sequence lacks a particular function. phylogenetic determination of loss of key residues evidence A type of phylogenetic evidence characterized by the absence of key sequence residues. ECO:MCC A means by which a statement is made about an entity. mchibucos 2010-11-12T04:17:37Z eco ECO:0000217 assertion method A means by which a statement is made about an entity. ECO:MCC An assertion method that involves human review. mchibucos 2010-11-12T04:20:02Z eco ECO:0000218 A manual assertion could be based on evidence that is generated by and interpreted by a human or it could involve human review of computationally generated information. manual assertion An assertion method that involves human review. ECO:MCC A type of sequencing assay that determines the sequence of a biopolymer comprised of nucleotides. mchibucos 2010-11-15T12:22:40Z eco DNA sequencing ECO:0000219 nucleotide sequencing assay evidence A type of sequencing assay that determines the sequence of a biopolymer comprised of nucleotides. ECO:MCC DNA sequencing OBI:0000626 A type of experimental evidence where the order of molecules that constitute a biopolymer is determined. mchibucos 2010-11-15T01:44:45Z eco ECO:0000220 sequencing assay evidence A type of experimental evidence where the order of molecules that constitute a biopolymer is determined. ECO:MCC OBI:0600047 A type of nucleotide sequencing assay evidence in which a sequence is derived from a parallelized sequencing technique. mchibucos 2010-11-15T02:19:34Z eco next generation sequencing evidence ECO:0000221 Typically thousands to millions of reads are produced in parallel. high throughput nucleotide sequencing assay evidence A type of nucleotide sequencing assay evidence in which a sequence is derived from a parallelized sequencing technique. ECO:MCC A type of high throughput nucleotide sequencing evidence in which sequence is determined through hybridization of adaptor-ligated DNA to a glass slide on which each fragment is simultaneously clonally amplified, followed by progressive rounds of base incorporation with fluorescently-tagged nucleotides, washing, imaging, and cleavage. mchibucos 2010-11-15T02:38:03Z eco Solexa sequencing result ECO:0000222 In Illumina sequencing technology, adapters are ligated onto the ends of randomly fragmented DNA. After single-stranded fragments are bound to the inside surface of a flow cell channel, they undergo in-place bridge PCR amplification. To begin the sequencing cycle, labeled reversible terminators, primers and DNA polymerase are added, followed by laser excitation of the fluorescent label and high resolution scanning. After non-incorporated nucleotides are washed away and the dye is chemically removed, the next cycle repeats with four labeled reversible terminators, primers and DNA polymerase, again followed by imaging. Illumina sequencing evidence A type of high throughput nucleotide sequencing evidence in which sequence is determined through hybridization of adaptor-ligated DNA to a glass slide on which each fragment is simultaneously clonally amplified, followed by progressive rounds of base incorporation with fluorescently-tagged nucleotides, washing, imaging, and cleavage. OBI:0000724 PMID:26000844 Solexa sequencing result OBI:0000724 A type of high throughput nucleotide sequencing evidence in which the sequence for a ssDNA is determined by addition of primers and then nucleotides, one base pair at a time (which generate a specific fluorescence), to the target strand. mchibucos 2010-11-15T03:50:14Z pyrosequencing eco ECO:0000223 454 pyrosequencing technology amplifies individual DNA fragments inside water droplets within an oil solution (emulsion PCR). Within each droplet, a single DNA template is attached to a single primer-coated bead. Each bead is subsequently captured in a picolitre well within the sequencing machine. A luciferase-based readout system is used to identify individual nucleotides added to the nascent DNA. The target strand is usually prepared by fragmentation, adaptor ligation, and amplification by emulsion PCR. 454 pyrosequencing evidence A type of high throughput nucleotide sequencing evidence in which the sequence for a ssDNA is determined by addition of primers and then nucleotides, one base pair at a time (which generate a specific fluorescence), to the target strand. EFO:0005016 pyrosequencing OBI:0000730 A type of high throughput nucleotide sequencing evidence in which sequence is determined through rounds of ligation-based sequencing with fluorescently-labeled Di-base probes and cleavage, after which the template is reset, with a primer offset by one base, for subsequent rounds of ligation. mchibucos 2010-11-15T04:17:41Z eco ECO:0000224 SOLiD sequencing technology is based on sequencing by ligation. After library preparation, emulsion PCR and bead enrichment are performed, including 3' modification of templates on selected beads to allow covalent bonding to a slide. 3' modified beads are attached to a glass slide and primers are added. Four fluorescently labeled di-base probes are added and multiple cycles of ligation, detection and cleavage are performed. The number of cycles determines read length. After a number of ligation cycles, the extension product is removed and another round of ligation cycles is performed with a new primer complimentary to the n-1 position of the template. Five rounds of primer reset are performed for each sequence tag. Samples are prepared by fragmentation of a sample library, adaptor ligation, emulsion PCR, and attachment of resultant beads to glass slides. SOLiD sequencing evidence A type of high throughput nucleotide sequencing evidence in which sequence is determined through rounds of ligation-based sequencing with fluorescently-labeled Di-base probes and cleavage, after which the template is reset, with a primer offset by one base, for subsequent rounds of ligation. OBI:0000706 A type of nucleotide sequencing assay in which DNA sequence is determined by addition of a primed DNA template to a reaction mixture, followed by addition of DNA polymerase, deoxynucleosidetriphosphates (dNTPs - one of which may be radiolabeled), and one of four di-deoxynucleotidetriphosphates (ddNTPs), after which DNA elongation is terminated and the DNA is separated by size and imaged. mchibucos 2010-11-15T04:46:31Z Sanger sequencing dye terminator sequencing eco ECO:0000225 Chain termination sequencing, also called Sanger sequencing after its developer, uses dideoxynucleotide triphosphates (ddNTPs) as DNA chain terminators. Single-stranded DNA template, DNA primer, DNA polymerase, fluorescently or radioactively labeled nucleotides, and one of four ddNTPs are added together in each of four separate sequencing reactions. The synthesized and labeled DNA fragments from each of the four reactions are denatured, separated by size by gel electrophoresis, and visualized by autoradiography or UV light. The ddNTPs lack an OH group so the next dNTP cannot be attached, causing chain termination. chain termination sequencing evidence A type of nucleotide sequencing assay in which DNA sequence is determined by addition of a primed DNA template to a reaction mixture, followed by addition of DNA polymerase, deoxynucleosidetriphosphates (dNTPs - one of which may be radiolabeled), and one of four di-deoxynucleotidetriphosphates (ddNTPs), after which DNA elongation is terminated and the DNA is separated by size and imaged. OBI:0000695 A type of immunoprecipitation evidence that is used to identify a protein binding site on a genomic DNA sequence. mchibucos 2010-11-16T01:29:08Z MI:0402 ChIP evidence eco ECO:0000226 Chromatin immunoprecipitation (ChIP) is used to investigate protein-DNA interactions in vivo. DNA and proteins are chemically cross-linked in vivo to form chromatin complexes, followed by cell lysis and DNA shearing. Fragmented DNA-protein complexes are selectively enriched for a protein of interest using a specific antibody (immunoprecipitation). Protein digestion and DNA purification are performed prior to DNA detection via molecular cloning and sequencing, polymerase chain reaction (PCR), microarray analysis (ChIP-on-chip), or direct high-throughput sequencing (ChIP-seq). chromatin immunoprecipitation evidence A type of immunoprecipitation evidence that is used to identify a protein binding site on a genomic DNA sequence. ECO:MCC MI:0402 chromatin immunoprecipitation assay A type of chromatin immunoprecipitation evidence that uses polymerase chain reaction (PCR) where specific primers are used on the pulled-down DNA for DNA detection. CollecTF mchibucos 2010-11-16T05:02:00Z ChIP-PCR evidence eco ECO:0000227 ChIP-PCR is often used to validate ChIP-chip results and less frequently,ChIP-Seq results. chromatin immunoprecipitation-PCR evidence A type of chromatin immunoprecipitation evidence that uses polymerase chain reaction (PCR) where specific primers are used on the pulled-down DNA for DNA detection. ECO:MCC ECO:SW PMID:18388953 To confirm the in vivo binding of FimR to pfim, and to determine the impact of Mn2+ and Fe2+ on the binding activity of FimR, chromatin immunoprecipitation (ChIP) assay-quantitative real time PCR (qPCR) with anti-FimR antibody was employed as detailed in the materials and methods. The strongest binding of FimR to pfim was detected in cells grown in the presence of 50 microM MnCl2 and 50 microM FeSO4 (Figure 5, lane IV), whereas minimal amounts of MnCl2 (0.01 microM) and FeSO4 (0.1 microM) led to the weakest binding (Figure 5, lane I). A type of chromatin immunoprecipitation evidence in which protein-DNA interactions are investigated at known genomic binding sites through a process of ChIP, DNA purification, and finally quantitative polymerase chain reaction (qPCR) for DNA detection. mchibucos 2010-11-16T05:26:47Z ChIP-qPCR evidence eco ECO:0000228 chromatin immunoprecipitation-qPCR evidence To confirm the in vivo binding of FimR to pfim, and to determine the impact of Mn2+ and Fe2+ on the binding activity of FimR, chromatin immunoprecipitation (ChIP) assay-quantitative real time PCR (qPCR) with anti-FimR antibody was employed as detailed in the materials and methods. The strongest binding of FimR to pfim was detected in cells grown in the presence of 50 microM MnCl2 and 50 microM FeSO4 (Figure 5, lane IV), whereas minimal amounts of MnCl2 (0.01 microM) and FeSO4 (0.1 microM) led to the weakest binding (Figure 5, lane I). PMID:23823757 A type of chromatin immunoprecipitation evidence in which protein-DNA interactions are investigated at known genomic binding sites through a process of ChIP, DNA purification, and finally quantitative polymerase chain reaction (qPCR) for DNA detection. url:https://www.diagenode.com/applications/chip-qpcr A type of chromatin immunoprecipitation evidence that uses high-throughput sequencing where immunoprecipitated DNA fragments are funnelled into a massively parallel sequencer to produce multiple short reads for locating binding sites of DNA-associated proteins. CollecTF mchibucos 2010-11-16T05:30:41Z ChIP-SEQ evidence ChIP-seq evidence eco ECO:0000229 ChIP-Seq experiments often use the input as a control to eliminate biases. To obtain similar results, ChIP-chip with high-density tiling arrays can be used. chromatin immunoprecipitation-seq evidence A type of chromatin immunoprecipitation evidence that uses high-throughput sequencing where immunoprecipitated DNA fragments are funnelled into a massively parallel sequencer to produce multiple short reads for locating binding sites of DNA-associated proteins. ECO:MCC ECO:SW OBI:0000716 PMID:22955991 ChIP-SEQ evidence OBI:0000716 ChIP-seq evidence PMID:22955991 A type of chromatin immunoprecipitation evidence that uses a tiling microarray for the detection of protein-bound DNA regions where chromatin is immunoprecipitated for protein tagging and DNA is sheared from the cross-linked protein-DNA complex to be arrayed revealing the protein-bound genomic regions. CollecTF mchibucos 2010-11-16T05:43:55Z MI:0225 ChIP-chip evidence ChIP-on-chip evidence eco ECO:0000230 A fixating agent such as formaldehyde is used to cross link proteins and DNA. Sonication is applied for DNA shearing. For transcription factor tagging, an antibody or epitope is employed. After cross-linking is reversed, the DNA is amplified and labeled with a flourophore for microarray which produces a resolution of aproximately 500 bp. chromatin immunoprecipitation-chip evidence A type of chromatin immunoprecipitation evidence that uses a tiling microarray for the detection of protein-bound DNA regions where chromatin is immunoprecipitated for protein tagging and DNA is sheared from the cross-linked protein-DNA complex to be arrayed revealing the protein-bound genomic regions. ECO:MCC ECO:SW PMID:18388953 PMID:19381927 MI:0225 chromatin immunoprecipitation array A type of DNA detection assay evidence where the reaction product is quantified in real-time across cycles by means of fluorescent dyes or fluorescent probes for detection and quantification of specific sequences in a DNA sample. CollecTF mchibucos 2010-11-16T05:57:20Z Q-PCR evidence qPCR evidence quantitative PCR evidence quantitative real-time PCR evidence real time polymerase chain reaction evidence real-time PCR evidence real-time quantitative PCR eco qRT-PCR evidence ECO:0000231 Quantitative PCR enables both detection and quantification (as absolute number of copies or relative amount when normalized to DNA input or additional normalizing genes) of one or more specific sequences in a DNA sample. The dye is activated upon binding double-stranded DNA. Although qRT-PCR is commonly found in literature synonymous to qPCR, it is preferable not to use this synonym as it is the accepted abbreviation for reverse transcription PCR. qPCR should be used instead (ISBN 978-0-470-68386-6 page 173). qPCR can be used to quantitatively determine levels of gene expression. quantitative polymerase chain reaction evidence A type of DNA detection assay evidence where the reaction product is quantified in real-time across cycles by means of fluorescent dyes or fluorescent probes for detection and quantification of specific sequences in a DNA sample. ECO:MCC ECO:SW A type of experimental evidence that is based on a five-step technique of cross-linking DNA in vivo, restriction digestion, intramolecular ligation, reversing DNA cross-links, DNA processing, and quantitation that serves to analyze the spatial organization of chromatin in a cell and quantify the number of interactions between genomic loci that are nearby in 3-D space. mchibucos 2010-11-17T12:27:14Z chromosome conformation capture-based evidence 3C chromosome conformation capture eco ECO:0000232 Chromosome conformation capture technologies are used to study the structural properties and spatial organization of chromosomes inside cells. All types of chromosome conformation capture technology involve five primary steps: cross-linking of DNA in vivo, restriction digestion, intramolecular ligation, reversing cross-linkages, and DNA enrichment and quantitation. The last step is different for each type of chromosome conformation capture technology, and may include PCR (3C), inverse PCR (4C), or ligation-mediated amplification (5C). Methods for product quantitation can include agarose gel detection or real-time quantitative PCR in the case of 3C, or high-throughput sequencing or microarray analysis for 4C and 5C. chromosome conformation-based evidence A type of experimental evidence that is based on a five-step technique of cross-linking DNA in vivo, restriction digestion, intramolecular ligation, reversing DNA cross-links, DNA processing, and quantitation that serves to analyze the spatial organization of chromatin in a cell and quantify the number of interactions between genomic loci that are nearby in 3-D space. ECO:MCC A type of chromosome conformation-based evidence that is derived by 1) quantifying interactions between a single pair of genomic loci and not multiple interactions and 2) performing polymerase chain reaction (PCR) in the final product quantitation step. mchibucos 2010-11-17T12:46:15Z 3C chromosome conformation capture evidence chromosome conformation capture-PCR evidence eco ECO:0000233 3C is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 3C differs only in the fifth step, which involves performing either standard polymerase chain reaction (PCR) or quantitative PCR (qPCR) for product quantitation. 3C evidence A type of chromosome conformation-based evidence that is derived by 1) quantifying interactions between a single pair of genomic loci and not multiple interactions and 2) performing polymerase chain reaction (PCR) in the final product quantitation step. ECO:MCC A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a prior circularized 3C library followed by product quantitation with a microarray. mchibucos 2010-11-19T01:20:28Z chromosome conformation capture on chip circularized 3C circularized chromosome conformation capture evidence eco ECO:0000234 4C is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 4C differs only in the fifth step, which involves inverse polymerase chain reaction (inverse PCR) on a circularized 3C library prior to product quantitation. 4C evidence A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a prior circularized 3C library followed by product quantitation with a microarray. ECO:MCC PMID:17033624 A type of chromosome conformation-based evidence that is derived by performing ligation-mediated amplification (LMA) prior to product quantitation. mchibucos 2010-11-19T01:22:20Z 5C carbon-copy 3C carbon-copy chromosome conformation capture evidence eco ECO:0000235 5C is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 5C differs only in the fifth step, which involves ligation-mediated amplification (LMA) followed by product quantitation. 5C evidence A type of chromosome conformation-based evidence that is derived by performing ligation-mediated amplification (LMA) prior to product quantitation. ECO:MCC A type of chromosome conformation capture evidence that is derived by performing polymerase chain reaction (PCR) in the quantitation step. mchibucos 2010-11-19T03:00:47Z 3C 3C-PCR eco ECO:0000236 See 3C evidence. 3C evidence was initially developed using PCR. chromosome conformation capture-PCR evidence true A type of chromosome conformation capture evidence that is derived by performing polymerase chain reaction (PCR) in the quantitation step. ECO:MCC A type of 3C evidence evidence that 1) quantifies interactions between a single pair of genomic loci (not multiple interactions) and 2) performs quantitative polymerase chain reaction (qPCR) in the quantitation step. mchibucos 2010-11-19T03:06:47Z 3C-quantitative PCR 3C-real-time PCR chromosome conformation capture-qPCR evidence eco ECO:0000237 3C-qPCR evidence A type of 3C evidence evidence that 1) quantifies interactions between a single pair of genomic loci (not multiple interactions) and 2) performs quantitative polymerase chain reaction (qPCR) in the quantitation step. ECO:MCC PMID:17641637 PMID:26025624 A type of chromosome conformation-based evidence that is derived by performing immunoprecipitation enrichment of the biotin labelled ligated fragments events prior to sequencing of the library and mapping it to the genome. mchibucos 2010-11-19T04:24:03Z eco ECO:0000238 Hi-C is used to study the structural properties and spatial organization of chromosomes inside cells. Hi-C is similar to other types of chromosome conformation capture technology, but involves the addition of biotinylated nucleotides during the second or fourth step and enrichment for ligated fragments using immunoprecipitation after the fourth step. Hi-C evidence A type of chromosome conformation-based evidence that is derived by performing immunoprecipitation enrichment of the biotin labelled ligated fragments events prior to sequencing of the library and mapping it to the genome. ECO:MCC A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a circularized 3C library prior to product quantitation with multiplexed high-throughput (HT) sequencing. mchibucos 2010-11-30T03:22:25Z 3C sequencing circularized 3C sequencing circularized 3C-seq eco chromosome conformation capture sequencing evidence ECO:0000239 3C-seq is used to study the structural properties and spatial organization of chromosomes inside cells. Like other types of chromosome conformation capture technology, 3C-seq differs only in the fifth step, which involves inverse polymerase chain reaction (PCR) on a circularized 3C library prior to product quantitation. 3C-seq evidence A type of chromosome conformation-based evidence that is derived by inverse polymerase chain reaction (inverse PCR) on a circularized 3C library prior to product quantitation with multiplexed high-throughput (HT) sequencing. ECO:MCC PMID:23411633 A type of experimental phenotypic evidence resulting from the disruption of a structural feature. mchibucos 2010-12-06T12:24:16Z anatomical perturbation evidence eco ECO:0000240 anatomical perturbation phenotypic evidence A type of experimental phenotypic evidence resulting from the disruption of a structural feature. ECO:MCC A type of experimental phenotypic evidence resulting from modification to the surroundings or conditions in which an organism lives or operates. mchibucos 2010-12-06T12:33:58Z environmental perturbation evidence eco mechanical constraint evidence ECO:0000241 Many environmental factors are subject to modification, such as temperature, pressure, humidity, radiation, and so forth. environmental perturbation phenotypic evidence A type of experimental phenotypic evidence resulting from modification to the surroundings or conditions in which an organism lives or operates. ECO:MCC A type of anatomical perturbation phenotypic evidence resulting from the surgical removal of tissue or subcellular components. mchibucos 2010-12-06T12:33:58Z ablated tissue evidence tissue ablation evidence eco ECO:0000242 tissue ablation phenotypic evidence A type of anatomical perturbation phenotypic evidence resulting from the surgical removal of tissue or subcellular components. ECO:MCC A type of anatomical perturbation phenotypic evidence resulting from the addition of tissue to an organism through a graft procedure. mchibucos 2010-12-06T12:33:58Z tissue grafting evidence eco ECO:0000243 tissue grafting phenotypic evidence A type of anatomical perturbation phenotypic evidence resulting from the addition of tissue to an organism through a graft procedure. ECO:MCC A type of combinatorial analysis that is used in a manual assertion. mchibucos 2010-12-09T02:02:12Z eco inferred from in-silico analysis ECO:0000244 Combinatorial analyses could include experimental or computational results. Examples include: (i) large-scale experiment such as a genome-wide two-hybrid or genome-wide synthetic interactions; (ii) integration of large-scale data sets of various types; and (iii) text-based-computation, e.g. text-mining. For simple sequence comparisons, one should use the sequence similarity analysis evidence type. For microarray results alone, expression pattern analysis is appropriate; whereas, large-scale computational analysis should be used when microarray results are combined with the results of other types of large-scale experiments. combinatorial evidence used in manual assertion true A type of combinatorial analysis that is used in a manual assertion. ECO:MCC RCA A type of automatically integrated combinatorial evidence that is used in a manual assertion. mchibucos 2010-12-09T02:37:54Z GOECO:RCA RCA inferred from reviewed computational analysis eco computational combinatorial evidence used in manual assertion ECO:0000245 automatically integrated combinatorial evidence used in manual assertion http://geneontology.org/page/rca-inferred-reviewed-computational-analysis true true RCA Default A type of automatically integrated combinatorial evidence that is used in a manual assertion. ECO:RCT GOECO:RCA inferred from reviewed computational analysis RCA GOECO:RCA inferred from reviewed computational analysis GOECO:RCA A type of computational combinatorial analysis that is used in an automatic assertion. mchibucos 2010-12-09T02:37:54Z eco ECO:0000246 Merged with ECO:0000053. computational combinatorial evidence used in automatic assertion true A type of computational combinatorial analysis that is used in an automatic assertion. ECO:MCC ISA A type of sequence alignment evidence that is used in a manual assertion. mchibucos 2010-12-09T05:12:27Z GOECO:ISA ISA inferred from sequence alignment eco ECO:0000247 sequence alignment evidence used in manual assertion http://geneontology.org/page/isa-inferred-sequence-alignment true ISA Default A type of sequence alignment evidence that is used in a manual assertion. ECO:RCT GOECO:ISA inferred from sequence alignment ISA GOECO:ISA inferred from sequence alignment GOECO:ISA IEA A type of sequence alignment evidence that is used in an automatic assertion. mchibucos 2010-12-09T05:12:27Z eco ECO:0000248 sequence alignment evidence used in automatic assertion true A type of sequence alignment evidence that is used in an automatic assertion. ECO:RCT IEA A type of sequence similarity evidence that is used in an automatic assertion. mchibucos 2010-12-09T05:22:30Z eco ECO:0000249 sequence similarity evidence used in automatic assertion true A type of sequence similarity evidence that is used in an automatic assertion. ECO:RCT ISS A type of sequence similarity evidence that is used in a manual assertion. mchibucos 2010-12-09T05:22:30Z GOECO:ISS ISS inferred from sequence or structural similarity eco ECO:0000250 sequence similarity evidence used in manual assertion http://geneontology.org/page/iss-inferred-sequence-or-structural-similarity true ISS Default A type of sequence similarity evidence that is used in a manual assertion. ECO:MCC GOECO:ISS inferred from sequence or structural similarity ISS GOECO:ISS inferred from sequence or structural similarity GOECO:ISS IEA A type of similarity evidence that is used in an automatic assertion. mchibucos 2010-12-09T05:28:12Z IS eco inferred from similarity ECO:0000251 similarity evidence used in automatic assertion true A type of similarity evidence that is used in an automatic assertion. ECO:RCT A type of similarity evidence that is used in a manual assertion. mchibucos 2010-12-09T05:28:12Z IS eco inferred from similarity ECO:0000252 similarity evidence used in manual assertion true A type of similarity evidence that is used in a manual assertion. ECO:RCT A type of genetic similarity evidence that is used in a manual assertion. mchibucos 2010-12-10T01:42:44Z IGTS eco inferred from genetic similarity ECO:0000253 genetic similarity evidence used in manual assertion true A type of genetic similarity evidence that is used in a manual assertion. ECO:RCT IEA A type of genetic similarity evidence that is used in an automatic assertion. mchibucos 2010-12-10T01:42:44Z IGTS eco inferred from genetic similarity ECO:0000254 genetic similarity evidence used in automatic assertion true A type of genetic similarity evidence that is used in an automatic assertion. ECO:RCT ISM A type of match to sequence model evidence that is used in a manual assertion. mchibucos 2010-12-10T02:26:35Z GOECO:ISM GO_REF:0000011 ISM inferred from sequence model eco ECO:0000255 match to sequence model evidence used in manual assertion http://geneontology.org/page/ism-inferred-sequence-model true ISM Default A type of match to sequence model evidence that is used in a manual assertion. ECO:RCT GOECO:ISM inferred from sequence model GO_REF:0000011 Hidden Markov Models (TIGR) ISM GOECO:ISM inferred from sequence model GOECO:ISM IEA A type of match to sequence model evidence that is used in an automatic assertion. mchibucos 2010-12-10T02:26:35Z GO_REF:0000002 GO_REF:0000107 eco ECO:0000256 match to sequence model evidence used in automatic assertion true A type of match to sequence model evidence that is used in an automatic assertion. ECO:RCT GO_REF:0000002 Gene Ontology annotation through association of InterPro records with GO terms. GO_REF:0000107 Automatic transfer of experimentally verified manual GO annotation data to orthologs using Ensembl ISM A type of motif similarity evidence that is used in a manual assertion. mchibucos 2010-12-10T02:44:34Z eco recognized domains ECO:0000257 motif similarity evidence used in manual assertion true A type of motif similarity evidence that is used in a manual assertion. ECO:RCT IEA A type of motif similarity evidence that is used in an automatic assertion. mchibucos 2010-12-10T02:44:34Z eco recognized domains ECO:0000258 motif similarity evidence used in automatic assertion true A type of motif similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of match to InterPro member signature evidence that is used in an automatic assertion. mchibucos 2010-12-10T02:54:51Z eco ECO:0000259 match to InterPro member signature evidence used in automatic assertion true A type of match to InterPro member signature evidence that is used in an automatic assertion. ECO:RCT ISM A type of match to InterPro member signature evidence that is used in a manual assertion. mchibucos 2010-12-10T02:54:51Z eco ECO:0000260 match to InterPro member signature evidence used in manual assertion true A type of match to InterPro member signature evidence that is used in a manual assertion. ECO:RCT IEA A type of targeting sequence prediction that is used in an automatic assertion. mchibucos 2010-12-10T03:02:49Z eco targeting sequence prediction ECO:0000261 targeting sequence prediction evidence used in automatic assertion true A type of targeting sequence prediction that is used in an automatic assertion. ECO:RCT ISM A type of targeting sequence prediction that is used in a manual assertion. mchibucos 2010-12-10T03:02:49Z eco targeting sequence prediction ECO:0000262 targeting sequence prediction evidence used in manual assertion true A type of targeting sequence prediction that is used in a manual assertion. ECO:RCT IEA A type of transmembrane domain prediction that is used in an automatic assertion. mchibucos 2010-12-10T03:28:35Z eco transmembrane domain prediction ECO:0000263 transmembrane domain prediction evidence used in automatic assertion true A type of transmembrane domain prediction that is used in an automatic assertion. ECO:RCT ISM A type of transmembrane domain prediction that is used in a manual assertion. mchibucos 2010-12-10T03:28:35Z eco transmembrane domain prediction ECO:0000264 transmembrane domain prediction evidence used in manual assertion true A type of transmembrane domain prediction that is used in a manual assertion. ECO:RCT IEA A type of sequence orthology evidence that is used in an automatic assertion. mchibucos 2010-12-10T03:39:41Z GO_REF:0000019 GO_REF:0000020 GO_REF:0000035 GO_REF:0000049 eco Ortholog evidence ortholog evidence ECO:0000265 sequence orthology evidence used in automatic assertion true A type of sequence orthology evidence that is used in an automatic assertion. ECO:RCT GO_REF:0000019 Automatic transfer of experimentally verified manual GO annotation data to orthologs using Ensembl Compara GO_REF:0000020 Electronic Gene Ontology annotations created by transferring manual GO annotations between orthologous microbial proteins. GO_REF:0000035 Automatic transfer of experimentally verified manual GO annotation data to plant orthologs using Ensembl Compara GO_REF:0000049 Automatic transfer of experimentally verified manual GO annotation data to fungal orthologs using Ensembl Compara ISO A type of sequence orthology evidence that is used in a manual assertion. mchibucos 2010-12-10T03:39:41Z GOECO:ISO ISO inferred from sequence orthology eco Ortholog evidence ortholog evidence ECO:0000266 sequence orthology evidence used in manual assertion http://geneontology.org/page/iso-inferred-sequence-orthology true ISO Default A type of sequence orthology evidence that is used in a manual assertion. ECO:MCC GOECO:ISO inferred from sequence orthology ISO GOECO:ISO inferred from sequence orthology GOECO:ISO A type of protein detection assay evidence where an antigen is bound to a substrate, and an antibody directly or indirectly linked to an enzyme is utilized to determine the amount of bound antigen which is visualized with a color change in the substrate. CollecTF mchibucos 2010-12-14T01:57:13Z MI:0411 ELISA evidence enzyme-linked immunosorbent assay eco ECO:0000267 ELISA is sometimes used in the study of transcriptional regulation to identify a produced protein, especially secreted protein. enzyme-linked immunoabsorbent assay evidence A type of protein detection assay evidence where an antigen is bound to a substrate, and an antibody directly or indirectly linked to an enzyme is utilized to determine the amount of bound antigen which is visualized with a color change in the substrate. ECO:MCC ECO:SW PMID:23949770 MI:0411 enzyme linked immunosorbent assay A type of direct assay evidence in which cells or particles are characterized by passing them through a light source and monitoring the resultant light scatter or fluorochrome excitation. mchibucos 2010-12-14T02:07:08Z FCM eco ECO:0000268 flow cytometry evidence A type of direct assay evidence in which cells or particles are characterized by passing them through a light source and monitoring the resultant light scatter or fluorochrome excitation. ECO:MCC EXP A type of experimental evidence that is used in a manual assertion. mchibucos 2010-12-20T05:36:49Z GOECO:EXP EXP inferred from experiment eco ECO:0000269 experimental evidence used in manual assertion http://geneontology.org/page/exp-inferred-experiment true EXP Default A type of experimental evidence that is used in a manual assertion. ECO:MCC GOECO:EXP inferred from experiment EXP GOECO:EXP inferred from experiment GOECO:EXP IEP A type of expression pattern evidence that is used in a manual assertion. mchibucos 2010-12-20T05:46:39Z GOECO:IEP IEP inferred from expression pattern eco ECO:0000270 expression pattern evidence used in manual assertion http://geneontology.org/page/iep-inferred-expression-pattern true IEP Default A type of expression pattern evidence that is used in a manual assertion. ECO:MCC GOECO:IEP inferred from expression pattern IEP GOECO:IEP inferred from expression pattern GOECO:IEP mchibucos 2010-12-20T05:51:58Z eco ECO:0000271 This general 'array experiment' term should not be used - replace with the specific type of array (e.g. ECO:0000273, ECO:0000276, ECO:0000285, etc.) array experiment evidence used in manual assertion true IEP A type of Affymetrix GeneChip evidence that is used in a manual assertion. mchibucos 2010-12-20T05:53:36Z Affymetrix array experiment evidence eco ECO:0000272 Affymetrix GeneChip evidence used in manual assertion true A type of Affymetrix GeneChip evidence that is used in a manual assertion. ECO:MCC IEP A type of cDNA to DNA expression microarray evidence that is used in a manual assertion. mchibucos 2010-12-20T05:55:49Z ECO:0001178 ECO:0005525 eco DNA microarray|RNA microarray ECO:0000273 cDNA to DNA expression microarray evidence used in manual assertion true A type of cDNA to DNA expression microarray evidence that is used in a manual assertion. ECO:MCC IDA A type of differential methylation hybridization evidence that is used in a manual assertion. mchibucos 2010-12-20T05:58:44Z CpG island microarray evidence CpG island microarray evidence used in manual assertion eco ECO:0000274 differential methylation hybridization evidence used in manual assertion true A type of differential methylation hybridization evidence that is used in a manual assertion. ECO:RCT IEP A type of expression microarray evidence that is used in a manual assertion. mchibucos 2010-12-20T06:01:26Z eco differential gene expression evidence from microarray experiment ECO:0000275 expression microarray evidence used in manual assertion true A type of expression microarray evidence that is used in a manual assertion. ECO:MCC IEP A type of cRNA to DNA expression microarray evidence that is used in a manual assertion. mchibucos 2010-12-20T06:03:28Z genomic microarray evidence genomic microarray evidence used in manual assertion eco ECO:0000276 cRNA to DNA expression microarray evidence used in manual assertion true A type of cRNA to DNA expression microarray evidence that is used in a manual assertion. ECO:RCT IEP A type of evidence arising from a Nimblegen array experiment that is used in a manual assertion. mchibucos 2010-12-20T06:05:20Z eco ECO:0000277 Nimblegen array evidence used in manual assertion true A type of evidence arising from a Nimblegen array experiment that is used in a manual assertion. ECO:MCC EXP A type of array-based sequence capture evidence that is used in a manual assertion. mchibucos 2010-12-20T06:09:45Z DNA microarray oligonucleotide microarray evidence oligonucleotide microarray evidence used in manual assertion eco SNP array evidence single nucleotide polymorphism array evidence ECO:0000278 array-based sequence capture evidence used in manual assertion true A type of array-based sequence capture evidence that is used in a manual assertion. ECO:MCC IEP A type of qualitative western immunoblotting evidence that is used in a manual assertion. mchibucos 2010-12-20T06:20:01Z ECO:0007183 protein expression level evidence based on western blot used in manual assertion eco Western blot expression analysis protein immunoblot protein levels (e.g. Western blots) ECO:0000279 qualitative western immunoblotting evidence used in manual assertion true true A type of qualitative western immunoblotting evidence that is used in a manual assertion. ECO:MCC IEP A type of expression library screen evidence that is used in a manual assertion. mchibucos 2010-12-20T06:24:05Z eco expression library screening ECO:0000281 expression library screen evidence used in manual assertion true A type of expression library screen evidence that is used in a manual assertion. ECO:MCC IEP A type of heterologous protein expression analysis that is used in a manual assertion. mchibucos 2010-12-20T06:27:04Z eco protein expression in heterologous system ECO:0000282 heterologous protein expression evidence used in manual assertion true A type of heterologous protein expression analysis that is used in a manual assertion. ECO:MCC IEP A type of protein expression spatial pattern analysis that is used in a manual assertion. mchibucos 2010-12-20T06:31:44Z eco ECO:0000283 spatial pattern of protein expression evidence used in manual assertion true A type of protein expression spatial pattern analysis that is used in a manual assertion. ECO:MCC IEP A type of protein expression analysis that is used in a manual assertion. mchibucos 2010-12-20T06:33:46Z ECO:0000280 protein expression level evidence used in manual assertion eco ECO:0000284 protein expression evidence used in manual assertion true A type of protein expression analysis that is used in a manual assertion. ECO:MCC IEP A type of DNA to cDNA expression microarray evidence that is used in a manual assertion. mchibucos 2010-12-20T06:41:33Z REM evidence RNA expression microarray evidence microarray RNA expression level evidence eco transcript levels (e.g. microarray data) ECO:0000285 DNA to cDNA expression microarray evidence used in manual assertion true A type of DNA to cDNA expression microarray evidence that is used in a manual assertion. ECO:MCC IEP A type of differential hybridization experiment that is used in a manual assertion. mchibucos 2010-12-20T06:55:14Z eco differential hybridization ECO:0000287 differential hybridization evidence used in manual assertion true A type of differential hybridization experiment that is used in a manual assertion. ECO:MCC EXP A type of RNA protection assay that is used in a manual assertion. mchibucos 2010-12-20T06:57:33Z ribonuclease protection assay eco RNA protection assay|RPA RNAse protection assay ECO:0000288 RNA protection assay evidence used in manual assertion true A type of RNA protection assay that is used in a manual assertion. ECO:MCC IEP A type of spatial pattern of transcript expression analysis that is used in a manual assertion. mchibucos 2010-12-20T06:59:18Z eco ECO:0000289 spatial pattern of transcript expression evidence used in manual assertion true A type of spatial pattern of transcript expression analysis that is used in a manual assertion. ECO:MCC IEP A type of subtractive hybridization experiment that is used in a manual assertion. mchibucos 2010-12-20T07:00:48Z eco subtractive hybridization ECO:0000290 subtractive hybridization evidence used in manual assertion true A type of subtractive hybridization experiment that is used in a manual assertion. ECO:MCC IEP A type of transcript expression evidence that is used in a manual assertion. mchibucos 2010-12-20T07:02:08Z ECO:0000286 transcript expression level evidence transcriptomics evidence used in manual assertion eco ECO:0000291 transcript expression evidence used in manual assertion true A type of transcript expression evidence that is used in a manual assertion. ECO:MCC A type of mutant phenotype evidence that uses anti-sense by introducing morpholino oligonucleotides into the cytosol of a cell. mchibucos 2011-01-10T03:36:25Z anti-sense eco ECO:0000292 Morpholino oligonucleotides modify gene expression by blocking access of other molecules to specific, approximately 25-base-long regions of the base-pairing surfaces of ribonucleic acid (RNA). To achieve this anti-sense knockdown technique, delivery of the morpholino can be achieved via microinjection, electroporation, or another method. morpholino experiment evidence A type of mutant phenotype evidence that uses anti-sense by introducing morpholino oligonucleotides into the cytosol of a cell. ECO:MCC A total of 160 SELEX fragments were cloned and sequenced, which were classified into 29 CRP-binding sequences, including 13 previously identified loci and 16 newly identified sites (Table S2). When the CRP-binding sequences are located upstream or near promoters of the flanking genes, these genes are predicted to be under the control of CRP. A type of evidence arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand. mchibucos 2011-01-10T04:23:50Z MI:0657 SELEX evidence in vitro selection evidence eco in vitro evolution evidence ECO:0000293 SELEX begins with the synthesis of a large oligonucleotide library, either single-stranded DNA or RNA, which consists of random fixed-length sequences flanked by constant 5' and 3' ends that serve as primers. The library is exposed to a target ligand, typically a protein or small organic compound. Unbound sequences are removed, typically with affinity chromatography. Bound sequences are eluted and the nucleic acid is extracted, followed by PCR amplification (RNA is first reverse transcribed). PCR product is converted to single stranded (DNA) or transcribed (RNA). Oligonucleotides are bound to the ligand again and the process is repeated with increasing elution stringency. After several rounds of the process, recovered oligonucleotides are sequenced and analyzed to reveal the binding specificity of the protein. systematic evolution of ligands by exponential amplification evidence A total of 160 SELEX fragments were cloned and sequenced, which were classified into 29 CRP-binding sequences, including 13 previously identified loci and 16 newly identified sites (Table S2). When the CRP-binding sequences are located upstream or near promoters of the flanking genes, these genes are predicted to be under the control of CRP. PMID:21673794 A type of evidence arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand. ECO:MCC url:http://en.wikipedia.org/wiki/Systematic_Evolution_of_Ligands_by_Exponential_Enrichment MI:0657 systematic evolution of ligands by exponential enrichment Bacterial one-hybrid assays confirmed the interaction between MtrA and the regulatory sequence of the dnaA initiator gene. A type of bait-prey hybrid interaction evidence that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey). mchibucos 2011-01-10T06:16:20Z B1H evidence eco ECO:0000294 Bacterial one-hybrid assay is a method for screening a library of candidate proteins (prey plasmid) for the ability to bind to a target, cis-regulatory element or any other short, DNA binding sequence placed 5' to reporter genes (bait plasmid). Transformation of a bacterial host with two different plasmids is required: One is designed to express the "bait". The other plasmid contains a "prey" which, if bound to by the chimeric fusion product, drives expression of downstream reporter genes. bacterial one-hybrid evidence Bacterial one-hybrid assays confirmed the interaction between MtrA and the regulatory sequence of the dnaA initiator gene. PMID:20843371 A type of bait-prey hybrid interaction evidence that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey). ECO:MCC A type of transcript evidence based on high-throughput (HT) sequencing of fragmented cDNA molecules. mchibucos 2011-01-11T12:54:50Z ECO:0000357 RNA-seq evidence RNAseq evidence WTSS whole transcriptome shotgun sequencing differential gene expression evidence from RNA-seq experiment eco RNA sequencing ECO:0000295 Total RNA is isolated from cells and mRNA is purified by targeting the 3' polyadenylated (poly(A)) tail with poly(T) oligos covalently attached to a substrate. Next, cDNA fragments are generated either by hydrolysis of RNA into 200-300 base oligonucleotides, preceded by reverse transcription, or by reverse transcription initiated by random primers. The cDNA second strand is synthesized, fragments are adapter ligated and high-throughput sequencing is performed by Roche 454, Illumina, ABI-SOLiD, or another HT sequencing technology. Resulting sort reads are aligned against a reference genome, and downstream analysis is performed. RNA-sequencing evidence A type of transcript evidence based on high-throughput (HT) sequencing of fragmented cDNA molecules. ECO:MCC whole transcriptome shotgun sequencing PMID:18611170 A type of experimental phenotypic evidence where embryonic development proceeds although cytokinesis is blocked. mchibucos 2011-01-11T03:28:49Z eco ECO:0000298 In the embryos of some organisms, inhibition of cytokinesis blocks neither the cell cycle nor the unfolding of the developmental program. As such, embryonic morphology can be frozen, allowing analysis of the developmental fate of each cell present at the time of cleavage arrest. cleavage arrested development evidence A type of experimental phenotypic evidence where embryonic development proceeds although cytokinesis is blocked. ECO:MCC A type of cleavage arrested development that arises after treatment with cytochalasin. mchibucos 2011-01-11T03:30:29Z eco ECO:0000299 Cytochalasin inhibits cytokinesis by blocking the formation of contractile microfilaments. cytochalasin experiment evidence A type of cleavage arrested development that arises after treatment with cytochalasin. ECO:MCC A type of immunolocalization evidence data that was generated using green fluorescent protein (GFP) as a marker. mchibucos 2011-01-11T03:48:50Z GFP immunolocalization evidence eco ECO:0000300 This term describes immunolocalization of the protein; to describe transcriptional activation, use the term "localization of green fluorescent protein transcript". green fluorescent protein immunolocalization evidence A type of immunolocalization evidence data that was generated using green fluorescent protein (GFP) as a marker. ECO:MCC A type of immunolocalization evidence that was generated using LacZ protein as a marker. mchibucos 2011-01-11T04:06:40Z LacZ protein immunolocalization evidence eco ECO:0000301 This term describes immunolocalization of the protein; to describe transcriptional activation, use the term "localization of LacZ transcript". beta-galactosidase protein immunolocalization evidence A type of immunolocalization evidence that was generated using LacZ protein as a marker. ECO:MCC A type of author statement that is used in a manual assertion. mchibucos 2011-01-20T02:26:47Z ECO:0007764 author inference used in manual assertion eco ECO:0000302 author statement used in manual assertion true A type of author statement that is used in a manual assertion. ECO:MCC NAS A type of author statement without traceable support that is used in a manual assertion. mchibucos 2011-01-20T02:29:50Z GOECO:NAS NAS eco non-traceable author statement ECO:0000303 author statement without traceable support used in manual assertion http://geneontology.org/page/nas-non-traceable-author-statement true NAS Default A type of author statement without traceable support that is used in a manual assertion. ECO:MCC GOECO:NAS non-traceable author statement NAS GOECO:NAS non-traceable author statement GOECO:NAS TAS A type of author statement supported by traceable reference that is used in a manual assertion. mchibucos 2011-01-20T02:31:03Z GOECO:TAS TAS eco traceable author statement ECO:0000304 author statement supported by traceable reference used in manual assertion http://geneontology.org/page/tas-traceable-author-statement true TAS Default A type of author statement supported by traceable reference that is used in a manual assertion. ECO:MCC GOECO:TAS traceable author statement TAS GOECO:TAS traceable author statement GOECO:TAS IC A type of curator inference that is used in a manual assertion. mchibucos 2011-01-20T02:33:32Z GOECO:IC IC inferred by curator eco ECO:0000305 curator inference used in manual assertion http://geneontology.org/page/ic-inferred-curator true IC Default A type of curator inference that is used in a manual assertion. ECO:MCC GOECO:IC inferred by curator IC GOECO:IC inferred by curator GOECO:IC IC A type of inference from background scientific knowledge that is used in a manual assertion. mchibucos 2011-01-20T02:35:11Z eco ECO:0000306 inference from background scientific knowledge used in manual assertion true A type of inference from background scientific knowledge that is used in a manual assertion. ECO:MCC ND An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an manual assertion. mchibucos 2011-01-20T02:43:18Z GOECO:ND ND no biological data available eco ECO:0000307 no evidence data found used in manual assertion http://geneontology.org/page/nd-no-biological-data-available true ND Default An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an manual assertion. ECO:MCC GOECO:ND no biological data available ND GOECO:ND no biological data available GOECO:ND A type of phylogenetic evidence whereby an aspect of a descendant gene is inferred through the characterization of an aspect of an ancestral gene. mchibucos 2011-02-04T05:41:26Z eco ECO:0000308 First, a characteristic of the most recent common ancestor (MRCA) is inferred from experimental evidence in descendants; this is followed by inferring a characteristic of a descendant of the MRCA. This type of evidence can be used in support of both positive and "not" GO annotations. biological aspect of ancestor evidence A type of phylogenetic evidence whereby an aspect of a descendant gene is inferred through the characterization of an aspect of an ancestral gene. ECO:MCC A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by a cap-trapper system. mchibucos 2011-02-17T01:33:09Z CAGE eco ECO:0000309 Complementary DNA (cDNA) is synthesized from microgram quantities of mRNA using first-strand cDNA primer (oligo dT12-18) and reverse transcriptase in the presence of trehalose and sorbitol, followed by selection of full-length cDNA with biotinylated cap-trapper. Linkers are attached to the 5' ends of full-length enriched cDNAs to introduce a recognition site for the restriction endonuclease MmeI, which creates a two base overhang. After amplification, sequencing tags are concatenated for high-throughput sequencing. Resulting sort reads are aligned against a reference genome, and downstream analysis is performed. cap analysis of gene expression evidence A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by a cap-trapper system. ECO:MCC CAGE PMID:16489339 A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by reverse transcriptase template switching. mchibucos 2011-02-17T01:33:34Z eco nanoCAGE ECO:0000310 NanoCAGE captures the 5' ends of molecules by template switching. When polymerizing the cDNA of a capped mRNA, the reverse transcriptase adds extra cytosines that are complementary to the cap. Each 5' full length cDNAs is extended upon hybridization of the riboguanosine-tailed template switching oligonucleotides to these extra cytosines. In semisuppressive PCR, the short templates fold intramolecularly and prevent the binding of primers, which precludes amplification; longer molecules are less likely to fold and are thus amplified. Templates derived from reaction artifacts form stable homoduplexes, also precluding amplification. After template switching, semisuppressive PCR, and EcoP151 cleavage, 25-bp tags are ligated to bar code-containing oligonucleotide adaptors. After PCR amplification, the nanoCAGE tags are sequenced by synthesis. NanoCAGE requires as little as 10 nanograms of total RNA. nano-cap analysis of gene expression evidence A type of transcript expression evidence based on high-throughput (HT) sequencing of the 5' ends of cDNA molecules that are selected by reverse transcriptase template switching. ECO:MCC nanoCAGE PMID:20543846 A type of evidence that is based on work performed by a person or group prior to a use by a different person or group. mchibucos 2011-03-02T05:24:13Z eco ECO:0000311 imported information A type of evidence that is based on work performed by a person or group prior to a use by a different person or group. ECO:MCC A type of imported information that is used in a manual assertion. mchibucos 2011-03-02T05:29:44Z eco ECO:0000312 imported information used in manual assertion true A type of imported information that is used in a manual assertion. ECO:MCC IEA A type of imported information that is used in an automatic assertion. mchibucos 2011-03-02T05:33:43Z eco ECO:0000313 imported information used in automatic assertion true A type of imported information that is used in an automatic assertion. ECO:MCC IDA A type of direct assay evidence that is used in a manual assertion. mchibucos 2011-10-28T04:59:31Z GOECO:IDA IDA inferred from direct assay eco ECO:0000314 direct assay evidence used in manual assertion http://geneontology.org/page/ida-inferred-direct-assay true IDA Default A type of direct assay evidence that is used in a manual assertion. ECO:MCC GOECO:IDA inferred from direct assay IDA GOECO:IDA inferred from direct assay GOECO:IDA IMP A type of mutant phenotype evidence that is used in a manual assertion. mchibucos 2011-10-28T05:12:49Z GOECO:IMP IMP inferred from mutant phenotype eco ECO:0000315 mutant phenotype evidence used in manual assertion http://geneontology.org/page/imp-inferred-mutant-phenotype true IMP Default A type of mutant phenotype evidence that is used in a manual assertion. ECO:MCC GOECO:IMP inferred from mutant phenotype IMP GOECO:IMP inferred from mutant phenotype GOECO:IMP IGI A type of genetic interaction experiment evidence that is used in a manual assertion. mchibucos 2011-10-28T05:14:42Z GOECO:IGI IGI inferred from genetic interaction eco ECO:0000316 genetic interaction evidence used in manual assertion http://geneontology.org/page/igi-inferred-genetic-interaction true IGI Default A type of genetic interaction experiment evidence that is used in a manual assertion. ECO:MCC GOECO:IGI inferred from genetic interaction IGI GOECO:IGI inferred from genetic interaction GOECO:IGI IGC A type of genomic context evidence that is used in a manual assertion. mchibucos 2011-10-28T05:22:53Z GOECO:IGC IGC inferred from genomic context eco ECO:0000317 genomic context evidence used in manual assertion http://geneontology.org/page/igc-inferred-genomic-context true IGC Default A type of genomic context evidence that is used in a manual assertion. ECO:MCC GOECO:IGC inferred from genomic context IGC GOECO:IGC inferred from genomic context GOECO:IGC IBA A type of biological aspect of ancestor evidence that is used in a manual assertion. mchibucos 2011-10-28T05:23:51Z GOECO:IBA IBA inferred from biological aspect of ancestor eco ECO:0000318 biological aspect of ancestor evidence used in manual assertion http://geneontology.org/page/iba-inferred-biological-aspect-ancestor true IBA Default A type of biological aspect of ancestor evidence that is used in a manual assertion. ECO:MCC GOECO:IBA inferred from biological aspect of ancestor IBA GOECO:IBA inferred from biological aspect of ancestor GOECO:IBA IBD A type of biological aspect of descendant evidence that is used in a manual assertion. mchibucos 2011-10-28T05:25:09Z GOECO:IBD IBD inferred from biological aspect of descendant eco ECO:0000319 biological aspect of descendant evidence used in manual assertion http://geneontology.org/page/ibd-inferred-biological-aspect-descendent true IBD Default A type of biological aspect of descendant evidence that is used in a manual assertion. ECO:MCC GOECO:IBD inferred from biological aspect of descendant IBD GOECO:IBD inferred from biological aspect of descendant GOECO:IBD IKR IMR A type of phylogenetic determination of loss of key residues evidence that is used in a manual assertion. mchibucos 2011-10-28T05:25:48Z GOECO:IKR GOECO:IMR IKR IMR inferred from key residues inferred from missing residues eco ECO:0000320 phylogenetic determination of loss of key residues evidence used in manual assertion http://geneontology.org/page/ikr-inferred-key-residues true IKR Default IMR Default A type of phylogenetic determination of loss of key residues evidence that is used in a manual assertion. ECO:MCC GOECO:IKR inferred from key residues GOECO:IMR inferred from missing residues IKR GOECO:IKR IMR GOECO:IKR inferred from key residues GOECO:IKR inferred from missing residues GOECO:IKR IRD A type of rapid divergence from ancestral sequence evidence that is used in a manual assertion. mchibucos 2011-10-28T05:26:42Z GOECO:IRD IRD inferred from rapid divergence eco ECO:0000321 rapid divergence from ancestral sequence evidence used in manual assertion http://geneontology.org/page/ird-inferred-rapid-divergence true IRD Default A type of rapid divergence from ancestral sequence evidence that is used in a manual assertion. ECO:MCC GOECO:IRD inferred from rapid divergence IRD GOECO:IRD inferred from rapid divergence GOECO:IRD IEA Evidence that was initially used in manual assertion by one person or group, which is imported by a second person or group and used in automatic assertion. mchibucos 2011-12-13T12:04:48Z GO_REF:0000037 GO_REF:0000039 GO_REF:0000041 eco ECO:0000322 imported manually asserted information used in automatic assertion Evidence that was initially used in manual assertion by one person or group, which is imported by a second person or group and used in automatic assertion. ECO:MCC GO_REF:0000037 Gene Ontology annotation based on manual assignment of UniProtKB keywords in UniProtKB/Swiss-Prot entries. GO_REF:0000039 Gene Ontology annotation based on the manual assignment of UniProtKB Subcellular Location terms in UniProtKB/Swiss-Prot entries. GO_REF:0000041 IEA (UniProt UniPathway) IEA A type of imported information used in automatic assertion that was initially used in automatic assertion by one person or group, which is imported by a second person or group and used in automatic assertion. mchibucos 2011-12-13T02:06:25Z GO_REF:0000038 GO_REF:0000040 eco ECO:0000323 imported automatically asserted information used in automatic assertion A type of imported information used in automatic assertion that was initially used in automatic assertion by one person or group, which is imported by a second person or group and used in automatic assertion. ECO:MCC GO_REF:0000038 Gene Ontology annotation based on automatic assignment of UniProtKB keywords in UniProtKB/TrEMBL entries. GO_REF:0000040 Gene Ontology annotation based on the automatic assignment of UniProtKB Subcellular Location terms in UniProtKB/TrEMBL entries. In the images shown in Figure 9, the MelR focus is 15 x 33 nm across the shortest and longest axes of the oval in the complex with the shortened arm (right hand panel), compared to 9 x 12 nm in the other complex (centre panel). The simplest explanation for these observations, that is consistent with the location of sites in the DNA fragment (Figure 9), is that one type of complex contains 3 MelR molecules bound at sites 2, 1 and 1' (centre panel), whilst the other contains 4 MelR molecules bound at sites 2, 1, 1' and R (right panel). A type of direct assay evidence in which an image is created and analyzed. mchibucos 2012-02-23T12:01:43Z ECO:0001122 ECO:0005024 ECO:MCC radiologic test evidence eco ECO:0000324 imaging assay evidence In the images shown in Figure 9, the MelR focus is 15 x 33 nm across the shortest and longest axes of the oval in the complex with the shortened arm (right hand panel), compared to 9 x 12 nm in the other complex (centre panel). The simplest explanation for these observations, that is consistent with the location of sites in the DNA fragment (Figure 9), is that one type of complex contains 3 MelR molecules bound at sites 2, 1 and 1' (centre panel), whilst the other contains 4 MelR molecules bound at sites 2, 1, 1' and R (right panel). PMID:18346968 A type of experimental evidence that is based on separation of constituent parts of a mixture (the mobile phase) as they pass differentially through a stationary phase due to differences in partition coefficient and retention on the stationary phase. mchibucos 2012-05-16T11:46:27Z chromatographic evidence eco ECO:0000325 chromatography evidence A type of experimental evidence that is based on separation of constituent parts of a mixture (the mobile phase) as they pass differentially through a stationary phase due to differences in partition coefficient and retention on the stationary phase. ECO:MCC A type of sequence alignment evidence that is based on comparing the position of exon junctions, relative to a reference genome, for a transcript annotation and a supporting transcript. mchibucos 2012-06-08T11:03:59Z eco ECO:0000326 transcript splice pattern evidence A type of sequence alignment evidence that is based on comparing the position of exon junctions, relative to a reference genome, for a transcript annotation and a supporting transcript. ECO:MCC A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features. mchibucos 2012-06-08T11:11:24Z eco ECO:0000327 This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that have the same splice pattern as a RefSeq transcript. If such full transcript information is not available, RefSeq reports sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, supported by the evidence term ECO:0000328 or a child. whole transcript splice pattern evidence A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features. ECO:MCC A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript. mchibucos 2012-06-08T11:21:57Z eco ECO:0000328 This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, but for which full transcript information is unavailable. For sequences that have the same splice pattern as a whole RefSeq transcript, use the evidence term ECO:0000327 or a child. coding sequence splice pattern evidence A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript. ECO:MCC ISA A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in manual assertion. mchibucos 2012-06-08T11:40:03Z eco ECO:0000329 This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that have the same splice pattern as a RefSeq transcript. If such full transcript information is not available, RefSeq reports sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, supported by the evidence term ECO:0000328 or a child. whole transcript splice pattern evidence used in manual assertion true A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in manual assertion. ECO:MCC ISA A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in manual assertion. mchibucos 2012-06-08T11:43:47Z eco ECO:0000330 This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, but for which full transcript information is unavailable. For sequences that have the same splice pattern as a whole RefSeq transcript, use the evidence term ECO:0000327 or a child. coding sequence splice pattern evidence used in manual assertion true A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in manual assertion. ECO:MCC IEA A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in automatic assertion. mchibucos 2012-06-08T11:48:09Z eco ECO:0000331 This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, but for which full transcript information is unavailable. For sequences that have the same splice pattern as a whole RefSeq transcript, use the evidence term ECO:0000327 or a child. coding sequence splice pattern evidence used in automatic assertion true A type of transcript splice pattern evidence that is based on the exon combination of a coding sequence (CDS), a sub-feature of a whole transcript, and is used in automatic assertion. ECO:MCC IEA A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in automatic assertion. mchibucos 2012-06-08T11:49:17Z eco ECO:0000332 This term is used by the NCBI Reference Sequences (RefSeq) in support of sequences that have the same splice pattern as a RefSeq transcript. If such full transcript information is not available, RefSeq reports sequences that match the splice pattern of a coding sequence (CDS) annotated on a RefSeq, supported by the evidence term ECO:0000328 or a child. whole transcript splice pattern evidence used in automatic assertion true A type of transcript splice pattern evidence that is based on the exon combination of a whole transcript, rather than its constituent features, and is used in automatic assertion. ECO:MCC A type of gel electrophoresis evidence where proteins are separated according to their electrophoretic mobility. mchibucos 2012-07-31T02:56:43Z SDS-PAGE evidence eco ECO:0000333 Electrophoretic mobility is a function of both the length and charge of a protein. The protein sample is linearized with sodium dodecyl sulfate (SDS), an anionic detergent. Typically, polypeptides bound with SDS possess an even distribution of charge per unit mass, and subsequent fractionation is by size. sodium dodecyl sulfate polyacrylamide gel electrophoresis evidence A type of gel electrophoresis evidence where proteins are separated according to their electrophoretic mobility. ECO:MCC PubMed:4861258 url:http://www.nature.com/nmeth/journal/v2/n1/full/nmeth0105-83.html url:http://www.ncbi.nlm.nih.gov/Class/NAWBIS/Modules/Protein/protein18.html A type of direct assay evidence resulting from an assay where both the size of and number of particles in a sample are determined. mchibucos 2012-07-31T03:19:32Z eco ECO:0000334 An example of an instrument used to analyze particle sizes and counts is the Beckman Coulter® Z Series system. particle size and count assay evidence A type of direct assay evidence resulting from an assay where both the size of and number of particles in a sample are determined. ECO:MCC A type of direct assay evidence where the quantity of a substance used as part of an assay is measured. mchibucos 2012-07-31T03:52:46Z eco ECO:0000335 Two examples of substance quantification assay are (i) measuring how much of a radiolabelled compound is taken up by a cell and (ii) measuring how much of a substrate is turned over by a given enzyme. substance quantification evidence A type of direct assay evidence where the quantity of a substance used as part of an assay is measured. ECO:MCC A type of cell proliferation assay evidence in which a mutated strain of a microorganism, such as a yeast or bacterium, is grown competitively with wild-type cells and the relative fitness of the strains is assessed usually by means of a fluorescent marker and flow cytometric analysis. mchibucos 2012-08-24T12:03:58Z fitness profiling eco ECO:0000336 competitive growth assay evidence A type of cell proliferation assay evidence in which a mutated strain of a microorganism, such as a yeast or bacterium, is grown competitively with wild-type cells and the relative fitness of the strains is assessed usually by means of a fluorescent marker and flow cytometric analysis. GOC:MAH PMID:14718172 PMID:20537132 fitness profiling GOC:MAH PMID:20537132 We analyzed the electrophoretic pattern of cytosolic proteins extracted from LM3 and LM3-2 cells, grown under standard conditions up to mid-exponential phase (Fig. 1). The presence of differentially expressed proteins in the two strains, together with results of previous studies [28,29] demonstrated the role of CcpA as global regulator in L. plantarum. A type of direct assay evidence where molecules have been sorted according to their size and charge by moving through a gel in the presence of an electric field. mchibucos 2012-08-24T12:11:51Z ECO:0005026 eco ECO:0000337 Molecules typically separated include DNA, RNA, or protein. The gel is typically made of agarose, polyacrylamide, or starch. gel electrophoresis evidence We analyzed the electrophoretic pattern of cytosolic proteins extracted from LM3 and LM3-2 cells, grown under standard conditions up to mid-exponential phase (Fig. 1). The presence of differentially expressed proteins in the two strains, together with results of previous studies [28,29] demonstrated the role of CcpA as global regulator in L. plantarum. PMID:17129387 A type of direct assay evidence where molecules have been sorted according to their size and charge by moving through a gel in the presence of an electric field. ECO:MCC wikipedia:Gel_electrophoresis A type of gel electrophoresis evidence in which large DNA molecules are separated on agarose gel by alternately pulsed, perpendicularly oriented electrical fields, at least one of which is inhomogeneous. mchibucos 2012-08-24T12:34:01Z PFGE eco ECO:0000338 pulsed-field gel electrophoresis evidence A type of gel electrophoresis evidence in which large DNA molecules are separated on agarose gel by alternately pulsed, perpendicularly oriented electrical fields, at least one of which is inhomogeneous. PMID:6373014 A type of gel electrophoresis evidence where DNA molecules are electrophoresed on a low percentage agarose gel followed by high voltage electrophoresis on a higher percentage agarose gel in the presence of ethidium bromide. mchibucos 2012-08-24T12:42:37Z 2-D agarose gel electrophoresis eco ECO:0000339 The first dimension gel is intentionally run at low voltage in low percentage agarose to separate DNA molecules in proportion to their mass. The second dimension is run at high voltage in a gel of higher agarose concentration in the presence of ethidium bromide so that the mobility of a non-linear molecule is drastically influenced by its shape. two-dimensional agarose gel electrophoresis evidence A type of gel electrophoresis evidence where DNA molecules are electrophoresed on a low percentage agarose gel followed by high voltage electrophoresis on a higher percentage agarose gel in the presence of ethidium bromide. PMID:16118435 PMID:8594382 A type of experimental evidence in which a plasmid that is capable of being replicated is introduced into cells, cells are grown without selection for several generations, and retention of the plasmid is determined. mchibucos 2012-08-24T01:27:58Z minichromosome maintenance assay evidence eco ECO:0000340 Loss per generation is determined by comparing colony numbers on selective and non-selective media. plasmid maintenance assay evidence A type of experimental evidence in which a plasmid that is capable of being replicated is introduced into cells, cells are grown without selection for several generations, and retention of the plasmid is determined. ECO:MCC PMID:6323245 minichromosome maintenance assay evidence PMID:6323245 A type of specific protein inhibition evidence where the molecular function of a protein is inhibited by an antibody. mchibucos 2012-08-24T01:48:24Z eco ECO:0000341 specific protein inhibition by antibody evidence A type of specific protein inhibition evidence where the molecular function of a protein is inhibited by an antibody. ECO:MCC A type of RNA-seq evidence where intron locations in predicted transcripts are compared to intron locations supported by RNA-seq evidence. mchibucos 2013-04-03T04:22:05Z Support of intron positions by RNA-seq alignment evidence eco ECO:0000342 RNA-seq alignment intron location evidence is used by NCBI RefSeq (http://www.ncbi.nlm.nih.gov/refseq). Exon-exon boundaries (or intron locations) of a RefSeq transcript, as determined by aligning the transcript to a reference chromosome, are compared to intron locations supported by RNAseq data. support of intron positions by RNA-sequencing alignment evidence A type of RNA-seq evidence where intron locations in predicted transcripts are compared to intron locations supported by RNA-seq evidence. ECO:MCC A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment from a single sample supports all of the intron positions (exon pairs) predicted for a transcript. mchibucos 2013-04-03T04:41:48Z Full support of intron positions by RNA-seq alignment evidence eco ECO:0000343 Full support entails that all exon pairs represented in the transcript are supported. For example, for a transcript containing five exons, if liver RNA-seq reads support all four introns but brain RNA-seq supports only three introns, then the liver data fully support the transcript exons whereas the brain data do not. full support of intron positions by RNA-sequencing alignment evidence A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment from a single sample supports all of the intron positions (exon pairs) predicted for a transcript. ECO:MCC A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment to a genome supports only some of the intron positions (exon pairs) predicted for a transcript. mchibucos 2013-04-03T04:50:46Z Partial support of intron positions by RNA-seq alignment evidence eco ECO:0000344 Partial support can occur in two ways. First, one or more exon-exon pair (intron) is not supported by any RNA-seq sample included in the analysis. Second, no single RNA-seq sample provides support for all exon-exon pairs (introns) represented in a transcript, but all represented exons are supported by at least one sample. partial support of intron positions by RNA-sequencing alignment evidence A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignment to a genome supports only some of the intron positions (exon pairs) predicted for a transcript. ECO:MCC A type of sequence alignment evidence resulting from the comparison of a single exon transcript to a collection / database of known single exon genes. mchibucos 2013-04-03T05:10:34Z eco ECO:0000345 single exon transcript confirmation via alignment evidence A type of sequence alignment evidence resulting from the comparison of a single exon transcript to a collection / database of known single exon genes. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4897596/ IEP A type of support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion. mchibucos 2013-04-04T04:37:35Z Support of intron positions by RNA-seq alignment evidence used in manual assertion eco ECO:0000346 support of intron positions by RNA-sequencing alignment evidence used in manual assertion true A type of support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion. ECO:MCC IEA A type of support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. mchibucos 2013-04-04T04:38:45Z Support of intron positions by RNA-seq alignment evidence used in automatic assertion eco ECO:0000347 support of intron positions by RNA-sequencing alignment evidence used in automatic assertion true A type of support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. ECO:MCC IEA A type of full support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. mchibucos 2013-04-04T04:40:19Z Full support of intron positions by RNA-seq alignment evidence used in automatic assertion eco ECO:0000348 full support of intron positions by RNA-sequencing alignment evidence used in automatic assertion true A type of full support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. ECO:MCC IEP A type of full support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion. mchibucos 2013-04-04T04:41:34Z Full support of intron positions by RNA-seq alignment evidence used in manual assertion eco ECO:0000349 full support of intron positions by RNA-sequencing alignment evidence used in manual assertion true A type of full support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion. ECO:MCC IEA A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. mchibucos 2013-04-04T04:42:53Z Partial support of intron positions by RNA-seq alignment evidence used in automatic assertion eco ECO:0000350 partial support of intron positions by RNA-sequencing alignment evidence used in automatic assertion true A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. ECO:MCC IEP A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion. mchibucos 2013-04-04T04:43:56Z Partial support of intron positions by RNA-seq alignment evidence used in manual assertion eco ECO:0000351 partial support of intron positions by RNA-sequencing alignment evidence used in manual assertion true A type of partial support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion. ECO:MCC A type of evidence that is used in an manual assertion. mchibucos eco ECO:0000352 evidence used in manual assertion true true A type of evidence that is used in an manual assertion. ECO:MCC IPI A type of physical interaction evidence that is used in a manual assertion. mchibucos 2013-10-31T21:01:27Z GOECO:IPI IPI inferred from physical interaction eco ECO:0000353 physical interaction evidence used in manual assertion http://geneontology.org/page/ipi-inferred-physical-interaction true IPI Default A type of physical interaction evidence that is used in a manual assertion. ECO:MCC GOECO:IPI inferred from physical interaction IPI GOECO:IPI inferred from physical interaction GOECO:IPI IGC A type of gene neighbors evidence that is used in a manual assertion. mchibucos 2013-11-19T13:37:24Z inferred from genome cluster GO_REF:0000025 eco ICL ECO:0000354 gene neighbors evidence used in manual assertion true A type of gene neighbors evidence that is used in a manual assertion. ECO:MCC GO_REF:0000025 operon structure as IGC evidence A type of phylogenetic evidence characterized by the mapping of the character states of living organisms onto phylogenies using the method of maximum parsimony. mchibucos 2014-04-22T17:02:31Z eco ECO:0000355 Example of use: "The presence of paired evaginated hemispheres and olfactory bulbs in both agnathan and gnathostome radiations suggests that such hemispheres were also present in the common ancestor." PMID: 7013637. Northcutt RG. (1981) Evolution of the telencephalon in nonmammals. Ann. Rev. Neurosci. phylogenetic distribution evidence A type of phylogenetic evidence characterized by the mapping of the character states of living organisms onto phylogenies using the method of maximum parsimony. ECO:MCC PMID:21238344 A type of transcript expression evidence resulting from a microarray analysis with the use of the Gene Set Enrichment Analysis (GSEA) method or the Fisher's-Exact (FE) method to assess the differential expression. mchibucos 2014-09-26T16:25:47Z eco ECO:0000358 differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) A type of transcript expression evidence resulting from a microarray analysis with the use of the Gene Set Enrichment Analysis (GSEA) method or the Fisher's-Exact (FE) method to assess the differential expression. PMID:19725948 A type of transcript expression evidence resulting from the use of the Gene Set Enrichment Analysis (GSEA) method or Fisher's-Exact (FE) method to assess an RNA-seq dataset for differential gene expression. mchibucos 2014-09-26T16:26:48Z eco ECO:0000359 differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) A type of transcript expression evidence resulting from the use of the Gene Set Enrichment Analysis (GSEA) method or Fisher's-Exact (FE) method to assess an RNA-seq dataset for differential gene expression. PMC:2881125 A type of experimental evidence resulting from the prediction of drug-target interactions by computational means. mchibucos 2014-09-26T16:39:11Z eco ECO:0000360 biological target-disease association via drug evidence A type of experimental evidence resulting from the prediction of drug-target interactions by computational means. https://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-018-2199-x A type of evidence where an assertion is derived from another assertion via logical inference or some non-logical but rational means. mchibucos 2015-07-14T11:19:37Z eco ECO:0000361 Inference is the process of deriving logical conclusions from premises known or assumed to be true, or alternatively, arriving at conclusions via some non-logical means of observation of patterns of facts, which can result in identifying new meanings and contexts for understanding. Given the evidence provided by a set of premises, deductive reasoning involves drawing conclusions that necessarily follow, i.e. are certain, whereas inductive reasoning generates conclusions that are likely to be, but are not necessarily, true. inferential evidence A type of evidence where an assertion is derived from another assertion via logical inference or some non-logical but rational means. ECO:MCC A type of inferential evidence based on a computationally derived unary inference or an inference chain in which at least one step is computationally derived. mchibucos 2015-07-14T11:24:27Z evidence based on computational logical inference eco ECO:0000362 computational inference A type of inferential evidence based on a computationally derived unary inference or an inference chain in which at least one step is computationally derived. ECO:MCC GOC:MC IEA A type of evidence based on computational logical inference that is used in automatic assertion. mchibucos 2015-07-14T11:35:08Z GO_REF:0000108 evidence based on computational logical inference used in automatic assertion eco ECO:0000363 computational inference used in automatic assertion true true A type of evidence based on computational logical inference that is used in automatic assertion. ECO:MCC GO_REF:0000108 Automatic assignment of GO terms using logical inference, based on on inter-ontology links IEA A type of evidence based on logical inference from a manually curated annotation that is used in an automatic assertion. mchibucos 2015-07-14T11:44:19Z eco ECO:0000364 evidence based on logical inference from manual annotation used in automatic assertion A type of evidence based on logical inference from a manually curated annotation that is used in an automatic assertion. ECO:MCC IEA A type of evidence based on logical inference from an automatically curated annotation that is used in an automatic assertion. mchibucos 2015-07-14T11:45:25Z eco ECO:0000366 evidence based on logical inference from automatic annotation used in automatic assertion A type of evidence based on logical inference from an automatically curated annotation that is used in an automatic assertion. ECO:MCC IEA A type of evidence that is used in an automatic assertion. cjm GOECO:IEA GO_REF:0000003 GO_REF:0000004 GO_REF:0000023 IEA inferred from electronic annotation eco ECO:0000501 evidence used in automatic assertion http://geneontology.org/page/automatically-assigned-evidence-codes true true IEA Default A type of evidence that is used in an automatic assertion. ECO:cjm GOECO:IEA inferred from electronic annotation GO_REF:0000003 Gene Ontology annotation based on Enzyme Commission mapping. GO_REF:0000004 Gene Ontology annotation based on Swiss-Prot keyword mapping. GO_REF:0000023 Gene Ontology annotation based on Swiss-Prot Subcellular Location vocabulary mapping. IEA GOECO:IEA inferred from electronic annotation GOECO:IEA A type of cell proliferation assay evidence resulting from the growth of cells in a micro-environment that mimics real tissue and establishes physiological cell-cell and cell-substrate interactions that regulate proliferation and differentiation. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001001 3D cell culture evidence A type of cell proliferation assay evidence resulting from the growth of cells in a micro-environment that mimics real tissue and establishes physiological cell-cell and cell-substrate interactions that regulate proliferation and differentiation. PMID:21042962 url:http://volttecnologia.com.br/wp-content/uploads/2016/03/Drug-discovery.pdf A type of cell-based assay evidence resulting from labeling cells with [3H]arachidonic acid and subsequently determining the release of the arachidonic acid by the cells. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001002 [3H]arachidonic acid release assay evidence A type of cell-based assay evidence resulting from labeling cells with [3H]arachidonic acid and subsequently determining the release of the arachidonic acid by the cells. ISBN:0323152295 PMID:20693009 A type of DNA synthesis cell proliferation assay evidence resulting from the measurement of cell proliferation rate by determining the incorporation of [3H]-thymidine into cellular nucleic acids. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001003 [3H]-thymidine incorporation assay evidence A type of DNA synthesis cell proliferation assay evidence resulting from the measurement of cell proliferation rate by determining the incorporation of [3H]-thymidine into cellular nucleic acids. OBI:0000669 url:http://www.scientistsolutions.com/forum/cell-culture-and-tissue-culture-proliferationapoptosis/3h-thymidine-incorporation-assay-rat-1a A type of cytotoxicity assay evidence resulting from the measurement of the amount of radioactive 51Cr released in the supernatant of a sample of 51Cr pre-labeled cells via cytolysis by effector cells (cytotoxic T-cells). SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001004 51Cr release assay evidence A type of cytotoxicity assay evidence resulting from the measurement of the amount of radioactive 51Cr released in the supernatant of a sample of 51Cr pre-labeled cells via cytolysis by effector cells (cytotoxic T-cells). PMC:3929704 url:http://www4.mpbio.com/ecom/docs/proddata.nsf/5f64ffd4f38c2fda8525645d00769d68/53d2a75653615bab852568cb00572ff3?OpenDocument A type of apoptotic assay evidence resulting from the use of 7-aminoactinomycin D (7-AAD) to distinguish viable, apoptotic, and dead cells, using the fact that permeability of the cell membrane, and fluorescence intensity, is low in early apoptotic cells and high in late apoptotic and dead cells. SIB:PG mchibucos 2014-03-16T11:30:54Z 7-AAD staining evidence 7-amino-actinomycin D staining evidence eco ECO:0001005 7-aminoactinomycin staining evidence A type of apoptotic assay evidence resulting from the use of 7-aminoactinomycin D (7-AAD) to distinguish viable, apoptotic, and dead cells, using the fact that permeability of the cell membrane, and fluorescence intensity, is low in early apoptotic cells and high in late apoptotic and dead cells. ECO:RCT A type of cell-based assay evidence resulting from the analysis of cell binding either to extracellular matrix proteins or other cells. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001006 adhesion assay evidence A type of cell-based assay evidence resulting from the analysis of cell binding either to extracellular matrix proteins or other cells. PMID:15576904 PMID:21909903 A type of ex vivo assay evidence derived by ex vivo selection of tumor-reactive lymphocytes, and their activation and numerical expansion before re-infusion to the autologous tumor-bearing host. SIB:PG mchibucos 2014-03-16T11:30:54Z Adoptive immunotherapy passive immunization eco ECO:0001007 adoptive cell transfer evidence A type of ex vivo assay evidence derived by ex vivo selection of tumor-reactive lymphocytes, and their activation and numerical expansion before re-infusion to the autologous tumor-bearing host. ECO:SN url:http://jco.ascopubs.org/content/23/10/2346.full.pdf+html url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2305722/pdf/nihms42807.pdf A type of cell viability assay evidence resulting from the continuous measurement of fluorescence intensity from the viable cells, where a cell permeable compound, resazurin (the active ingredient of alamarBlue), is reduced to fluorescent resorufin. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001008 alamarBlue assay evidence A type of cell viability assay evidence resulting from the continuous measurement of fluorescence intensity from the viable cells, where a cell permeable compound, resazurin (the active ingredient of alamarBlue), is reduced to fluorescent resorufin. PMC:3478843 url:https://www.thermofisher.com/us/en/home/references/protocols/cell-and-tissue-analysis/cell-profilteration-assay-protocols/cell-viability-with-alamarblue.html A type of anatomical perturbation phenotypic evidence resulting from the transplantation of an organ or tissue from one individual of the same species with a different genotype. SIB:PG mchibucos 2014-03-16T11:30:54Z Allotransplantation allograft transplantation experiment evidence allografting tissue grafting eco ECO:0001009 allograft transplantation phenotypic evidence A type of anatomical perturbation phenotypic evidence resulting from the transplantation of an organ or tissue from one individual of the same species with a different genotype. ECO:SN url:http://www.nature.com/subjects/allograft url:http://www.organdonor.gov/about/terms_and_topics/ A type of chromatography evidence where a positively charged ion exchange resin with an affinity for molecules having net negative surface charges is used to separate the molecules. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001010 anion-exchange chromatography evidence A type of chromatography evidence where a positively charged ion exchange resin with an affinity for molecules having net negative surface charges is used to separate the molecules. ECO:SN PMID:20978968 url:http://www.bio-rad.com/en-us/applications-technologies/anion-exchange-chromatography url:http://www.uta.edu/faculty/sawasthi/Enzymology-4351-5324/Class%20Syllabus%20Enzymology/Ion%20Exchange%20Chromatography-1.pdf A type of apoptotic assay evidence resulting from the addition and subsequent binding of Annexin V to phosphatidylserine in cells to detect if they are viable, apoptotic, or necrotic. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001011 annexin-V staining evidence A type of apoptotic assay evidence resulting from the addition and subsequent binding of Annexin V to phosphatidylserine in cells to detect if they are viable, apoptotic, or necrotic. PMC:3169266 A type of experimental phenotypic evidence resulting from behavioral phenotyping and analysis to assess cognitive functioning. SIB:PG mchibucos 2014-03-16T11:30:54Z behavioral assay evidence eco ECO:0001012 cognitive assay phenotypic evidence A type of experimental phenotypic evidence resulting from behavioral phenotyping and analysis to assess cognitive functioning. PMID:24462904 A type of immunological assay evidence resulting from inhibitory effect of monoclonal antibody combining with an antigen over other antibodies. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001013 blocking monoclonal antibody evidence A type of immunological assay evidence resulting from inhibitory effect of monoclonal antibody combining with an antigen over other antibodies. PMID:11292349 url:http://www.sciencedirect.com/science/article/pii/S0140673600034966 A type of immunological assay evidence resulting from the use of peptides to block antibodies from binding to their targets. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001014 blocking peptide evidence A type of immunological assay evidence resulting from the use of peptides to block antibodies from binding to their targets. ECO:RCT A type of immunological assay evidence resulting from the inhibitory effect of polyclonal antibodies (antibodies secreted by different B cell lineages), which while not reacting with a specific antigen, serve to prevent other antibodies from doing so. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001015 blocking polyclonal antibody evidence A type of direct assay evidence where a blood sample is extracted from an organism to analyze different blood components. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001016 blood test evidence A type of direct assay evidence where a blood sample is extracted from an organism to analyze different blood components. ECO:SN url:https://www.nhlbi.nih.gov/health/health-topics/topics/bdt A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the number of cells that migrate from the upper compartment of a chamber (separated by a micro-porous membrane) to the lower compartment, in which chemotactic agents are present. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001017 Boyden chamber assay evidence A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the number of cells that migrate from the upper compartment of a chamber (separated by a micro-porous membrane) to the lower compartment, in which chemotactic agents are present. PMID:13872176 PMID:15576901 A type of nucleotide analog incorporation evidence resulting from the incorporation of bromodeoxyuridine (BrdU) as a thymidine analog into nuclear DNA, resulting in a label that can be tracked using antibody probes. SIB:PG mchibucos 2014-03-16T11:30:54Z ECO:0005010 cell proliferation marker detection assay evidence 5-bromo-2'-deoxyuridine incorporation assay evidence BUdR incorporation assay evidence BrdU incorporation assay evidence BrdUrd incorporation assay evidence eco ECO:0001018 bromodeoxyuridine incorporation assay evidence A type of nucleotide analog incorporation evidence resulting from the incorporation of bromodeoxyuridine (BrdU) as a thymidine analog into nuclear DNA, resulting in a label that can be tracked using antibody probes. PMID:23690005 A type of apoptotic assay evidence resulting from the detection of caspase activation, which results in the cleaving of intracellular substrates during apoptosis. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001019 caspase assay evidence A type of apoptotic assay evidence resulting from the detection of caspase activation, which results in the cleaving of intracellular substrates during apoptosis. PMID:18314058 PMID:25086023 A type of cell-based assay evidence resulting from the quantification of a sample of cells. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001020 cell counting evidence A type of cell-based assay evidence resulting from the quantification of a sample of cells. ECO:RCT A type of cell-based assay evidence resulting from the quantification of cell permeability. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001021 cell permeability assay evidence A type of cell-based assay evidence resulting from the quantification of cell permeability. PMID:16962665 A type of staining evidence resulting from monitoring division by the use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to label intracellular molecules with carboxyfluorescein; when a labeled cell divides, the number of carboxyfluorescein-tagged molecules is split. SIB:PG mchibucos 2014-03-16T11:30:54Z CFDA-SE staining evidence CFSE-staining evidence eco ECO:0001022 carboxyfluorescein diacetate succinimidyl ester staining evidence A type of staining evidence resulting from monitoring division by the use of carboxyfluorescein diacetate succinimidyl ester (CFSE) to label intracellular molecules with carboxyfluorescein; when a labeled cell divides, the number of carboxyfluorescein-tagged molecules is split. PMC:3185625 A type of protein detection assay evidence resulting from a complex (a chemiluminescent compound, protein and a steroidal hapten) utilized as a labeled antigen, which emits light when treated with hydrogen peroxide and copper acetate at a high pH. SIB:PG mchibucos 2014-03-16T11:30:54Z CLIA evidence eco ECO:0001023 chemiluminescence-linked immunoassay evidence A type of protein detection assay evidence resulting from a complex (a chemiluminescent compound, protein and a steroidal hapten) utilized as a labeled antigen, which emits light when treated with hydrogen peroxide and copper acetate at a high pH. PMID:659901 A type of mutant phenotype evidence resulting from the fusion of two or more different genes to create one protein product. SIB:PG mchibucos 2014-03-16T11:30:54Z chimeric protein evidence eco ECO:0001024 chimeric protein phenotypic evidence A type of mutant phenotype evidence resulting from the fusion of two or more different genes to create one protein product. PMID:22588898 PMID:25832756 A type of gel electrophoresis evidence resulting from the electrophoresis of two substances together, allowing for the characterization of ligand/nucleic acid binding interactions. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001025 co-electrophoresis evidence A type of gel electrophoresis evidence resulting from the electrophoresis of two substances together, allowing for the characterization of ligand/nucleic acid binding interactions. PMID:7668395 A type of imaging assay evidence resulting from the limited observation of the co-occurrence of molecules in a subcellular location. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001026 co-localization evidence A type of imaging assay evidence resulting from the limited observation of the co-occurrence of molecules in a subcellular location. PMC:3074624 A type of direct assay evidence resulting from the counting of microbial colonies that arise from viable cells grown on a plate or dish. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001027 colony counting evidence A type of direct assay evidence resulting from the counting of microbial colonies that arise from viable cells grown on a plate or dish. PMID:16558698 PMID:23457446 A type of physical interaction evidence resulting from the separation of a mixture of molecules under the influence of a force such as artificial gravity, where molecules sedimenting together are assumed to interact. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001028 co-sedimentation assay evidence A type of physical interaction evidence resulting from the separation of a mixture of molecules under the influence of a force such as artificial gravity, where molecules sedimenting together are assumed to interact. MI:0027 A type of gel electrophoresis evidence resulting in the assessment of DNA breakage in a cell, based on size and shape of DNA migration. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001029 comet assay evidence A type of gel electrophoresis evidence resulting in the assessment of DNA breakage in a cell, based on size and shape of DNA migration. OBI:0302736 PMID:10737956 A type of knockout evidence resulting from a temporally-restricted and/or tissue-specific targeted gene removal. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001030 conditional knockout evidence A type of knockout evidence resulting from a temporally-restricted and/or tissue-specific targeted gene removal. PMC:3572410 A type of knockin evidence resulting from the targeted introduction of a temporally-restricted and/or tissue-specific mutation. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001031 conditional knockin evidence A type of knockin evidence resulting from the targeted introduction of a temporally-restricted and/or tissue-specific mutation. PMID:16832820 A type of experimental phenotypic evidence resulting from a constitutively active mutant (CAM), resulting in mutant proteins that remain active in the absence of upstream signals. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001032 constitutively active mutant evidence A type of experimental phenotypic evidence resulting from a constitutively active mutant (CAM), resulting in mutant proteins that remain active in the absence of upstream signals. PMID:12217490 To confirm this intriguing observation, we cross-linked AdpA and DNA in the presence of increasing amounts of ATP (figure 2b(iii)). In this assay, ATP prevented the formation of AdpA - DNA complexes in a concentration-dependent manner, an outcome consistent with the results obtained by SPR analysis. A type of protein binding evidence resulting from the identification of two interacting proteins (that exist in close proximity) by linking through covalent bonds followed by identification SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001033 cross-linking evidence To confirm this intriguing observation, we cross-linked AdpA and DNA in the presence of increasing amounts of ATP (figure 2b(iii)). In this assay, ATP prevented the formation of AdpA - DNA complexes in a concentration-dependent manner, an outcome consistent with the results obtained by SPR analysis. PMID:22870392 A type of protein binding evidence resulting from the identification of two interacting proteins (that exist in close proximity) by linking through covalent bonds followed by identification PMID:15530987 PMID:19241040 The crystal structures of E. coli MarR and Enterococcus faecalis SlyA-like proteins show their cross-sections are ~70 angstroms, suggesting they would protect ~20 bp of DNA (Alekshun et al., 2001; Wu et al., 2003). This suggests the presence of two SlyA dimers at the SlyA I site and at least three dimers at the SlyA II site. A type of structure determination evidence resulting from the use of a narrow beam of x-rays to identify molecular structures by creating a diffraction pattern. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001034 crystallography evidence The crystal structures of E. coli MarR and Enterococcus faecalis SlyA-like proteins show their cross-sections are ~70 angstroms, suggesting they would protect ~20 bp of DNA (Alekshun et al., 2001; Wu et al., 2003). This suggests the presence of two SlyA dimers at the SlyA I site and at least three dimers at the SlyA II site. PMID:17892462 A type of structure determination evidence resulting from the use of a narrow beam of x-rays to identify molecular structures by creating a diffraction pattern. MI:0114 A type of histochemistry evidence resulting from localizing chemical components of cells and organelles on histological sections. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001035 cytochemistry evidence A type of histochemistry evidence resulting from localizing chemical components of cells and organelles on histological sections. PMID:11597006 A type of apoptotic assay evidence resulting from the identification of an accumulation of cytochrome C in the cytoplasm after its release from the mitochondria, an early event in apoptosis. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001036 cytochrome C release assay evidence A type of apoptotic assay evidence resulting from the identification of an accumulation of cytochrome C in the cytoplasm after its release from the mitochondria, an early event in apoptosis. PMID:10914021 PMID:12815469 A type of staining evidence resulting from 4',6-diamidino-2-phenylindole (DAPI) binding to AT regions of DNA and emitting a blue fluorescence. SIB:PG mchibucos 2014-03-16T11:30:54Z DAPI staining evidence diaminophenylindole staining eco ECO:0001037 4',6-diamidino-2-phenylindole staining evidence A type of staining evidence resulting from 4',6-diamidino-2-phenylindole (DAPI) binding to AT regions of DNA and emitting a blue fluorescence. PMID:8580206 url:https://www.thermofisher.com/us/en/home/references/protocols/cell-and-tissue-analysis/protocols/dapi-imaging-protocol.html In contrast, and in full agreement with the previous results of Wade et al. (17), the longer deletion in the TB23 fragment, that removes MelR binding site 2, results in a sharp reduction in the repression of the melR promoter by MelR. A type of mutant phenotype evidence resulting from a mutation in which there is the removal of one or more contiguous nucleotides that may result in altered function or other measurable properties. SIB:PG mchibucos 2014-03-16T11:30:54Z ECO:0005510 deletion mutation evidence eco ECO:0001038 As a child of 'experimental phenotypic evidence', this is not to be confused with the biological processes deletion mutation / deletion deficiency in which DNA is lost during DNA replication. Contrast with knockout phenotypic evidence in which any number of changes to the DNA result in elimination of the function of the gene in question. The length of the DNA deleted can range from a single nucleotide to enough material that could include multiple genes. deletion mutation phenotypic evidence In contrast, and in full agreement with the previous results of Wade et al. (17), the longer deletion in the TB23 fragment, that removes MelR binding site 2, results in a sharp reduction in the repression of the melR promoter by MelR. PMID:18346968 A type of mutant phenotype evidence resulting from a mutation in which there is the removal of one or more contiguous nucleotides that may result in altered function or other measurable properties. SO:0000159 A type of apoptotic assay evidence resulting from the visualization via gel electrophoresis of the fragmented DNA (DNA ladder) which is the result of apoptotic DNA fragmentation. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001039 DNA laddering assay evidence A type of apoptotic assay evidence resulting from the visualization via gel electrophoresis of the fragmented DNA (DNA ladder) which is the result of apoptotic DNA fragmentation. PMC:4401164 A type of RNA detection assay evidence based on the direct application of a RNA mixture in a circular motion on a matrix for hybridization with labeled DNA fragments. CollecTF SIB:PG mchibucos 2014-03-16T11:30:54Z eco RNA dot blot ECO:0001040 RNA dot blot assay evidence A type of RNA detection assay evidence based on the direct application of a RNA mixture in a circular motion on a matrix for hybridization with labeled DNA fragments. ECO:SW PMID:21424648 A type of mutant phenotype evidence resulting from a mutated gene producing mutant polypeptides that disrupt the activity of the wild-type genes. SIB:PG mchibucos 2014-03-16T11:30:54Z dominant-negative mutant evidence eco ECO:0001042 dominant-negative mutant phenotypic evidence A type of mutant phenotype evidence resulting from a mutated gene producing mutant polypeptides that disrupt the activity of the wild-type genes. PMC:2217636 PMID:8018332 EXP A type of Edman degradation evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:59:00Z eco ECO:0001043 Edman degradation evidence used in manual assertion true A type of Edman degradation evidence that is used in a manual assertion. ECO:MCC A type of protein detection assay evidence resulting from labeling a termonal amino acid residue and cleaving it from a peptide by sequentially removing one residue at a time from the amino end of the peptide, without disrupting the bonds. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001044 Edman degradation evidence A type of protein detection assay evidence resulting from labeling a termonal amino acid residue and cleaving it from a peptide by sequentially removing one residue at a time from the amino end of the peptide, without disrupting the bonds. OBI:0000705 doi:10.3891/acta.chem.scand.04-0283 A type of affinity evidence resulting from the quantitative analysis of gene and protein expression monitored by proprietary eTag reporters. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001045 eTag assay evidence A type of affinity evidence resulting from the quantitative analysis of gene and protein expression monitored by proprietary eTag reporters. PMID:15137949 A type of physical interaction evidence resulting from a mixture of two molecules passed through a nitrocellulose filter, where one may be immobilized on the filter, and if the immobilized molecule is capable of binding to the other, it will be retained on the filter as well. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001046 filter binding assay evidence A type of physical interaction evidence resulting from a mixture of two molecules passed through a nitrocellulose filter, where one may be immobilized on the filter, and if the immobilized molecule is capable of binding to the other, it will be retained on the filter as well. PMID:23028069 A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of fluorescent probes to detect complementary sequences of nucleic acids. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001047 fluorescence in situ hybridization evidence A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of fluorescent probes to detect complementary sequences of nucleic acids. PMC:346675 PMID:6812046 A type of dynamic fluorescence quenching evidence resulting from the measurement of the proximity of two fluorophores, where the energy from an excited molecular fluorophore to another fluorophore can only occur within ~10nm. SIB:PG mchibucos 2014-03-16T11:30:54Z FRET eco ECO:0001048 fluorescence resonance energy transfer evidence A type of dynamic fluorescence quenching evidence resulting from the measurement of the proximity of two fluorophores, where the energy from an excited molecular fluorophore to another fluorophore can only occur within ~10nm. PMID:11516318 PMID:15696158 A type of chromatography evidence resulting from the exclusion of proteins based on molecular size by filtration through a porous matrix (swollen gel), from which larger molecules are excluded. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001049 gel-filtration evidence A type of chromatography evidence resulting from the exclusion of proteins based on molecular size by filtration through a porous matrix (swollen gel), from which larger molecules are excluded. CHMO:0001011 doi:10.1038/nmeth0506-410 A type of histology evidence resulting from the identification of chemical components in cells and tissues. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001050 histochemistry evidence A type of histology evidence resulting from the identification of chemical components in cells and tissues. MMO:0000497 A type of imaging assay evidence resulting from the qualitative microscopic examination of cells or tissues. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001051 histology evidence A type of imaging assay evidence resulting from the qualitative microscopic examination of cells or tissues. OBI:0600020 No OD increases with the mutant and the wild type were measured with DMSO provided as electron acceptor at 2 and 10 mM; however, HPLC analyses of cultures with 2 mM DMSO revealed that DMSO was completely consumed in wild type cultures, whereas no DMSO consumption was evident in the mutant cultures (Figure 3). A type of chromatography evidence resulting from the separation of molecules in a solute by forcing the solvent containing the sample through a column packed with nonporous particles at high pressure. mchibucos 2014-03-16T11:30:54Z HPLC evidence eco ECO:0001052 high-performance liquid chromatography evidence No OD increases with the mutant and the wild type were measured with DMSO provided as electron acceptor at 2 and 10 mM; however, HPLC analyses of cultures with 2 mM DMSO revealed that DMSO was completely consumed in wild type cultures, whereas no DMSO consumption was evident in the mutant cultures (Figure 3). PMID:21450087 A type of chromatography evidence resulting from the separation of molecules in a solute by forcing the solvent containing the sample through a column packed with nonporous particles at high pressure. PMID:16376355 A type of protein detection assay evidence resulting from the use of antibodies linked to coloring agents to localize structures in cell cultures to identify proteins. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001053 immunocytochemistry evidence A type of protein detection assay evidence resulting from the use of antibodies linked to coloring agents to localize structures in cell cultures to identify proteins. MI:1200 OBI:0001986 A type of immunological assay evidence resulting from the use of antibodies to remove specific proteins from a sample. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001054 immunodepletion evidence A type of immunological assay evidence resulting from the use of antibodies to remove specific proteins from a sample. BAO:0002505 A type of protein detection assay evidence resulting from the use of antibodies to detect proteins in localized cells of tissue sections. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001055 immunohistochemistry evidence A type of protein detection assay evidence resulting from the use of antibodies to detect proteins in localized cells of tissue sections. OBI:0001986 A type of genetic transformation evidence resulting from a mutation induced by a mutagenic compounds or irradiation. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001056 This term was made obsolete for a couple of reasons: the def. doesn’t make sense as the suggested means of mutagenesis fail to introduce exogenous DNA (it is a child of genetic transformation evidence) and the def. is too much like random mutagenesis evidence. induced mutation evidence true A type of genetic transformation evidence resulting from a mutation induced by a mutagenic compounds or irradiation. OBI:0001154 A type of acetylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001057 in vitro acetylation assay evidence A type of acetylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml A type of cleavage assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001058 in vitro cleavage assay evidence A type of cleavage assay evidence used in an in vitro experiment. PMID:21121091 A type of deubiquitination assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001059 in vitro deubiquitination assay evidence A type of deubiquitination assay evidence used in an in vitro experiment. ECO:SN PMID:19692941 SIB:PG A type of deacetylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001060 in vitro deacetylation assay evidence A type of deacetylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml A type of defarnesylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001061 in vitro defarnesylation assay evidence A type of defarnesylation assay evidence used in an in vitro experiment. ECO:SN PMID:16126733 SIB:PG A type of demethylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001062 in vitro demethylation assay evidence A type of demethylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Demethylation A type of desumoylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001063 in vitro desumoylation assay evidence A type of desumoylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/ A type of farnesylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001064 in vitro farnesylation assay evidence A type of farnesylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Farnesyltransferase A type of methylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001065 in vitro methylation assay evidence A type of methylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Methylation A type of palmitoylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001066 in vitro palmitoylation assay evidence A type of palmitoylation assay evidence used in an in vitro experiment. ECO:SN PMID:17077383 SIB:PG A type of phosphatase assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001067 in vitro phosphatase assay evidence A type of phosphatase assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Phosphatase A type of protein kinase assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001068 in vitro protein kinase assay evidence A type of protein kinase assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Protein_kinase url:http://en.wikipedia.org/wiki/Protein_phosphorylation A type of polyADP-ribosylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001069 in vitro polyADP-ribosylation assay evidence A type of polyADP-ribosylation assay evidence used in an in vitro experiment. ECO:SN PMID:21870253 SIB:PG A type of sumoylation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001070 in vitro sumoylation assay evidence A type of sumoylation assay evidence used in an in vitro experiment. ECO:SN SIB:PG url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/ A type of transcription assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001071 in vitro transcription assay evidence A type of transcription assay evidence used in an in vitro experiment. ECO:SN ECO:SW PMID:21125481 SIB:PG A type of translation assay evidence used in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001072 in vitro translation assay evidence A type of translation assay evidence used in an in vitro experiment. ECO:SN PMID:18230759 SIB:PG A type of ubiquitination assay evidenceused in an in vitro experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001073 in vitro ubiquitination assay evidence A type of ubiquitination assay evidenceused in an in vitro experiment. ECO:SN PMID:19692941 SIB:PG A type of acetylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001074 in vivo acetylation assay evidence A type of acetylation assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml A type of cleavage assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001075 in vivo cleavage assay evidence A type of cleavage assay evidence used in an in vivo experiment. ECO:SN PMID:22154596 A type of deacetylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001076 in vivo deacetylation assay evidence A type of deacetylation assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml A type of defarnesylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001077 in vivo defarnesylation assay evidence A type of defarnesylation assay evidence used in an in vivo experiment. ECO:SN PMID:15556768 PMID:16507103 SIB:PG A type of demethylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001078 in vivo demethylation assay evidence A type of demethylation assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Demethylation A type of deubiquitination assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001079 in vivo deubiquitination assay evidence A type of deubiquitination assay evidence used in an in vivo experiment. ECO:SN PMID:19692941 SIB:PG A type of desumoylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001080 in vivo desumoylation assay evidence A type of desumoylation assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/ A type of farnesylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001081 in vivo farnesylation assay evidence A type of farnesylation assay evidence used in an in vivo experiment. ECO:SN PMID:9030603 SIB:PG A type of methylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001082 in vivo methylation assay evidence A type of methylation assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Methylation A type of palmitoylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001083 in vivo palmitoylation assay evidence A type of palmitoylation assay evidence used in an in vivo experiment. ECO:SN PMID:10329400 SIB:PG A type of phosphatase assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001084 in vivo phosphatase assay evidence A type of phosphatase assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Phosphatase A type of protein kinase assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001085 in vivo protein kinase assay evidence A type of protein kinase assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://en.wikipedia.org/wiki/Protein_kinase url:http://en.wikipedia.org/wiki/Protein_phosphorylation A type of sumoylation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001086 in vivo sumoylation assay evidence A type of sumoylation assay evidence used in an in vivo experiment. ECO:SN SIB:PG url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/ A type of transcription assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001087 in vivo transcription assay evidence A type of transcription assay evidence used in an in vivo experiment. ECO:SN PMID:12181418 SIB:PG A type of translation assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001088 in vivo translation assay evidence A type of translation assay evidence used in an in vivo experiment. ECO:SN PMID:24901308 SIB:PG A type of ubiquitination assay evidence used in an in vivo experiment. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001089 in vivo ubiquitination assay evidence A type of ubiquitination assay evidence used in an in vivo experiment. ECO:SN PMID:19692941 SIB:PG A type of genetic transformation evidence resulting from the targetted replacement of a wild-type DNA sequence with a different sequence. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001090 knockin evidence A type of genetic transformation evidence resulting from the targetted replacement of a wild-type DNA sequence with a different sequence. PMID:18077807 PMID:21800101 A type of genetic transformation evidence resulting from a change in the DNA that results in the elimination of the function of the gene, allowing for functional analysis. SIB:PG mchibucos 2014-03-16T11:30:54Z knockout evidence gene deletion evidence gene knockout evidence eco ECO:0001091 A change in the DNA may result from any number of processes such (deletion, insertion, frame shift, etc.) Additionally, the gene may be made inoperative via homologous recombination, site-specific nucleases, zinc finger nucleases, transcription activator-like effector nucleases (TALENs), or CRISPR (Clustered regularly interspaced short palindromic repeats). Contrast with deletion mutation phenotypic evidence in which DNA is deleted which may result in altering the function of the resulting protein(s). knockout phenotypic evidence A type of genetic transformation evidence resulting from a change in the DNA that results in the elimination of the function of the gene, allowing for functional analysis. PMC:2782548 A type of physical interaction evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to a lipid. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001092 lipid binding assay evidence A type of physical interaction evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to a lipid. PMID:22848065 PMID:23681540 A type of physical interaction evidence resulting from the analysis of protein-protein interactions by use of a luciferase enzyme fused to a particular protein (or proteins), which are coexpressed with epitope-tagged partners in mammalian cells. SIB:PG mchibucos 2014-03-16T11:30:54Z LUMIER assay eco ECO:0001093 luminescence-based mammalian interactome mapping assay evidence A type of physical interaction evidence resulting from the analysis of protein-protein interactions by use of a luciferase enzyme fused to a particular protein (or proteins), which are coexpressed with epitope-tagged partners in mammalian cells. MI:0729 PMID:15761153 A type of experimental evidence that is visible to the naked eye cf. microscopy evidence which requires the aid of a microscope. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001094 macroscopy evidence A type of bait-prey hybrid interaction evidence resulting from the analysis of proteins of interest attached to two portions of the transcriptional activator, and in interaction bring the two portions together to increase expression of the reporter gene. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001095 mammalian 2-hybrid assay evidence A type of bait-prey hybrid interaction evidence resulting from the analysis of proteins of interest attached to two portions of the transcriptional activator, and in interaction bring the two portions together to increase expression of the reporter gene. ECO:RCT PMID:9043710 The MS analyses showed that two VapB10 peaks (836.437, 1584.789 m/z) and three VapC10-His6 peaks (1049.526, 1299.733 and 1455.853 m/z) were detected in MS-DIGEST program, indicating that both VapB10 and VapC10-His6 had the expected peptide masses (Figure S3). These results suggest that VapB10 binds to VapC10-His6 forming the TA complex VapBC10 in vivo, which may cause the counteraction of the VapC10-induced growth arrest (Figure 2). A type of spectrometry evidence resulting from identifying the amount and type of material entities present in a sample by fragmenting it and measuring the mass-to-charge ratio of the resulting particles. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001096 mass spectrometry evidence The MS analyses showed that two VapB10 peaks (836.437, 1584.789 m/z) and three VapC10-His6 peaks (1049.526, 1299.733 and 1455.853 m/z) were detected in MS-DIGEST program, indicating that both VapB10 and VapC10-His6 had the expected peptide masses (Figure S3). These results suggest that VapB10 binds to VapC10-His6 forming the TA complex VapBC10 in vivo, which may cause the counteraction of the VapC10-induced growth arrest (Figure 2). PMID:24260461 A type of spectrometry evidence resulting from identifying the amount and type of material entities present in a sample by fragmenting it and measuring the mass-to-charge ratio of the resulting particles. OBI:0000470 A type of imaging assay evidence resulting from the use of technology to visualize and provide information about the body to diagnose, treat, or monitor medical conditions. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001097 medical imaging evidence A type of imaging assay evidence resulting from the use of technology to visualize and provide information about the body to diagnose, treat, or monitor medical conditions. url:http://www.fda.gov/Radiation-EmittingProducts/RadiationEmittingProductsandProcedures/MedicalImaging/ucm2005914.htm A type of direct assay evidence resulting from the use of a microscope. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001098 Microscopy may include any of the following: optical, electron, scanning probe, or X-ray. microscopy evidence A type of direct assay evidence resulting from the use of a microscope. ECO:MCC A type of cell-based assay evidence to measure cell motility in which a "wound" is created in a cell monolayer and the migration of the cells is captured by imaging at regular intervals during cell migration to close the wound. SIB:PG mchibucos 2014-03-16T11:30:54Z ECO:0001135 wound healing assay evidence eco ECO:0001099 motility wound healing assay evidence A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) in combination with phenazine methyl sulfate (PMS) as an intermediate electron acceptor reagent to produce a soluble formazan dye in viable cells. SIB:PG mchibucos 2014-03-16T11:30:54Z 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium eco ECO:0001100 MTS assay evidence A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) in combination with phenazine methyl sulfate (PMS) as an intermediate electron acceptor reagent to produce a soluble formazan dye in viable cells. NBK:144065 PMID:1867954 A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to its insoluble purple formazan dye in viable cells and measures cell viability / metabolic activity. SIB:PG mchibucos 2014-03-16T11:30:54Z 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide eco ECO:0001101 MTT assay evidence A type of apoptotic assay evidence resulting from the reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) to its insoluble purple formazan dye in viable cells and measures cell viability / metabolic activity. NBK:144065 PMID:6606682 A type of protein detection assay evidence resulting from determination of analyte concentration by fluorescent bead sets attached to an antibody (to a specific analyte) with a fluorescent reporter dye label attached to a second antibody (to a specific analyte). SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001102 multiplex bead-based immunoassay evidence A type of protein detection assay evidence resulting from determination of analyte concentration by fluorescent bead sets attached to an antibody (to a specific analyte) with a fluorescent reporter dye label attached to a second antibody (to a specific analyte). PMC:1534009 A type of experimental phenotypic evidence resulting from the observation of the impact of a natural mutation on the expressed traits. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001103 natural variation mutant evidence A type of experimental phenotypic evidence resulting from the observation of the impact of a natural mutation on the expressed traits. ECO:RCT A type of apoptotic assay evidence resulting from the nuclei fragmenting into smaller pieces during programmed cell death. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001104 nuclear fragmentation evidence A type of apoptotic assay evidence resulting from the nuclei fragmenting into smaller pieces during programmed cell death. PMID:16738861 A type of magnetic resonance evidence in which atomic nuclei in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001105 nuclear magnetic resonance evidence A type of magnetic resonance evidence in which atomic nuclei in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured. url:https://en.wikipedia.org/wiki/Nuclear_magnetic_resonance A type of RNA detection assay evidence resulting from the detection and quantitation of specific RNAs (from a sample of total cellular RNA) that are bound by antisense RNA or DNA probes and therefore protected from nucleases. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001106 nuclease protection assay evidence A type of RNA detection assay evidence resulting from the detection and quantitation of specific RNAs (from a sample of total cellular RNA) that are bound by antisense RNA or DNA probes and therefore protected from nucleases. PMID:17486122 PMID:18428580 A type of DNA synthesis cell proliferation assay evidence resulting from the analysis and measurement of the incorporation of fluorescently labeled nucleotide analog(s) into the DNA. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001107 nucleotide analog incorporation assay evidence A type of DNA synthesis cell proliferation assay evidence resulting from the analysis and measurement of the incorporation of fluorescently labeled nucleotide analog(s) into the DNA. PMC:3149870 A type of protein binding evidence resulting from the panning of a phage library where the individual phage displayed a different peptide or protein by fusion to coat proteins on the capsid. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001108 phage display evidence A type of protein binding evidence resulting from the panning of a phage library where the individual phage displayed a different peptide or protein by fusion to coat proteins on the capsid. MI:0084 PMID:11680867 A type of direct assay evidence resulting from the identification of the phosphorylated residue in a protein by amino acid analysis. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001109 phosphoamino acid analysis evidence A type of direct assay evidence resulting from the identification of the phosphorylated residue in a protein by amino acid analysis. PMID:11680867 PMID:18429115 A type of affinity evidence resulting from the appending of affinity tags on proteins so that they may be purified from their biological source using an affinity technique. SIB:PG mchibucos 2014-03-16T11:30:54Z phosphopeptide affinity enrichment evidence eco ECO:0001110 peptide affinity enrichment evidence A type of direct assay evidence resulting from the physical examination and measurement of the feature of a subject or sample. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001111 physical examination evidence A type of direct assay evidence resulting from the physical examination and measurement of the feature of a subject or sample. ECO:RCT A type of protein binding evidence resulting from protein-bound peptides detected from a collection of peptides arranged as an array and incubated with the partner protein in order to map protein-protein interaction sites. SIB:PG mchibucos 2014-03-16T11:30:54Z phosphopeptide array evidence eco ECO:0001112 peptide array evidence A type of protein binding evidence resulting from protein-bound peptides detected from a collection of peptides arranged as an array and incubated with the partner protein in order to map protein-protein interaction sites. PMID:21243154 A type of mutant phenotype evidence resulting from the change in a single nucleotide. SIB:PG mchibucos 2014-03-16T11:30:54Z point mutation evidence eco ECO:0001113 point mutation phenotypic evidence A type of mutant phenotype evidence resulting from the change in a single nucleotide. SO:1000008 A type of staining evidence resulting from the binding and labeling of DNA (during apoptosis, when there is a loss of nuclear DNA content) with propidium iodide (PI) to identify the cells from which it originated. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001114 propidium iodide staining evidence A type of staining evidence resulting from the binding and labeling of DNA (during apoptosis, when there is a loss of nuclear DNA content) with propidium iodide (PI) to identify the cells from which it originated. PMID:17406435 A type of direct assay evidence resulting from the analysis of a molecule by its intrinsic fluorescence, or by attaching it with a fluorophore. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001115 fluorescence evidence A type of direct assay evidence resulting from the analysis of a molecule by its intrinsic fluorescence, or by attaching it with a fluorophore. url:http://www.nature.com/subjects/biological-fluorescence A type of protein detection assay evidence resulting from protein samples immobilized on a membrane, then subsequently incubated and imaged. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001116 protein dot blot assay evidence A type of protein detection assay evidence resulting from protein samples immobilized on a membrane, then subsequently incubated and imaged. doi:10.1007/978-94-009-0951-9_24 A type of protein detection assay evidence resulting from proteins immobilized to prepare protein chips, or microwells, that can be utilized to determine presence of proteins, monitor differential expression profiles, and/or study protein interactions. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001117 protein microarray evidence A type of protein detection assay evidence resulting from proteins immobilized to prepare protein chips, or microwells, that can be utilized to determine presence of proteins, monitor differential expression profiles, and/or study protein interactions. PMC:1828913 A type of sequencing assay evidence resulting from determining the sequence of amino acids in a protein. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001118 protein sequencing assay evidence A type of sequencing assay evidence resulting from determining the sequence of amino acids in a protein. ERO:0001287 A type of mass spectrometry evidence resulting from quantitative analysis of peptides, proteins, and proteomes. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001119 quantitative mass spectrometry evidence A type of mass spectrometry evidence resulting from quantitative analysis of peptides, proteins, and proteomes. PMID:22665296 A type of direct assay evidence resulting from the assessment of biological reactions by use of a radioactive isotope to label the reactant. SIB:PG mchibucos 2014-03-16T11:30:54Z radioassay radioisotopic assay eco ECO:0001120 radioisotope assay evidence A type of direct assay evidence resulting from the assessment of biological reactions by use of a radioactive isotope to label the reactant. ISBN:978-3-642-50036-7 A type of protein detection assay evidence resulting from the use of a radioligand to measure the binding of a substance to a specific antibody or other receptor system. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001121 radioimmunoassay evidence A type of protein detection assay evidence resulting from the use of a radioligand to measure the binding of a substance to a specific antibody or other receptor system. MeSH:D011863 A type of direct assay evidence from the analysis of the real-time interaction between an analyte in solution and its interactant linked to the surface of the resonant mirror. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001123 resonant mirror biosensor evidence A type of direct assay evidence from the analysis of the real-time interaction between an analyte in solution and its interactant linked to the surface of the resonant mirror. PMID:19151938 A type of DNA detection assay evidence resulting from homologous DNA fragments digested by restriction enzymes, and the resulting restriction fragments are sorted by length to illustrate differences. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001124 restriction fragment detection evidence A type of DNA detection assay evidence resulting from homologous DNA fragments digested by restriction enzymes, and the resulting restriction fragments are sorted by length to illustrate differences. doi:10.1007/978-94-009-0951-9_24 url:http://www.ncbi.nlm.nih.gov/probe/docs/techrflp/ A type of spectrometry evidence resulting from the evaluation of a molecule in a fluid or solid by its ability to alter the transmission of light at specific wavelengths. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001126 spectrophotometry evidence A type of spectrometry evidence resulting from the evaluation of a molecule in a fluid or solid by its ability to alter the transmission of light at specific wavelengths. MMO:0000173 Electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR) demonstrated that AdpAHis6 specifically bound the oriC fragment (283-bp) containing the in silico-predicted A-boxes in a concentration-dependent manner (figures 1b and 2a), but not the remaining part of oriC (data not shown). Further confirmation of the specific interaction was obtained by conducting the competing surface plasmon resonance (SPR) assay with the unlabeled DNA fragments. As shown in Additional file 3, a significantly lower response was observed when either the unlabeled S2 or S5 was added together with MtrA, which indicated that they could compete the binding of MtrA with the promoter DNA on the chip. Our SPR analysis revealed that also housekeeping genes required for ribosome function (rplR) and beta subunit RNA polymerase (rpoB) belong to the LexA regulon, a feature of the SOS network not yet observed in bacteria. A type of physical interaction evidence based on real-time, rapid plasmon generation on the interface between a planar surface and vacuum that measures changes in refractive index close to the sensor surface when an analyte and its immobilized ligand bind to observe and characterize molecular interaction. SIB:PG mchibucos 2014-03-16T11:30:54Z SPR evidence eco ECO:0001127 Plasmons are generated by an incident light beam. surface plasmon resonance evidence Electrophoretic mobility shift assay (EMSA) and surface plasmon resonance (SPR) demonstrated that AdpAHis6 specifically bound the oriC fragment (283-bp) containing the in silico-predicted A-boxes in a concentration-dependent manner (figures 1b and 2a), but not the remaining part of oriC (data not shown). PMID:22870392 Further confirmation of the specific interaction was obtained by conducting the competing surface plasmon resonance (SPR) assay with the unlabeled DNA fragments. As shown in Additional file 3, a significantly lower response was observed when either the unlabeled S2 or S5 was added together with MtrA, which indicated that they could compete the binding of MtrA with the promoter DNA on the chip. PMID:20843371 Our SPR analysis revealed that also housekeeping genes required for ribosome function (rplR) and beta subunit RNA polymerase (rpoB) belong to the LexA regulon, a feature of the SOS network not yet observed in bacteria. PMID:24713082 A type of physical interaction evidence based on real-time, rapid plasmon generation on the interface between a planar surface and vacuum that measures changes in refractive index close to the sensor surface when an analyte and its immobilized ligand bind to observe and characterize molecular interaction. ECO:SW PMID:11578932 PMID:19151937 PMID:8574707 SPR evidence PMID:11578932 A type of experimental phenotypic evidence resulting from a transplantation in which the transplanted material (stem cells) is from an individual's identical twin. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001128 syngeneic transplantation experiment evidence A type of experimental phenotypic evidence resulting from a transplantation in which the transplanted material (stem cells) is from an individual's identical twin. PMID:18469352 A type of enzymatic activity assay evidence resulting from the analysis of tumor necrosis factor (TNF)-a converting enzyme (TACE), which releases a soluble TNF-a from the membrane-bound precursor protein. SIB:PG mchibucos 2014-03-16T11:30:54Z Tumor necrosis factor - alpha converting enzyme activity assay eco ECO:0001129 TACE activity assay evidence A type of enzymatic activity assay evidence resulting from the analysis of tumor necrosis factor (TNF)-a converting enzyme (TACE), which releases a soluble TNF-a from the membrane-bound precursor protein. PMC:1808921 A type of cytochemistry evidence resulting from the analysis of section(s) of a paraffin block containing embedded tissues cores arranged in an array pattern. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001130 tissue microarray evidence A type of cytochemistry evidence resulting from the analysis of section(s) of a paraffin block containing embedded tissues cores arranged in an array pattern. PMID:11770905 A type of genetic transformation evidence resulting from an organism that has had its expressed phenotype altered by modification. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001131 transgenic organism evidence A type of genetic transformation evidence resulting from an organism that has had its expressed phenotype altered by modification. OBI:1000048 A type of mass spectrometry evidence resulting from the analysis of prepared phosphopeptides separated in two dimensions on a TLC plate. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001132 tryptic phosphopeptide mapping assay evidence A type of mass spectrometry evidence resulting from the analysis of prepared phosphopeptides separated in two dimensions on a TLC plate. PMID:18429120 A type of apoptotic assay evidence resulting from the visualization of DNA fragmentation by detection of exposed 3'-OH ends, localized by terminal deoxynucleotidyl transferase (TdT) which then catalyzes the addition of labeled dUTPs. SIB:PG mchibucos 2014-03-16T11:30:54Z TUNEL assay evidence TdT-mediated dUTP-biotin nick end labeling assay terminal deoxynucleotidyl transferase-dUTP nick end labeling assay evidence eco ECO:0001133 terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence A type of apoptotic assay evidence resulting from the visualization of DNA fragmentation by detection of exposed 3'-OH ends, localized by terminal deoxynucleotidyl transferase (TdT) which then catalyzes the addition of labeled dUTPs. PMID:22566045 A type of direct assay evidence resulting from the analysis of a urine sample. SIB:PG mchibucos 2014-03-16T11:30:54Z eco ECO:0001134 urine test evidence A type of direct assay evidence resulting from the analysis of a urine sample. ECO:RCT A type of cell proliferation assay evidence resulting from the assessment of metabolic activity from a water-soluble tetrazolium salt WST-1 being reduced outside the cell (by reacting with mitochondrial succinate-tetrazolium reductase) to form a formazan dye. SIB:PG mchibucos 2014-03-16T11:30:54Z ECO:0005009 metabolic cell proliferation assay evidence eco ECO:0001136 WST-1 assay evidence A type of cell proliferation assay evidence resulting from the assessment of metabolic activity from a water-soluble tetrazolium salt WST-1 being reduced outside the cell (by reacting with mitochondrial succinate-tetrazolium reductase) to form a formazan dye. PMID:18417231 A type of anatomical perturbation phenotypic evidence resulting from the transplantation, implantation, or infusion of live cells, tissues, or organs between individuals of different species. SIB:PG mchibucos 2014-03-16T11:30:54Z Xenograft transplantation Xenografting Xenotransplantation xenotransplantation experiment evidence tissue grafting eco ECO:0001137 xenotransplantation phenotypic evidence A type of anatomical perturbation phenotypic evidence resulting from the transplantation, implantation, or infusion of live cells, tissues, or organs between individuals of different species. ECO:SN url:http://ilarjournal.oxfordjournals.org/content/37/1/16.full.pdf+html url:http://www.fda.gov/BiologicsBloodVaccines/Xenotransplantation/ IDA A type of 3D cell culture evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:18:35Z eco ECO:0001138 3D cell culture evidence used in manual assertion true A type of 3D cell culture evidence that is used in a manual assertion. ECO:MCC IDA A type of 51Cr release assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:20:55Z eco ECO:0001139 51Cr release assay evidence used in manual assertion true A type of 51Cr release assay evidence that is used in a manual assertion. ECO:MCC IDA A type of 7-aminoactinomycin staining evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:22:01Z 7-AAD staining evidence 7-amino-actinomycin D staining evidence eco ECO:0001140 7-aminoactinomycin staining evidence used in manual assertion true A type of 7-aminoactinomycin staining evidence that is used in a manual assertion. ECO:MCC IDA A type of [3H]-thymidine incorporation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:31:52Z eco ECO:0001141 [3H]-thymidine incorporation assay evidence used in manual assertion true A type of [3H]-thymidine incorporation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of [3H]arachidonic acid release assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:32:44Z eco ECO:0001142 [3H]arachidonic acid release assay evidence used in manual assertion true A type of [3H]arachidonic acid release assay evidence that is used in a manual assertion. ECO:MCC IDA A type of adhesion assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:33:38Z eco ECO:0001143 adhesion assay evidence used in manual assertion true A type of adhesion assay evidence that is used in a manual assertion. ECO:MCC IDA A type of adoptive cell transfer evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:36:19Z Adoptive immunotherapy passive immunization eco ECO:0001144 adoptive cell transfer evidence used in manual assertion true A type of adoptive cell transfer evidence that is used in a manual assertion. ECO:MCC IDA A type of alamarBlue assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:37:21Z eco ECO:0001145 alamarBlue assay evidence used in manual assertion true A type of alamarBlue assay evidence that is used in a manual assertion. ECO:MCC EXP A type of allograft transplantation phenotypic evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:38:22Z Allotransplantation allografting allograft transplantation evidence used in manual assertion eco tissue grafting ECO:0001146 allograft transplantation phenotypic evidence used in manual assertion true A type of allograft transplantation phenotypic evidence that is used in a manual assertion. ECO:MCC EXP A type of anion-exchange chromatography evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:44:30Z eco ECO:0001147 anion-exchange chromatography evidence used in manual assertion true A type of anion-exchange chromatography evidence that is used in a manual assertion. ECO:MCC IDA A type of annexin-V staining evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:52:01Z eco ECO:0001148 annexin-V staining evidence used in manual assertion true A type of annexin-V staining evidence that is used in a manual assertion. ECO:MCC EXP A type of cognitive assay phenotypic evidence used that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:53:38Z behavioral assay evidence used in manual assertion eco ECO:0001149 cognitive assay phenotypic evidence used in manual assertion true A type of cognitive assay phenotypic evidence used that is used in a manual assertion. ECO:MCC IPI A type of blocking monoclonal antibody evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:54:44Z eco ECO:0001150 blocking monoclonal antibody evidence used in manual assertion true A type of blocking monoclonal antibody evidence that is used in a manual assertion. ECO:MCC IPI A type of blocking peptide evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T15:55:33Z eco ECO:0001151 blocking peptide evidence used in manual assertion true A type of blocking peptide evidence that is used in a manual assertion. ECO:MCC IPI A type of blocking polyclonal antibody evidence tthat is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:01:39Z eco ECO:0001152 blocking polyclonal antibody evidence used in manual assertion true A type of blocking polyclonal antibody evidence tthat is used in a manual assertion. ECO:MCC IDA A type of blood test evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:02:47Z eco ECO:0001153 blood test evidence used in manual assertion true A type of blood test evidence that is used in a manual assertion. ECO:MCC IDA A type of Boyden chamber assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:03:53Z eco ECO:0001154 Boyden chamber assay evidence used in manual assertion true A type of Boyden chamber assay evidence that is used in a manual assertion. ECO:MCC IDA A type of bromodeoxyuridine incorporation assay evidence used in manual assertion. SIB:PG mchibucos 2014-03-17T16:04:49Z 5-bromo-2'-deoxyuridine incorporation assay evidence BUdR incorporation assay evidence BrdU incorporation assay evidence BrdUrd incorporation assay evidence eco ECO:0001155 bromodeoxyuridine incorporation assay evidence used in manual assertion true A type of bromodeoxyuridine incorporation assay evidence used in manual assertion. ECO:MCC IDA A type of caspase assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:06:06Z eco ECO:0001156 caspase assay evidence used in manual assertion true A type of caspase assay evidence that is used in a manual assertion. ECO:MCC IDA A type of cell counting evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:07:13Z eco ECO:0001157 cell counting evidence used in manual assertion true A type of cell counting evidence that is used in a manual assertion. ECO:MCC IDA A type of cell permeability assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:07:58Z eco ECO:0001158 cell permeability assay evidence used in manual assertion true A type of cell permeability assay evidence that is used in a manual assertion. ECO:MCC IDA A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:08:54Z CFDA-SE staining evidence CFSE-staining evidence eco ECO:0001159 carboxyfluorescein diacetate succinimidyl ester staining evidence used in manual assertion true A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in a manual assertion. ECO:MCC EXP A type of chemiluminescence-linked immunoassay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:09:55Z CLIA evidence eco ECO:0001160 chemiluminescence-linked immunoassay evidence used in manual assertion true A type of chemiluminescence-linked immunoassay evidence that is used in a manual assertion. ECO:MCC IMP A type of chimeric protein phenotypic evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:10:40Z chimeric protein evidence used in manual assertion eco ECO:0001161 chimeric protein phenotypic evidence used in manual assertion true A type of chimeric protein phenotypic evidence that is used in a manual assertion. ECO:MCC IDA A type of co-electrophoresis evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:11:22Z eco ECO:0001162 co-electrophoresis evidence used in manual assertion true A type of co-electrophoresis evidence that is used in a manual assertion. ECO:MCC IDA A type of co-localization evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:12:04Z eco ECO:0001163 co-localization evidence used in manual assertion true A type of co-localization evidence that is used in a manual assertion. ECO:MCC IPI A type of co-sedimentation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:12:55Z eco ECO:0001164 co-sedimentation assay evidence used in manual assertion true A type of co-sedimentation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of colony counting evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:14:57Z eco ECO:0001165 colony counting evidence used in manual assertion true A type of colony counting evidence that is used in a manual assertion. ECO:MCC IDA A type of comet assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:16:01Z eco ECO:0001166 comet assay evidence used in manual assertion true A type of comet assay evidence that is used in a manual assertion. ECO:MCC IMP A type of conditional knockin evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:17:22Z eco ECO:0001167 conditional knockin evidence used in manual assertion true A type of conditional knockin evidence that is used in a manual assertion. ECO:MCC IMP A type of conditional knockout evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:17:58Z eco ECO:0001168 conditional knockout evidence used in manual assertion true A type of conditional knockout evidence that is used in a manual assertion. ECO:MCC EXP A type of constitutively active mutant evidence that is used a in manual assertion. SIB:PG mchibucos 2014-03-17T16:20:23Z eco ECO:0001169 constitutively active mutant evidence used in manual assertion true A type of constitutively active mutant evidence that is used a in manual assertion. ECO:MCC IPI A type of cross-linking evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:21:29Z eco ECO:0001170 cross-linking evidence used in manual assertion true A type of cross-linking evidence that is used in a manual assertion. ECO:MCC EXP A type of crystallography evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:22:20Z eco ECO:0001171 crystallography evidence used in manual assertion true A type of crystallography evidence that is used in a manual assertion. ECO:MCC IDA A type of cytochemistry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:23:10Z eco ECO:0001172 cytochemistry evidence used in manual assertion true A type of cytochemistry evidence that is used in a manual assertion. ECO:MCC IDA A type of cytochrome C release assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:23:53Z eco ECO:0001173 cytochrome C release assay evidence used in manual assertion true A type of cytochrome C release assay evidence that is used in a manual assertion. ECO:MCC IDA A type of 4',6-diamidino-2-phenylindole staining evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:25:03Z DAPI staining evidence eco ECO:0001174 4',6-diamidino-2-phenylindole staining evidence used in manual assertion true A type of 4',6-diamidino-2-phenylindole staining evidence that is used in a manual assertion. ECO:MCC IMP A type of deletion mutation phenotypic evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:25:54Z deletion mutation evidence used in manual assertion eco ECO:0001175 deletion mutation phenotypic evidence used in manual assertion true A type of deletion mutation phenotypic evidence that is used in a manual assertion. ECO:MCC IDA A type of DNA laddering assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:26:46Z eco ECO:0001176 DNA laddering assay evidence used in manual assertion true A type of DNA laddering assay evidence that is used in a manual assertion. ECO:MCC EXP A type of RNA dot blot assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:45:52Z RNA dot blot evidence eco ECO:0001177 RNA dot blot assay evidence used in manual assertion true A type of RNA dot blot assay evidence that is used in a manual assertion. ECO:MCC IMP A type of dominant-negative mutant phenotypic evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:47:44Z dominant-negative mutant evidence used in manual assertion eco ECO:0001179 dominant-negative mutant phenotypic evidence used in manual assertion true A type of dominant-negative mutant phenotypic evidence that is used in a manual assertion. ECO:MCC IPI A type of eTag assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T16:59:39Z eco ECO:0001180 eTag assay evidence used in manual assertion true A type of eTag assay evidence that is used in a manual assertion. ECO:MCC IPI A type of filter binding assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:03:28Z eco ECO:0001181 filter binding assay evidence used in manual assertion true A type of filter binding assay evidence that is used in a manual assertion. ECO:MCC IEP A type of fluorescence in situ hybridization evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:04:20Z eco ECO:0001182 fluorescence in situ hybridization evidence used in manual assertion true true A type of fluorescence in situ hybridization evidence that is used in a manual assertion. ECO:MCC IPI A type of fluorescence resonance energy transfer evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:05:22Z FRET evidence eco ECO:0001183 fluorescence resonance energy transfer evidence used in manual assertion true A type of fluorescence resonance energy transfer evidence that is used in a manual assertion. ECO:MCC EXP A type of gel-filtration evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:06:14Z eco ECO:0001184 gel-filtration evidence used in manual assertion true A type of gel-filtration evidence that is used in a manual assertion. ECO:MCC IDA A type of histochemistry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:07:19Z eco ECO:0001185 histochemistry evidence used in manual assertion true A type of histochemistry evidence that is used in a manual assertion. ECO:MCC EXP A type of immunocytochemistry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:12:39Z eco ECO:0001186 immunocytochemistry evidence used in manual assertion true A type of immunocytochemistry evidence that is used in a manual assertion. ECO:MCC IDA A type of histology evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:09:50Z eco ECO:0001187 histology evidence used in manual assertion true A type of histology evidence that is used in a manual assertion. ECO:MCC IPI A type of immunodepletion evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:16:19Z eco ECO:0001188 immunodepletion evidence used in manual assertion true A type of immunodepletion evidence that is used in a manual assertion. ECO:MCC EXP A type of immunohistochemistry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:17:22Z eco ECO:0001189 immunohistochemistry evidence used in manual assertion true A type of immunohistochemistry evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro acetylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:19:24Z eco ECO:0001190 in vitro acetylation assay evidence used in manual assertion true A type of in vitro acetylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro cleavage assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:21:22Z eco ECO:0001191 in vitro cleavage assay evidence used in manual assertion true A type of in vitro cleavage assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro deacetylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:23:42Z eco ECO:0001192 in vitro deacetylation assay evidence used in manual assertion true A type of in vitro deacetylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro defarnesylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:25:45Z eco ECO:0001193 in vitro defarnesylation assay evidence used in manual assertion true A type of in vitro defarnesylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro demethylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:27:00Z eco ECO:0001194 in vitro demethylation assay evidence used in manual assertion true A type of in vitro demethylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro desumoylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:29:01Z eco ECO:0001195 in vitro desumoylation assay evidence used in manual assertion true A type of in vitro desumoylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro deubiquitination assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:29:48Z eco ECO:0001196 in vitro deubiquitination assay evidence used in manual assertion true A type of in vitro deubiquitination assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro farnesylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:30:50Z eco ECO:0001197 in vitro farnesylation assay evidence used in manual assertion true A type of in vitro farnesylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro methylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:31:54Z eco ECO:0001198 in vitro methylation assay evidence used in manual assertion true A type of in vitro methylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro palmitoylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:32:57Z eco ECO:0001199 in vitro palmitoylation assay evidence used in manual assertion true A type of in vitro palmitoylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro phosphatase assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:34:16Z eco ECO:0001200 in vitro phosphatase assay evidence used in manual assertion true A type of in vitro phosphatase assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro polyADP-ribosylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:34:57Z eco ECO:0001201 in vitro polyADP-ribosylation assay evidence used in manual assertion true A type of in vitro polyADP-ribosylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro protein kinase assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:39:57Z eco ECO:0001202 in vitro protein kinase assay evidence used in manual assertion true A type of in vitro protein kinase assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro sumoylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:41:25Z eco ECO:0001203 in vitro sumoylation assay evidence used in manual assertion true A type of in vitro sumoylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro transcription assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:44:40Z eco ECO:0001204 in vitro transcription assay evidence used in manual assertion true A type of in vitro transcription assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro translation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:46:30Z eco ECO:0001205 in vitro translation assay evidence used in manual assertion true A type of in vitro translation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vitro ubiquitination assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:47:18Z eco ECO:0001206 in vitro ubiquitination assay evidence used in manual assertion true A type of in vitro ubiquitination assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo acetylation assay evidence that is used in manual assertion. SIB:PG mchibucos 2014-03-17T17:48:56Z eco ECO:0001207 in vivo acetylation assay evidence used in manual assertion true A type of in vivo acetylation assay evidence that is used in manual assertion. ECO:MCC IDA A type of in vivo cleavage assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:49:43Z eco ECO:0001208 in vivo cleavage assay evidence used in manual assertion true A type of in vivo cleavage assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo deacetylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:50:47Z eco ECO:0001209 in vivo deacetylation assay evidence used in manual assertion true A type of in vivo deacetylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo defarnesylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:52:41Z eco ECO:0001210 in vivo defarnesylation assay evidence used in manual assertion true A type of in vivo defarnesylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo demethylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:53:40Z eco ECO:0001211 in vivo demethylation assay evidence used in manual assertion true A type of in vivo demethylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo desumoylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:54:36Z eco ECO:0001212 in vivo desumoylation assay evidence used in manual assertion true A type of in vivo desumoylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo deubiquitination assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:56:28Z eco ECO:0001213 in vivo deubiquitination assay evidence used in manual assertion true A type of in vivo deubiquitination assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo farnesylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T17:57:18Z eco ECO:0001214 in vivo farnesylation assay evidence used in manual assertion true A type of in vivo farnesylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo methylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:03:16Z eco ECO:0001215 in vivo methylation assay evidence used in manual assertion true A type of in vivo methylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo palmitoylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:04:07Z eco ECO:0001216 in vivo palmitoylation assay evidence used in manual assertion true A type of in vivo palmitoylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo phosphatase assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:06:08Z eco ECO:0001217 in vivo phosphatase assay evidence used in manual assertion true A type of in vivo phosphatase assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo protein kinase assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:07:58Z eco ECO:0001218 in vivo protein kinase assay evidence used in manual assertion true A type of in vivo protein kinase assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo sumoylation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:09:49Z eco ECO:0001219 in vivo sumoylation assay evidence used in manual assertion true A type of in vivo sumoylation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo transcription assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:11:20Z eco ECO:0001220 in vivo transcription assay evidence used in manual assertion true A type of in vivo transcription assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo translation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:42:50Z eco ECO:0001221 in vivo translation assay evidence used in manual assertion true A type of in vivo translation assay evidence that is used in a manual assertion. ECO:MCC IDA A type of in vivo ubiquitination assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:44:11Z eco ECO:0001222 in vivo ubiquitination assay evidence used in manual assertion true A type of in vivo ubiquitination assay evidence that is used in a manual assertion. ECO:MCC A type of induced mutation evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:45:56Z eco ECO:0001223 induced mutation evidence used in manual assertion true A type of induced mutation evidence that is used in a manual assertion. ECO:MCC IMP A type of knockin evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:49:35Z eco ECO:0001224 knockin evidence used in manual assertion true A type of knockin evidence that is used in a manual assertion. ECO:MCC IMP A type of knockout evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:51:31Z eco ECO:0001225 knockout evidence used in manual assertion true A type of knockout evidence that is used in a manual assertion. ECO:MCC IPI A type of lipid binding assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:52:19Z eco ECO:0001226 lipid binding assay evidence used in manual assertion true A type of lipid binding assay evidence that is used in a manual assertion. ECO:MCC IPI A type of LUMIER assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:55:16Z LUMIER assay evidence eco ECO:0001227 luminescence-based mammalian interactome mapping assay evidence used in manual assertion true A type of LUMIER assay evidence that is used in a manual assertion. ECO:MCC EXP A type of macroscopy evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:56:21Z eco ECO:0001228 macroscopy evidence used in manual assertion true A type of macroscopy evidence that is used in a manual assertion. ECO:MCC IPI A type of mammalian 2-hybrid assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:57:25Z eco ECO:0001229 mammalian 2-hybrid assay evidence used in manual assertion true A type of mammalian 2-hybrid assay evidence that is used in a manual assertion. ECO:MCC EXP A type of mass spectrometry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T18:59:50Z eco ECO:0001230 mass spectrometry evidence used in manual assertion true A type of mass spectrometry evidence that is used in a manual assertion. ECO:MCC IDA A type of medical imaging evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:04:43Z eco ECO:0001231 medical imaging evidence used in manual assertion true A type of medical imaging evidence that is used in a manual assertion. ECO:MCC IDA A type of microscopy evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:05:37Z eco ECO:0001232 microscopy evidence used in manual assertion true A type of microscopy evidence that is used in a manual assertion. ECO:MCC IDA A type of motility wound healing assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:08:13Z ECO:0001262 wound healing assay evidence used in manual assertion eco ECO:0001233 motility wound healing assay evidence used in manual assertion true A type of motility wound healing assay evidence that is used in a manual assertion. ECO:MCC IDA A type of MTS assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:08:51Z eco 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium ECO:0001234 MTS assay evidence used in manual assertion true A type of MTS assay evidence that is used in a manual assertion. ECO:MCC IDA A type of MTT assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:13:17Z eco 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide ECO:0001235 MTT assay evidence used in manual assertion true A type of MTT assay evidence that is used in a manual assertion. ECO:MCC EXP A type of multiplex bead-based immunoassay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:14:03Z eco ECO:0001236 multiplex bead-based immunoassay evidence used in manual assertion true A type of multiplex bead-based immunoassay evidence that is used in a manual assertion. ECO:MCC EXP A type of natural variation mutant evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:15:48Z eco ECO:0001237 natural variation mutant evidence used in manual assertion true A type of natural variation mutant evidence that is used in a manual assertion. ECO:MCC EXP A type of nuclear magnetic resonance evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:18:50Z eco ECO:0001238 nuclear magnetic resonance evidence used in manual assertion true A type of nuclear magnetic resonance evidence that is used in a manual assertion. ECO:MCC IDA A type of nuclear fragmentation evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:19:55Z eco ECO:0001239 nuclear fragmentation evidence used in manual assertion true A type of nuclear fragmentation evidence that is used in a manual assertion. ECO:MCC EXP A type of nuclease protection assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:23:41Z eco ECO:0001240 nuclease protection assay evidence used in manual assertion true A type of nuclease protection assay evidence that is used in a manual assertion. ECO:MCC IDA A type of nucleotide analog incorporation assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:25:17Z eco ECO:0001241 nucleotide analog incorporation assay evidence used in manual assertion true A type of nucleotide analog incorporation assay evidence that is used in a manual assertion. ECO:MCC IPI A type of phage display evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:27:17Z eco ECO:0001242 phage display evidence used in manual assertion true A type of phage display evidence that is used in a manual assertion. ECO:MCC IDA A type of phosphoamino acid analysis evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:28:59Z eco ECO:0001243 phosphoamino acid analysis evidence used in manual assertion true A type of phosphoamino acid analysis evidence that is used in a manual assertion. ECO:MCC IPI A type of peptide affinity enrichment evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T19:30:13Z eco phosphopeptide affinity enrichment evidence ECO:0001244 peptide affinity enrichment evidence used in manual assertion true A type of peptide affinity enrichment evidence that is used in a manual assertion. ECO:MCC IPI A type of peptide array evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:16:45Z eco phosphopeptide array evidence ECO:0001245 peptide array evidence used in manual assertion true A type of peptide array evidence that is used in a manual assertion. ECO:MCC IDA A type of physical examination evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:17:27Z eco ECO:0001246 physical examination evidence used in manual assertion true A type of physical examination evidence that is used in a manual assertion. ECO:MCC IMP A type of point mutation phenotypic evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:18:10Z point mutation evidence used in manual assertion eco ECO:0001247 point mutation phenotypic evidence used in manual assertion true A type of point mutation phenotypic evidence that is used in a manual assertion. ECO:MCC IDA A type of propidium iodide staining evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:18:58Z eco ECO:0001248 propidium iodide staining evidence used in manual assertion true A type of propidium iodide staining evidence that is used in a manual assertion. ECO:MCC IDA A type of protein detection by fluorescence evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:19:35Z eco ECO:0001249 fluorescence evidence used in manual assertion true A type of protein detection by fluorescence evidence that is used in a manual assertion. ECO:MCC EXP A type of protein dot blot assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:20:30Z eco ECO:0001250 protein dot blot assay evidence used in manual assertion true A type of protein dot blot assay evidence that is used in a manual assertion. ECO:MCC EXP A type of protein microarray evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:21:11Z eco ECO:0001251 protein microarray evidence used in manual assertion true A type of protein microarray evidence that is used in a manual assertion. ECO:MCC EXP A type of protein sequencing assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:22:08Z eco ECO:0001252 protein sequencing assay evidence used in manual assertion true A type of protein sequencing assay evidence that is used in a manual assertion. ECO:MCC EXP A type of quantitative mass spectrometry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:23:15Z eco ECO:0001253 quantitative mass spectrometry evidence used in manual assertion true A type of quantitative mass spectrometry evidence that is used in a manual assertion. ECO:MCC IDA A type of radioisotope assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:27:05Z radioassay evidence radioisotopic assay evidence eco ECO:0001254 radioisotope assay evidence used in manual assertion true A type of radioisotope assay evidence that is used in a manual assertion. ECO:MCC EXP A type of radioimmunoassay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:28:04Z eco ECO:0001255 radioimmunoassay evidence used in manual assertion true A type of radioimmunoassay evidence that is used in a manual assertion. ECO:MCC IDA A type of imaging assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:00Z eco radiologic test evidence ECO:0001256 imaging assay evidence used in manual assertion true A type of imaging assay evidence that is used in a manual assertion. ECO:MCC EXP A type of restriction fragment detection evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:05Z eco ECO:0001257 restriction fragment detection evidence used in manual assertion true A type of restriction fragment detection evidence that is used in a manual assertion. ECO:MCC EXP A type of spectrophotometry evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:09Z eco ECO:0001258 spectrophotometry evidence used in manual assertion true A type of spectrophotometry evidence that is used in a manual assertion. ECO:MCC EXP A type of syngeneic transplantation experiment evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:13Z eco ECO:0001259 syngeneic transplantation experiment evidence used in manual assertion true A type of syngeneic transplantation experiment evidence that is used in a manual assertion. ECO:MCC EXP A type of xenotransplantation phenotypic evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:18Z xenograft transplantation evidence xenografting evidence xenotransplantation evidence xenotransplantation experiment evidence used in manual assertion eco tissue grafting ECO:0001260 xenotransplantation phenotypic evidence used in manual assertion true A type of xenotransplantation phenotypic evidence that is used in a manual assertion. ECO:MCC IDA A type of WST-1 assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:22Z metabolic cell proliferation assay evidence eco ECO:0001261 WST-1 assay evidence used in manual assertion true A type of WST-1 assay evidence that is used in a manual assertion. ECO:MCC IDA A type of urine test evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:30Z eco ECO:0001263 urine test evidence used in manual assertion true A type of urine test evidence that is used in a manual assertion. ECO:MCC IDA A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:34Z TUNEL assay evidence TdT-mediated dUTP-biotin nick end labeling assay evidence terminal deoxynucleotidyl transferase-dUTP nick end labeling assay evidence eco ECO:0001264 terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence used in manual assertion true A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence assay evidence that is used in a manual assertion. ECO:MCC EXP A type of tryptic phosphopeptide mapping assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:38Z eco ECO:0001265 tryptic phosphopeptide mapping assay evidence used in manual assertion true A type of tryptic phosphopeptide mapping assay evidence that is used in a manual assertion. ECO:MCC IMP A type of transgenic organism evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:41Z eco ECO:0001266 transgenic organism evidence used in manual assertion true A type of transgenic organism evidence that is used in a manual assertion. ECO:MCC IDA A type of tissue microarray evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:45Z eco ECO:0001267 tissue microarray evidence used in manual assertion true A type of tissue microarray evidence that is used in a manual assertion. ECO:MCC IDA A type of TACE activity assay evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:49Z Tumor necrosis factor - alpha converting enzyme activity assay evidence eco ECO:0001268 TACE activity assay evidence used in manual assertion true A type of TACE activity assay evidence that is used in a manual assertion. ECO:MCC IPI A type of surface plasmon resonance evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:54Z SPR evidence eco ECO:0001269 surface plasmon resonance evidence used in manual assertion true A type of surface plasmon resonance evidence that is used in a manual assertion. ECO:MCC EXP A type of restriction landmark genome scanning evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:29:58Z RLGS evidence restriction landmark genome scanning evidence eco ECO:0001270 restriction landmark genomic scanning evidence used in manual assertion true A type of restriction landmark genome scanning evidence that is used in a manual assertion. ECO:MCC IDA A type of resonant mirror biosensor evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T20:30:02Z eco ECO:0001271 resonant mirror biosensor evidence used in manual assertion true A type of resonant mirror biosensor evidence that is used in a manual assertion. ECO:MCC EXP A type of high-performance liquid chromatography evidence that is used in a manual assertion. mchibucos 2014-03-16T20:49:54Z HPLC evidence eco ECO:0001272 high-performance liquid chromatography evidence used in manual assertion true A type of high-performance liquid chromatography evidence that is used in a manual assertion. ECO:MCC EXP A type of ectopic expression evidence that is used in a manual assertion. SIB:PG mchibucos 2014-03-17T22:34:56Z eco analysis of overexpression/ectopic expression phenotype ECO:0001273 ectopic expression evidence used in manual assertion true A type of ectopic expression evidence that is used in a manual assertion. ECO:MCC A type of molecule detection assay evidence resulting from the detection and quantification of a small molecule (a low molecular weight (typically < 900 daltons) organic compound), such as lipids, sugars, animo acids, drugs, etc. CollecTF jbmunro 2018-11-09T12:00:00Z metabolite detection assay evidence eco ECO:0001522 small molecule detection assay evidence A type of direct assay evidence in which the sub-cellular location of a protein or nucleic acid sequence is determined. ECO_ExpGenomicCleanup jbmunro 2018-05-17T12:00:00Z eco ECO:0001533 localization evidence A type of localization evidence based on localization of a specific segment of DNA or RNA within tissue by the application of a complementary strand of nucleic acid to which a reporter molecule (i.e. either radio-, fluorescent- or antigen-labeled probe) is attached and quantified using either autoradiography, fluorescence microscopy, or immunohistochemistry. ECO_ExpGenomicCleanup jbmunro 2018-05-17T12:00:00Z eco ECO:0001534 nucleic acid localization evidence A type of direct assay evidence where acetylated residues are detected in a protein. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001546 acetylation assay evidence A type of direct assay evidence where acetylated residues are detected in a protein. SIB:PG url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml A type of direct assay evidence where the cleavage of a protein into protein fragments by a protease is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001547 cleavage assay evidence A type of direct assay evidence where the cleavage of a protein into protein fragments by a protease is detected. PMID:21121091 PMID:22154596 A type of direct assay evidence where the removal of acetyl groups are detected in a protein. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001548 deacetylation assay evidence A type of direct assay evidence where the removal of acetyl groups are detected in a protein. SIB:PG url:http://www.perkinelmer.com/resources/technicalresources/applicationsupportknowledgebase/radiometric/acetylation.xhtml A type of direct assay evidence where the removal of farnesyl groups from a protein is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001549 defarnesylation assay evidence A type of direct assay evidence where the removal of farnesyl groups from a protein is detected. PMID:15556768 PMID:16126733 PMID:16507103 SIB:PG A type of direct assay evidence where the removal of methyl groups from a substrate (RNA/DNA or protein) is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001550 demethylation assay evidence A type of direct assay evidence where the removal of methyl groups from a substrate (RNA/DNA or protein) is detected. SIB:PG url:http://en.wikipedia.org/wiki/Demethylation A type of direct assay evidence where the removal of sumo groups from a protein is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001551 desumoylation assay evidence A type of direct assay evidence where the removal of sumo groups from a protein is detected. SIB:PG url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/ A type of direct assay evidence where the removal of ubiquitin groups from a protein is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001552 deubiquitination assay evidence A type of direct assay evidence where the removal of ubiquitin groups from a protein is detected. PMID:19692941 SIB:PG A type of direct assay evidence where farnesylated residues in proteins are detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001553 farnesylation assay evidence A type of direct assay evidence where farnesylated residues in proteins are detected. PMID:9030603 SIB:PG url:http://en.wikipedia.org/wiki/Farnesyltransferase A type of direct assay evidence where methylated residues of a substarte (RNA/DNA or protein) are detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001554 methylation assay evidence A type of direct assay evidence where methylated residues of a substarte (RNA/DNA or protein) are detected. SIB:PG url:http://en.wikipedia.org/wiki/Methylation A type of direct assay evidence where palmitoylated residues in a protein are detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001555 palmitoylation assay evidence A type of direct assay evidence where palmitoylated residues in a protein are detected. PMID:10329400 PMID:17077383 SIB:PG A type of direct assay evidence where the removal of phosphatase groups from a protein is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001556 phosphatase assay evidence A type of direct assay evidence where the removal of phosphatase groups from a protein is detected. SIB:PG url:http://en.wikipedia.org/wiki/Phosphatase A type of direct assay evidence where ADP-ribosylated residues in proteins are detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001557 polyADP-ribosylation assay evidence A type of direct assay evidence where ADP-ribosylated residues in proteins are detected. PMID:21870253 PMID:2820766 SIB:PG A type of enzymatic activity assay evidence that measures transfer of a phosphate to a peptide or protein substrate by a protein kinase. ECO_AssayCleanup jbmunro mchibucos 2017-11-30T14:00:00Z eco ECO:0001558 protein kinase assay evidence A type of enzymatic activity assay evidence that measures transfer of a phosphate to a peptide or protein substrate by a protein kinase. url:https://www.ncbi.nlm.nih.gov/books/NBK91991/ A type of direct assay evidence where sumoylated residues on a protein are detected. ECO_AssayCleanup jbmunro 2017-11-30T14:00:00Z eco ECO:0001559 sumoylation assay evidence A type of direct assay evidence where sumoylated residues on a protein are detected. SIB:PG url:http://www.enzolifesciences.com/BML-UW8955/sumoylation-kit/ IEA A type of single cell RNA-sequencing evidence that is used in automatic assertion. jbmunro 2019-01-02T12:00:00Z eco ECO:000156 single-cell RNA-sequencing evidence used in automatic assertion true A type of RNA-sequencing evidence that uses a single cell as the source of the RNA. Bgee jbmunro 2019-01-02T12:00:00Z scRNA-seq evidence eco ECO:0001560 single-cell RNA-sequencing evidence A type of direct assay evidence where de novo protein synthesis is detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001561 translation assay evidence A type of direct assay evidence where de novo protein synthesis is detected. PMID:18230759 PMID:24901308 SIB:PG A type of direct assay evidence where ubiquitinated residues on a protein are detected. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001562 ubiquitination assay evidence A type of direct assay evidence where ubiquitinated residues on a protein are detected. PMID:19692941 SIB:PG However, as shown in Fig. 5A, the recombinant mycobacterial cells became sensitive to the anti-TB drugs isoniazid and streptomycin, as evidenced by their inhibited growth in the presence of 25 mug/mL of isoniazid or 0.5 mug/mL of streptomycin in the medium. Similar growth profiles of these strains were observed in liquid media with the corresponding inducers (data not shown). These indicate that the expression of vapC10 alone led to growth arrest of E. coli, and the simultaneous expression of vapB10 could neutralize this growth-inhibition effect, suggesting that vapC10 encodes a TA toxin and vapB10 encodes the cognate antitoxin. A type of direct assay evidence where biological cell development, i.e. an increase in cell mass and size are measured. ECO_AssayCleanup mchibucos / jbmunro 2017-11-30T14:00:00Z eco ECO:0001563 cell growth assay evidence However, as shown in Fig. 5A, the recombinant mycobacterial cells became sensitive to the anti-TB drugs isoniazid and streptomycin, as evidenced by their inhibited growth in the presence of 25 mug/mL of isoniazid or 0.5 mug/mL of streptomycin in the medium. PMID:20843371 Similar growth profiles of these strains were observed in liquid media with the corresponding inducers (data not shown). These indicate that the expression of vapC10 alone led to growth arrest of E. coli, and the simultaneous expression of vapB10 could neutralize this growth-inhibition effect, suggesting that vapC10 encodes a TA toxin and vapB10 encodes the cognate antitoxin. PMID:24260461 A type of direct assay evidence where biological cell development, i.e. an increase in cell mass and size are measured. GO:0016049 PMID:11057898 A type of direct assay evidence resulting from the study of cells. jbmunro 2017-11-30T14:00:00Z eco ECO:0001565 cell-based assay evidence The real-time RT-PCR validated that Zur repressed the first gene of each of the three operons, znuA, znuCB and ykgM-rpmJ2 (Additional file 5). A type of reverse transcription polymerase chain reaction evidence that combines reverse transcription polymerase chain reaction and real time polymerase chain reaction to quantitatively assay for the detection of RNA levels. jbmunro 2018-07-07T12:00:00Z RRT-PCR evidence RT-qPCR evidence qRT-PCR evidence quantitative RT-PCR evidence quantitative real-time RT-PCR evidence rRT-PCR evidence real-time RT-PCR evidence real-time qRT-PCR evidence real-time quantitative reverse transcription PCR evidence real-time reverse transcription polymerase chain reaction evidence eco ECO:0001566 quantitative reverse transcription polymerase chain reaction evidence The real-time RT-PCR validated that Zur repressed the first gene of each of the three operons, znuA, znuCB and ykgM-rpmJ2 (Additional file 5). PMID:19552825 EXP A type of quantitative reverse transcription polymerase chain reaction evidence used in manual assertion. jbmunro 2018-07-07T12:00:00Z eco ECO:0001567 quantitative reverse transcription polymerase chain reaction evidence used in manual assertion true IEA A type of quantitative reverse transcription polymerase chain reaction evidence used in automatic assertion. jbmunro 2018-07-07T12:00:00Z ECO:000156 eco ECO:0001568 quantitative reverse transcription polymerase chain reaction evidence used in automatic assertion. true EXP A type of colony diameter phenotype evidence that is used in manual assertion. jbmunro 2019-01-03T12:00:00Z eco ECO:000157 colony diameter phenotype evidence used in manual assertion true IEP A type of single cell RNA-sequencing evidence that is used in manual assertion. jbmunro 2019-01-02T12:00:00Z eco ECO:0001570 single-cell RNA-sequencing evidence used in manual assertion true A type of colony size phenotypic evidence resulting from measurement of a microbial colony's diameter. OMP jbmunro 2019-01-03T12:00:00Z eco ECO:0001571 colony diameter phenotype evidence IEA A type of colony diameter phenotype evidence that is used in automatic assertion jbmunro 2019-01-03T12:00:00Z eco ECO:0001572 colony diameter phenotype evidence used in automatic assertion true A type of direct assay evidence in which a broad variety of physiological processes are measured when two separate membranes merge into a single contiguous membrane. jbmunro 2019-03-01T12:00:00Z eco ECO:0001574 Measurements can include but are not limited to: synaptic transmission, fertilization, and viral entry. membrane fusion assay evidence A type of direct assay evidence in which a broad variety of physiological processes are measured when two separate membranes merge into a single contiguous membrane. PMID:1836993 IEA A type of membrane fusion assay evidence that is used in automatic assertion. jbmunro 2019-03-01T12:00:00Z eco ECO:0001575 membrane fusion assay evidence used in automatic assertion true true IDA A type of membrane fusion assay evidence that is used in manual assertion. jbmunro 2019-03-01T12:00:00Z eco ECO:0001576 membrane fusion assay evidence used in manual assertion true true A type of membrane fusion assay evidence based on the fusion of spheroplasts. jbmunro 2019-03-01T12:00:00Z eco ECO:0001577 A spheroplast is a Gram-negative bacterium cell in which the cell wall has been almost completely removed. spheroplast fusion assay evidence A spheroplast is a Gram-negative bacterium cell in which the cell wall has been almost completely removed. PMID:25870259 IEA A type of spheroplast fusion assay evidence used in automatic assertion. jbmunro 2019-03-01T12:00:00Z eco ECO:0001578 spheroplast fusion assay evidence used in automatic assertion true true IDA A type of spheroplast fusion assay evidence that is used in manual assertion. jbmunro 2019-03-01T12:00:00Z eco ECO:0001579 spheroplast fusion assay evidence used in manual assertion true true A type of mass spectrometry evidence where liquid chromatography is used to separate particles in solution, followed by fragmentation and measurement of the mass-to-charge ratio of the resulting particles to identify the amount and type of material entities present in a sample. OMP jbmunro 2019-03-26T12:00:00Z eco ECO:0001580 liquid chromatography coupled with tandem mass spectrometry evidence IEA A type of liquid chromatography coupled with tandem mass spectrometry evidence that is used in an automatic assertion. OMP jbmunro 2019-03-26T12:00:00Z eco ECO:0001581 liquid chromatography coupled with tandem mass spectrometry evidence used in automatic assertion true true EXP A type of liquid chromatography coupled with tandem mass spectrometry evidence that is used in a manual assertion. OMP jbmunro 2019-03-26T12:00:00Z ECO:0001582 liquid chromatography coupled with tandem mass spectrometry evidence used in manual assertion true true A type of anti-sense experiment evidence where gene expression is disrupted through the introduction of double-stranded RNA molecules, 20-25 base pairs in length, which operate within the RNA interference pathway. OMP jbmunro 2019-04-03T12:00:00Z short interfering RNA siRNA silencing RNA eco ECO:0001583 small interfering RNA knockdown evidence IEA A type of small interfering RNA knockdown evidence that is used in an automatic assertion. OMP jbmunro 2019-04-03T12:00:00Z eco ECO:0001584 small interfering RNA knockdown evidence used in automatic assertion true IMP A type of small interfering RNA knockdown evidence that is used in a manual assertion. OMP jbmunro 2019-04-03T12:00:00Z eco ECO:0001585 small interfering RNA knockdown evidence used in manual assertion true A type of mass spectrometry evidence where a combination of magnetic and/or electric fields are utilized to capture charged particles in tandem with mass spectrometry. OMP jbmunro 2019-04-15T12:00:00Z eco ECO:0001586 ion trap mass spectrometry evidence A type of mass spectrometry evidence where a combination of magnetic and/or electric fields are utilized to capture charged particles in tandem with mass spectrometry. PMID:1561330 IEA A type of ion trap mass spectrometry evidence that is used in an automatic assertion. OMP jbmunro 2019-04-15T12:00:00Z eco ECO:0001587 ion trap mass spectrometry evidence used in automatic assertion true EXP A type of ion trap mass spectrometry evidence that is used in a manual assertion. OMP jbmunro 2019-04-15T12:00:00Z eco ECO:0001588 ion trap mass spectrometry evidence used in manual assertion true AFM revealed loop structures stabilized by multiple EspR dimer of dimers suggesting the presence of several distant EspR binding sites in the espACD upstream region. A type of microscopy evidence where a mechanical probe is applied to a sample (i.e. a type of scanning probe microscopy) which can result in production of an image (with resolution in the order of fractions of a nanometer), force measurement, or sample manipulation. CollecTF jbmunro 2019-04-15T12:00:00Z AFM SFM scanning force microscopy eco ECO:0001589 Atomic force microscopy can be used for force measurement (force spectroscopy), imaging (rendering a three-dimensional shape (topography), and manipulation of the sample. atomic force microscopy evidence AFM revealed loop structures stabilized by multiple EspR dimer of dimers suggesting the presence of several distant EspR binding sites in the espACD upstream region. PMID:22479184 A type of atomic force microscopy evidence that is used in an automatic assertion. CollecTF jbmunro 2019-04-15T12:00:00Z eco ECO:0001590 atomic force microscopy evidence used in automatic assertion A type of atomic force microscopy evidence that is used in a manual assertion. CollecTF jbmunro 2019-04-15T12:00:00Z eco ECO:0001591 atomic force microscopy evidence used in manual assertion A type of experimental evidence employed to study the associations between multiple ribosomes and mRNA that utilizes density gradient centrifugation to separate out the lysate of cells of interest with the objective of isolating polysomes/polyribosomes which are complexes of an mRNA molecule and two or more ribosomes that act to translate mRNA. The optical density of the fractions is then determined. OMP jbmunro 2019-04-15T12:00:00Z eco ECO:0001592 Once isolated, gel electrophoresis, immunoblot, and other protein profiling techniques can be applied to garner more information. polysome profiling evidence A type of experimental evidence employed to study the associations between multiple ribosomes and mRNA that utilizes density gradient centrifugation to separate out the lysate of cells of interest with the objective of isolating polysomes/polyribosomes which are complexes of an mRNA molecule and two or more ribosomes that act to translate mRNA. The optical density of the fractions is then determined. PMID:30545912 IEA A type of polysome profiling evidence that is used in an automatic assertion. OMP jbmunro 2019-04-15T12:00:00Z eco ECO:0001593 polysome profiling evidence used in automatic assertion true EXP A type of polysome profiling evidence that is used in a manual assertion. OMP jbmunro 2019-04-15T12:00:00Z eco ECO:0001594 polysome profiling evidence used in manual assertion true A type of nucleotide sequencing assay evidence in which DNA sequence variations within a specific set of genes (typically housekeeping genes) are used to characterizes strains by their unique allelic profiles. CollecTF jbmunro 2019-05-06T12:00:00Z MLST eco ECO:0001598 See PMID:24713082 for use example. multilocus sequence typing evidence A type of nucleotide sequencing assay evidence in which DNA sequence variations within a specific set of genes (typically housekeeping genes) are used to characterizes strains by their unique allelic profiles. PMID:9501229 IEA A type of multilocus sequence typing evidence that is used in an automatic assertion. CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001599 multilocus sequence typing evidence used in automatic assertion true EXP A type of multilocus sequence typing evidence that is used in a manual assertion CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001600 multilocus sequence typing evidence used in manual assertion true A type of protein-binding evidence that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites. swolfish 2015-06-05T14:36:00Z PBM evidence eco ECO:0001601 protein-oligonucleotide microarray binding evidence A type of protein-binding evidence that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites. PMID:22146299 A type of cell-based assay evidence in which living cells are stained with a vital stain, i.e. dye that can be used on living cells without causing cell death. swolfish 2015-06-08T11:51:37Z eco vital staining evidence ECO:0001603 cell staining evidence A type of cell-based assay evidence in which living cells are stained with a vital stain, i.e. dye that can be used on living cells without causing cell death. GOC:MAH vital staining evidence GOC:MAH A type of reporter gene assay evidence based on the fusion of selected genes with the phoA gene to express alkaline phosphatase in periplasmic space for protein tracing. CollecTF swolfish 2015-10-29T15:53:45Z eco SEAP reporter assay Secreted Embryonic Alkaline Phosphatase reporter assay ECO:0001801 Alkaline phosphatase reporter assay produces a hybrid protein with alkaline phosphatase activity following transportation across the cellular membrane. alkaline phosphatase reporter gene assay evidence A type of reporter gene assay evidence based on the fusion of selected genes with the phoA gene to express alkaline phosphatase in periplasmic space for protein tracing. ECO:SW PMID:11823238 For each of the three genes, there was a significant increase of beta-galactosidase activity in Deltazur compared to WT when they grew in TMH with the addition of zinc. Thus, Zur repressed the promoter activities of znuC, znuA and ykgM. A type of reporter gene assay evidence based on the fusion of the lacZ gene to a specific promoter for the expression of beta-galactosidase which will appear blue when grown on a X-gal medium. CollecTF swolfish 2015-10-29T15:57:10Z ECO:0000297 LacZ transcript localization evidence beta-gal reporter gene assay beta-galactosidase assay evidence eco lacZ reporter gene assay ECO:0001802 The assay is often performed using a plasmid borne construction on a lacZ strain. beta-galactosidase reporter gene assay evidence For each of the three genes, there was a significant increase of beta-galactosidase activity in Deltazur compared to WT when they grew in TMH with the addition of zinc. Thus, Zur repressed the promoter activities of znuC, znuA and ykgM. PMID:19552825 A type of reporter gene assay evidence based on the fusion of the lacZ gene to a specific promoter for the expression of beta-galactosidase which will appear blue when grown on a X-gal medium. ECO:SW PMID:20439410 A type of reporter gene assay evidence based on the fusion of the CAT gene to a specific promoter for the expression of chloramphenicol acetyltransferase which confers resistance to the chloramphenicol antibiotic. CollecTF swolfish 2015-10-29T16:06:42Z CAT reporter gene assay eco ECO:0001803 The amount of acetylated chloramphenicol is directly proportional to the amount of CAT enzyme present. chloramphenicol acetyltransferase reporter gene assay evidence A type of reporter gene assay evidence based on the fusion of the CAT gene to a specific promoter for the expression of chloramphenicol acetyltransferase which confers resistance to the chloramphenicol antibiotic. ECO:SW PMID:1630936 CAT reporter gene assay PMID:1630936 A type of reporter gene assay evidence where the beta-glucuronidase enzyme from Escherichia coli is used as the reporter to transform non-fluorescent substrates into fluorescents for detection. CollecTF swolfish 2015-10-29T16:11:02Z GUS reporter gene assay eco ECO:0001804 beta-glucuronidase reporter gene assay evidence A type of reporter gene assay evidence where the beta-glucuronidase enzyme from Escherichia coli is used as the reporter to transform non-fluorescent substrates into fluorescents for detection. ECO:SW A type of reporter gene assay evidence where luciferase, an oxidative enzyme, is used as the reporter to detect a gene product with bioluminescence. CollecTF swolfish 2015-10-29T16:15:39Z eco ECO:0001805 luciferase reporter gene assay evidence A type of reporter gene assay evidence where luciferase, an oxidative enzyme, is used as the reporter to detect a gene product with bioluminescence. ECO:SW PMID:17623934 A type of chromatin immunoprecipitation evidence that uses gama-exonuclease to digest TF-unbound DNA after ChIP for the identification of transcription factor binding site locations with high-resolution data. CollecTF swolfish 2015-10-29T16:37:36Z ChIP-exo eco ECO:0001806 chromatin immunoprecipitation- exonuclease evidence A type of chromatin immunoprecipitation evidence that uses gama-exonuclease to digest TF-unbound DNA after ChIP for the identification of transcription factor binding site locations with high-resolution data. ECO:SW PMID:25249628 ChIP-exo PMID:25249628 IPI A type of electrophoretic mobility shift that is used in a manual assertion. swolfish 2015-11-03T12:13:17Z EMSA evidence electrophoretic mobility shift assay eco gel retardation assay ECO:0001807 electrophoretic mobility shift assay evidence used in manual assertion true A type of electrophoretic mobility shift that is used in a manual assertion. ECO:SW EXP A type of reverse transcription polymerase chain reaction evidence that is used in a manual assertion. swolfish 2015-11-03T12:22:46Z eco ECO:0001808 reverse transcription polymerase chain reaction evidence used in manual assertion true A type of reverse transcription polymerase chain reaction evidence that is used in a manual assertion. ECO:SW A type of chromatography evidence where immobilized promoter DNA is labeled and bound to a matrix through which a protein mixture is poured and then eluted to purify specific DNA binding proteins. CollecTF swolfish 2015-11-03T13:48:49Z eco DNA affinity purification ECO:0001809 Biotinylation is commonly used for labeling and beads are commonly used as the matrix. Bound protein will remain attached to the beads. Results can be detected through gel electrophoresis and then sequenced by mass-spectrometry. This technique can be used to demonstrate binding of a purified protein, or to purify the binding protein from crude extract or protein mixture. DNA affinity chromatography evidence A type of chromatography evidence where immobilized promoter DNA is labeled and bound to a matrix through which a protein mixture is poured and then eluted to purify specific DNA binding proteins. ECO:SW PMID:11694305 PMID:11725488 Subsequent DNase I footprinting experiments (Fig. 5d) indicated that His-PhoP protected a single region located from 102 to 47 bp upstream of rovA. This footprint was considered the PhoP site. The subsequent DNase I footprinting experiments (Figure 3a) showed that His-OmpR-P protected a single region within the ompR promoter. Therefore, OmpR stimulated its own gene at the transcriptional level, which was mediated through the binding of OmpR-P to its own promoter. To precisely determine the PhoP-binding sites of target genes, DNase I footprinting assay was performed on 17 PhoP-dependent promoter DNA regions (both coding and noncoding strands) (Additional file 6). DNase I footprinting results confirmed the direct binding of His-PhoP to these promoter regions in vitro. We therefore pursued DNase I footprinting assays on several of the Crp-associated sequences that gave an unusual downshift in our initial EMSA trials, in an effort to identify a consensus binding sequence (see Fig. S2 in the supplemental material). We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1). A type of nucleic acid binding evidence where proteins that have been bound to DNA protect a binding site from enzymatic cleavage with DNAse, thereby detecting protein-DNA interactions. CollecTF swolfish 2015-11-03T13:55:15Z eco DNase protection ECO:0001810 In DNAse footingprinting amplified DNA combined with TF and DNAse is electrophoresed for fragment comparison with a non-TF control sample. TF-bound fragments do not appear in the gel. Such fragments can be isolated, purified, and sequenced. This technique is often used to identify the binding motif of a TF resolving the protected region to 50-100 bp which can be further examined for TF-binding sites. DNAse footprinting evidence Subsequent DNase I footprinting experiments (Fig. 5d) indicated that His-PhoP protected a single region located from 102 to 47 bp upstream of rovA. This footprint was considered the PhoP site. PMID:21966533 The subsequent DNase I footprinting experiments (Figure 3a) showed that His-OmpR-P protected a single region within the ompR promoter. Therefore, OmpR stimulated its own gene at the transcriptional level, which was mediated through the binding of OmpR-P to its own promoter. PMID:21345178 To precisely determine the PhoP-binding sites of target genes, DNase I footprinting assay was performed on 17 PhoP-dependent promoter DNA regions (both coding and noncoding strands) (Additional file 6). DNase I footprinting results confirmed the direct binding of His-PhoP to these promoter regions in vitro. PMID:18366809 We therefore pursued DNase I footprinting assays on several of the Crp-associated sequences that gave an unusual downshift in our initial EMSA trials, in an effort to identify a consensus binding sequence (see Fig. S2 in the supplemental material). We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1). PMID:23232715 A type of nucleic acid binding evidence where proteins that have been bound to DNA protect a binding site from enzymatic cleavage with DNAse, thereby detecting protein-DNA interactions. ECO:SW PMID:212715 PMID:22194258 Since these FA analyses are conducted with 300 nM scOhrR, this suggests that oxidation leads to at least a 100-fold reduction in DNA-binding affinity. A type of fluorescence evidence based on rapid and quantitative analysis of diverse molecular interactions, enzyme activities, and nucleic acid hybridization which uses a fluorophore to measure the binding constants and kinetics of reactions that cause a change in the rotational time of the molecules. CollecTF swolfish 2015-11-03T14:01:36Z FA eco FP Fluorescence polarization ECO:0001811 The degree of polarization of a fluorophore is inversely related to its molecular rotation. When the fluorophore is bound to a small molecule, the rate at which it tumbles can decrease significantly from when it is bound tightly to a large protein. If the fluorophore is attached to the larger protein in a binding pair, the difference in polarization between bound and unbound states will be smaller and less accurate. The degree of binding is calculated by using the difference in anisotropy of the partially bound, free, and fully bound states measured by titrating the two binding partners. Fluorescence polarixation assays are homogeneous. fluorescence anisotropy evidence Since these FA analyses are conducted with 300 nM scOhrR, this suggests that oxidation leads to at least a 100-fold reduction in DNA-binding affinity. PMID:19129220 A type of fluorescence evidence based on rapid and quantitative analysis of diverse molecular interactions, enzyme activities, and nucleic acid hybridization which uses a fluorophore to measure the binding constants and kinetics of reactions that cause a change in the rotational time of the molecules. ECO:SW PMID:20232898 FP PMCID:3277431 PMID:20232898 Fluorescence polarization PMCID:3277431 PMID:20232898 A type of systematic evolution of ligands by exponential amplification evidence based on a restricted genomic DNA library to identify naturally occurring genomic aptamers and RNA-protein interaction networks with RNA-binding protein as bait and high-throughput sequencing. CollecTF swolfish 2015-11-03T14:05:37Z genomic SELEX eco ECO:0001812 The reported sequences should always be verified for presence in the genome sequence. genomic systematic evolution of ligands by exponential amplification evidence A type of systematic evolution of ligands by exponential amplification evidence based on a restricted genomic DNA library to identify naturally occurring genomic aptamers and RNA-protein interaction networks with RNA-binding protein as bait and high-throughput sequencing. ECO:SW PMID:20541015 PMID:21720957 genomic SELEX PMID:20541015 A type of nuclear magnetic resonance spectroscopy evidence based on two-dimensional NMR for elucidation of the chemical structure of an isolated or synthesized chemical compound where the characteristic transfer magnetization of a proton to a nitrogen or carbon isotope is monitored by NMR, generating a specific peak in the spectrum. CollecTF swolfish 2015-11-03T14:11:06Z HSQC eco ECO:0001813 Chemical shifts in the spectrum indicating binding can be detected from analysis of a protein spectrum in the presence or absence of its cognate DNA binding site. heteronuclear single quantum coherence spectroscopy evidence A type of nuclear magnetic resonance spectroscopy evidence based on two-dimensional NMR for elucidation of the chemical structure of an isolated or synthesized chemical compound where the characteristic transfer magnetization of a proton to a nitrogen or carbon isotope is monitored by NMR, generating a specific peak in the spectrum. ECO:SW PMID:19856946 HSQC PMID:19856946 A type of nucleic acid binding evidence where the synthetic molecule methidiumpropyl-EDTA (MPE) is used to cleave ligand-protected DNA, followed by analysis of the restriction fragments to generate a footprint (i.e. size and location) of small molecule binding sites on the DNA. CollecTF swolfish 2015-11-03T14:24:04Z eco MPE Fe(II) footprinting MPE-EDTA Fe(II) footprinting Methidiumpropyl-EDTA Fe(II) footprinting ECO:0001814 methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence A type of nucleic acid binding evidence where the synthetic molecule methidiumpropyl-EDTA (MPE) is used to cleave ligand-protected DNA, followed by analysis of the restriction fragments to generate a footprint (i.e. size and location) of small molecule binding sites on the DNA. ECO:SW PMID:6225070 MPE Fe(II) footprinting PMID:6225070 MPE-EDTA Fe(II) footprinting PMID:6225070 Methidiumpropyl-EDTA Fe(II) footprinting PMID:6225070 A type of nucleic acid binding evidence where nucleic acid that has been bound to protein is cleaved with 1,10-phenanthroline-copper complex resulting in a high-resolution footprint of sequence-specific protein-DNA contacts. CollecTF swolfish 2015-11-04T08:37:51Z 1,10-Phenanthroline-copper footprinting eco OP-Cu Complex ECO:0001815 copper-phenanthroline footprinting evidence A type of nucleic acid binding evidence where nucleic acid that has been bound to protein is cleaved with 1,10-phenanthroline-copper complex resulting in a high-resolution footprint of sequence-specific protein-DNA contacts. ECO:SW PMID:11691942 1,10-Phenanthroline-copper footprinting PMID:1384472 OP-Cu Complex PMID:1384472 A type of reporter gene assay evidence based on the fusion of select genes with the green fluorescent protein (GFP) gene for detection with bioluminescence of the gene product when exposed to blue ultraviolet light. CollecTF swolfish 2015-11-04T08:58:42Z ECO:0000296 GFP reporter gene assay green fluorescent protein transcript localization evidence eco GFP promoter fusion green fluorescent protein promoter fusion ECO:0001816 green fluorescent protein reporter gene assay evidence A type of reporter gene assay evidence based on the fusion of select genes with the green fluorescent protein (GFP) gene for detection with bioluminescence of the gene product when exposed to blue ultraviolet light. ECO:SW PMID:11989662 GFP reporter gene assay PMID:11989662 A type of bait-prey hybrid interaction evidence where a gene is fused with the GST gene and the resulting recombinant bait protein is captured on an immobilized Glutathione affinity ligand and incubated with prey protein to identify and characterize protein-protein interactions. CollecTF swolfish 2015-11-04T09:05:56Z GST pull-down assay eco ECO:0001817 The recombinant protein can also be eluted following the pull-down and analyzed further with qPCR or sequencing. glutathione S-transferase pull-down assay evidence A type of bait-prey hybrid interaction evidence where a gene is fused with the GST gene and the resulting recombinant bait protein is captured on an immobilized Glutathione affinity ligand and incubated with prey protein to identify and characterize protein-protein interactions. ECO:SW PMID:26096507 GST pull-down assay PMID:26096507 A type of nucleic acid binding evidence used to identify protein-binding sites on the DNA molecule where DNA that has been bound to protein is digested with hydroxyl radical produced by reduction of hydrogen peroxide with iron (II), followed by separating the cleavage products on a denaturing electrophoresis gel. CollecTF swolfish 2015-11-04T09:20:26Z eco ECO:0001818 hydroxyl-radical footprinting evidence A type of nucleic acid binding evidence used to identify protein-binding sites on the DNA molecule where DNA that has been bound to protein is digested with hydroxyl radical produced by reduction of hydrogen peroxide with iron (II), followed by separating the cleavage products on a denaturing electrophoresis gel. ECO:SW PMID:18546600 PMID:19378159 PMID:3090544 The primer extension assay (Fig. 6a) defined the transcription start sites the three sRNA genes qrr2 - 4, and this assay also indicated that the promoter activity of all the thee qrr genes was under the positive control of OpaR. The primer extension assay detected two transcriptional start sites located at 343 and 78 bp upstream of rovA (Fig. 2); therefore, two promoters (named P2 and P1, respectively) were transcribed for rovA. A type of transcript expression evidence used to determine expression levels of mRNA where a labeled synthetic oligonucleotide primer is annealed to mRNA downstream of the presumed transcription start site of a gene. The mRNA is extended with reverse transcriptase, producing cDNA which is electrophoresed, and the band size is enables determination of the 5' end of the mRNA (i.e. the transcription start site). CollecTF swolfish 2015-11-04T09:33:18Z eco ECO:0001819 The most commonly used radiolabel is 32P. primer extension assay evidence The primer extension assay (Fig. 6a) defined the transcription start sites the three sRNA genes qrr2 - 4, and this assay also indicated that the promoter activity of all the thee qrr genes was under the positive control of OpaR. PMID:22506036 The primer extension assay detected two transcriptional start sites located at 343 and 78 bp upstream of rovA (Fig. 2); therefore, two promoters (named P2 and P1, respectively) were transcribed for rovA. PMID:21966533 A type of transcript expression evidence used to determine expression levels of mRNA where a labeled synthetic oligonucleotide primer is annealed to mRNA downstream of the presumed transcription start site of a gene. The mRNA is extended with reverse transcriptase, producing cDNA which is electrophoresed, and the band size is enables determination of the 5' end of the mRNA (i.e. the transcription start site). ECO:SW PMID:23378648 5' RACE analysis was employed to localize the espR promoter using RNA extracted from Mtb H37Rv grown to mid-log phase. The espR transcript starts with a poly-G (7) sequence 144 bp upstream of the translational start codon. The 5'-end of the espA mRNA was located 66 bp upstream of the translation start codon using 5' RACE (Fig. S3). Using 5' rapid amplification of cDNA ends (RACE), we mapped the transcriptional start sites of rpoQ and VF_A1016 (Fig. 4A). Neither start site was detected in the DeltarpoQ mutant, supporting the idea that transcription of rpoQ and VF_A1016 requires RpoQ (data not shown). A type of nucleotide sequencing assay evidence in which RT-PCR (cDNA synthesis) is first used to produce a cDNA copy of a region of the RNA transcript being investigated followed by PCR to capture either the unknown 5' or 3' end of the transcript for sequencing, depending on whether 5' RACE-PCR or 3' RACE-PCR are being undertaken. CollecTF swolfish 2015-11-04T09:48:38Z 3’ RACE-PCR 5’ RACE-PCR RACE PCR eco ECO:0001820 5' and 3' RACE-PCR utilize different protocols to amplify an unknown end using the known sequence of the center of the transcript. For cDNA synthesis, 5' RACE-PCR uses an anti-sense oligonucleotide primer (gene specific primer (GSP)) that recognizes a known sequence in the middle of the gene of interest and the reverse transcriptase to add base pairs to the 3' end of the primer. Next, terminal deoxynucleotidyl transferase (TdT) is used to add a string of identical nucleotides to the 3' end of the cDNA. A PCR reaction is then carried out, using a second anti-sense gene specific primer (GSP2) that binds to the known sequence, and a sense (forward) universal primer (UP) that binds the homopolymeric tail added to the 3' ends of the cDNAs to amplify a cDNA product from the 5' end. In contrast, 3' RACE-PCR utilizes the naturally occurring 3' polyA tail of the transcript and uses an Oligo-dT-adaptor primer (a primer with a short sequence of deoxy-thymine nucleotides) that complements the polyA tail and adds a special adaptor sequence to the 5' end of each cDNA. PCR is then used to amplify 3' cDNA from a known region using a sense GSP, and an anti-sense primer complementary to the adaptor sequence. RACE PCR is frequently used to verify transcription start sites relevant to the function of transcription factor binding sites such as repression. rapid amplification of cDNA ends polymerase chain reaction evidence 5' RACE analysis was employed to localize the espR promoter using RNA extracted from Mtb H37Rv grown to mid-log phase. The espR transcript starts with a poly-G (7) sequence 144 bp upstream of the translational start codon. PMID:22479184 The 5'-end of the espA mRNA was located 66 bp upstream of the translation start codon using 5' RACE (Fig. S3). PMID:22479184 Using 5' rapid amplification of cDNA ends (RACE), we mapped the transcriptional start sites of rpoQ and VF_A1016 (Fig. 4A). Neither start site was detected in the DeltarpoQ mutant, supporting the idea that transcription of rpoQ and VF_A1016 requires RpoQ (data not shown). PMID:22233679 A type of nucleotide sequencing assay evidence in which RT-PCR (cDNA synthesis) is first used to produce a cDNA copy of a region of the RNA transcript being investigated followed by PCR to capture either the unknown 5' or 3' end of the transcript for sequencing, depending on whether 5' RACE-PCR or 3' RACE-PCR are being undertaken. ECO:SW PMID:17498297 PMID:7685466 RACE PCR PMI:17498297 CollecTF swolfish 2015-11-04T10:15:57Z eco ECO:0001821 Use ECO:0000295 (RNA-seq evidence) in place of this term. RNA sequencing assay evidence true A type of knockout evidence based on the survival of an organism in a particular environment where a gene for an enzyme or regulator is knocked out and results are used as a natural reporter. CollecTF swolfish 2015-11-04T10:48:59Z eco ECO:0001822 survival rate analysis evidence A type of knockout evidence based on the survival of an organism in a particular environment where a gene for an enzyme or regulator is knocked out and results are used as a natural reporter. ECO:SW A type of crystallography evidence where a purified sample at high concentration is crystallised and the crystals are exposed to an x ray beam to obtain three dimensional molecular structure of proteins and biological macromolecules. CollecTF swolfish 2015-11-04T10:56:22Z eco ECO:0001823 X-ray crystallography can be used for a crystal used to probe at the tridimensional structure of proteins. In some cases, it is possible to co-crystallize the protein bound to its DNA binding site, providing detail on the particular arrangement of the two components. x-ray crystallography evidence A type of crystallography evidence where a purified sample at high concentration is crystallised and the crystals are exposed to an x ray beam to obtain three dimensional molecular structure of proteins and biological macromolecules. ECO:SW PMID:23135450 PMID:24648090 A type of affinity evidence used to identify DNA binding sites in eukaryotes where Escherichia coli DNA adenine methyltransferase (Dam) is fused to a transcription factor, co-factor, chromatin-associated protein, or nuclear-associated protein, followed by a methyl-dependent PCR to localize methyltransferase in the region of the binding site. CollecTF swolfish 2015-11-05T15:56:13Z DamID eco ECO:0001824 The methylation tag is detected with methylation-sensitive restriction enzymes, DpnI and DpnII. DNA adenine methyltransferase identification evidence A type of affinity evidence used to identify DNA binding sites in eukaryotes where Escherichia coli DNA adenine methyltransferase (Dam) is fused to a transcription factor, co-factor, chromatin-associated protein, or nuclear-associated protein, followed by a methyl-dependent PCR to localize methyltransferase in the region of the binding site. ECO:SW PMID:16938559 PMID:17545983 PMID:19588092 DamID PMID:19588092 A type of affinity evidence where the absorbed or released heat of a biomolecular binding event is directly measured in a reference cell and sample cell after the addition of a ligand using a microcalorimeter for a complete thermodynamic profile of the molecular interaction. CollecTF swolfish 2015-11-05T16:06:20Z ITC eco ECO:0001825 When ITC is used to study TF, the temperature of two identical cells containing a known concentration of TF is monitored. After the ligand is added to the cells in precisely measured aliquots, the temperature difference in each cell is observed to determine target binding. This value can be used to compute the energetics of the reaction and hence, binding affinity of the TF for the DNA fragment. The thermodynamic profile that is measured includes the values of binding constant (K(a)), stoichiometry (n), and the enthalpy of binding (DeltaH(b)). isothermal titration calorimetry evidence A type of affinity evidence where the absorbed or released heat of a biomolecular binding event is directly measured in a reference cell and sample cell after the addition of a ligand using a microcalorimeter for a complete thermodynamic profile of the molecular interaction. ECO:SW PMID:10527727 ITC PMID:10527727 A type of nucleic acid binding evidence where DNA is non-specifically fragmented with ultraviolet light while protein-bound regions are protected from UV damage and strand breakage patterns are analyzed by PAGE and sequenced to detect protein-DNA contacts. CollecTF swolfish 2015-11-05T16:13:36Z eco UV footprinting ultraviolet footprinting ECO:0001826 ultraviolet light footprinting evidence A type of nucleic acid binding evidence where DNA is non-specifically fragmented with ultraviolet light while protein-bound regions are protected from UV damage and strand breakage patterns are analyzed by PAGE and sequenced to detect protein-DNA contacts. ECO:SW PMID:2842760 PMID:7602584 A type of nucleic acid binding evidence used to identify protein binding sites on the DNA molecule where multiple copies of a DNA fragment containing a putative TF-binding site are randomly methylated with dimethyl sulfate (DMS) and cleaved at the methyl group, followed by separating the cleavage products on a denaturing electrophoresis gel. CollecTF swolfish 2015-11-05T16:16:27Z methylation interference footprinting evidence eco ECO:0001827 methylation interference footprinting evidence A type of nucleic acid binding evidence used to identify protein binding sites on the DNA molecule where multiple copies of a DNA fragment containing a putative TF-binding site are randomly methylated with dimethyl sulfate (DMS) and cleaved at the methyl group, followed by separating the cleavage products on a denaturing electrophoresis gel. ECO:SW PMID:1583685 A type of inference of sequence features from visual inspection that is used in a manual assertion. swolfish 2015-11-10T14:40:16Z visual sequence inspection evidence eco ECO:0001828 inference of sequence features from visual inspection used in manual assertion true true A type of inference of sequence features from visual inspection that is used in a manual assertion. ECO:RCJ A type of reporter gene assay evidence used to locate and isolate Fur sites where a plasmid library is created and cloned into a cell line with a ferric uptake regulator (Fur)-repressed reporter and the Fur protein is titrated away from its binding site on the reporter, after which the cell is isolated and plasmid extracted for further sequence analysis. CollecTF swolfish 2015-11-10T14:55:36Z FURTA eco Fluorescence polarization ECO:0001829 ferric uptake regulator titration assay evidence A type of reporter gene assay evidence used to locate and isolate Fur sites where a plasmid library is created and cloned into a cell line with a ferric uptake regulator (Fur)-repressed reporter and the Fur protein is titrated away from its binding site on the reporter, after which the cell is isolated and plasmid extracted for further sequence analysis. ECO:SW PMID:10713425 PMID:7642488 PMID:8107138 FURTA PMID:10713425 Fluorescence polarization PMID:15689115 A type of experimental evidence in which the colonization or adhesion capacity is measured. CollecTF jbmunro 2019-05-06T12:00:00Z adhesion assay evidence eco ECO:0001830 Has to do with the ability of the bacterium or virus to bind to a host. host colonization assay evidence IEA A type of host colonization assay evidence that is used in an automatic assertion. CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001831 host colonization assay evidence used in automatic assertion true EXP A type of host colonization assay evidence that is used in a manual assertion. CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001832 host colonization assay evidence used in manual assertion true A type of host colonization assay evidence in which the infection capacity is measured by assessing changes in the host. CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001833 Has to do with the outcome of a bacterial or viral / host interaction, be it a measure of cell death, cytotoxicity, invasion, etc. infection assay evidence IEA A type of infection assay evidence that is used in an automatic assertion. CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001834 infection assay evidence used in automatic assertion true EXP A type of infection assay evidence that is used in a manual assertion. CollecTF jbmunro 2019-05-06T12:00:00Z eco ECO:0001835 infection assay evidence used in manual assertion true A type of expression pattern evidence in which single-stranded DNA or RNA (probe) are annealed to complementary DNA or RNA in a portion or section of tissue. planarian anatomy ontology (PLANA) jbmunro 2019-09-26T12:00:00Z eco ECO:0001836 in situ hybridization evidence IEA A type of in situ hybridization evidence that is used in an automatic assertion. jbmunro 2019-09-26T12:00:00Z eco ECO:0001837 in situ hybridization evidence used in automatic assertion true IEP A type of in situ hybridization evidence that is used in a manual assertion. jbmunro 2019-09-26T12:00:00Z eco ECO:0001838 in situ hybridization evidence used in manual assertion true A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of colorimetric probes to detect complementary sequences of nucleic acids. planarian anatomy ontology (PLANA) jbmunro 2019-09-26T12:00:00Z eco ECO:0001839 colorimetric in situ hybridization evidence A type of nucleic acid localization evidence and in situ hybridization evidence resulting from the use of colorimetric probes to detect complementary sequences of nucleic acids. PMID:23497040 IEA A type of colorimetric in situ hybridization evidence that is used in an automatic assertion. jbmunro 2019-09-26T12:00:00Z eco ECO:0001840 colorimetric in situ hybridization evidence used in automatic assertion true IEP A type of colorimetric in situ hybridization evidence that is used in a manual assertion. jbmunro 2019-09-26T12:00:00Z eco ECO:0001841 colorimetric in situ hybridization evidence used in manual assertion true A type of random mutagenesis phenotypic evidence resulting from the random mutation of a specifically targeted region of DNA. ECO jbmunro 2019-12-09T12:00:00Z eco ECO:0001842 random mutagenesis of specific target DNA evidence IEA A type of random mutagenesis of specific target DNA evidence that is used in an automatic assertion. ECO jbmunro 2019-12-09T12:00:00Z eco ECO:0001843 random mutagenesis of specific target DNA evidence used in automatic assertion true IMP A type of random mutagenesis of specific target DNA evidence that is used in a manual assertion. ECO jbmunro 2019-12-09T12:00:00Z eco ECO:0001844 random mutagenesis of specific target DNA evidence used in manual assertion true A type of cell-based assay evidence in which optical density is used to measure some aspect of a population of cells. Examples of aspects that can affect optical density measurements include, but are not limited to, cell number and cell shape. CACAO jbmunro 2020-01-28T12:00:00Z eco ECO:0001845 cell population optical density evidence A type of cell population optical density evidence that is used in an automatic assertion. CACAO jbmunro 2020-01-28T12:00:00Z eco ECO:0001846 cell population optical density evidence used in automatic assertion A type of cell population optical density evidence that is used in a manual assertion. CACAO jbmunro 2020-01-28T12:00:00Z eco ECO:0001847 cell population optical density evidence used in manual assertion A type of cell-based assay evidence resulting from analyzing the ability of cells to survive or live successfully. snadendla 2015-02-13T12:08:01Z eco ECO:0005004 cell viability assay evidence A type of cell-based assay evidence resulting from analyzing the ability of cells to survive or live successfully. NBK:144065 A type of cell-based assay evidence resulting from the measurement of the number of cells, which is a reflection of the balance between cell division and cell loss through cell differentiation or cell death. snadendla 2015-02-11T16:27:13Z eco ECO:0005007 cell proliferation assay evidence A type of cell-based assay evidence resulting from the measurement of the number of cells, which is a reflection of the balance between cell division and cell loss through cell differentiation or cell death. ECO:RCT GO:0008283 PMID:11057898 A type of cell proliferation assay evidence resulting from the measure of DNA synthesis in the presece of a label. snadendla 2015-02-11T16:30:10Z eco ECO:0005008 DNA synthesis cell proliferation assay evidence A type of cell proliferation assay evidence resulting from the measure of DNA synthesis in the presece of a label. PMC:3908118 A type of cell viability assay evidence resulting from the analysis of ATP concentration (by measuring light intensity) when luciferase catalyzes the oxidation of luciferin in the presence of ATP, magnesium ions and molecular oxygen. snadendla 2015-02-11T16:47:30Z eco ECO:0005011 ATP bioluminescence assay evidence A type of cell viability assay evidence resulting from the analysis of ATP concentration (by measuring light intensity) when luciferase catalyzes the oxidation of luciferin in the presence of ATP, magnesium ions and molecular oxygen. PMID:15344559 A type of cell-based assay evidence resulting from the ability of an agent to induce cellular necrosis or apoptosis and the subsequent analysis of cell death mechanism. snadendla 2015-02-12T11:39:35Z eco ECO:0005012 cytotoxicity assay evidence snadendla 2015-02-12T13:26:55Z eco ECO:0005014 Use children of ECO:0001565 (cell-based assay evidence) in place of this term. in vitro cell based assay evidence true A type of direct assay evidence resulting from the use of stains or dyes to aid in analysis of a microscopic image. snadendla 2015-02-19T11:48:57Z eco ECO:0005019 staining evidence A type of direct assay evidence resulting from the use of stains or dyes to aid in analysis of a microscopic image. ECO:RCT A type of cell-based assay evidence resulting from the evaluation of chemotactic ability (i.e. the movement, or lack of movement, in response to a chemical stimulus) of prokaryotic or eukaryotic cells. snadendla 2015-02-19T13:10:20Z eco ECO:0005021 chemotaxis assay evidence A type of cell-based assay evidence resulting from the evaluation of chemotactic ability (i.e. the movement, or lack of movement, in response to a chemical stimulus) of prokaryotic or eukaryotic cells. PMC:3667641 A type of mutant phenotype evidence resulting from the conversion of one genotype into another by the introduction of exogenous DNA. snadendla 2015-03-16T15:33:50Z eco ECO:0005027 genetic transformation evidence A type of mutant phenotype evidence resulting from the conversion of one genotype into another by the introduction of exogenous DNA. ECO:RCT The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30). A type of experimental evidence resulting from the visualization and examination of chemical and/or molecular structures. snadendla 2015-03-20T12:16:17Z eco ECO:0005031 structure determination evidence The secondary structure of VapC10 (Figure S2), predicted with the 3DJIGSAW prediction tool [36] and the DALI server [37], exhibited homology with several well studied VapC toxins, such as the first PIN domain structure for the protein PAE2754 from the archae bacterium Pyrobaculum aerophilum (30). PMID:24260461 A type of experimental evidence resulting from the visualization and examination of chemical and/or molecular structures. ECO:RCT Electron micrographs showed that all the cells are rod-shaped and those of the parent strain Ye9 and the envZ mutant strain EZ10 are flagellated, but the ompR mutant cells lack flagella. A type of microscopy evidence and structure determination evidence resulting from an electron beam utilized to create an image. snadendla 2015-03-20T12:21:48Z eco ECO:0005033 electron microscopy evidence Electron micrographs showed that all the cells are rod-shaped and those of the parent strain Ye9 and the envZ mutant strain EZ10 are flagellated, but the ompR mutant cells lack flagella. PMID:20830609 A type of microscopy evidence and structure determination evidence resulting from an electron beam utilized to create an image. ECO:RCT A type of cell-based assay evidence resulting from the occurrence, visualization, and/or analysis of apoptosis. snadendla 2015-04-07T21:58:24Z eco ECO:0005034 apoptotic assay evidence A type of cell-based assay evidence resulting from the occurrence, visualization, and/or analysis of apoptosis. ECO:RCT A type of polyADP-ribosylation assay evidence used in an in vivo experiment. snadendla 2015-06-15T15:35:05Z eco ECO:0005500 in vivo polyADP-ribosylation assay evidence A type of polyADP-ribosylation assay evidence used in an in vivo experiment. ECO:SN PMID:2820766 SIB:PG IDA A type of in vivo polyADP-ribosylation assay evidence that is used in a manual assertion. snadendla 2015-06-15T15:37:23Z eco ECO:0005501 in vivo polyADP-ribosylation assay evidence used in manual assertion true A type of in vivo polyADP-ribosylation assay evidence that is used in a manual assertion. ECO:SN A type of direct assay evidence derived by studying an organ, tissues, or cells taken from an organism and studied in an external environment with the minimum alteration of natural conditions. snadendla 2015-06-26T11:46:15Z eco ECO:0005502 ex vivo assay evidence A type of direct assay evidence derived by studying an organ, tissues, or cells taken from an organism and studied in an external environment with the minimum alteration of natural conditions. ECO:SN PMID:16305312 url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2305722/pdf/nihms42807.pdf A type of gel electrophoresis evidence that involves one dimension electrophoresis where biomolecules are electrophoresed on a low percentage polyacrylamide gel to be separated in proportion to their mass or isoelectric point, followed by high voltage electrophoresis on a higher percentage gel in the presence of ethidium bromide to alter non-linear molecular shape. CollecTF snadendla 2015-10-01T16:23:20Z 2D PAGE 2D-PAGE eco ECO:0005503 Two-dimensional polyacrylamide gel electrophoresis is commonly employed to establish a proteome for an organism and demonstrate expression changes. two-dimensional polyacrylamide gel electrophoresis evidence A type of gel electrophoresis evidence that involves one dimension electrophoresis where biomolecules are electrophoresed on a low percentage polyacrylamide gel to be separated in proportion to their mass or isoelectric point, followed by high voltage electrophoresis on a higher percentage gel in the presence of ethidium bromide to alter non-linear molecular shape. ECO:SW url:http://www.nature.com/nmeth/journal/v2/n1/full/nmeth0105-83.html A type of experimental evidence resulting from the use of a spectrometer. snadendla 2015-08-14T15:48:08Z eco ECO:0005504 spectrometry evidence A type of experimental evidence resulting from the use of a spectrometer. ECO:RCT A type of motif similarity evidence where the motif, a local alignment of sequences, is represented by a regular expression, which captures the variability of nucleotides at each position in a discrete form and can then be used to search genetic sequences by identifying matches to the regular expression. CollecTF snadendla 2015-10-09T13:51:52Z eco ECO:0005505 Regular expression is a computational tool used for determining whether a given genome contains a DNA region resembling a transcription factor binding motif. For example A/T=W indicates A or T may be present in a column of the alignment. (PMID: 20708667). regular expression motif search evidence A type of motif similarity evidence where the motif, a local alignment of sequences, is represented by a regular expression, which captures the variability of nucleotides at each position in a discrete form and can then be used to search genetic sequences by identifying matches to the regular expression. ECO:SW PMID:17337630 A type of point mutation phenotypic evidence resulting from a change in a base (or bases) causing the substitution of one amino acid for another. snadendla 2015-09-18T16:52:34Z missense mutation evidence eco ECO:0005506 missense mutation phenotypic evidence A type of point mutation phenotypic evidence resulting from a change in a base (or bases) causing the substitution of one amino acid for another. SO:0001583 A type of point mutation phenotypic evidence resulting in an incomplete and usually nonfunctional protein product because of a premature stop codon. snadendla 2015-09-18T16:55:32Z nonsense mutation evidence eco ECO:0005507 nonsense mutation phenotypic evidence A type of point mutation phenotypic evidence resulting in an incomplete and usually nonfunctional protein product because of a premature stop codon. url:https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations A type of point mutation phenotypic evidence resulting from the change of a DNA nucleotide that does not cause any changes in the amino acid sequence. snadendla 2015-09-18T17:01:12Z eco ECO:0005508 silent mutation evidence A type of point mutation phenotypic evidence resulting from the change of a DNA nucleotide that does not cause any changes in the amino acid sequence. url:http://www.sciencemag.org/news/2006/12/sound-silent-mutation A type of mutant phenotype evidence resulting from a mutation in which there is an insertion of one or more contiguous nucleotides. snadendla 2015-09-18T17:02:03Z insertion mutation evidence eco ECO:0005509 insertion mutation phenotypic evidence A type of mutant phenotype evidence resulting from a mutation in which there is an insertion of one or more contiguous nucleotides. GO:0070705 A type of experimental phenotypic evidence resulting from a mutation in which inserted nucleotide(s) have a sequence identical to, or derived from, adjacent nucleotides. snadendla 2015-09-18T17:03:25Z eco ECO:0005511 duplication mutation evidence A type of experimental phenotypic evidence resulting from a mutation in which inserted nucleotide(s) have a sequence identical to, or derived from, adjacent nucleotides. SO:1000035 A type of mutant phenotype evidence resulting from any mutation that causes an insertion or deletion of nucleotides in a DNA sequence that is not divisible by three and therefore changes the codon reading frame and the translated amino acids. snadendla 2015-09-18T17:05:49Z frameshift mutation evidence eco ECO:0005512 frameshift mutation phenotypic evidence A type of mutant phenotype evidence resulting from any mutation that causes an insertion or deletion of nucleotides in a DNA sequence that is not divisible by three and therefore changes the codon reading frame and the translated amino acids. url:https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations A type of mutant phenotype evidence resulting from a mutation that increases the number of times that a DNA sequence is repeated. snadendla 2015-09-18T17:06:34Z repeat expansion mutation evidence eco ECO:0005513 repeat expansion mutation phenotypic evidence A type of mutant phenotype evidence resulting from a mutation that increases the number of times that a DNA sequence is repeated. PMID:9397685 url:https://ghr.nlm.nih.gov/primer/mutationsanddisorders/possiblemutations A type of mutant phenotype evidence resulting from a mutation in which there is a change in nucleotides at a splice site. snadendla 2015-09-18T17:07:29Z splice site mutation evidence eco ECO:0005514 splice site mutation phenotypic evidence A type of mutant phenotype evidence resulting from a mutation in which there is a change in nucleotides at a splice site. ECO:RCT A type of mutant phenotype evidence resulting from a mutation in which a region of a chromosome is transferred to a nonhomologous chromosome. snadendla 2015-09-18T17:08:01Z translocation mutation evidence eco ECO:0005515 translocation mutation phenotypic evidence A type of mutant phenotype evidence resulting from a mutation in which a region of a chromosome is transferred to a nonhomologous chromosome. ECO:RCT A type of experimental evidence resulting from the detection and analysis of molecular markers. snadendla 2015-09-24T15:54:21Z eco ECO:0005516 molecule detection assay evidence A type of experimental evidence resulting from the detection and analysis of molecular markers. ECO:RCT A type of molecule detection assay evidence resulting from the detection and quantification of a protein, or multiple proteins. snadendla 2015-09-25T14:27:40Z eco ECO:0005517 protein detection assay evidence A type of molecule detection assay evidence resulting from the detection and quantification of a protein, or multiple proteins. ECO:RCT A type of molecule detection assay evidence resulting from the detection of specific RNAs. snadendla 2015-09-25T14:43:53Z eco ECO:0005518 RNA detection assay evidence A type of molecule detection assay evidence resulting from the detection of specific RNAs. ECO:RCT A type of molecule detection assay evidence resulting from the detection and visualization of a sequence of DNA. snadendla 2015-09-25T19:33:25Z eco ECO:0005519 DNA detection assay evidence A type of molecule detection assay evidence resulting from the detection and visualization of a sequence of DNA. ECO:RCT A type of molecule detection assay evidence based on changes in surface-reflected light due to ligand binding on the surface of a semi-transparent substrate to detect proteins, DNA, and other biological material in a multiplexed, high-throughput microarray format without labels. CollecTF snadendla 2015-09-28T16:01:01Z IRIS SRIB Spectral Reflectance Imaging Biosensor eco ECO:0005520 Differences in the optical path lengths between a surface layer and a buried silica layer can be measured very precisely allowing optical height information to be converted to accumulated mass on the surface. For the purpose of TF-binding site identification, IRIS is coupled with DNA-arrays with immobilized potential binding regions exposed to the protein of interest and eluted. Protein-bound fragments exhibit changes in reflectance that can be used to gauge binding quantitatively. interferometric reflectance imaging sensor evidence A type of molecule detection assay evidence based on changes in surface-reflected light due to ligand binding on the surface of a semi-transparent substrate to detect proteins, DNA, and other biological material in a multiplexed, high-throughput microarray format without labels. ECO:SW PMID:21587155 PMID:24271115 A type of nuclease protection assay evidence where RNA is hybridized with complementary DNA probes and exposed to S1 nuclease for unbound RNA degradation after which the intact RNA is run on a gel for probe size determination and RNA identification to detect and map specific RNAs in a complex mixture of total cellular RNA. CollecTF snadendla 2015-09-28T17:16:56Z eco ECO:0005521 S1 nuclease protection assay evidence A type of nuclease protection assay evidence where RNA is hybridized with complementary DNA probes and exposed to S1 nuclease for unbound RNA degradation after which the intact RNA is run on a gel for probe size determination and RNA identification to detect and map specific RNAs in a complex mixture of total cellular RNA. ECO:SW PMID:21390683 A type of DNA detection assay evidence resulting from evaluation of the relative abundance of target sequences hybridizing to DNA samples that are immobilized on a nitrocellulose or nylon membrane. snadendla 2015-09-30T10:03:03Z eco ECO:0005522 DNA dot blot assay evidence A type of DNA detection assay evidence resulting from evaluation of the relative abundance of target sequences hybridizing to DNA samples that are immobilized on a nitrocellulose or nylon membrane. PMID:18265189 EXP A type of DNA dot blot assay evidence that is used in a manual assertion. snadendla 2015-09-30T10:04:00Z eco ECO:0005523 DNA dot blot assay evidence used in manual assertion true A type of DNA dot blot assay evidence that is used in a manual assertion. ECO:SN ECO:SW A type of protein detection assay evidence where soft ionization is used for the analysis of biomolecules for mass determination in a three step process of plate preparation, radiation, and ionization with high throughput technology. CollecTF snadendla 2015-09-30T10:51:56Z MALDI-TOF Mass Spectrometry MALDI-TOF-MS eco ECO:0005526 MALDI-TOF MS is commonly used for protein identification in constructing a proteome where protein fingerprints obtained by microbial cells are compared with a database of reference spectra by means of various algorithms integrated in systems recently made commercially available. matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence A type of protein detection assay evidence where soft ionization is used for the analysis of biomolecules for mass determination in a three step process of plate preparation, radiation, and ionization with high throughput technology. ECO:SW PMID:21964792 PMID:25354905 EXP A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in a manual assertion. snadendla 2015-09-30T10:58:51Z MALDI-TOF mass spectrometry evidence MALDI-TOF-MS evidence eco ECO:0005527 matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence used in manual assertion true A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in a manual assertion. ECO:SN ECO:SW If the AGAA sequence is mutated CTCC (Pxyn2aM, see Table 1), no DNA-protein complex is formed under either repressing or inducing conditions (Figure 1). This result indicates that this part of the xyn2 promoter is essential for binding a transcription factor under repressing conditions. To identify key residues required for specific GlnR binding we mutated the highly conserved AC-n9-AC and AT-n9-AC DNA binding motifs. Figure 4 shows that the highly conserved adenosine residues in the motif are critical as GlnR binding is abolished when these residues are mutated. We also tested a hyaS promoter in which one (highest score) of the three putative AdpA-binding sites was mutated (at position -134 to -129, see Additional file 3: Figure S1a): the affinity of AdpA for this promoter region was reduced and one protein-DNA complex disappeared (Additional file 3: Figure S1b). These results suggest that one dimer of AdpA binds the adjacent sites -129 and -123 of S. lividans hyaS promoter and another dimer binds the -100 site resulting in the formation of the two DNA-AdpA complexes depicted in Figure 2. A type of mutant phenotype phenotype evidence based on target-specified mutagenesis for the characterization of various gene and protein interactions, structures, and functions where oligonucleotide primers are used to alter a nucleotide sequence. CollecTF snadendla 2015-09-30T11:34:41Z site directed mutagenesis site-directed mutagenesis evidence eco ECO:0005528 Site-directed mutagenesis is often performed in tandem with EMSA. It is often implemented only in conserved motif positions or serially through all positions of a site. site-directed mutagenesis phenotypic evidence If the AGAA sequence is mutated CTCC (Pxyn2aM, see Table 1), no DNA-protein complex is formed under either repressing or inducing conditions (Figure 1). This result indicates that this part of the xyn2 promoter is essential for binding a transcription factor under repressing conditions. PMID:21087492 To identify key residues required for specific GlnR binding we mutated the highly conserved AC-n9-AC and AT-n9-AC DNA binding motifs. Figure 4 shows that the highly conserved adenosine residues in the motif are critical as GlnR binding is abolished when these residues are mutated. PMID:23642041 We also tested a hyaS promoter in which one (highest score) of the three putative AdpA-binding sites was mutated (at position -134 to -129, see Additional file 3: Figure S1a): the affinity of AdpA for this promoter region was reduced and one protein-DNA complex disappeared (Additional file 3: Figure S1b). These results suggest that one dimer of AdpA binds the adjacent sites -129 and -123 of S. lividans hyaS promoter and another dimer binds the -100 site resulting in the formation of the two DNA-AdpA complexes depicted in Figure 2. PMID:24694298 A type of mutant phenotype phenotype evidence based on target-specified mutagenesis for the characterization of various gene and protein interactions, structures, and functions where oligonucleotide primers are used to alter a nucleotide sequence. ECO:SW PMID:21204030 PMID:24011050 PMID:3541892 A type of mutant phenotype evidence where a mutagenic product or process is used to alter the nucleotide sequence and thus induce genetic mutation. Examples include, but are not limited to mutagenic compounds, irradiation, PCR w/ degenerate primers, etc. CollecTF snadendla 2015-09-30T11:55:03Z random mutagenesis evidence eco ECO:0005529 Random mutagenesis is not often used in TF-binding site determination; however, it is sometimes used to investigate the effect of mutations in TF binding domains in conjunction with expression assays. Random mutations can also be introduced via chemicals, error-prone PCR (EP-PCR), degenerate oligonucleotides-Pfu(DOP), UV irradiation, mutator strains, nucleotide analogs, or DNA recombination. random mutagenesis phenotypic evidence A type of mutant phenotype evidence where a mutagenic product or process is used to alter the nucleotide sequence and thus induce genetic mutation. Examples include, but are not limited to mutagenic compounds, irradiation, PCR w/ degenerate primers, etc. ECO:SW PMID:15153637 PMID:18265275 IMP A type of random mutagenesis phenotypic evidence that is used in a manual assertion. snadendla 2015-09-30T11:57:00Z eco ECO:0005530 random mutagenesis evidence used in manual assertion true A sequence alignment of the phlA gene promoter region from strain 2P24 with other well-studied 2,4-DAPG producing Pseudomonas strains revealed a very well conserved palindromic sequence GAAACN5GTTTC (Fig. S1). In order to identify a potential regulatory motif for KstR2, we used the promoter regions of the kstR2 orthologues as a training set for the motif identification program MEME (Bailey & Elkan, 1994). This identified a potential regulatory sequence that contains a 14 bp inverted palindromic motif AnCAAGnnCTTGnT (Fig. 2). We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1). A type of multiple sequence alignment evidence based on a set of algorithms that infer over-represented motifs from a set of biological sequences returning one or more local multiple sequence alignment defining the inferred motifs. CollecTF snadendla 2015-09-30T15:04:45Z eco ECO:0005531 Relationship type between sequences (e.g. orthologs from multiple genomes or co-expressed genes in the same genome) is not necessarily assumed. The local multiple sequence alignment is typically ungapped. A common application of motif discovery is to infer the binding motif of a given transcription factor (TF). This can be based on the results of a whole-genome expression analysis, assuming that co-expressed genes are co-regulated by the same TF, from peaks in ChIP-seq experiments with the TF, or from the comparative genomics analysis of the promoter regions of orthologs. motif discovery evidence A sequence alignment of the phlA gene promoter region from strain 2P24 with other well-studied 2,4-DAPG producing Pseudomonas strains revealed a very well conserved palindromic sequence GAAACN5GTTTC (Fig. S1). PMID:23209661 In order to identify a potential regulatory motif for KstR2, we used the promoter regions of the kstR2 orthologues as a training set for the motif identification program MEME (Bailey & Elkan, 1994). This identified a potential regulatory sequence that contains a 14 bp inverted palindromic motif AnCAAGnnCTTGnT (Fig. 2). PMID:20167624 We mapped sites upstream of crp itself, SCO4561 and SCO2977, and identified a consensus binding sequence [GTG(N)6GNCAC]; derivatives of this motif could be found in all of the secondary metabolism-associated target sequences, although notably, one-half of the palindrome seemed to be better conserved than the other [GTG(N)6GNGAN] (Fig. 2C; Table 1). PMID:23232715 A type of multiple sequence alignment evidence based on a set of algorithms that infer over-represented motifs from a set of biological sequences returning one or more local multiple sequence alignment defining the inferred motifs. ECO:SW PMID:10812473 PMID:16845028 PMID:8211139 Relationship type between sequences (e.g. orthologs from multiple genomes or co-expressed genes in the same genome) is not necessarily assumed. The local multiple sequence alignment is typically ungapped. A common application of motif discovery is to infer the binding motif of a given transcription factor (TF). This can be based on the results of a whole-genome expression analysis, assuming that co-expressed genes are co-regulated by the same TF, from peaks in ChIP-seq experiments with the TF, or from the comparative genomics analysis of the promoter regions of orthologs. PMID:19892760 PMID:23032607 A type of motif similarity evidence where the motif is represented by a consensus sequence which incorporates the most frequent nucleotide at each position acting as a generic representative for the sequences in the alignment, and is compared to the genetic sequence for a perfect or imperfect match. CollecTF snadendla 2015-10-09T14:12:54Z eco ECO:0005532 This technique is used to identify transcription factor binding sites by searching a bacterial genome for DNA regions resembling a given TF-binding motif. PMID: 17085555. consensus search evidence A type of motif similarity evidence where the motif is represented by a consensus sequence which incorporates the most frequent nucleotide at each position acting as a generic representative for the sequences in the alignment, and is compared to the genetic sequence for a perfect or imperfect match. ECO:SW PMID:15130839 A type of motif discovery evidence based on a set of algorithms that infer motifs in non-coding DNA sequences from the conservation of functional regulatory sites through evolution at a higher rate than their local surroundings for the identification of an evolutionary 'footprint'. CollecTF snadendla 2015-09-30T16:23:02Z eco ECO:0005533 The name derives to experimental footprinting techniques where transcription factor (TF)-binding sites are identified by sequencing the region of DNA protected from biochemical agents by the bound TF. This technique is used to identify or verify transcription factor-binding motifs, most commonly in the Eukaryota (PMID: 11997340). phylogenetic footprinting evidence A type of motif discovery evidence based on a set of algorithms that infer motifs in non-coding DNA sequences from the conservation of functional regulatory sites through evolution at a higher rate than their local surroundings for the identification of an evolutionary 'footprint'. ECO:SW PMID:16477324 PMID:3199442 A type of motif similarity evidence based on comparative genomics which uses a search method to scan a set of genomes for instances of a specific motif, and then applies a comparative criterion to analyze the collective strength of these predictions, based on the assumption that functional instances of the motif will be preserved by natural selection and their prediction will therefore be consistent across genomes. CollecTF snadendla 2015-10-09T14:30:38Z eco ECO:0005534 This technique is used to predict transcription factor binding sites in gene promoter regions by identifying conserved DNA regions across multiple genomes. PMID: 22305460. Orthology is a typical comparative criterion used. comparative genomics motif search evidence A type of motif similarity evidence based on comparative genomics which uses a search method to scan a set of genomes for instances of a specific motif, and then applies a comparative criterion to analyze the collective strength of these predictions, based on the assumption that functional instances of the motif will be preserved by natural selection and their prediction will therefore be consistent across genomes. ECO:SW PMID:10854408 A type of match to sequence model evidence which captures the application of a broad suite of supervised and unsupervised machine learning algorithms trained on known motif instances and applied to the prediction of novel putative instances of a motif in a set of biological sequences. CollecTF snadendla 2015-10-01T11:58:36Z eco ECO:0005535 Machine learning algorithms include, but are not limited to artificial neural networks, random-forest, k-means clustering, hidden Markov models. This suite of methods can be used to identify or verify transcription factor-binding sites in genomic sequences (PMID: 15703297). machine learning prediction of motif instance evidence A type of match to sequence model evidence which captures the application of a broad suite of supervised and unsupervised machine learning algorithms trained on known motif instances and applied to the prediction of novel putative instances of a motif in a set of biological sequences. ECO:SW PMID:17117497 PMID:2014171 A type of motif similarity evidence where the motif is represented by a position-specific frequency matrix (PSFM) that specifies the frequency of each base at each position of the motif, from which a position-specific scoring matrix (PSSM) can be derived under the framework of a log-likelihood ratio providing a scoring system based on the likelihood of a sequence given the motif, versus a genomic-frequency based null hypothesis. CollecTF snadendla 2015-10-09T15:04:35Z PSSM motif search PSSM eco ECO:0005536 This technique is used to predict transcription factor binding sites in gene promoter regions by using a position weight matrix approach. (PMID: 15604457). position-specific scoring matrix motif search evidence A type of motif similarity evidence where the motif is represented by a position-specific frequency matrix (PSFM) that specifies the frequency of each base at each position of the motif, from which a position-specific scoring matrix (PSSM) can be derived under the framework of a log-likelihood ratio providing a scoring system based on the likelihood of a sequence given the motif, versus a genomic-frequency based null hypothesis. ECO:SW PMID:10812473 A type of reporter gene assay evidence based on the fusion of the xylE gene to a specific promoter for the expression of catechol 2,3-dioxygenase that converts the colorless catechol substrate to yellow 2-hydroxymuconic semialdehyde for identification of the expression of a particular gene. CollecTF snadendla 2015-10-28T15:31:28Z eco ECO:0005537 xylE reporter gene assay evidence A type of reporter gene assay evidence based on the fusion of the xylE gene to a specific promoter for the expression of catechol 2,3-dioxygenase that converts the colorless catechol substrate to yellow 2-hydroxymuconic semialdehyde for identification of the expression of a particular gene. ECO:SW PMID:2592344 snadendla 2015-11-17T15:15:50Z eco ECO:0005538 computationally derived logical inference true snadendla 2015-11-17T15:17:47Z eco ECO:0005539 computationally derived logical inference used in automatic assertion true snadendla 2015-11-17T15:24:42Z eco ECO:0005540 computationally derived logical inference from automatic assertion used in automatic assertion true snadendla 2015-11-17T15:32:03Z eco ECO:0005541 computationally derived logical inference from manual assertion used in automatic assertion true A type of biological system reconstruction evidence by experimental evidence from single species that is used in a manual assertion. snadendla 2015-12-16T15:32:41Z eco ECO:0005542 Processes, pathways and complexes shown by a single experiment should not be annotated with this term but with ECO:0000353 or a child thereof. biological system reconstruction evidence by experimental evidence from single species used in manual assertion true A type of biological system reconstruction evidence by experimental evidence from single species that is used in a manual assertion. ECO:SN PMID:19450514 A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in a manual assertion. snadendla 2015-12-16T15:45:01Z eco ECO:0005543 Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. The evidence may originate from a combination of several experiments. biological system reconstruction evidence by experimental evidence from mixed species used in manual assertion true A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in a manual assertion. ECO:SN PMID:22232657 A type of biological system reconstruction evidence based on orthology evidence that is used in a manual assertion. snadendla 2015-12-18T16:20:49Z eco ECO:0005544 Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments. biological system reconstruction evidence based on orthology evidence used in manual assertion A type of biological system reconstruction evidence based on orthology evidence that is used in a manual assertion. ECO:SN A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by orthology from an existing experimentally supported model to a process, pathway or complex in another species. snadendla 2015-12-16T15:57:37Z eco ECO:0005545 Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments. biological system reconstruction evidence based on orthology evidence A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by orthology from an existing experimentally supported model to a process, pathway or complex in another species. ECO:SN PMID:15660128 A type of biological system reconstruction evidence based on paralogy evidence that is used in a manual assertion. snadendla 2015-12-16T16:05:15Z eco ECO:0005546 Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments. biological system reconstruction evidence based on paralogy evidence used in manual assertion A type of biological system reconstruction evidence based on paralogy evidence that is used in a manual assertion. ECO:SN PMID:15660128 A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in a manual assertion. snadendla 2015-12-16T16:07:42Z eco ECO:0005547 Functional studies or ligand binding evidence are often used for the reconstruction of biological systems. It does not provide physical interaction evidence but uses proxies such a ligand binding evidences to infer the presence or absence of the complex components. biological system reconstruction evidence based on inference from background scientific knowledge used in manual assertion true A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in a manual assertion. ECO:SN PMID:17876790 A type of biological system reconstruction based solely on background scientific knowledge of that biological system. snadendla 2015-12-18T15:32:15Z eco ECO:0005548 The available knowledge is usually a combination of partial or weak experimental evidence where either some components are missing or no physical interaction evidence can be found but the system is inferred by similarity to related systems in taxonomically-disparate organisms with experimental evidence. Functional studies or ligand binding evidence are often used for the reconstruction of biological systems. It does not provide physical interaction evidence but uses proxies such a ligand binding evidences to infer the presence or absence of the complex components. biological system reconstruction evidence based on inference from background scientific knowledge A type of biological system reconstruction based solely on background scientific knowledge of that biological system. ECO:SN PMID:17876790 A type of biological system reconstruction where the evidence is inferred by homology based on conservation of sequence, function, and composition from an existing experimentally supported model to a process, pathway, or complex. snadendla 2015-12-18T15:49:46Z eco ECO:0005549 Inference may be based on paralogy and/or orthology of the genome-encoded components and is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments in the same or another species. biological system reconstruction evidence based on homology evidence A type of biological system reconstruction where the evidence is inferred by homology based on conservation of sequence, function, and composition from an existing experimentally supported model to a process, pathway, or complex. ECO:SN PMID:15660128 A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by paralogy from an existing experimentally supported model to a process, pathway, or complex in the same species. snadendla 2015-12-18T16:24:08Z eco ECO:0005550 Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments. biological system reconstruction evidence based on paralogy evidence A type of biological system reconstruction evidence based on homology evidence where the evidence is inferred by paralogy from an existing experimentally supported model to a process, pathway, or complex in the same species. ECO:SN PMID:15660128 A type of biological system reconstruction evidence that uses experimental evidence as support. snadendla 2015-12-18T16:34:13Z eco ECO:0005551 biological system reconstruction evidence by experimental evidence A type of biological system reconstruction evidence that uses experimental evidence as support. ECO:SN PMID:19450514 PMID:22232657 A type of biological system reconstruction evidence where the experimental evidence is derived by using a mix of species used in the same experiment. snadendla 2015-12-18T16:35:13Z eco ECO:0005552 Inference is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. The evidence may originate from a combination of several experiments. biological system reconstruction evidence by experimental evidence from mixed species A type of biological system reconstruction evidence where the experimental evidence is derived by using a mix of species used in the same experiment. ECO:SN PMID:22232657 A type of biological system reconstruction where the experimental evidence is derived by using multiple experiments in a single species. snadendla 2015-12-18T16:36:44Z eco ECO:0005553 Processes, pathways and complexes shown by a single experiment should not be annotated with this term but with ECO:0000353 or a child thereof. biological system reconstruction evidence by experimental evidence from single species A type of biological system reconstruction where the experimental evidence is derived by using multiple experiments in a single species. ECO:SN A type of sequence alignment evidence where two sequences are aligned to identify regions of similarity that may indicate functional, structural and/or evolutionary relationships between two biological sequences (protein or nucleic acid). snadendla 2016-02-08T14:30:46Z eco ECO:0005554 pairwise sequence alignment evidence A type of sequence alignment evidence where two sequences are aligned to identify regions of similarity that may indicate functional, structural and/or evolutionary relationships between two biological sequences (protein or nucleic acid). ECO:SN url:http://www.ebi.ac.uk/Tools/psa/ A type of sequence alignment evidence where three or more biological sequences (protein or nucleic acid) of similar length are aligned to infer homology and the evolutionary relationships between the sequences studied. CollecTF snadendla 2016-02-08T14:31:24Z eco ECO:0005555 multiple sequence alignment evidence A type of sequence alignment evidence where three or more biological sequences (protein or nucleic acid) of similar length are aligned to infer homology and the evolutionary relationships between the sequences studied. ECO:SN url:http://www.ebi.ac.uk/Tools/msa/ ISA A type of multiple sequence alignment evidence that is used in a manual assertion. snadendla 2016-02-08T14:59:18Z eco ECO:0005556 multiple sequence alignment evidence used in manual assertion true A type of multiple sequence alignment evidence that is used in a manual assertion. ECO:SN IEA A type of multiple sequence alignment evidence that is used in an automatic assertion. snadendla 2016-02-08T15:00:50Z eco ECO:0005557 multiple sequence alignment evidence used in automatic assertion true A type of multiple sequence alignment evidence that is used in an automatic assertion. ECO:SN ISA A type of motif discovery evidence that is used in a manual assertion. snadendla 2016-02-08T15:07:47Z eco ECO:0005558 motif discovery evidence used in manual assertion true A type of motif discovery evidence that is used in a manual assertion. ECO:SN IEA A type of motif discovery evidence that is used in an automatic assertion. snadendla 2016-02-08T15:08:19Z eco ECO:0005559 motif discovery evidence used in automatic assertion true A type of motif discovery evidence that is used in an automatic assertion. ECO:SN ISA A type of pairwise sequence alignment evidence that is used in a manual assertion. snadendla 2016-02-08T15:17:05Z eco ECO:0005560 pairwise sequence alignment evidence used in manual assertion true A type of pairwise sequence alignment evidence that is used in a manual assertion. ECO:SN IEA A type of pairwise sequence alignment evidence that is used in an automatic evidence. snadendla 2016-02-08T15:17:52Z eco ECO:0005561 pairwise sequence alignment evidence used in automatic assertion true A type of pairwise sequence alignment evidence that is used in an automatic evidence. ECO:SN A type of protein kinase assay evidence resulting from the evaluation of the phosphorylation activity of kinase on a gel-incorporated kinase substrate. snadendla 2016-02-09T12:05:29Z eco ECO:0005562 in-gel protein kinase assay evidence A type of protein kinase assay evidence resulting from the evaluation of the phosphorylation activity of kinase on a gel-incorporated kinase substrate. PMID:12372853 A type of voltage clamp recording evidence that involves recording trace of the current (pA) going through the analyzed ion channels determined from voltage clamp current recording. snadendla 2016-02-09T12:40:03Z eco ECO:0005563 macroscopic current trace evidence A type of voltage clamp recording evidence that involves recording trace of the current (pA) going through the analyzed ion channels determined from voltage clamp current recording. ECO:SN PMID:17938230 url:http://www.utdallas.edu/~tres/microelectrode/microelectrodes_ch03.pdf A type of electrophysiology assay evidence that involves measuring the amount of current (pA) going through the ion channels per unit of membrane. snadendla 2016-02-09T12:43:07Z eco ECO:0005564 current density evidence A type of electrophysiology assay evidence that involves measuring the amount of current (pA) going through the ion channels per unit of membrane. ECO:SN url:http://circres.ahajournals.org/content/102/11/1298.full url:http://www.bem.fi/book/04/04.htm snadendla 2016-02-09T12:45:42Z eco ECO:0005565 single channel conductance evidence true A type of electrophysiology assay evidence that involves the measurement of the current that persists after the fast and slow inactivation of the analyzed channels. snadendla 2016-02-09T12:46:54Z eco ECO:0005566 sustained current evidence A type of electrophysiology assay evidence that involves the measurement of the current that persists after the fast and slow inactivation of the analyzed channels. ECO:SN url:http://www.nature.com/ncomms/journal/v3/n2/full/ncomms1717.html snadendla 2016-02-09T12:48:17Z eco ECO:0005567 steady state activation curve evidence true snadendla 2016-02-09T12:50:45Z eco ECO:0005568 steady state inactivation curve evidence true snadendla 2016-02-09T12:57:16Z eco ECO:0005569 window current trace evidence true A type of electrophysiology assay evidence in which the amount of current remaining after a series of depolarization at different frequencies described as the normalized current related to the time course. snadendla 2016-02-09T12:58:18Z eco ECO:0005570 use dependence of inactivation evidence A type of electrophysiology assay evidence in which the amount of current remaining after a series of depolarization at different frequencies described as the normalized current related to the time course. ECO:SN url:http://circres.ahajournals.org/content/89/8/700.full A type of electrophysiology assay evidence that involves recording the change in membrane potential caused by applying specific current to the cell. snadendla 2016-02-12T13:58:32Z birnlex:2278 current clamp voltage recording evidence eco ECO:0005571 current clamp recording evidence A type of electrophysiology assay evidence that involves recording the change in membrane potential caused by applying specific current to the cell. ECO:SN url:http://www.nature.com/nprot/journal/v4/n8/full/nprot.2009.91.html birnlex:2278 current clamp voltage recording protocol A type of voltage clamp recording evidence that involves direct measurement of ionic current across a membrane while controlling the membrane potential by maintaining the voltage. snadendla 2016-02-12T14:06:40Z birnlex:2281 eco ECO:0005572 whole-cell voltage clamp recording evidence A type of voltage clamp recording evidence that involves direct measurement of ionic current across a membrane while controlling the membrane potential by maintaining the voltage. ECO:SN url:http://circres.ahajournals.org/content/72/1/91.full.pdf birnlex:2281 whole-cell voltage clamp recording protocol A type of patch-clamp recording evidence that involves isolation of a patch of membrane electrically from the external solution and to record current flowing into the patch and this is achieved by pressing a fire-polished glass pipette, which has been filled with a suitable electrolyte solution, against the surface of a cell and applying light suction. snadendla 2016-02-12T14:07:39Z birnlex:2283 cell-attached patch-clamp recording evidence eco ECO:0005573 cell-attached single-channel recording evidence A type of patch-clamp recording evidence that involves isolation of a patch of membrane electrically from the external solution and to record current flowing into the patch and this is achieved by pressing a fire-polished glass pipette, which has been filled with a suitable electrolyte solution, against the surface of a cell and applying light suction. ECO:SN url:http://www.utdallas.edu/~tres/microelectrode/microelectrodes_ch04.pdf birnlex:2283 cell-attached single-channel recording protocol A type of patch-clamp recording evidence that involves study of individual ion channels by gently pulling the patch of membrane away from the cell, and the patch remains attached to the pipette with its cytoplasmic surface exposed to the bathing solution. snadendla 2016-02-12T14:16:53Z birnlex:2286 cell-detached inside-out patch-clamp recording evidence eco ECO:0005574 cell-detached inside-out single-channel recording evidence A type of patch-clamp recording evidence that involves study of individual ion channels by gently pulling the patch of membrane away from the cell, and the patch remains attached to the pipette with its cytoplasmic surface exposed to the bathing solution. ECO:SN url:http://www.acnp.org/g4/GN401000005/CH005.html birnlex:2286 cell-detached inside-out single-channel recording protocol A type of patch-clamp reocrding evidence that involves ion channel analysis by incorporating the ion channels into liposomes suitable for patch-clamping which allows isolation and study of a specific population of channels into that bilayer membrane. snadendla 2016-02-12T14:17:46Z birnlex:2287 eco ECO:0005575 reconstituted bilayer single-channel patch recording evidence A type of patch-clamp reocrding evidence that involves ion channel analysis by incorporating the ion channels into liposomes suitable for patch-clamping which allows isolation and study of a specific population of channels into that bilayer membrane. ECO:SN url:http://nanion.de/images/stories/papers/Bilayers_lab-on-a-chip08.pdf birnlex:2287 reconstituted bilayer single-channel patch recording protocol A type of electrophysiology assay evidence that involves recording membrane potential by controlling the membrane voltage and measuring the transmembrane current required to maintain that voltage. snadendla 2016-02-12T14:18:36Z birnlex:2279 voltage clamp current recording evidence eco ECO:0005576 voltage clamp recording evidence A type of electrophysiology assay evidence that involves recording membrane potential by controlling the membrane voltage and measuring the transmembrane current required to maintain that voltage. ECO:SN url:http://neurobio.drexelmed.edu/GaoWeb/Resources/Recording%20_Techniques.pdf url:http://www.acnp.org/g4/GN401000005/CH005.html birnlex:2279 voltage clamp current recording protocol A type of electrophysiology assay evidence that involves recording the electrical activity of the brain by means of electrodes placed on the surface of the head. snadendla 2016-02-12T14:19:21Z birnlex:2293 eco ECO:0005577 electroencephalography recording evidence A type of electrophysiology assay evidence that involves recording the electrical activity of the brain by means of electrodes placed on the surface of the head. ECO:SN url:http://www.jove.com/science-education/5420/electro-encephalography-eeg birnlex:2293 electroencephalography recording protocol A type of microscopy evidence where the images are taken with a higher resolution than the diffraction limit that help in studying nanoscopic sub-cellular structures. snadendla 2016-02-12T15:20:47Z eco ECO:0005578 super-resolution microscopy evidence A type of microscopy evidence where the images are taken with a higher resolution than the diffraction limit that help in studying nanoscopic sub-cellular structures. ECO:SN url:http://journal.frontiersin.org/article/10.3389/fncel.2015.00007/full IDA A type of immunogold labelling evidence that is used in a manual assertion. snadendla 2016-02-12T15:38:03Z immunogold labelling eco ECO:0005579 immunogold labelling evidence used in manual assertion true A type of immunogold labelling evidence that is used in a manual assertion. ECO:SN IDA A type of flow cytometry evidence that is used in a manual assertion. snadendla 2016-02-12T16:04:23Z FCM eco ECO:0005580 flow cytometry evidence used in manual assertion true A type of flow cytometry evidence that is used in a manual assertion. ECO:SN EXP A type of enzyme-linked immunoabsorbent assay evidence that is used in a manual assertion. snadendla 2016-02-12T16:23:38Z ELISA evidence|enzyme-linked immunosorbent assay evidence eco ECO:0005581 enzyme-linked immunoabsorbent assay evidence used in manual assertion true A type of enzyme-linked immunoabsorbent assay evidence that is used in a manual assertion. ECO:SN A type of patch-clamp recording evidence where a part of cellular membrane is detached from the cell and whose external face is exposed to the extracellular medium which allows isolating and studying a single or at least a small number of channels into that fragment (patch). snadendla 2016-03-02T10:47:25Z cell-detached outside-out patch-clamp evidence eco ECO:0005582 cell-detached outside-out single-channel recording evidence A type of patch-clamp recording evidence where a part of cellular membrane is detached from the cell and whose external face is exposed to the extracellular medium which allows isolating and studying a single or at least a small number of channels into that fragment (patch). ECO:SN url:http://www.nature.com/nprot/journal/v2/n11/full/nprot.2007.403.html A type of voltage clamp recording evidence that involves inserting the oocyte in a chamber that separates the surface into 3 regions where the top portion of the oocyte membrane is the region that is clamped from which currents are actually recorded while the bottom portion is the region of the oocyte that is cut-open, making it possible to inject current intracellularly through a low resistance pathway. snadendla 2016-03-02T11:29:32Z eco ECO:0005583 cut-open oocyte voltage clamp recording evidence A type of voltage clamp recording evidence that involves inserting the oocyte in a chamber that separates the surface into 3 regions where the top portion of the oocyte membrane is the region that is clamped from which currents are actually recorded while the bottom portion is the region of the oocyte that is cut-open, making it possible to inject current intracellularly through a low resistance pathway. ECO:SN PMID:9711615 A type of voltage clamp recording evidence where recording is done on a fragment of the cell membrane (attached to or detached from the cell) using a large tip diameter pipette that allows isolating and studying a small number of channels into that fragment (patch). snadendla 2016-03-02T11:33:48Z eco ECO:0005584 macropatch voltage clamp recording evidence A type of voltage clamp recording evidence where recording is done on a fragment of the cell membrane (attached to or detached from the cell) using a large tip diameter pipette that allows isolating and studying a small number of channels into that fragment (patch). ECO:SN url:http://jxb.oxfordjournals.org/content/50/Special_Issue/1037.full.pdf A type of mass spectrometry evidence where mass-to-charge ratio (m/z) of gas-phase ions is measured which is used to identify and quantify molecules in complex solutions within the framework of high throughput studies. snadendla 2016-03-02T12:33:07Z eco ECO:0005585 There are significant differences in data analysis and data evaluation if to compare a HTP mass-spec and a regular mass-spec. The regular mass spec method is quite a reliable technique for identifying a protein molecular weight and analysing its post-modifications, other mass-spec applications might require the additional quality controls and more stringent data evaluation. More complex sample mixture is processed, more quality questions should be addressed, such as a sample contamination and sensitivity of the mass spectrometer while using HTP mass-spec. For HTP mass-spec, the analysis of the small data sets allows to manually assign the spectra to proteins or peptides, but for large data sets only the statistical tools can be used instead. high throughput mass spectrometry evidence A type of mass spectrometry evidence where mass-to-charge ratio (m/z) of gas-phase ions is measured which is used to identify and quantify molecules in complex solutions within the framework of high throughput studies. ECO:SN PMID:20805795 EXP A type of high throughput mass spectrometry evidence that is used in a manual assertion. snadendla 2016-03-02T12:50:02Z eco ECO:0005586 high throughput mass spectrometry evidence used in manual assertion true A type of high throughput mass spectrometry evidence that is used in a manual assertion. ECO:SN A type of microscopy evidence where sharp images are taken by excluding most of the light from the specimen that is not from the microscope's focal plane, thus allowing better contrast and less haze, which makes it possible to build three-dimensional reconstructions of a volume of the specimen by assembling a series of thin slices taken along the vertical axis. snadendla 2016-03-17T12:29:45Z eco ECO:0005587 confocal microscopy evidence A type of microscopy evidence where sharp images are taken by excluding most of the light from the specimen that is not from the microscope's focal plane, thus allowing better contrast and less haze, which makes it possible to build three-dimensional reconstructions of a volume of the specimen by assembling a series of thin slices taken along the vertical axis. ECO:SN url:http://www.physics.emory.edu/faculty/weeks//lab/papers/ebbe05.pdf A type of microscopy evidence where imaging of a thin cell or a tissue specimen is performed by full aperture emission of light gathered by the microscope's objective, which maximizes the recorded signal and simultaneously minimizes the required exposure times. snadendla 2016-03-17T12:30:27Z eco ECO:0005588 wide-field microscopy evidence A type of microscopy evidence where imaging of a thin cell or a tissue specimen is performed by full aperture emission of light gathered by the microscope's objective, which maximizes the recorded signal and simultaneously minimizes the required exposure times. ECO:SN url:http://jcb.rupress.org/content/172/1/9.full url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3048960/ url:http://zeiss-campus.magnet.fsu.edu/articles/livecellimaging/techniques.html IDA A type confocal microscopy evidence that is used in a manual assertion. snadendla 2016-03-17T12:32:24Z eco ECO:0005589 confocal microscopy evidence used in manual assertion true A type confocal microscopy evidence that is used in a manual assertion. ECO:SN IDA A type of wide-field microscopy evidence that is used in a manual assertion. snadendla 2016-03-17T12:34:42Z eco ECO:0005590 wide-field microscopy evidence used in manual assertion true A type of wide-field microscopy evidence that is used in a manual assertion. ECO:SN A type of immunogold labelling evidence where electron microscopy technique is used to detect the location of the antibodies labeled with colloidal gold particles. snadendla 2016-03-17T15:43:00Z eco ECO:0005591 immunogold labelling electron microscopy assay evidence A type of immunogold labelling evidence where electron microscopy technique is used to detect the location of the antibodies labeled with colloidal gold particles. ECO:SN PMID:4110101 IDA A type of immunogold labelling electron microscopy assay evidence that is used in a manual assertion. snadendla 2016-03-17T16:39:37Z eco ECO:0005592 immunogold labelling electron microscopy assay evidence used in manual assertion true true A type of immunogold labelling electron microscopy assay evidence that is used in a manual assertion. ECO:SN A type of direct assay evidence that involves the use of antibodies to detect biomolecules. snadendla 2016-03-17T17:07:33Z eco ECO:0005593 immunodetection assay evidence A type of direct assay evidence that involves the use of antibodies to detect biomolecules. ECO:SN A type of immunolocalization evidence involving enzymatic detection of a peroxidase tagged antibody. snadendla 2016-03-17T17:11:34Z eco ECO:0005594 immunoperoxidase immunolocalization evidence A type of immunolocalization evidence involving enzymatic detection of a peroxidase tagged antibody. ECO:SN IDA A type of immunoperoxidase immunolocalization evidence that is used in a manual assertion. snadendla 2016-03-17T17:14:05Z eco ECO:0005595 immunoperoxidase immunolocalization evidence used in manual assertion true A type of immunoperoxidase immunolocalization evidence that is used in a manual assertion. ECO:SN A type of immunoperoxidase immunolocalization evidence where electron microscopy technique is used for enzymatic detection of a peroxidase tagged antibody. snadendla 2016-03-17T17:16:38Z Immunoperoxidase labelling electron microscopy eco ECO:0005596 immunoperoxidase immunolocalization electron microscopy evidence A type of immunoperoxidase immunolocalization evidence where electron microscopy technique is used for enzymatic detection of a peroxidase tagged antibody. ECO:SN IDA A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in a manual assertion. snadendla 2016-03-17T17:23:56Z immunoperoxidase labelling electron microscopy evidence eco ECO:0005597 immunoperoxidase immunolocalization electron microscopy evidence used in manual assertion true true A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in a manual assertion. ECO:SN A type of wide-field microscopy evidence where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter. snadendla 2016-03-18T11:53:56Z eco ECO:0005598 The optical filter is used to select the wavelength of excitation light. The detection camera is typically a CCD camera. Both topographical and dynamic information of a sample are obtained. wide-field fluorescence microscopy evidence A type of wide-field microscopy evidence where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter. ECO:SN url:http://www.bristol.ac.uk/synaptic/research/techniques/widefield.html A type of wide-field fluorescence microscopy evidence where fluorescently tagged antibodies are imaged that are used to bind to their antigens. snadendla 2016-03-18T11:55:40Z wide-field epifluorescence microscopy eco ECO:0005599 immunofluorescence wide-field microscopy evidence A type of wide-field fluorescence microscopy evidence where fluorescently tagged antibodies are imaged that are used to bind to their antigens. ECO:SN url:http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0057135 The endogenous protein expression and localization for WalR and WalK was also checked using confocal immunofluorescence microscopy. WalR could be localized to the cytoplasm of B. anthracis but WalK could not be detected once again (data not shown). A type of confocal microscopy evidence where light passes through immunofluorescent-stained tissue sections or cells and then the emitted light passes through the dichroic mirror and is focused onto the pinhole for subsequent detection. snadendla 2016-03-18T12:48:42Z eco ECO:0005600 This allows visualization of sub cellular distribution of biomolecules of interest. immunofluorescence confocal microscopy evidence The endogenous protein expression and localization for WalR and WalK was also checked using confocal immunofluorescence microscopy. WalR could be localized to the cytoplasm of B. anthracis but WalK could not be detected once again (data not shown). PMID:24490131 A type of confocal microscopy evidence where light passes through immunofluorescent-stained tissue sections or cells and then the emitted light passes through the dichroic mirror and is focused onto the pinhole for subsequent detection. ECO:SN url:http://www.physics.emory.edu/faculty/weeks/confocal/ url:https://www.hycultbiotech.com/media/wysiwyg/protocol_Immunofluorescence.pdf IDA A type of immunofluorescence confocal microscopy evidence that is used in a manual assertion. snadendla 2016-03-18T12:52:04Z eco ECO:0005601 immunofluorescence confocal microscopy evidence used in manual assertion true true A type of immunofluorescence confocal microscopy evidence that is used in a manual assertion. ECO:SN A type of mass spectrometry evidence where one or more protein analyses are performed. snadendla 2016-03-18T13:11:37Z eco ECO:0005603 protein mass spectrometry evidence A type of mass spectrometry evidence where one or more protein analyses are performed. ECO:SN A type of cell proliferation assay evidence where the investigated organism or a potential antagonist is inoculated so as to grow along the diameter line of the agar medium in a Petri dish, then, potentially susceptible microbes (usually bacteria) are streaked perpendicularly to the growth line and inhibition of growth of a test microbe in the vicinity of that line suggests that the antagonist secretes one or more diffusible antibiotics. snadendla 2016-03-29T15:40:54Z eco ECO:0005604 cross-streak test evidence A type of cell proliferation assay evidence where the investigated organism or a potential antagonist is inoculated so as to grow along the diameter line of the agar medium in a Petri dish, then, potentially susceptible microbes (usually bacteria) are streaked perpendicularly to the growth line and inhibition of growth of a test microbe in the vicinity of that line suggests that the antagonist secretes one or more diffusible antibiotics. ECO:SN url:www.jstor.org/stable/3792785 Disk diffusion assays were used to determine if ohr and ohrR mutations affected resistance to ROS. The ohr mutant was less resistant than its parental strain when challenged with organic peroxides as shown by the zones of growth inhibition: 4.1 +- 0.2 cm for CuOOH and 3.1 +- 0.1 cm for tBOOH versus to 2.3 +- 0.2 and 2.5 +- 0.3 cm for wild type strain. A type of zone of inhibition evidence where sensitivity/resistance to an antimicrobial agent is tested by impregnating small filter disks with a known concentration of antimicrobial agent which is then placed on a Mueller-Hinton agar plate inoculated with the test organism. snadendla 2016-03-29T16:02:22Z eco ECO:0005605 disk diffusion test evidence Disk diffusion assays were used to determine if ohr and ohrR mutations affected resistance to ROS. The ohr mutant was less resistant than its parental strain when challenged with organic peroxides as shown by the zones of growth inhibition: 4.1 +- 0.2 cm for CuOOH and 3.1 +- 0.1 cm for tBOOH versus to 2.3 +- 0.2 and 2.5 +- 0.3 cm for wild type strain. PMID:21569462 A type of zone of inhibition evidence where sensitivity/resistance to an antimicrobial agent is tested by impregnating small filter disks with a known concentration of antimicrobial agent which is then placed on a Mueller-Hinton agar plate inoculated with the test organism. ECO:SN url:http://www.cdc.gov/nczved/resources/cholera/ch9.pdf A type of experimental evidence where a foreign genetic material is introduced into the cell for study of gene function and regulation and protein function. snadendla 2016-03-29T16:59:17Z eco ECO:0005606 cell transfection experiment evidence A type of experimental evidence where a foreign genetic material is introduced into the cell for study of gene function and regulation and protein function. ECO:SN url:http://ch.promega.com/resources/product-guides-and-selectors/protocols-and-applications-guide/transfection/ url:http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2911531/ A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by observing the rotational behavior of the cells tethered to a coverslip by their flagella. snadendla 2016-03-31T15:51:10Z eco ECO:0005607 tethered cell assay evidence A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by observing the rotational behavior of the cells tethered to a coverslip by their flagella. ECO:SN PMID:1103143 A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis in swimming organisms is determined by measuring chemotaxis in response to sudden concentration changes from one uniform spatial environment to another. snadendla 2016-03-31T16:42:35Z Temporal assay eco ECO:0005608 tumble frequency assay evidence A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis in swimming organisms is determined by measuring chemotaxis in response to sudden concentration changes from one uniform spatial environment to another. ECO:SN PMID:4576832 A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the rate of accumulation of the cells into a capillary. snadendla 2016-03-31T16:45:29Z eco ECO:0005609 To determine the presence of negative chemotaxis, a repellent is added to the organismal suspension (but not in the capillary) and the organisms that fled into the capillary are measured. To determine the presence of positive chemotaxis, an attractant is placed in the capillary and the presence of positive chemotaxis is determined based on the amount of organism that accumulated in the capillary. capillary assay evidence A type of chemotaxis assay evidence where the presence or absence of positive or negative chemotaxis is determined by measuring the rate of accumulation of the cells into a capillary. ECO:SN PMID:4632978 A type of biological system reconstruction evidence based on homology evidence that is used in a manual assertion. snadendla 2016-03-31T17:00:03Z eco ECO:0005610 Inference may be based on paralogy and/or orthology of the genome-encoded components and is made primarily on functional conservation between the two systems. The sequences and number of genome-encoded components are fairly conserved but some divergence is observed. Evidence may originate from a combination of several experiments in the same or another species. biological system reconstruction evidence based on homology evidence used in manual assertion true A type of biological system reconstruction evidence based on homology evidence that is used in a manual assertion. ECO:SN A type of direct assay evidence used in manual assertion where phenotype or disease association is made with the gene because of involvement in the molecular mechanism of disease or involvement in a pathway known to contribute to a disease. snadendla 2016-04-12T16:55:16Z IED inferred from experimental data eco ECO:0005611 inference from experimental data evidence true A type of direct assay evidence used in manual assertion where phenotype or disease association is made with the gene because of involvement in the molecular mechanism of disease or involvement in a pathway known to contribute to a disease. ECO:SN A type of mutant phenotype evidence used in manual assertion where variations or changes, such as mutations or abnormal levels of the product(s) of a single gene of interest, including non-mutational changes such as inhibition with antibodies or other inhibitors are determined. snadendla 2016-04-12T17:09:43Z IPM inferred from phenotype manipulation eco ECO:0005612 Changes can include any gene mutation/knockout, over-expression or ectopic expression of wild-type or mutant genes, anti-sense experiments, RNAi experiments, specific protein inhibitors. inference from phenotype manipulation evidence true A type of mutant phenotype evidence used in manual assertion where variations or changes, such as mutations or abnormal levels of the product(s) of a single gene of interest, including non-mutational changes such as inhibition with antibodies or other inhibitors are determined. ECO:SN EXP A type of natural variation mutant evidence used in manual assertion where alleles are directly linked to phenotype and Mendelian diseases as a result of various experiments. snadendla 2016-04-12T17:24:00Z IAGP inferred by association of genotype from phenotype eco ECO:0005613 Used for 1) polymorphism or segregation of genetic markers (SNPs, mutations, RFLPs, microsatellites); 2) polymorphism or segregation of physical markers (FISH, centromeric or heterochromatic regions, chromosomal banding patterns); 3) detection of polymorphisms in inbred stock. inference by association of genotype from phenotype A type of natural variation mutant evidence used in manual assertion where alleles are directly linked to phenotype and Mendelian diseases as a result of various experiments. ECO:SN IDA A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in a manual assertion. snadendla 2016-05-06T11:03:08Z 2D-PAGE evidence eco ECO:0005614 two-dimensional polyacrylamide gel electrophoresis evidence used in manual assertion true A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in a manual assertion. ECO:SN IEP A type of alkaline phosphatase reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-06T11:05:59Z eco SEAP reporter assay secreted embryonic alkaline phosphatase reporter assay ECO:0005615 alkaline phosphatase reporter gene assay evidence used in manual assertion true A type of alkaline phosphatase reporter gene assay evidence that is used in a manual assertion. ECO:SN IEP A type of beta-galactosidase reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-06T11:08:57Z beta-gal reporter gene assay evidence LacZ transcript localization evidence used in manual assertion eco lacZ reporter gene assay ECO:0005616 beta-galactosidase reporter gene assay evidence used in manual assertion true A type of beta-galactosidase reporter gene assay evidence that is used in a manual assertion. ECO:SN IEP A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-06T11:11:07Z CAT reporter gene assay evidence eco ECO:0005617 chloramphenicol acetyltransferase reporter gene assay evidence used in manual assertion true A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in a manual assertion. ECO:SN IEA A type of chromatin immunoprecipitation-chip evidence that is used in an automatic assertion. snadendla 2016-05-06T11:17:04Z ChIP-chip evidence ChIP-on-chip evidence eco ECO:0005618 chromatin immunoprecipitation-chip evidence used in automatic assertion true A type of chromatin immunoprecipitation-chip evidence that is used in an automatic assertion. ECO:SN IEA A type of chromatin immunoprecipitation- exonuclease evidence that is used in an automatic assertion. snadendla 2016-05-06T11:22:25Z ChIP-exo evidence eco ECO:0005619 chromatin immunoprecipitation- exonuclease evidence used in automatic assertion true A type of chromatin immunoprecipitation- exonuclease evidence that is used in an automatic assertion. ECO:SN IPI A type of chromatin immunoprecipitation-PCR evidence that is used in a manual assertion. snadendla 2016-05-06T11:25:01Z ChIP-PCR evidence eco ECO:0005620 chromatin immunoprecipitation-PCR evidence used in manual assertion true A type of chromatin immunoprecipitation-PCR evidence that is used in a manual assertion. ECO:SN IEA A type of chromatin immunoprecipitation-seq evidence that is used in an automatic assertion. snadendla 2016-05-06T11:29:13Z ChIP-SEQ evidence ChIP-seq evidence eco ECO:0005621 chromatin immunoprecipitation-seq evidence used in automatic assertion true A type of chromatin immunoprecipitation-seq evidence that is used in an automatic assertion. ECO:SN ISM A type of comparative genomics motif search evidence that is used in a manual assertion. snadendla 2016-05-06T14:49:36Z eco ECO:0005622 comparative genomics motif search evidence used in manual assertion true A type of comparative genomics motif search evidence that is used in a manual assertion. ECO:SN IEA A type of comparative genomics motif search evidence that is used in an automatic assertion. snadendla 2016-05-06T14:52:21Z eco ECO:0005623 comparative genomics motif search evidence used in automatic assertion true A type of comparative genomics motif search evidence that is used in an automatic assertion. ECO:SN ISM A type of consensus search evidence that is used in a manual assertion. snadendla 2016-05-06T14:54:53Z eco ECO:0005624 consensus search evidence used in manual assertion true A type of consensus search evidence that is used in a manual assertion. ECO:SN IEA A type of consensus search evidence that is used in an automatic assertion. snadendla 2016-05-06T14:58:22Z eco ECO:0005625 consensus search evidence used in automatic assertion true A type of consensus search evidence that is used in an automatic assertion. ECO:SN IPI A type of copper-phenanthroline footprinting evidence that is used in a manual assertion. snadendla 2016-05-06T15:01:25Z 1,10-phenanthroline-copper footprinting evidence eco OP-Cu Complex ECO:0005626 copper-phenanthroline footprinting evidence used in manual assertion true A type of copper-phenanthroline footprinting evidence that is used in a manual assertion. ECO:SN IPI A type of DNA adenine methyltransferase identification evidence that is used in a manual assertion. snadendla 2016-05-06T15:05:14Z DamID evidence eco ECO:0005627 DNA adenine methyltransferase identification evidence used in manual assertion true A type of DNA adenine methyltransferase identification evidence that is used in a manual assertion. ECO:SN IEA A type of DNA adenine methyltransferase identification evidence that is used in an automatic assertion. snadendla 2016-05-06T15:06:46Z DamID evidence eco ECO:0005628 DNA adenine methyltransferase identification evidence used in automatic assertion true A type of DNA adenine methyltransferase identification evidence that is used in an automatic assertion. ECO:SN EXP A type of DNA affinity chromatography evidence that is used in a manual assertion. snadendla 2016-05-06T15:08:40Z DNA affinity purification evidence eco ECO:0005629 DNA affinity chromatography evidence used in manual assertion true A type of DNA affinity chromatography evidence that is used in a manual assertion. ECO:SN IEA A type of cDNA to DNA expression microarray evidence that is used in an automatic assertion. snadendla 2016-05-06T15:31:51Z DNA microarray evidence RNA microarray evidence eco ECO:0005630 cDNA to DNA expression microarray evidence used in automatic assertion true A type of cDNA to DNA expression microarray evidence that is used in an automatic assertion. ECO:SN IPI A type of DNAse footprinting evidence that is used in a manual assertion. snadendla 2016-05-06T15:35:41Z DNase protection evidence eco ECO:0005631 DNAse footprinting evidence used in manual assertion true A type of DNAse footprinting evidence that is used in a manual assertion. ECO:SN IDA A type of fluorescence anisotropy evidence that is used in a manual assertion. snadendla 2016-05-06T15:45:40Z FA evidence eco FP fluorescence polarization ECO:0005632 fluorescence anisotropy evidence used in manual assertion true A type of fluorescence anisotropy evidence that is used in a manual assertion. ECO:SN IEP A type of ferric uptake regulator titration assay evidence that is used in a manual assertion. snadendla 2016-05-06T15:49:18Z FURTA evidence eco ECO:0005633 ferric uptake regulator titration assay evidence used in manual assertion true A type of ferric uptake regulator titration assay evidence that is used in a manual assertion. ECO:SN IPI A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in a manual assertion. snadendla 2016-05-06T16:41:30Z genomic SELEX evidence eco ECO:0005634 genomic systematic evolution of ligands by exponential amplification evidence used in manual assertion true A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in a manual assertion. ECO:SN IEA A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion. snadendla 2016-05-06T16:43:03Z genomic SELEX evidence eco ECO:0005635 genomic systematic evolution of ligands by exponential amplification evidence used in automatic assertion true A type of genomic systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion. ECO:SN IEP A type of green fluorescent protein reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-06T16:46:32Z GFP reporter gene assay evidence green fluorescent protein transcript localization evidence used in manual assertion eco GFP promoter fusion green fluorescent protein promoter fusion ECO:0005636 green fluorescent protein reporter gene assay evidence used in manual assertion true A type of green fluorescent protein reporter gene assay evidence that is used in a manual assertion. ECO:SN IEA A type of green fluorescent protein reporter gene assay evidence that is used in an automatic assertion. snadendla 2016-05-06T16:48:29Z GFP reporter gene assay evidence green fluorescent protein transcript localization evidence used in automatic assertion eco GFP promoter fusion green fluorescent protein promoter fusion ECO:0005637 green fluorescent protein reporter gene assay evidence used in automatic assertion true A type of green fluorescent protein reporter gene assay evidence that is used in an automatic assertion. ECO:SN IDA A type of cell growth regulation assay evidence that is used in a manual assertion. snadendla 2016-05-06T16:52:15Z eco growth curve analysis ECO:0005638 cell growth regulation assay evidence used in manual assertion true A type of cell growth regulation assay evidence that is used in a manual assertion. ECO:SN IEA A type of cell growth regulation assay evidence that is used in an automatic assertion. snadendla 2016-05-06T16:53:28Z eco growth curve analysis ECO:0005639 cell growth regulation assay evidence used in automatic assertion true A type of cell growth regulation assay evidence that is used in an automatic assertion. ECO:SN IPI A type of glutathione S-transferase pull-down assay evidence that is used in a manual assertion. snadendla 2016-05-06T16:56:39Z GST pull-down assay evidence eco ECO:0005640 glutathione S-transferase pull-down assay evidence used in manual assertion true A type of glutathione S-transferase pull-down assay evidence that is used in a manual assertion. ECO:SN IEP A type of beta-glucuronidase reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-06T16:58:29Z GUS reporter gene assay evidence eco ECO:0005641 beta-glucuronidase reporter gene assay evidence used in manual assertion true A type of beta-glucuronidase reporter gene assay evidence that is used in a manual assertion. ECO:SN EXP A type of heteronuclear single quantum coherence spectroscopy evidence that is used in a manual assertion. snadendla 2016-05-06T23:10:13Z HSQC evidence eco ECO:0005642 heteronuclear single quantum coherence spectroscopy evidence used in manual assertion true A type of heteronuclear single quantum coherence spectroscopy evidence that is used in a manual assertion. ECO:SN IPI A type of hydroxyl-radical footprinting evidence that is used in a manual assertion. snadendla 2016-05-06T23:14:48Z eco ECO:0005643 hydroxyl-radical footprinting evidence used in manual assertion true A type of hydroxyl-radical footprinting evidence that is used in a manual assertion. ECO:SN IPI A type of immunoprecipitation evidence that is used in a manual assertion. snadendla 2016-05-06T23:20:49Z immunoprecipitation eco ECO:0005644 immunoprecipitation evidence used in manual assertion true A type of immunoprecipitation evidence that is used in a manual assertion. ECO:SN EXP A type of interferometric reflectance imaging sensor evidence that is used in a manual assertion. snadendla 2016-05-06T23:27:58Z IRIS evidence SRIB evidence spectral reflectance imaging biosensor evidence eco ECO:0005645 interferometric reflectance imaging sensor evidence used in manual assertion true A type of interferometric reflectance imaging sensor evidence that is used in a manual assertion. ECO:SN IEA A type of interferometric reflectance imaging sensor evidence that is used in an automatic assertion. snadendla 2016-05-06T23:29:23Z IRIS evidence SRIB evidence spectral reflectance imaging biosensor evidence eco ECO:0005646 interferometric reflectance imaging sensor evidence used in automatic assertion true A type of interferometric reflectance imaging sensor evidence that is used in an automatic assertion. ECO:SN IPI A type of isothermal titration calorimetry evidence that is used in a manual assertion. snadendla 2016-05-06T23:36:26Z ITC evidence eco ECO:0005647 isothermal titration calorimetry evidence used in manual assertion true A type of isothermal titration calorimetry evidence that is used in a manual assertion. ECO:SN IEP A type of luciferase reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-06T23:44:52Z eco ECO:0005648 luciferase reporter gene assay evidence used in manual assertion true A type of luciferase reporter gene assay evidence that is used in a manual assertion. ECO:SN ISM A type of machine learning prediction of motif instance evidence that is used in a manual assertion. snadendla 2016-05-06T23:51:30Z eco ECO:0005649 machine learning prediction of motif instance evidence used in manual assertion true A type of machine learning prediction of motif instance evidence that is used in a manual assertion. ECO:SN IEA A type of machine learning prediction of motif instance evidence that is used in an automatic assertion. snadendla 2016-05-06T23:54:00Z eco ECO:0005650 machine learning prediction of motif instance evidence used in automatic assertion true A type of machine learning prediction of motif instance evidence that is used in an automatic assertion. ECO:SN IEA A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in an automatic assertion. snadendla 2016-05-06T23:57:30Z MALDI-TOF mass spectrometry evidence MALDI-TOF-MS evidence eco ECO:0005651 matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence used in automatic assertion true A type of matrix-assisted laser desorption/ionization time-of-flight mass spectrometry evidence that is used in an automatic assertion. ECO:SN IPI A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in a manual assertion. snadendla 2016-05-09T14:42:28Z MPE-EDTA Fe(II) footprinting evidence Methidiumpropyl-EDTA Fe(II) footprinting evidence eco MPE Fe(II) footprinting ECO:0005652 methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence used in manual assertion true A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in a manual assertion. ECO:SN IEP A type of northern assay evidence that is used in a manual assertion. snadendla 2016-05-09T14:48:03Z RNA blot evidence northern assay evidence eco transcript levels (e.g. Northerns) ECO:0005653 northern assay evidence used in manual assertion true A type of northern assay evidence that is used in a manual assertion. ECO:SN ISA A type of phylogenetic footprinting evidence that is used in a manual assertion. snadendla 2016-05-09T14:50:52Z eco ECO:0005654 phylogenetic footprinting evidence used in manual assertion true A type of phylogenetic footprinting evidence that is used in a manual assertion. ECO:SN IEA A type of phylogenetic footprinting evidence that is used in an automatic assertion. snadendla 2016-05-09T14:51:55Z eco ECO:0005655 phylogenetic footprinting evidence used in automatic assertion true A type of phylogenetic footprinting evidence that is used in an automatic assertion. ECO:SN IPI A type of methylation interference footprinting evidence that is used in a manual assertion. snadendla 2016-05-09T14:55:25Z premethylation interference footprinting evidence used in manual assertion eco ECO:0005656 methylation interference footprinting evidence used in manual assertion true A type of methylation interference footprinting evidence that is used in a manual assertion. ECO:SN IEP A type of primer extension assay evidence that is used in a manual assertion. snadendla 2016-05-09T14:58:38Z eco ECO:0005657 primer extension assay evidence used in manual assertion true A type of primer extension assay evidence that is used in a manual assertion. ECO:SN ISM A type of position-specific scoring matrix motif search evidence that is used in a manual assertion. snadendla 2016-05-09T15:01:31Z PSSM motif search evidence eco ECO:0005658 position-specific scoring matrix motif search evidence used in manual assertion true A type of position-specific scoring matrix motif search evidence that is used in a manual assertion. ECO:SN IEA A type of position-specific scoring matrix motif search evidence that is used in an automatic assertion. snadendla 2016-05-09T15:02:31Z PSSM motif search evidence eco ECO:0005659 position-specific scoring matrix motif search evidence used in automatic assertion true A type of position-specific scoring matrix motif search evidence that is used in an automatic assertion. ECO:SN EXP A type of quantitative polymerase chain reaction evidence that is used in a manual assertion. snadendla 2016-05-09T15:09:01Z eco ECO:0005660 quantitative polymerase chain reaction evidence used in manual assertion true A type of quantitative polymerase chain reaction evidence that is used in a manual assertion. ECO:SN EXP A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in a manual assertion. snadendla 2016-05-09T15:19:20Z RACE PCR evidence eco ECO:0005661 rapid amplification of cDNA ends polymerase chain reaction evidence used in manual assertion true A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in a manual assertion. ECO:SN ISM A type of regular expression motif search evidence that is used in a manual assertion. snadendla 2016-05-09T16:13:55Z eco ECO:0005662 regular expression motif search evidence used in manual assertion true A type of regular expression motif search evidence that is used in a manual assertion. ECO:SN IEA A type of regular expression motif search evidence that is used in an automatic assertion. snadendla 2016-05-09T16:15:03Z eco ECO:0005663 regular expression motif search evidence used in automatic assertion true A type of regular expression motif search evidence that is used in an automatic assertion. ECO:SN snadendla 2016-05-09T16:18:35Z eco ECO:0005664 Use ECO:0006068 (RNA-seq evidence used in manual assertion) in place of this term. RNA sequencing assay evidence used in manual assertion true snadendla 2016-05-09T16:19:38Z eco ECO:0005665 Use ECO:0006069 (RNA-seq evidence used in automatic assertion) in place of this term. RNA sequencing assay evidence used in automatic assertion true EXP A type of S1 nuclease protection assay evidence that is used in a manual assertion. snadendla 2016-05-09T16:22:58Z eco ECO:0005666 S1 nuclease protection assay evidence used in manual assertion true A type of S1 nuclease protection assay evidence that is used in a manual assertion. ECO:SN IMP A type of site-directed phenotypic mutagenesis evidence that is used in a manual assertion. snadendla 2016-05-09T16:29:13Z site directed mutagenesis evidence site-directed mutagenesis evidence used in manual assertion eco ECO:0005667 site-directed mutagenesis phenotypic evidence used in manual assertion true A type of site-directed phenotypic mutagenesis evidence that is used in a manual assertion. ECO:SN IMP A type of survival rate analysis evidence that is used in a manual assertion. snadendla 2016-05-09T16:31:08Z eco ECO:0005668 survival rate analysis evidence used in manual assertion true A type of survival rate analysis evidence that is used in a manual assertion. ECO:SN IPI A type of ultraviolet light footprinting evidence that is used in a manual assertion. snadendla 2016-05-09T16:33:44Z eco UV footprinting ECO:0005669 ultraviolet light footprinting evidence used in manual assertion true A type of ultraviolet light footprinting evidence that is used in a manual assertion. ECO:SN EXP A type of x-ray crystallography evidence that is used in a manual assertion. snadendla 2016-05-10T11:53:00Z eco ECO:0005670 x-ray crystallography evidence used in manual assertion true A type of x-ray crystallography evidence that is used in a manual assertion. ECO:SN IEA A type of x-ray crystallography evidence that is used in an automatic assertion. snadendla 2016-05-10T11:54:03Z eco ECO:0005671 x-ray crystallography evidence used in automatic assertion true A type of x-ray crystallography evidence that is used in an automatic assertion. ECO:SN IEP A type of xylE reporter gene assay evidence that is used in a manual assertion. snadendla 2016-05-10T11:57:15Z eco ECO:0005672 xylE reporter gene assay evidence used in manual assertion true A type of xylE reporter gene assay evidence that is used in a manual assertion. ECO:SN A type of experimental phenotypic evidence where a non-standard trait (e.g. natural competence) is assessed qualitatively (e.g. presence/absence) and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor. CollecTF snadendla 2016-05-10T12:57:41Z eco ECO:0005673 ad-hoc qualitative phenotype observation evidence A type of experimental phenotypic evidence where a non-standard trait (e.g. natural competence) is assessed qualitatively (e.g. presence/absence) and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor. ECO:SN PMID:15150239 EXP A type of ad-hoc qualitative phenotype observation that is used in a manual assertion. snadendla 2016-05-10T14:28:47Z eco ECO:0005674 ad-hoc qualitative phenotype observation evidence used in manual assertion true A type of ad-hoc qualitative phenotype observation that is used in a manual assertion. ECO:SN A type of experimental phenotypic evidence where a quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor. CollecTF snadendla 2016-05-10T14:30:50Z eco ECO:0005675 ad-hoc quantitative phenotype observation evidence A type of experimental phenotypic evidence where a quantifiable phenotypic trait (e.g. glucose intake) is assessed in a quantitative manner after induction of the regulatory mechanism and used as a natural reporter to conclude that some genes or pathways are regulated by the transcription factor. ECO:SN PMID:15150239 EXP A type of ad-hoc quantitative phenotype observation evidence that is used in a manual assertion. snadendla 2016-05-10T14:34:50Z eco ECO:0005676 ad-hoc quantitative phenotype observation evidence used in manual assertion true A type of ad-hoc quantitative phenotype observation evidence that is used in a manual assertion. ECO:SN A direct assay evidence where the activity of a solution is determined by exposing an indicator culture or organism to a series of dilutions and determining the lowest concentration that elicits a biological response. critical dilution assay spot assay For chemicals, bacteriocins, or phage, the indicator culture is typically present in a soft-agar layer on top of nutrient agar and a small quantity of each dilution is spotted onto the soft agar overlay. dilution assay evidence A direct assay evidence where the activity of a solution is determined by exposing an indicator culture or organism to a series of dilutions and determining the lowest concentration that elicits a biological response. http://www.sciencedirect.com/science/article/pii/016770129400068I IDA A type of enzyme assay evidence that is used in a manual assertion. enzyme assays eco ECO:0005801 enzymatic activity assay evidence used in manual assertion true A type of enzyme assay evidence that is used in a manual assertion. ECO:SN EXP A type of cell transfection experiment evidence that is used in a manual assertion. eco ECO:0005802 cell transfection experiment evidence used in manual assertion true A type of cell transfection experiment evidence that is used in a manual assertion. ECO:SN A motility assay at 37 degrees C revealed a non-motile phenotype for all strains, as expected (data not shown). A type of direct assay evidence where the motility of a cell or cells is determined. eco ECO:0005803 motility assay evidence A motility assay at 37 degrees C revealed a non-motile phenotype for all strains, as expected (data not shown). PMID:20830609 A type of direct assay evidence where the motility of a cell or cells is determined. ECO:SN EXP A type of immunofluorescence evidence that is used in a manual assertion. immunofluorescence eco ECO:0005804 immunofluorescence evidence used in manual assertion true A type of immunofluorescence evidence that is used in a manual assertion. ECO:SN IPI A type of yeast 2-hybrid evidence that is used in a manual assertion. yeast two-hybrid assay eco ECO:0005805 yeast 2-hybrid evidence used in manual assertion true A type of yeast 2-hybrid evidence that is used in a manual assertion. ECO:SN A type of evidence derived from exploiting the CyaA (calmodulin-activated adenylate cyclase toxin) secreted by Bordatella pertussis to synthesize cAMP and alter cellular physiology in a host cell for various biological applications. rctauber 2016-06-15T08:42:16Z eco ECO:0006001 Cya fusion reporter assay evidence A type of evidence derived from exploiting the CyaA (calmodulin-activated adenylate cyclase toxin) secreted by Bordatella pertussis to synthesize cAMP and alter cellular physiology in a host cell for various biological applications. PMID:10217833 PMID:14702323 IEP A type of Cya fusion reporter assay evidence that is used in a manual assertion. CollecTF rctauber 2010-06-15T08:44:10Z eco ECO:0006002 Cya fusion reporter assay evidence used in manual assertion true true A type of Cya fusion reporter assay evidence that is used in a manual assertion. ECO:RCT IDA A type of electron microscopy evidence that is used in a manual assertion. rctauber 2016-10-12T12:32:29Z eco ECO:0006003 electron microscopy evidence used in manual assertion true A type of electron microscopy evidence that is used in a manual assertion. ECO:RCT IDA A type of super-resolution microscopy evidence that is used in a manual assertion. rctauber 2016-10-12T12:32:29Z eco ECO:0006004 super-resolution microscopy evidence used in manual assertion true A type of super-resolution microscopy evidence that is used in a manual assertion. ECO:RCT IDA A type of fractionation evidence that is used in a manual assertion. rctauber 2016-10-12T12:32:29Z eco ECO:0006005 fractionation evidence used in manual assertion true A type of fractionation evidence that is used in a manual assertion. ECO:RCT IDA A type of electrophysiology assay evidence that is used in a manual assertion. rctauber 2016-10-12T12:32:29Z eco ECO:0006006 electrophysiology assay evidence used in manual assertion true A type of electrophysiology assay evidence that is used in a manual assertion. ECO:RCT IPI A type of chromatin immunoprecipitation-chip evidence that is used in a manual assertion. rctauber 2016-10-21T11:55:53Z ChIP-chip evidence ChIP-on-chip evidence eco ECO:0006007 chromatin immunoprecipitation-chip evidence used in manual assertion true A type of chromatin immunoprecipitation-chip evidence that is used in a manual assertion. ECO:RCT IPI A type of chromatin immunoprecipitation- exonuclease evidence that is used in a manual assertion. rctauber 2016-10-21T11:55:53Z ChIP-exo eco ECO:0006008 chromatin immunoprecipitation- exonuclease evidence used in manual assertion true A type of chromatin immunoprecipitation- exonuclease evidence that is used in a manual assertion. ECO:RCT IPI A type of chromatin immunoprecipitation-seq evidence that is used in a manual assertion. rctauber 2016-10-21T11:55:53Z ChIP-SEQ evidence ChIP-seq evidence eco ECO:0006009 chromatin immunoprecipitation-seq evidence used in manual assertion true A type of chromatin immunoprecipitation-seq evidence that is used in a manual assertion. ECO:RCT A type of nucleic acid binding evidence in which RNA-binding proteins are identified through cross-linking RNA and proteins by UV light, capturing RNA-protein complexes on oligo(dT) beads, and finally identifying by mass spectrometry. rctauber 2016-10-21T12:28:17Z ultraviolet light cross-linking RNA binding evidence eco ECO:0006010 mRNA interactome capture evidence A type of nucleic acid binding evidence in which RNA-binding proteins are identified through cross-linking RNA and proteins by UV light, capturing RNA-protein complexes on oligo(dT) beads, and finally identifying by mass spectrometry. PMID:27729395 IPI A type of mRNA interactome capture evidence that is used in a manual assertion. rctauber 2016-10-21T12:28:17Z ultraviolet light cross-linking RNA binding evidence eco ECO:0006011 mRNA interactome capture evidence used in manual assertion true A type of mRNA interactome capture evidence that is used in a manual assertion. ECO:RCT A type of electrophysiology assay evidence in which a glass micropipette is sealed to the surface of a cell membrane (patch) to study ion channels. rctauber 2016-11-28T11:44:05Z eco ECO:0006012 patch-clamp recording evidence A type of electrophysiology assay evidence in which a glass micropipette is sealed to the surface of a cell membrane (patch) to study ion channels. ECO:RCT IDA A type of patch-clamp recording evidence that is used in a manual assertion. rctauber 2016-11-28T11:44:05Z eco ECO:0006013 patch-clamp recording evidence used in manual assertion A type of patch-clamp recording evidence that is used in a manual assertion. ECO:RCT A type of patch-clamp recording evidence in which a glass micropipette filled with a prepared solution is used to form a seal with the cell membrane followed by rupture of membrane to provide accurate and high resolution electrical property measurements of the whole cell. rctauber 2016-11-28T11:44:05Z eco ECO:0006014 whole-cell patch-clamp recording evidence A type of patch-clamp recording evidence in which a glass micropipette filled with a prepared solution is used to form a seal with the cell membrane followed by rupture of membrane to provide accurate and high resolution electrical property measurements of the whole cell. PMID:27341060 IDA A type of whole-cell patch-clamp recording evidence that is used in a manual assertion. rctauber 2016-11-28T11:44:05Z eco ECO:0006015 whole-cell patch-clamp recording evidence used in manual assertion A type of whole-cell patch-clamp recording evidence that is used in a manual assertion. ECO:RCT A type of traceable author statement that is based on a publication about a clinical study. rctauber 2016-11-30T09:44:47Z published clinical study evidence eco traceable author statement from published clinical study ECO:0006016 author statement from published clinical study TAS A type of author statement from published clinical study that is used in a manual assertion. rctauber 2016-11-30T09:44:47Z published clinical study evidence PCS eco ECO:0006017 Created and used by the Human Phenotype Ontology (HPO) Annotations group. Here it is used when evidence for an HPO annotation is information extracted from articles in the medical literature. author statement from published clinical study used in manual assertion http://human-phenotype-ontology.github.io/documentation.html#annot true PCS HPO:PCS A type of curator inference that is based on the individual clinical experience of a clinician rctauber 2016-11-30T09:44:47Z individual clinical experience evidence eco ECO:0006018 inference based on individual clinical experience IC A type of inference based on individual clinical experience that is used in a manual assertion. rctauber 2016-11-30T09:44:47Z individual clinical experience evidence ICE eco ECO:0006019 Created and used by the Human Phenotype Ontology (HPO) Annotations group. Here it is used for annotating disorders with a limited amount of published data, and is accompanied by a reference to the individual or center performing the annotation. inference based on individual clinical experience used in manual assertion http://human-phenotype-ontology.github.io/documentation.html#annot true ICE HPO:ICE A type of cell proliferation assay evidence in which biofilm growth is monitored and detected from attachment to development. rctauber 2016-12-05T09:33:18Z biofilm assay evidence eco ECO:0006020 biofilm formation assay evidence A type of cell proliferation assay evidence in which biofilm growth is monitored and detected from attachment to development. PMID:10547784 IDA A type of biofilm formation assay evidence that is used in a manual assertion. rctauber 2016-12-05T09:33:18Z eco ECO:0006021 biofilm formation assay evidence used in manual assertion true A type of biofilm formation assay evidence that is used in a manual assertion. ECO:RCT A type of biofilm formation assay evidence in which microtiter dishes or tubes are inoculated and incubated to promote biofilm formation, and then biofilms are detected by staining with crystal violet or safranin to observe phenotypes. rctauber 2016-12-05T09:33:18Z 96-well biofilm assay evidence eco ECO:0006022 microtiter plate biofilm assay evidence A type of biofilm formation assay evidence in which microtiter dishes or tubes are inoculated and incubated to promote biofilm formation, and then biofilms are detected by staining with crystal violet or safranin to observe phenotypes. PMID:10547784 IDA A type of microtiter plate biofilm assay evidence that is used in a manual assertion. rctauber 2016-12-05T09:33:18Z eco ECO:0006023 microtiter plate biofilm assay evidence used in manual assertion true A type of microtiter plate biofilm assay evidence that is used in a manual assertion. ECO:RCT A type of biofilm formation assay evidence in which biofilm formation is analyzed, without staining, over 4 to 48 hours by growth on a tilted multiwell plate. rctauber 2016-12-05T09:33:18Z ALI biofilm assay evidence eco ECO:0006024 Tilting of the plate positions the air-liquid interface on a clear portion to improve visability. air-liquid interface assay evidence A type of biofilm formation assay evidence in which biofilm formation is analyzed, without staining, over 4 to 48 hours by growth on a tilted multiwell plate. PMID:18770545 IDA A type of air-liquid interface assay evidence that is used in a manual assertion. rctauber 2016-12-05T09:33:18Z ALI biofilm assay evidence eco ECO:0006025 air-liquid interface assay evidence used in manual assertion true A type of air-liquid interface assay evidence that is used in a manual assertion. ECO:RCT A type of biofilm formation assay evidence in which a colony is grown on a semipermeable membrane on an agar plate. The plate serves to supply nutrients and the semipermeable membrane can be relocated to fresh plates. rctauber 2016-12-05T09:33:18Z eco ECO:0006026 The plates commonly contain different carbon sources or antibiotic treatments to observe properties of the cells. colony biofilm assay evidence A type of biofilm formation assay evidence in which a colony is grown on a semipermeable membrane on an agar plate. The plate serves to supply nutrients and the semipermeable membrane can be relocated to fresh plates. PMID:18770545 IDA A type of colony biofilm assay evidence that is used in a manual assertion. rctauber 2016-12-05T09:33:18Z eco ECO:0006027 colony biofilm assay evidence used in manual assertion true A type of colony biofilm assay evidence that is used in a manual assertion. ECO:RCT A type of biofilm formation assay evidence in which mature bacterial biofilms are grown in a multiwell plate that has a growth medium continually pumped through the wells while waste is continually pumped out. rctauber 2016-12-05T09:33:18Z eco ECO:0006028 Kadouri drip-fed biofilm assay evidence A type of biofilm formation assay evidence in which mature bacterial biofilms are grown in a multiwell plate that has a growth medium continually pumped through the wells while waste is continually pumped out. PMID:18770545 IDA A type of Kadouri drip-fed biofilm assay evidence that is used in a manual assertion. rctauber 2016-12-05T09:33:18Z eco ECO:0006029 Kadouri drip-fed biofilm assay evidence used in manual assertion true A type of Kadouri drip-fed biofilm assay evidence that is used in a manual assertion. ECO:RCT IPI A type of co-immunoprecipitation evidence that is used in a manual assertion. rctauber 2016-01-13T11:32:26Z co-immunoprecipitation eco ECO:0006030 co-immunoprecipitation evidence used in manual assertion true A type of co-immunoprecipitation evidence that is used in a manual assertion. ECO:RCT IDA A type of immunolocalization evidence that is used in a manual assertion. rctauber 2017-01-23T07:54:37Z immunolocalization eco ECO:0006031 immunolocalization evidence used in manual assertion true A type of immunolocalization evidence that is used in a manual assertion. ECO:RCT A type of experimental phenotypic evidence arising from experiment in which neuronal activity is manipulated using genetically encoded, optically activated neuronal actuators. rctauber 2017-01-23T11:58:48Z optogenetic actuator evidence eco ECO:0006032 optogenetic evidence A type of experimental phenotypic evidence arising from experiment in which neuronal activity is manipulated using genetically encoded, optically activated neuronal actuators. GOC:DOS PMID:17035522 EXP A type of optogenetic evidence that is used in a manual assertion. rctauber 2017-01-23T11:58:48Z optogenetic actuator evidence eco ECO:0006033 optogenetic evidence used in manual assertion true A type of optogenetic evidence that is used in a manual assertion. ECO:RCT A type of fluorescence evidence that is based on direct, quantitative measurement of some cellular property using a fluorescent sensor. rctauber 2017-01-23T11:58:48Z eco ECO:0006034 Examples include sensors for ion concentration and potential difference across a membrane. fluorescent sensor evidence A type of fluorescence evidence that is based on direct, quantitative measurement of some cellular property using a fluorescent sensor. GOC:DOS IDA A type of fluorescent sensor evidence that is used in a manual assertion. rctauber 2017-01-23T11:58:48Z eco ECO:0006035 fluorescent sensor evidence used in manual assertion true A type of fluorescent sensor evidence that is used in a manual assertion. ECO:RCT A type of fluorescent sensor evidence that is based on direct, quantitative measurement of some cellular property using a genetically encoded fluorescent sensor. rctauber 2017-01-23T11:58:48Z optogenetic sensor evidence eco ECO:0006036 genetically encoded fluorescent sensor evidence A type of fluorescent sensor evidence that is based on direct, quantitative measurement of some cellular property using a genetically encoded fluorescent sensor. GOC:DOS IDA A type of genetically encoded fluorescent sensor evidence that is used in a manual assertion. rctauber 2017-01-23T11:58:48Z optogenetic sensor evidence eco ECO:0006037 genetically encoded fluorescent sensor evidence used in manual assertion true A type of genetically encoded fluorescent sensor evidence that is used in a manual assertion. ECO:RCT A type of fluorescent sensor evidence and electrophysiology assay evidence where the electrical properties of cells or tissues are studied using fluorescent sensors. rctauber 2017-01-23T11:58:48Z electrophysiology - optical assay evidence eco ECO:0006038 Examples include genetically encoded sensors that detect potential difference across plasma membrane. genetically encoded fluorescent electrophysiology assay evidence A type of fluorescent sensor evidence and electrophysiology assay evidence where the electrical properties of cells or tissues are studied using fluorescent sensors. GOC:DOS IDA A type of genetically encoded fluorescent electrophysiology assay evidence that is used in a manual assertion. rctauber 2017-01-23T11:58:48Z electrophysiology - optical assay evidence eco ECO:0006039 genetically encoded fluorescent electrophysiology assay evidence used in manual assertion true true A type of genetically encoded fluorescent electrophysiology assay evidence that is used in a manual assertion. ECO:RCT A type of genetically encoded fluorescent electrophysiology assay evidence that is based on direct, quantitative measurement of ion concentration using a genetically encoded fluorescent sensor. rctauber 2017-01-23T11:58:48Z eco ECO:0006040 Examples include the genetically encoded calcium indicator GCaMP. genetically encoded fluorescent ion concentration sensor assay evidence A type of genetically encoded fluorescent electrophysiology assay evidence that is based on direct, quantitative measurement of ion concentration using a genetically encoded fluorescent sensor. GOC:DOS IDA A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in a manual assertion. rctauber 2017-01-23T11:58:48Z eco ECO:0006041 genetically encoded fluorescent ion concentration sensor assay evidence used in manual assertion true A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in a manual assertion. ECO:RCT IDA A type of cell fractionation evidence that is used in a manual assertion. rctauber 2017-02-21T07:26:28Z cell fractionation eco ECO:0006042 cell fractionation evidence used in manual assertion true A type of cell fractionation evidence that is used in a manual assertion. ECO:RCT A type of electrophysiology assay evidence resulting from the use of electrodes to measure in vivo electrical activity coming from adjacent neurons. rctauber 2017-02-21T07:26:28Z eco ECO:0006043 extracellular recording evidence A type of electrophysiology assay evidence resulting from the use of electrodes to measure in vivo electrical activity coming from adjacent neurons. url:http://www.nature.com/subjects/extracellular-recording IDA A type of extracellular recording evidence that is used in a manual assertion. rctauber 2017-02-21T07:26:28Z eco ECO:0006044 extracellular recording evidence used in manual assertion true A type of extracellular recording evidence that is used in a manual assertion. ECO:RCT A type of extracellular recording evidence in which an extracellular microelectrode is used to measure the electrical activity of a single neuron. rctauber 2017-02-21T07:26:28Z eco ECO:0006045 single-unit extracellular recording evidence A type of extracellular recording evidence in which an extracellular microelectrode is used to measure the electrical activity of a single neuron. doi:10.1385/0-89603-185-3:1 IDA A type of single-unit extracellular recording evidence that is used in a manual assertion. rctauber 2017-02-21T07:26:28Z eco ECO:0006046 single-unit extracellular recording evidence used in manual assertion true A type of single-unit extracellular recording evidence that is used in a manual assertion. ECO:RCT A type of extracellular recording evidence in which electrical activity is measured in either tissue or at a cellular level with microelectrodes. rctauber 2017-02-21T07:26:28Z local field potential recording evidence eco ECO:0006047 field potential recording evidence A type of extracellular recording evidence in which electrical activity is measured in either tissue or at a cellular level with microelectrodes. ECO:RCT IDA A type of field potential recording evidence that is used in a manual assertion. rctauber 2017-02-21T07:26:28Z eco local field potential recording evidence ECO:0006048 field potential recording evidence used in manual assertion true A type of field potential recording evidence that is used in a manual assertion. ECO:RCT IMP A type of genetic transformation evidence that is used in a manual assertion rctauber 2017-02-21T18:08:58Z eco ECO:0006049 genetic transformation evidence used in manual assertion true A type of genetic transformation evidence that is used in a manual assertion ECO:RCT IMP A type of anti-sense experiment evidence that is used in a manual assertion. rctauber 2017-02-21T18:08:58Z anti-sense experiments eco ECO:0006050 anti-sense experiment evidence used in manual assertion true A type of anti-sense experiment evidence that is used in a manual assertion. ECO:RCT IMP A type of morpholino experiment evidence that is used in a manual assertion. rctauber 2017-02-21T18:08:58Z anti-sense evidence eco ECO:0006051 morpholino experiment evidence used in manual assertion true A type of morpholino experiment evidence that is used in a manual assertion. ECO:RCT IMP A type of RNAi evidence that is used in a manual assertion. rctauber 2017-02-21T18:08:58Z RNAi experiment eco ECO:0006052 RNAi evidence used in manual assertion true A type of RNAi evidence that is used in a manual assertion. ECO:RCT A type of experimental phenotypic evidence that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist. dosumis 2017-03-07T08:51:02Z eco ECO:0006053 pharmacological assay evidence A type of experimental phenotypic evidence that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist. GOC:DOS EXP A type of experimental phenotypic evidence used in a manual assertion that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist. rctauber 2017-03-07T08:51:02Z eco ECO:0006054 pharmacological assay evidence used in manual assertion true A type of experimental phenotypic evidence used in a manual assertion that arises from assaying the response of a cell, tissue, organ or organism following exposure to a receptor agonist or antagonist. GOC:DOS A type of evidence where data generation is automated with equipment to allow for assaying samples or molecules in parallel. mchibucos 2017-03-28T14:48:39Z HT evidence high-throughput evidence high throughput cell biology evidence high throughput screening evidence eco ECO:0006055 Some relevant articles include: PMID: 23340846, doi:10.1038/nmeth0607-523 high throughput evidence A type of evidence where data generation is automated with equipment to allow for assaying samples or molecules in parallel. ECO:MCC HTP A type of evidence that is used in a manual assertion where data generation is automated with equipment to allow for assaying large numbers of samples or molecules in parallel. rctauber 2017-03-28T14:48:39Z HT evidence high-throughput evidence GOECO:HTP HTP inferred from high throughput experiment eco high throughput cell biology evidence high throughput screening evidence ECO:0006056 high throughput evidence used in manual assertion true HTP Default A type of evidence that is used in a manual assertion where data generation is automated with equipment to allow for assaying large numbers of samples or molecules in parallel. ECO:RCT GOECO:HTP inferred from high throughput experiment HTP GOECO:HTP inferred from high throughput experiment GOECO:HTP IEA A type of evidence that is used in an automatic assertion where data generation is automated with equipment to allow for assaying samples or molecules in parallel. rctauber 2017-03-28T14:48:39Z HT evidence high-throughput evidence eco high throughput cell biology evidence high throughput screening evidence ECO:0006057 high throughput evidence used in automatic assertion true A type of evidence that is used in an automatic assertion where data generation is automated with equipment to allow for assaying samples or molecules in parallel. ECO:RCT A type of high throughput evidence where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel. mchibucos 2017-03-28T14:48:39Z eco omics experiment ECO:0006058 HT methodologies may incorporate techniques from optics, chemistry, biology or image analysis (https://en.wikipedia.org/wiki/High_throughput_biology) high throughput cell biology evidence A type of high throughput evidence where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel. ECO:MCC HTP A type of high throughput evidence used in a manual assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel. rctauber 2017-03-28T14:48:39Z eco omics experiment ECO:0006059 high throughput cell biology evidence used in manual assertion true A type of high throughput evidence used in a manual assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel. ECO:RCT IEA A type of high throughput evidence used in an automatic assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel. rctauber 2017-03-28T14:48:39Z eco omics experiment ECO:0006060 high throughput cell biology evidence used in automatic assertion true A type of high throughput evidence used in an automatic assertion where a classical cell biology technique is automated with equipment to allow for assaying biomolecules in parallel. ECO:RCT IDA A type of wide-field fluorescence microscopy evidence used in a manual assertion where fluorescently tagged antibodies are imaged that are used to bind to their antigens. rctauber 2017-05-15T08:57:07Z wide-field epifluorescence microscopy evidence eco ECO:0006061 immunofluorescence wide-field microscopy evidence used in manual assertion true true A type of wide-field fluorescence microscopy evidence used in a manual assertion where fluorescently tagged antibodies are imaged that are used to bind to their antigens. ECO:SN url:http://journals.plos.org/plosone/article?id=10.1371/journal.pone.0057135 IDA A type of wide-field microscopy evidence that is used in a manual assertion where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter. rctauber 2017-05-15T09:01:19Z eco ECO:0006062 wide-field fluorescence microscopy evidence used in manual assertion true A type of wide-field microscopy evidence that is used in a manual assertion where pure white and ultraviolet light are produced by a mercury lamp, passed through an optical filter (excitation filter), and directed to a sample via a dichroic mirror, followed by detection of the fluorescent light by a camera after it passes through an emission filter. ECO:SN url:http://www.bristol.ac.uk/synaptic/research/techniques/widefield.html IMP A type of experimental phenotypic evidence that is used in a manual assertion where a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product. rctauber 2017-05-15T09:03:49Z eco analysis of overexpression/ectopic expression phenotype ECO:0006063 over expression analysis evidence used in manual assertion true A type of experimental phenotypic evidence that is used in a manual assertion where a gene and/or gene product is investigated in a transgenic organism that has been engineered to overexpress that gene product. PMID:22419077 IDA A type of cell-free assay evidence that is used in a manual assertion. rctauber 2017-05-15T09:08:17Z in vitro assay evidence eco ECO:0006064 cell-free assay evidence used in manual assertion true A type of cell-free assay evidence that is used in a manual assertion. PMID:18453125 rctauber 2017-05-15T09:11:13Z eco ECO:0006065 Use children of ECO:0001565 (cell-based assay evidence) in place of this term. in vitro cell based assay evidence used in manual assertion true A type of fluorescence evidence where quantitative information on the diffusion properties of a sample is produced from the measurement of diffusion of fluorescent probes over time into an area that has been photobleached by a high-intensity laser pulse. dosumis rctauber 2017-05-16T10:55:40Z FRAP evidence eco ECO:0006066 FRAP is a fluorescence microscopy-based technique. fluorescence recovery after photobleaching evidence A type of fluorescence evidence where quantitative information on the diffusion properties of a sample is produced from the measurement of diffusion of fluorescent probes over time into an area that has been photobleached by a high-intensity laser pulse. PMID:26314367 FRAP is a fluorescence microscopy-based technique. PMID:26314367 IDA A type of fluorescence evidence that is used in a manual assertion where quantitative information on the diffusion properties of a sample is produced from the measurement of diffusion of fluorescent probes over time into an area that has been photobleached by a high-intensity laser pulse. rctauber 2017-05-16T10:55:40Z FRAP evidence eco ECO:0006067 fluorescence recovery after photobleaching evidence used in manual assertion true IEP A type of high throughput nucleotide sequencing assay evidence used in a manual assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules. rctauber 2017-06-28T10:37:02Z WTSS evidence whole transcriptome shotgun sequencing RNA-seq evidence used in manual assertion RNAseq evidence used in manual assertion eco RNA sequencing|differential gene expression evidence from RNA-seq experiment ECO:0006068 RNA-sequencing evidence used in manual assertion true A type of high throughput nucleotide sequencing assay evidence used in a manual assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules. ECO:MCC IEA A type of high throughput nucleotide sequencing assay evidence used in an automatic assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules. rctauber 2017-06-28T10:37:02Z WTSS evidence whole transcriptome shotgun sequencing RNA-seq evidence used in automatic assertion RNAseq evidence used in automatic assertion eco RNA sequencing|differential gene expression evidence from RNA-seq experiment ECO:0006069 RNA-sequencing evidence used in automatic assertion true A type of high throughput nucleotide sequencing assay evidence used in an automatic assertion based on high-throughput (HT) sequencing of fragmented cDNA molecules. ECO:MCC A type of electron microscopy evidence resulting from the use of antibodies to identify the localization of antigens in cells and tissues. dosumis rctauber 2017-07-05T09:59:10Z immunolabelling electron microscopy evidence eco ECO:0006070 immuno-labelling electron microscopy evidence A type of electron microscopy evidence resulting from the use of antibodies to identify the localization of antigens in cells and tissues. PMID:25151300 IDA A type of electron microscopy evidence used in a manual assertion resulting from the use of antibodies to identify the localization of antigens in cells and tissues. PMID:25151300 dosumis rctauber 2017-07-05T09:59:10Z immunolabelling electron microscopy evidence eco ECO:0006071 immuno-labelling electron microscopy evidence used in manual assertion true A type of electron microscopy evidence used in a manual assertion resulting from the use of antibodies to identify the localization of antigens in cells and tissues. PMID:25151300 A type of super-resolution microscopy evidence resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue. dosumis rctauber 2017-07-05T09:59:10Z eco ECO:0006072 immunofluorescence super resolution microscopy evidence A type of super-resolution microscopy evidence resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue. PMID:19245833 IDA A type of super-resolution microscopy evidence used in a manual assertion resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue. dosumis rctauber 2017-07-05T09:59:10Z eco ECO:0006073 immunofluorescence super resolution microscopy evidence used in manual assertion true A type of super-resolution microscopy evidence used in a manual assertion resulting from the use of fluorescently-tagged antibodies to identify the localization of antigens in cells and tissue. PMID:19245833 IPI A type of physical interaction evidence that is used in manual assertion where a cellular component subunit is isolated as part of purification of its larger complex. rctauber 2017-09-14T09:19:19Z co-purification eco ECO:0006074 co-purification evidence used in manual assertion true A type of physical interaction evidence that is used in manual assertion where a cellular component subunit is isolated as part of purification of its larger complex. TAIR:TED IPI A type of physical interaction evidence that is used in manual assertion that depends on the strength of the interaction between two entities. rctauber 2017-09-14T09:19:20Z eco ligand binding evidence ECO:0006075 affinity evidence used in manual assertion true A type of physical interaction evidence that is used in manual assertion that depends on the strength of the interaction between two entities. ECO:MCC IPI A type of affinity evidence that is used in manual assertion resulting from the binding of a molecule to a protein or protein complex. rctauber 2017-09-14T09:19:21Z eco ECO:0006076 protein binding evidence used in manual assertion true A type of affinity evidence that is used in manual assertion resulting from the binding of a molecule to a protein or protein complex. GO:0005515 IPI A type of bait-prey hybrid interaction evidence that is used in manual assertion where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein. rctauber 2017-09-14T09:19:22Z bait-prey protein pull-down evidence eco ECO:0006077 bait-prey hybrid interaction evidence used in manual assertion true A type of bait-prey hybrid interaction evidence that is used in manual assertion where proteins of interest (bait and prey) are covalently linked to incomplete fragments of a third protein (reporter) and expressed in vivo, at which time interaction between bait and prey proteins brings reporter fragments in close enough proximity to allow them to reform and become a functional reporter protein. ECO:MCC IPI A type of affinity evidence that is used in manual assertion resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody. rctauber 2017-09-14T09:19:23Z eco ECO:0006078 immunological assay evidence used in manual assertion true A type of affinity evidence that is used in manual assertion resulting from quantitation of the analyte which depends on the reaction of an antigen (analyte) and an antibody. ERO:0001362 IPI A type of hybrid interaction evidence that is used in manual assertion that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors. rctauber 2017-09-14T09:19:24Z yeast one-hybrid assay eco ECO:0006079 yeast one-hybrid evidence used in manual assertion true A type of hybrid interaction evidence that is used in manual assertion that is based on a protein-DNA complementation assay where a single promoter acts as bait and is screened against a library of prey transcription factors. ECO:MCC IPI A type of split-ubiquitin functional complementation evidence that is used in a manual assertion that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein. rctauber 2017-09-14T09:19:25Z split-ubiquitin assay eco ECO:0006080 split-ubiquitin functional complementation evidence used in manual assertion true A type of split-ubiquitin functional complementation evidence that is used in a manual assertion that is based on detection of protein-protein interaction between a bait and prey protein by in vivo reconstitution of split-ubiquitin (when bait and prey interact) and release of a reporter protein. PMID:15064465 IPI A type of physical interaction evidence that is used in a manual assertion that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes. rctauber 2017-09-14T09:19:26Z far-Western analysis eco ECO:0006081 far-Western blotting evidence used in manual assertion true A type of physical interaction evidence that is used in a manual assertion that is based on detection of protein-protein interactions by separation of target proteins by SDS-PAGE which are blotted to a membrane, followed by denaturation and renaturation, probing with purified bait proteins, and detection of the target-bait complexes. PMID:18079728 IPI A type of affinity evidence that is used in a manual assertion that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bond compound. rctauber 2017-09-14T09:19:27Z affinity chromatography eco ECO:0006082 affinity chromatography evidence used in manual assertion true A type of affinity evidence that is used in a manual assertion that results from separation of biochemical mixtures by selective binding of a compound to an immobilized compound on a polymeric matrix, subsequent removal of unattached components, and then displacement of the bond compound. ECO:MCC IPI A type of affinity evidence that is used in a manual assertion resulting from the binding of a molecule to a nucleic acid. rctauber 2017-09-14T09:19:28Z eco ECO:0006083 nucleic acid binding evidence used in manual assertion true A type of affinity evidence that is used in a manual assertion resulting from the binding of a molecule to a nucleic acid. GO:0003676 IPI A type of nucleic acid binding evidence that is used in a manual assertion resulting from an enzyme displaying binding activity to specific ribohomopolymer. rctauber 2017-09-14T09:19:29Z ribohomopolymer binding assay eco ECO:0006084 ribohomopolymer binding assay evidence used in manual assertion true A type of nucleic acid binding evidence that is used in a manual assertion resulting from an enzyme displaying binding activity to specific ribohomopolymer. PMC:102612 IPI A type of protein binding evidence that is used in a manual assertion resulting from a metal ion binding to a protein at a specific binding site. rctauber 2017-09-14T09:19:30Z eco ECO:0006085 protein:ion binding evidence used in manual assertion true A type of protein binding evidence that is used in a manual assertion resulting from a metal ion binding to a protein at a specific binding site. PMID:2377604 IPI A type of nucleic acid binding evidence that is used in a manual assertion in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins. rctauber 2017-09-14T09:19:31Z Southwestern analysis eco ECO:0006086 Southwestern blot evidence used in manual assertion true A type of nucleic acid binding evidence that is used in a manual assertion in which DNA-protein binding is detected using labeled DNA as probes, hybridized to electrophoretically separated proteins. ECO:RCT IPI A type of nucleic acid binding evidence that is used in a manual assertion in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins. rctauber 2017-09-14T09:19:32Z Northwestern analysis eco ECO:0006087 Northwestern blot evidence used in manual assertion true A type of nucleic acid binding evidence that is used in a manual assertion in which RNA-protein binding is detected using labeled RNA as probes, hybridized to electrophoretically separated proteins. ECO:RCT IPI A type of evidence that is used in a manual assertion arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand. rctauber 2017-09-14T09:19:33Z SELEX evidence in vitro selection evidence eco in vitro evolution evidence ECO:0006088 systematic evolution of ligands by exponential amplification evidence used in manual assertion true A type of evidence that is used in a manual assertion arising from a physical interaction analysis where a combinatorial chemistry technique is used to identify oligonucleotides that bind to a target ligand. ECO:MCC IPI A type of hybrid interaction evidence that is used in a manual assertion that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey). rctauber 2017-09-14T09:19:34Z B1H evidence eco ECO:0006089 bacterial one-hybrid evidence used in manual assertion true A type of hybrid interaction evidence that is used in a manual assertion that uses bacterial transformation with two plasmids to assess in vivo binding of a DNA-binding domain (bait) and DNA target site (prey). ECO:MCC IPI A type of protein-oligonucleotide microarray binding evidence that is used in a manual assertion that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites. rctauber 2017-09-14T09:19:35Z PBM evidence eco ECO:0006090 protein-oligonucleotide microarray binding evidence used in manual assertion true true A type of protein-oligonucleotide microarray binding evidence that is used in a manual assertion that detects binding of a tagged protein to an array of oligonucleotide probes representing potential binding sites. PMID:22146299 IGI A type of genetic interaction evidence that is used in a manual assertion where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background. rctauber 2017-09-14T09:19:36Z functional complementation eco ECO:0006091 functional complementation evidence used in manual assertion true A type of genetic interaction evidence that is used in a manual assertion where a wild-type copy of the gene in question is inserted into a mutant cell to see if it restores the wild-type phenotype in the mutant background. PMID:27403640 IGI A type of functional complementation evidence that is used in a manual assertion that is used in manual assertion resulting from the introduction of a transgene to prevent, or "rescue" an organism from a condition. rctauber 2017-09-14T09:19:37Z eco ECO:0006092 transgenic rescue experiment evidence used in manual assertion true A type of functional complementation evidence that is used in a manual assertion that is used in manual assertion resulting from the introduction of a transgene to prevent, or "rescue" an organism from a condition. url:http://www.nature.com/gt/journal/v11/n15/full/3302282a.html IGI A type of transient rescue experiment evidence that is used in a manual assertion. rctauber 2017-09-14T09:19:38Z eco ECO:0006093 transient rescue experiment evidence used in manual assertion true A type of transient rescue experiment evidence that is used in a manual assertion. ECO:RCT IGI A type of suppressor/enhancer interaction phenotypic evidence that is used in a manual assertion. rctauber 2017-09-14T09:19:39Z 'traditional' genetic interactions (e.g. suppressors, synthetic lethals) suppressor/enhancer interaction evidence used in manual assertion eco ECO:0006094 suppressor/enhancer interaction phenotypic evidence used in manual assertion true A type of suppressor/enhancer interaction phenotypic evidence that is used in a manual assertion. url:http://www.wormbook.org/chapters/www:geneticsuppression/geneticsuppression.html IGI A type of double mutant phenotypic evidence that is used in a manual assertion. rctauber 2017-09-14T09:19:40Z double mutant analysis double mutant phenotype evidence used in manual assertion eco ECO:0006095 double mutant phenotypic evidence used in manual assertion true A type of double mutant phenotypic evidence that is used in a manual assertion. ECO:RCT IGI A type of epistatic interaction phenotypic evidence that is used in a manual assertion. rctauber 2017-09-14T09:19:41Z epistatic interactions epistatic interaction evidence used in manual assertion eco ECO:0006096 epistatic interaction phenotypic evidence used in manual assertion true A type of epistatic interaction phenotypic evidence that is used in a manual assertion. PMID:18852697 IGI A type of functional complementation evidence that is used in a manual assertion that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene. rctauber 2017-09-14T09:19:42Z functional complementation in heterologous system eco ECO:0006097 functional complementation in heterologous system evidence used in manual assertion true A type of functional complementation evidence that is used in a manual assertion that is based on the insertion of a wild-type copy of a gene into a heterologous organism, with the mutation occurring in a homologous gene. TAIR:TED A type of mutant phenotype evidence resulting from altered gene function at higher temperatures. pgaudet rctauber 2017-09-18T07:58:28Z Ts mutation evidence temperature-sensitive mutant phenotype evidence eco ECO:0006098 temperature-sensitive mutant phenotypic evidence A type of mutant phenotype evidence resulting from altered gene function at higher temperatures. GOC:PG PMID:19596904 IMP A type of temperature-sensitive mutant phenotypic evidence that is used in a manual assertion. pgaudet rctauber 2017-09-18T07:58:28Z Ts mutation evidence temperature-sensitive mutant phenotype evidence used in manual assertion eco ECO:0006099 temperature-sensitive mutant phenotypic evidence used in manual assertion true A type of temperature-sensitive mutant phenotypic evidence that is used in a manual assertion. GOC:PG PMID:19596904 A type of mutant phenotype evidence based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself. pgaudet rctauber 2017-09-18T07:58:28Z eco ECO:0006100 recessive mutant phenotype evidence A type of mutant phenotype evidence based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself. GOC:PG NBK:21578 IMP A type of mutant phenotype evidence that is used in a manual assertion based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself. pgaudet rctauber 2017-09-18T07:58:28Z eco ECO:0006101 recessive mutant phenotype evidence used in manual assertion true A type of mutant phenotype evidence that is used in a manual assertion based on the analysis of a mutation which, in diploid organisms, must be present in both alleles for a phenotype to manifest itself. GOC:PG NBK:21578 A type of computational evidence where the active site of the molecular system is described with highly accurate quantum theory, while the contribution of the rest of the system is described with molecular mechanical force field. snadendla QM/MM evidence eco ECO:0006135 quantum mechanics/molecular mechanics simulation evidence A type of computational evidence where the active site of the molecular system is described with highly accurate quantum theory, while the contribution of the rest of the system is described with molecular mechanical force field. ECO:SN PMID:26930454 A type of quantum mechanics/molecular mechanics simulation evidence that is used in an automatic assertion. snadendla eco ECO:0006136 quantum mechanics/molecular mechanics simulation evidence used in automatic assertion A type of quantum mechanics/molecular mechanics simulation evidence that is used in an automatic assertion. ECO:SN A type of quantum mechanics/molecular mechanics simulation evidence that is used in manual assertion. snadendla eco ECO:0006137 quantum mechanics/molecular mechanics simulation evidence used in manual assertion A type of quantum mechanics/molecular mechanics simulation evidence that is used in manual assertion. ECO:SN A type of computational evidence where the energy of a molecular system is predicted as a function of its conformation. snadendla MM evidence eco ECO:0006138 molecular mechanics simulation evidence A type of computational evidence where the energy of a molecular system is predicted as a function of its conformation. ECO:SN url:http://vergil.chemistry.gatech.edu/courses/chem6485/pdf/molmech.pdf A type of molecular mechanics simulation evidence that is used in an automatic assertion. snadendla eco ECO:0006139 molecular mechanics simulation evidence used in automatic assertion A type of molecular mechanics simulation evidence that is used in an automatic assertion. ECO:SN A type of molecular mechanics simulation evidence that is used in manual assertion. snadendla eco ECO:0006140 molecular mechanics simulation evidence used in manual assertion A type of molecular mechanics simulation evidence that is used in manual assertion. ECO:SN A type of computational evidence where the behavior of matter and light on the atomic and subatomic scale is described. snadendla QM evidence quantum physics evidence quantum theory evidence eco ECO:0006141 quantum mechanics simulation evidence A type of computational evidence where the behavior of matter and light on the atomic and subatomic scale is described. ECO:SN url:https://www.britannica.com/science/quantum-mechanics-physics A type of quantum mechanics simulation evidence that is used in an automatic assertion. snadendla eco ECO:0006142 quantum mechanics simulation evidence used in automatic assertion A type of quantum mechanics simulation evidence that is used in an automatic assertion. ECO:SN A type of quantum mechanics simulation evidence that is used in manual assertion. snadendla eco ECO:0006143 quantum mechanics simulation evidence used in manual assertion A type of quantum mechanics simulation evidence that is used in manual assertion. ECO:SN A type of quantum mechanics simulation evidence that results from the calculation of ground-state electronic structure of atoms, molecules and solid state materials. snadendla DFT evidence eco ECO:0006144 density functional theory simulation evidence A type of quantum mechanics simulation evidence that results from the calculation of ground-state electronic structure of atoms, molecules and solid state materials. ECO:SN url:https://www.sciencedirect.com/topics/physics-and-astronomy/density-functional-theory A type of density functional theory simulation evidence that is used in manual assertion. snadendla eco ECO:0006145 density functional theory simulation evidence used in manual assertion A type of density functional theory simulation evidence that is used in manual assertion. ECO:SN A type of density functional theory simulation evidence that is used in an automatic assertion. snadendla eco ECO:0006146 density functional theory simulation evidence used in automatic assertion A type of density functional theory simulation evidence that is used in an automatic assertion. ECO:SN A type of evidence in which information is recorded in some documentation system, for example, but not limited to a publication, survey, or medical record. snadendla eco ECO:0006151 documented statement evidence A type of evidence in which information is recorded in some documentation system, for example, but not limited to a publication, survey, or medical record. ECO:SN A type of documented statement evidence in which information is stated by a health care professional, for example, but not limited to a doctor, nurse, or psychologist. snadendla eco ECO:0006152 medical practitioner statement evidence A type of documented statement evidence in which information is stated by a health care professional, for example, but not limited to a doctor, nurse, or psychologist. ECO:SN A type of documented statement evidence in which information is provided by an individual through means including, but not limited to, paper form, electronic form, or verbal communication, and is captured in a documented record. snadendla eco ECO:0006153 self-reported individual's statement evidence A type of documented statement evidence in which information is provided by an individual through means including, but not limited to, paper form, electronic form, or verbal communication, and is captured in a documented record. ECO:SN A type of self-reported individual's statement evidence in which information is provided by a patient in a clinical setting. Pablo Botas for Foundation 29, Dx29 project snadendla eco ECO:0006154 self-reported patient statement evidence A type of self-reported individual's statement evidence in which information is provided by a patient in a clinical setting. ECO:SN A type of documented statement evidence that is used in a manual assertion. snadendla eco ECO:0006155 documented statement evidence used in manual assertion true A type of documented statement evidence that is used in a manual assertion. ECO:SN IEA A type of documented statement evidence that is used in an automatic assertion. snadendla eco ECO:0006156 documented statement evidence used in automatic assertion true A type of documented statement evidence that is used in an automatic assertion. ECO:SN A type of self-reported individual's statement evidence that is used in a manual assertion. snadendla eco ECO:0006157 self-reported individual's statement evidence used in manual assertion true A type of self-reported individual's statement evidence that is used in a manual assertion. ECO:SN IEA A type of self-reported individual's statement evidence that is used in an automatic assertion. snadendla eco ECO:0006158 self-reported individual's statement evidence used in automatic assertion true A type of self-reported individual's statement evidence that is used in an automatic assertion. ECO:SN A type of self-reported patient statement evidence that is used in a manual assertion. snadendla eco ECO:0006159 self-reported patient statement evidence used in manual assertion true A type of self-reported patient statement evidence that is used in a manual assertion. ECO:SN IEA A type of self-reported patient statement evidence that is used in an automatic assertion. snadendla eco ECO:0006160 self-reported patient statement evidence used in automatic assertion true A type of self-reported patient statement evidence that is used in an automatic assertion. ECO:SN A type of medical practitioner statement evidence that is used in a manual assertion. snadendla eco ECO:0006161 medical practitioner statement evidence used in manual assertion true A type of medical practitioner statement evidence that is used in a manual assertion. ECO:SN IEA A type of medical practitioner statement evidence that is used in an automatic assertion. snadendla eco ECO:0006162 medical practitioner statement evidence used in automatic assertion true A type of medical practitioner statement evidence that is used in an automatic assertion. ECO:SN A type of nuclear magnetic resonance evidence used for quantification of metabolites or for the determination of chemical structure or composition. SIB:PG snadendla NMR Spectroscopy eco ECO:0006163 nuclear magnetic resonance spectroscopy evidence A type of nuclear magnetic resonance evidence used for quantification of metabolites or for the determination of chemical structure or composition. ECO:SN PMID: 16428685 PMID: 23036848 IEA A type of nuclear magnetic resonance spectroscopy evidence that is used in an automatic assertion. SIB:PG snadendla eco ECO:0006164 nuclear magnetic resonance spectroscopy evidence used in automatic assertion true A type of nuclear magnetic resonance spectroscopy evidence that is used in an automatic assertion. ECO:SN EXP A type of nuclear magnetic resonance spectroscopy evidence that is used in a manual assertion. SIB:PG snadendla NMR spectroscopy evidence eco ECO:0006165 nuclear magnetic resonance spectroscopy evidence used in manual assertion true A type of nuclear magnetic resonance spectroscopy evidence that is used in a manual assertion. ECO:SN A type of nuclear magnetic resonance evidence used to image anatomy and physiological processes. bjonnh snadendla eco ECO:0006166 nuclear magnetic resonance imaging evidence A type of nuclear magnetic resonance evidence used to image anatomy and physiological processes. url:https://en.wikipedia.org/wiki/Magnetic_resonance_imaging IEA A type of nuclear magnetic resonance imaging evidence that is used in an automatic assertion. bjonnh snadendla eco ECO:0006167 nuclear magnetic resonance imaging evidence used in automatic assertion true A type of nuclear magnetic resonance imaging evidence that is used in an automatic assertion. ECO:SN EXP A type of nuclear magnetic resonance imaging evidence that is used in a manual assertion. bjonnh snadendla eco ECO:0006168 nuclear magnetic resonance imaging evidence used in manual assertion true A type of nuclear magnetic resonance imaging evidence that is used in a manual assertion. ECO:SN A type of qualitative western immunoblotting evidence where detection of the signal is carried out through digital imaging and the signal is normalized with methods such as standard curves built from reference housekeeping proteins or total transferred protein measurements. GO:Val snadendla eco ECO:0006169 quantitative western immunoblotting evidence A type of qualitative western immunoblotting evidence where detection of the signal is carried out through digital imaging and the signal is normalized with methods such as standard curves built from reference housekeeping proteins or total transferred protein measurements. ECO:SN PMID:25852189 IEP A type of quantitative western immunoblotting evidence that is used in a manual assertion. snadendla eco ECO:0006170 quantitative western immunoblotting evidence used in manual evidence true A type of quantitative western immunoblotting evidence that is used in a manual assertion. ECO:SN IEA A type of quantitatative western immunoblotting evidence that is used in an automatic assertion. snadendla eco ECO:0006171 quantitative western immunoblotting evidence used in automatic assertion true A type of quantitatative western immunoblotting evidence that is used in an automatic assertion. ECO:SN A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignments from a mixture of samples support all of the intron positions (exon pairs) predicted for a transcript. NCBI-RefSeq snadendla mixed support of intron positions by RNA-seq alignment evidence eco ECO:0006172 Mixed support entails that all exon pairs represented in the transcript are supported, but require a combination of evidence from multiple samples. For example, for a transcript containing five exons, if liver RNA-seq reads support the first two introns and brain RNA-seq supports the last three introns, then neither sample meets the criteria for full support (ECO:0000343) but the combination of samples qualifies as Mixed support. Mixed support may result from differential expression, or low expression levels that benefit from combining data. mixed support of intron positions by RNA-sequencing alignment evidence A type of support of intron positions by RNA-sequencing alignment evidence where RNA-seq alignments from a mixture of samples support all of the intron positions (exon pairs) predicted for a transcript. ECO:SN IEA A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. NCBI-RefSeq snadendla mixed support of intron positions by RNA-seq alignment evidence used in automatic assertion eco ECO:0006173 mixed support of intron positions by RNA-sequencing alignment evidence used in automatic assertion true A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in an automatic assertion. ECO:SN IEP A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion NCBI-RefSeq snadendla mixed support of intron positions by RNA-seq alignment evidence used in manual assertion eco ECO:0006174 mixed support of intron positions by RNA-sequencing alignment evidence used in manual assertion true A type of mixed support of intron positions by RNA-sequencing alignment evidence that is used in a manual assertion ECO:SN A type of nuclear magnetic resonance spectroscopy evidence resulting from measuring the change in a certain type of NMR spectrum as a result of the spontenaous exchange of hydrogen and deuterium nuclei between the sample and the solvent. DisProt:BalintMeszaros snadendla NMR HDX eco ECO:0006175 nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence A type of nuclear magnetic resonance spectroscopy evidence resulting from measuring the change in a certain type of NMR spectrum as a result of the spontenaous exchange of hydrogen and deuterium nuclei between the sample and the solvent. PMID:20960033 PMID:28538145 url:https://en.wikipedia.org/wiki/Hydrogen%E2%80%93deuterium_exchange#NMR_spectroscopy A type of nuclear magnetic resonance spectroscopy evidence in which the electromagnetic singal being measured comes from the perturbation of hydrogen nuclei resulting in a one dimensional spectrum. DisProt:BalintMeszaros snadendla 1D NMR proton NMR eco ECO:0006176 proton-based nuclear magnetic resonance evidence A type of nuclear magnetic resonance spectroscopy evidence in which the electromagnetic singal being measured comes from the perturbation of hydrogen nuclei resulting in a one dimensional spectrum. url:https://en.wikipedia.org/wiki/Proton_nuclear_magnetic_resonance A type of spectrometry evidence derived from irradiating a sample with light (either visible, infrared or ultraviolet wavelengths) and observing the difference of absorption of left-handed and right-handed light by the sample by comparing the extent of circular polarization in the incident and the emitted light. DisProt:BalintMeszaros DisProt:FedericaQuaglia snadendla CD eco ECO:0006177 circular dichroism evidence A type of spectrometry evidence derived from irradiating a sample with light (either visible, infrared or ultraviolet wavelengths) and observing the difference of absorption of left-handed and right-handed light by the sample by comparing the extent of circular polarization in the incident and the emitted light. PMID:17464384 url:https://en.wikipedia.org/wiki/Circular_dichroism A type of circular dichroism evidence where the source of radiation is radially accelerated particles, most often moving on a circular path in a synchrotron, typically providing lower wavelengths and therefore higher signal-to-noise ratio compared to regular circular dichroism measurements. DisProt:BalintMeszaros snadendla SRCD eco ECO:0006178 synchrotron radiation circular dichroism evidence A type of circular dichroism evidence where the source of radiation is radially accelerated particles, most often moving on a circular path in a synchrotron, typically providing lower wavelengths and therefore higher signal-to-noise ratio compared to regular circular dichroism measurements. PMID:20658968 A type of circular dichroism evidence whose spectrum is in the range of 190-230 nm, providing information mainly about amide bonds and through which the relative proportion of secondary structure elements of a protein can be estimated. DisProt:FedericaQuaglia snadendla far-UV CD eco ECO:0006179 far-UV circular dichroism evidence A type of circular dichroism evidence whose spectrum is in the range of 190-230 nm, providing information mainly about amide bonds and through which the relative proportion of secondary structure elements of a protein can be estimated. PMID:17464384 A type of circular dichroism evidence whose spectrum is in the range of 250-350 nm , providing information mainly about aromatic residues, i.e. phenylalanine, tyrosine and tryptophan, through which it provides information on the tertiary structure of a protein. DisProt:FedericaQuaglia snadendla near-UV CD eco ECO:0006180 near-UV circular dichroism evidence A type of circular dichroism evidence whose spectrum is in the range of 250-350 nm , providing information mainly about aromatic residues, i.e. phenylalanine, tyrosine and tryptophan, through which it provides information on the tertiary structure of a protein. PMID:17464384 A type of electron microscopy evidence where the sample being studied has been cooled to cryogenic temperatures (typically below -153 degrees Celsius) prior to the experiment. DisProt:BalintMeszaros DisProt:FedericaQuaglia snadendla cryo-EM eco ECO:0006181 cryogenic electron microscopy evidence A type of electron microscopy evidence where the sample being studied has been cooled to cryogenic temperatures (typically below -153 degrees Celsius) prior to the experiment. PMID:31078399 url:https://en.wikipedia.org/wiki/Cryogenic_electron_microscopy A type of light scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with an X-ray beam and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector. DisProt:BalintMeszaros snadendla SAXS eco ECO:0006182 small-angle X-ray scattering evidence A type of light scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with an X-ray beam and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector. PMID:26320411 url:https://en.wikipedia.org/wiki/Small-angle_X-ray_scattering A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by irradiating the sample with a particle beam and the scattered intensity is probed at a certain angle by a detector. DisProt:BalintMeszaros snadendla eco ECO:0006183 particle scattering evidence A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by irradiating the sample with a particle beam and the scattered intensity is probed at a certain angle by a detector. DisProt:BalintMeszaros A type of particle scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with a beam of thermal neutrons and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector. DisProt:BalintMeszaros snadendla SANS eco ECO:0006184 small-angle neutron scattering evidence A type of particle scattering evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight and structural transitions by irradiating the sample with a beam of thermal neutrons and the scattered intensity is probed at small angles (typically in the range of 0.1-10 degrees) by a detector. PMID:17714935 url:https://en.wikipedia.org/wiki/Small-angle_neutron_scattering A type of inferential evidence where an assertion is derived by the authors of a scientific publication from another assertion and/or primary data via logical inference or other rational means. DisProt:BalintMeszaros snadendla eco ECO:0006185 author inference A type of inferential evidence where an assertion is derived by the authors of a scientific publication from another assertion and/or primary data via logical inference or other rational means. DisProt:BalintMeszaros A type of combinatorial experimental and author inference evidence where the experimental results and author inference are contained in a single publication. DisProt:BalintMeszaros snadendla eco ECO:0006186 combinatorial experimental and author inference evidence contained in single publication A type of combinatorial experimental and author inference evidence where the experimental results and author inference are contained in a single publication. ECO:MG A type of X-ray cystallography evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule. DisProt:BalintMeszaros snadendla eco ECO:0006187 X-ray crystollagraphy-based structural model with missing residue coordinates A type of X-ray cystallography evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule. DisProt:BalintMeszaros A type of X-ray cystallography evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule. DisProt:BalintMeszaros snadendla eco ECO:0006188 X-ray crystollagraphy-based structural model with high relative B-factor values A type of X-ray cystallography evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule. DisProt:BalintMeszaros A type of cryogenic electron microscopy evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule. DisProt:BalintMeszaros snadendla eco ECO:0006189 cryogenic electron microscopy-based structural model with missing residue coordinates A type of cryogenic electron microscopy evidence in which a structural model is built lacking coordinates for some residues indicating high flexibility or structural disorder in that area of the molecule. DisProt:BalintMeszaros A type of cryogenic electron microscopy evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule. DisProt:BalintMeszaros snadendla eco ECO:0006190 cryogenic electron microscopy-based structural model with high relative B-factor values A type of cryogenic electron microscopy evidence in which a structural model is built that contains high relative B-factor values indicating flexibility in that area of the molecule. DisProt:BalintMeszaros A type of spectrophotometry evidence resulting from the evaluation of a molecule in a fluid or solid state by its ability to alter the transmission of infrared light, where the raw data collected is transformed into the specturm by Fourier transform. DisProt:BalintMeszaros snadendla FT-IR FTIR eco ECO:0006191 Fourier-transform infrared spectroscopy evidence A type of spectrophotometry evidence resulting from the evaluation of a molecule in a fluid or solid state by its ability to alter the transmission of infrared light, where the raw data collected is transformed into the specturm by Fourier transform. url:https://en.wikipedia.org/wiki/Fourier-transform_infrared_spectroscopy A type of direct assay evidence derived from measuring the amount of heat absorbed or released by a sample to monitor chemical reactions, phase transitions or other processes affecting the physical state or chemical composition. DisProt:BalintMeszaros snadendla calorimetry evidence eco ECO:0006192 heat capacity-based evidence A type of direct assay evidence derived from measuring the amount of heat absorbed or released by a sample to monitor chemical reactions, phase transitions or other processes affecting the physical state or chemical composition. url:https://en.wikipedia.org/wiki/Calorimetry A type of heat capacity-based evidence where the heat required to increase the temperature of the sample is continuously monitored and compared to the heat required to increase the temperature of a reference (having a largely identical composition compared to the sample, such as the empty buffer compared to a protein solution) over a range of temperatures. DisProt:BalintMeszaros snadendla DSC eco ECO:0006193 differential scanning calorimetry evidence A type of heat capacity-based evidence where the heat required to increase the temperature of the sample is continuously monitored and compared to the heat required to increase the temperature of a reference (having a largely identical composition compared to the sample, such as the empty buffer compared to a protein solution) over a range of temperatures. url:https://en.wikipedia.org/wiki/Differential_scanning_calorimetry Here, we describe the generation, characterisation, and utility of a monoclonal antibody that selectively binds with high affinity to the asymmetric TNF trimer–small molecule complex. The antibody helps to define the molecular dynamics of the apo TNF trimer, reveals the mode of action and specificity of the small molecule inhibitors, acts as a chaperone in solving the human TNF–TNFR1 complex crystal structure, and facilitates the measurement of small molecule target occupancy in complex biological samples. A type of immunodetection assay evidence that involves the use of antibodies that are selective to conformations of the epitope to which they bind in order to provide information on conformations present in a target molecule. DisProt:BalintMeszaros snadendla eco ECO:0006194 selective antibody-based structural conformation evidence Here, we describe the generation, characterisation, and utility of a monoclonal antibody that selectively binds with high affinity to the asymmetric TNF trimer–small molecule complex. The antibody helps to define the molecular dynamics of the apo TNF trimer, reveals the mode of action and specificity of the small molecule inhibitors, acts as a chaperone in solving the human TNF–TNFR1 complex crystal structure, and facilitates the measurement of small molecule target occupancy in complex biological samples. PMID:33495445 A type of immunodetection assay evidence that involves the use of antibodies that are selective to conformations of the epitope to which they bind in order to provide information on conformations present in a target molecule. DisProt:BalintMeszaros A type of mass spectrometry evidence derived from measuring changes in mass associated with the isotopic exchange between amide hydrogens of the protein backbone and its surrounding solvent, providing information on the structural state, the dynamics and the intrinsic chemical properties of the underlying amino acid sequence. DisProt:BalintMeszaros snadendla HDX-MS eco ECO:0006195 protein hydrogen-deuterium exchange mass spectrometry evidence A type of mass spectrometry evidence derived from measuring changes in mass associated with the isotopic exchange between amide hydrogens of the protein backbone and its surrounding solvent, providing information on the structural state, the dynamics and the intrinsic chemical properties of the underlying amino acid sequence. PMID:31249422 url:https://en.wikipedia.org/wiki/Hydrogen%E2%80%93deuterium_exchange#Mass_spectrometry EXP A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla NMR HDX eco ECO:0006196 nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence used in manual assertion true A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in a manual assertion. ECO:SN IEA A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla NMR HDX eco ECO:0006197 nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence used in automatic assertion true A type of nuclear magnetic resonance spectroscopy-based hydrogen-deuterium exchange evidence that is used in an automatic assertion. ECO:SN EXP A type of proton-based nuclear magnetic resonance evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla 1D NMR proton NMR eco ECO:0006198 proton-based nuclear magnetic resonance evidence used in manual assertion true A type of proton-based nuclear magnetic resonance evidence that is used in a manual assertion. ECO:SN IEA A type of proton-based nuclear magnetic resonance evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla 1D NMR proton NMR eco ECO:0006199 proton-based nuclear magnetic resonance evidence used in automatic assertion true A type of proton-based nuclear magnetic resonance evidence that is used in an automatic assertion. ECO:SN EXP A type of circular dichroism evidence that is used in a manual assertion. DisProt:BalintMeszaros DisProt:FedericaQuaglia snadendla CD eco ECO:0006200 circular dichroism evidence used in manual assertion true A type of circular dichroism evidence that is used in a manual assertion. ECO:SN IEA A type of circular dichroism evidence that is used in an automatic assertion. DisProt:BalintMeszaros DisProt:FedericaQuaglia snadendla CD eco ECO:0006201 circular dichroism evidence used in automatic assertion true true A type of circular dichroism evidence that is used in an automatic assertion. ECO:SN EXP A type of synchrotron radiation circular dichroism evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla SRCD eco ECO:0006202 synchrotron radiation circular dichroism evidence used in manual assertion true A type of synchrotron radiation circular dichroism evidence that is used in a manual assertion. ECO:SN IEA A type of synchrotron radiation circular dichroism evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla SRCD eco ECO:0006203 synchrotron radiation circular dichroism evidence used in automatic assertion true A type of synchrotron radiation circular dichroism evidence that is used in an automatic assertion. ECO:SN EXP A type of far-UV circular dichroism evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla far-UV CD eco ECO:0006204 far-UV circular dichroism evidence used in manual assertion true A type of far-UV circular dichroism evidence that is used in a manual assertion. ECO:SN IEA A type of far-UV circular dichroism evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla far-UV CD eco ECO:0006205 far-UV circular dichroism evidence used in automatic assertion true A type of far-UV circular dichroism evidence that is used in an automatic assertion. ECO:SN EXP A type of near-UV circular dichroism evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla near-UV CD eco ECO:0006206 near-UV circular dichroism evidence used in manual assertion true A type of near-UV circular dichroism evidence that is used in a manual assertion. ECO:SN IEA A type of near-UV circular dichroism evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla near-UV CD eco ECO:0006207 near-UV circular dichroism evidence used in automatic assertion true A type of near-UV circular dichroism evidence that is used in an automatic assertion. ECO:SN IDA A type of cryogenic electron microscopy evidence that is used in a manual assertion. DisProt:BalintMeszaros DisProt:FedericaQuaglia snadendla cryo-EM eco ECO:0006208 cryogenic electron microscopy evidence used in manual assertion true A type of cryogenic electron microscopy evidence that is used in a manual assertion. ECO:SN IEA A type of cryogenic electron microscopy evidence that is used in an automatic assertion. DisProt:BalintMeszaros DisProt:FedericaQuaglia snadendla cryo-EM eco ECO:0006209 cryogenic electron microscopy evidence used in automatic assertion true A type of cryogenic electron microscopy evidence that is used in an automatic assertion. ECO:SN EXP A type of small-angle X-ray scattering evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla SAXS eco ECO:0006210 small-angle X-ray scattering evidence used in manual assertion true A type of small-angle X-ray scattering evidence that is used in a manual assertion. ECO:SN IEA A type of small-angle X-ray scattering evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla SAXS eco ECO:0006211 small-angle X-ray scattering evidence used in automatic assertion true A type of small-angle X-ray scattering evidence that is used in an automatic assertion. ECO:SN EXP A type of particle scattering evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006212 particle scattering evidence used in manual assertion true A type of particle scattering evidence that is used in a manual assertion. ECO:SN IEA A type of particle scattering evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006213 particle scattering evidence used in automatic assertion true A type of particle scattering evidence that is used in an automatic assertion. ECO:SN EXP A type of small-angle neutron scattering evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla SANS eco ECO:0006214 small-angle neutron scattering evidence used in manual assertion true A type of small-angle neutron scattering evidence that is used in a manual assertion. ECO:SN IEA A type of small-angle neutron scattering evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla SANS eco ECO:0006215 small-angle neutron scattering evidence used in automatic assertion true A type of small-angle neutron scattering evidence that is used in an automatic assertion. ECO:SN A type of author inference that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006216 author inference used in manual assertion true true A type of author inference that is used in a manual assertion. ECO:SN IEA A type of author inference that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006217 author inference used in automatic assertion true true A type of author inference that is used in an automatic assertion. ECO:SN A type of combinatorial experimental and author inference evidence contained in single publication that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006218 combinatorial experimental and author inference evidence contained in single publication used in manual assertion true A type of combinatorial experimental and author inference evidence contained in single publication that is used in a manual assertion. ECO:SN IEA A type of combinatorial experimental and author inference evidence contained in single publication that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006219 combinatorial experimental and author inference evidence contained in single publication used in automatic assertion true A type of combinatorial experimental and author inference evidence contained in single publication that is used in an automatic assertion. ECO:SN EXP A type of X-ray crystollagraphy-based structural model with missing residue coordinates that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006220 X-ray crystollagraphy-based structural model with missing residue coordinates used in manual assertion true A type of X-ray crystollagraphy-based structural model with missing residue coordinates that is used in a manual assertion. ECO:SN IEA A type of X-ray crystollagraphy-based structural model with missing residue coordinates that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006221 X-ray crystollagraphy-based structural model with missing residue coordinates used in automatic assertion true A type of X-ray crystollagraphy-based structural model with missing residue coordinates that is used in an automatic assertion. ECO:SN EXP A type of X-ray crystollagraphy-based structural model with high relative B-factor values that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006222 X-ray crystollagraphy-based structural model with high relative B-factor values used in manual assertion true A type of X-ray crystollagraphy-based structural model with high relative B-factor values that is used in a manual assertion. ECO:SN IEA A type of X-ray crystollagraphy-based structural model with high relative B-factor values that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006223 X-ray crystollagraphy-based structural model with high relative B-factor values used in automatic assertion true A type of X-ray crystollagraphy-based structural model with high relative B-factor values that is used in an automatic assertion. ECO:SN IDA A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006224 cryogenic electron microscopy-based structural model with missing residue coordinates used in manual assertion true A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in a manual assertion. ECO:SN IEA A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006225 cryogenic electron microscopy-based structural model with missing residue coordinates used in automatic assertion true A type of cryogenic electron microscopy-based structural model with missing residue coordinates that is used in an automatic assertion. ECO:SN IDA A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006226 cryogenic electron microscopy-based structural model with high relative B-factor values used in manual assertion true A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in a manual assertion. ECO:SN IEA A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006227 cryogenic electron microscopy-based structural model with high relative B-factor values used in automatic assertion true A type of cryogenic electron microscopy-based structural model with high relative B-factor values that is used in an automatic assertion. ECO:SN EXP A type of Fourier-transform infrared spectroscopy evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla FT-IR FTIR eco ECO:0006228 Fourier-transform infrared spectroscopy evidence used in manual assertion true A type of Fourier-transform infrared spectroscopy evidence that is used in a manual assertion. ECO:SN IEA A type of Fourier-transform infrared spectroscopy evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla FT-IR FTIR eco ECO:0006229 Fourier-transform infrared spectroscopy evidence used in automatic assertion true A type of Fourier-transform infrared spectroscopy evidence that is used in an automatic assertion. ECO:SN IDA A type of heat capacity-based evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla calorimetry evidence eco ECO:0006230 heat capacity-based evidence used in manual assertion true A type of heat capacity-based evidence that is used in a manual assertion. ECO:SN IEA A type of heat capacity-based evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla calorimetry evidence eco ECO:0006231 heat capacity-based evidence used in automatic assertion true A type of heat capacity-based evidence that is used in an automatic assertion. ECO:SN IDA A type of differential scanning calorimetry evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla DSC eco ECO:0006232 differential scanning calorimetry evidence used in manual assertion true A type of differential scanning calorimetry evidence that is used in a manual assertion. ECO:SN IEA A type of differential scanning calorimetry evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla DSC eco ECO:0006233 differential scanning calorimetry evidence used in automatic assertion true A type of differential scanning calorimetry evidence that is used in an automatic assertion. ECO:SN IDA A type of selective antibody-based structural conformation evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006234 selective antibody-based structural conformation evidence used in manual assertion true A type of selective antibody-based structural conformation evidence that is used in a manual assertion. ECO:SN IEA A type of selective antibody-based structural conformation evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006235 selective antibody-based structural conformation evidence used in automatic assertion true true A type of selective antibody-based structural conformation evidence that is used in an automatic assertion. ECO:SN EXP A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla HDX-MS eco ECO:0006236 protein hydrogen-deuterium exchange mass spectrometry evidence used in manual assertion true A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in a manual assertion. ECO:SN IEA A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla HDX-MS eco ECO:0006237 protein hydrogen-deuterium exchange mass spectrometry evidence used in automatic assertion true A type of protein hydrogen-deuterium exchange mass spectrometry evidence that is used in an automatic assertion. ECO:SN A type of reporter gene assay evidence based on the fusion of the galK gene to a specific promoter for the expression of the enzyme galactokinase. OMP:DebbySiegele snadendla eco ECO:0006238 galactokinase reporter gene assay evidence A type of reporter gene assay evidence based on the fusion of the galK gene to a specific promoter for the expression of the enzyme galactokinase. url:https://www.sciencedirect.com/science/article/pii/007668796608039X A type of RNA-sequencing evidence based on sequencing of the 3' ends of cDNA molecules that are selected by presence of a polyadenylated tail. NCBI-RefSeq:MurphyTerence snadendla eco ECO:0006239 polyadenylated transcript 3'-end-sequencing evidence A type of RNA-sequencing evidence based on sequencing of the 3' ends of cDNA molecules that are selected by presence of a polyadenylated tail. PMID:31617559 A type of colony morphology phenotypic evidence based on the presence or absence of a visually apparent boundary formed between colonies of multiple isolates or strains of the same microbial species growing on a solid surface such as that of an agar culture medium. OMP:DebbySiegele snadendla eco ECO:0006240 colony boundary assay evidence A type of colony morphology phenotypic evidence based on the presence or absence of a visually apparent boundary formed between colonies of multiple isolates or strains of the same microbial species growing on a solid surface such as that of an agar culture medium. PMID:18621670 IEP A type of galactokinase reporter gene assay evidence that is used in a manual assertion. OMP:DebbySiegele snadendla eco ECO:0006241 galactokinase reporter gene assay evidence used in manual assertion true A type of galactokinase reporter gene assay evidence that is used in a manual assertion. ECO:SN IEA A type of galactokinase reporter gene assay evidence that is used in an automatic assertion. OMP:DebbySiegele snadendla eco ECO:0006242 galactokinase reporter gene assay evidence used in automatic assertion true A type of galactokinase reporter gene assay evidence that is used in an automatic assertion. ECO:SN IEP A type of polyadenylated transcript 3'-end-sequencing evidence that is used in a manual assertion. NCBI-RefSeq:MurphyTerence snadendla eco ECO:0006243 polyadenylated transcript 3'-end-sequencing evidence used in manual assertion true A type of polyadenylated transcript 3'-end-sequencing evidence that is used in a manual assertion. ECO:SN IEA A type of polyadenylated transcript 3'-end-sequencing evidence that is used in an automatic assertion. NCBI-RefSeq:MurphyTerence snadendla eco ECO:0006244 polyadenylated transcript 3'-end-sequencing evidence used in automatic assertion true A type of polyadenylated transcript 3'-end-sequencing evidence that is used in an automatic assertion. ECO:SN EXP A type of colony boundary assay evidence that is used in a manual assertion. OMP:DebbySiegele snadendla eco ECO:0006245 colony boundary assay evidence used in manual assertion true A type of colony boundary assay evidence that is used in a manual assertion. ECO:SN IEA A type of colony boundary assay evidence that is used in an automatic assertion. OMP:DebbySiegele snadendla eco ECO:0006246 colony boundary assay evidence used in automatic assertion true A type of colony boundary assay evidence that is used in an automatic assertion. ECO:SN A type of molecule detection assay evidence where the hydrodynamic behaviour of macromolecules is used to study their size, shape and interactions, by spinning the sample solution at high centrifugal field (up to above 100000 rpm and 1000000 g), and monitoring the evolution of sample concentration profile versus the axis of rotation. DisProt:FedericaQuaglia snadendla AUC eco ECO:0006247 analytical ultracentrifugation evidence A type of molecule detection assay evidence where the hydrodynamic behaviour of macromolecules is used to study their size, shape and interactions, by spinning the sample solution at high centrifugal field (up to above 100000 rpm and 1000000 g), and monitoring the evolution of sample concentration profile versus the axis of rotation. PMID:12192063 A type of physical interaction evidence based on the measurement of the change in the degree of polarization of a fluorophore upon binding to a molecular partner. DisProt:FedericaQuaglia snadendla FP eco ECO:0006248 fluorescence polarization evidence A type of physical interaction evidence based on the measurement of the change in the degree of polarization of a fluorophore upon binding to a molecular partner. PMID:21372817 OBSOLETE A type of protein binding evidence resulting from an affinity purification in-vitro technique used to detect physical interactions between two or more proteins, where a molecule of interest - a "bait" - is immobilized and incubated with a protein source containing putative "prey" proteins. DisProt:FedericaQuaglia snadendla eco ECO:0006249 This term has been obsoleted as this is same as the term bait-prey hybrid interaction evidence. obsolete bait-prey protein pull-down evidence true OBSOLETE A type of protein binding evidence resulting from an affinity purification in-vitro technique used to detect physical interactions between two or more proteins, where a molecule of interest - a "bait" - is immobilized and incubated with a protein source containing putative "prey" proteins. PMID:28667618 A type of electron microscopy evidence where a heavy metal is evaporated onto surface adsorbed molecules and macromolecular assemblies allowing high-contrast visualization of both individual macromolecules and the surface structure of macromolecular assemblies. DisProt:FedericaQuaglia snadendla RS-TEM eco ECO:0006250 rotary shadowing electron microscopy evidence A type of electron microscopy evidence where a heavy metal is evaporated onto surface adsorbed molecules and macromolecular assemblies allowing high-contrast visualization of both individual macromolecules and the surface structure of macromolecular assemblies. PMID:19247619 A type of mass spectrometry evidence resulting from the ionization of polar functional groups producing multiple charged ions followed by the detection of ion cyclotron frequencies within a magnetic field, making it suitable for the study of large molecules (>2 kDa). DisProt:FedericaQuaglia snadendla ESI FT-ICR MS eco ECO:0006251 electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence A type of mass spectrometry evidence resulting from the ionization of polar functional groups producing multiple charged ions followed by the detection of ion cyclotron frequencies within a magnetic field, making it suitable for the study of large molecules (>2 kDa). PMID:10575730 A type of experimental evidence in which particles in strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting eletromagnetic signal is captured. DisProt:FedericaQuaglia snadendla eco ECO:0006252 magnetic resonance evidence A type of experimental evidence in which particles in strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting eletromagnetic signal is captured. ECO:MG A type of magnetic resonance evidence in which unpaired electrons in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured. DisProt:BalintMeszaros snadendla EPR ESR eco ECO:0006253 electron paramagnetic resonance evidence A type of magnetic resonance evidence in which unpaired electrons in a strong constant magnetic field are perturbed by a weak oscillating magnetic field and the resulting electromagnetic signal is captured. PMID:21826602 url:https://en.wikipedia.org/wiki/Electron_paramagnetic_resonance A type of electron paramagnetic resonance evidence where the signal is obtained by labeling the protein in specific sites with a functional group (most often a nitroxide) containing an unpaired electron using site-directed mutagenesis. DisProt:BalintMeszaros snadendla SDSL eco ECO:0006254 site-directed spin-labelling electron paramagnetic resonance evidence A type of electron paramagnetic resonance evidence where the signal is obtained by labeling the protein in specific sites with a functional group (most often a nitroxide) containing an unpaired electron using site-directed mutagenesis. PMID:21826602 url:https://en.wikipedia.org/wiki/Site-directed_spin_labeling A type of direct assay evidence where the removal of glycan groups from a substrate (RNA, DNA, or protein) is detected. DisProt:BalintMeszaros snadendla eco ECO:0006255 deglycosylation assay evidence A type of direct assay evidence where the removal of glycan groups from a substrate (RNA, DNA, or protein) is detected. url:https://en.wikipedia.org/wiki/Glycosylation A type of physical interaction evidence that is based on the detection of a protein-protein interaction between a bait and prey protein by reconstitution of a reporter protein serving as a detectable entity (usually an enzyme or a fluorescent protein), the two halves of which are each attached separately to the bait and prey. DisProt:BalintMeszaros snadendla eco ECO:0006256 protein fragment functional complementation evidence A type of physical interaction evidence that is based on the detection of a protein-protein interaction between a bait and prey protein by reconstitution of a reporter protein serving as a detectable entity (usually an enzyme or a fluorescent protein), the two halves of which are each attached separately to the bait and prey. PMID:31274323 A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a functional beta galactosidase enzyme. DisProt:BalintMeszaros snadendla eco ECO:0006257 beta galactosidase functional complementation evidence A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a functional beta galactosidase enzyme. PMID:9237989 A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a transcriptional activation complex consisting of the GAL4 DNA-binding domain and the transactivation domain from the herpes simplex virus protein VP16. DisProt:BalintMeszaros snadendla eco ECO:0006258 GAL4-VP16 functional complementation evidence A type of protein fragment functional complementaion evidence where the interaction between bait and prey assemble a transcriptional activation complex consisting of the GAL4 DNA-binding domain and the transactivation domain from the herpes simplex virus protein VP16. PSI-MI:0728 A type of spectrophotometry evidence used to determine a structural fingerprint of the molecule in solution by probing its vibrational modes via the inelastic scattering of photons (called Raman scattering). DisProt:BalintMeszaros snadendla ROA Raman optical activity eco ECO:0006259 Raman spectroscopy evidence A type of spectrophotometry evidence used to determine a structural fingerprint of the molecule in solution by probing its vibrational modes via the inelastic scattering of photons (called Raman scattering). url:https://en.wikipedia.org/wiki/Raman_spectroscopy A type of heat capacity-based evidence in which the denaturation temperature of a protein sample is measured under varying conditions, such as pH, redox potential, concentration of other molecules or changes in the proteoform, to determine the effect of these factors on protein thermal stability. DisProt:BalintMeszaros snadendla eco ECO:0006260 protein thermal shift assay evidence A type of heat capacity-based evidence in which the denaturation temperature of a protein sample is measured under varying conditions, such as pH, redox potential, concentration of other molecules or changes in the proteoform, to determine the effect of these factors on protein thermal stability. url:https://en.wikipedia.org/wiki/Thermal_shift_assay A type of physical interaction evidence resulting from measuring the change of the fluorescent activity of a molecule as a function of binding to a non-fluorescent partner and its movement in a microspcopic thermal gradient affecting the intensity of fluorescence. DisProt:BalintMeszaros snadendla MST eco ECO:0006261 microscale thermophoresis evidence A type of physical interaction evidence resulting from measuring the change of the fluorescent activity of a molecule as a function of binding to a non-fluorescent partner and its movement in a microspcopic thermal gradient affecting the intensity of fluorescence. PMID:23270813 url:https://en.wikipedia.org/wiki/Microscale_thermophoresis A type of gel electrophoresis evidence resulting from the use of non-denaturing conditions so that the proteins being measured are in their native structural states. DisProt:BalintMeszaros snadendla native gel BN-PAGE CN-PAGE QPNC-PAGE native PAGE eco ECO:0006262 native protein gel electrophoresis evidence A type of gel electrophoresis evidence resulting from the use of non-denaturing conditions so that the proteins being measured are in their native structural states. url:https://en.wikipedia.org/wiki/Gel_electrophoresis_of_proteins A type of direct assay evidence where the optical properties of a solution is measured in the visible light spectrum, assessing the haziness or cloudiness as a result of the properties of the solutes or the changes in their material states. DisProt:BalintMeszaros snadendla eco ECO:0006263 turbidity measurement evidence A type of direct assay evidence where the optical properties of a solution is measured in the visible light spectrum, assessing the haziness or cloudiness as a result of the properties of the solutes or the changes in their material states. url:https://en.wikipedia.org/wiki/Turbidity A type of affinity evidence derived from an experimental setup where the binding properties of a ligand are assessed by measuring the competition with another ligand with already known binding properties. DisProt:BalintMeszaros snadendla competition assay eco ECO:0006264 competitive binding evidence A type of affinity evidence derived from an experimental setup where the binding properties of a ligand are assessed by measuring the competition with another ligand with already known binding properties. PMID:21115850 A type of structure determination evidence obtained by monitoring structural changes of a protein as a response to changes of an environmental parameter, such as pH or temperature, or the concentration of a denaturant, such as urea. DisProt:BalintMeszaros snadendla protein denaturation assay eco ECO:0006265 protein unfolding evidence A type of structure determination evidence obtained by monitoring structural changes of a protein as a response to changes of an environmental parameter, such as pH or temperature, or the concentration of a denaturant, such as urea. url:https://en.wikipedia.org/wiki/Equilibrium_unfolding A type of protein unfolding evidence where the unfolding of the protein is triggered by increasing concentrations of urea. DisProt:BalintMeszaros snadendla chemical denaturation chemical unfolding eco ECO:0006266 urea-induced protein unfolding evidence A type of protein unfolding evidence where the unfolding of the protein is triggered by increasing concentrations of urea. PMID:19708649 A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in pH. DisProt:BalintMeszaros snadendla eco ECO:0006267 pH-induced protein unfolding evidence A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in pH. PMID:23185611 A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in temperature. DisProt:BalintMeszaros snadendla thermal dentauration thermal unfolding eco ECO:0006268 temperature-induced protein unfolding evidence A type of protein unfolding evidence where the unfolding of the protein is triggered by changes in temperature. PMID:23185611 A type of cell-based assay evidence resulting from the analysis of cells irreversibly binding to each other. DisProt:BalintMeszaros snadendla eco ECO:0006269 cell aggregation evidence A type of cell-based assay evidence resulting from the analysis of cells irreversibly binding to each other. PMID:24092433 A type of affinity evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to RNA. DisProt:BalintMeszaros snadendla eco ECO:0006270 RNA-protein binding evidence A type of affinity evidence resulting from the qualitative and quantitative analysis of the affinity with which a protein binds to RNA. PMID:30804549 A type of microscopy evidence that is obtained by using the fluorescence of the studied sample instead of or in addition to the scattering, reflection, attenuation or absorption of light. DisProt:BalintMeszaros snadendla eco ECO:0006271 fluorescence microscopy evidence A type of microscopy evidence that is obtained by using the fluorescence of the studied sample instead of or in addition to the scattering, reflection, attenuation or absorption of light. url:https://en.wikipedia.org/wiki/Fluorescence_microscope A type of direct assay evidence where the viscosity of a solution is measured to quantify the material properties of the solution, or the changes of these properties in response to changing composition or environmental factors. DisProt:BalintMeszaros snadendla viscometry eco ECO:0006272 viscosity measurement evidence A type of direct assay evidence where the viscosity of a solution is measured to quantify the material properties of the solution, or the changes of these properties in response to changing composition or environmental factors. url:https://en.wikipedia.org/wiki/Viscometer A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the interaction between a fluorescence donor and acceptor in their excited state. DisProt:BalintMeszaros snadendla quenching Dexter FRET exciplex eco ECO:0006273 dynamic fluorescence quenching evidence A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the interaction between a fluorescence donor and acceptor in their excited state. url:https://en.wikipedia.org/wiki/Quenching_(fluorescence) A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the intramolecular interaction between a fluorescence donor and acceptor creating a non-fluorescent ground state. DisProt:BalintMeszaros snadendla quenching eco ECO:0006274 static fluorescence quenching evidence A type of physical interaction evidence derived from the decrease (quenching) of fluorescence as a result of the intramolecular interaction between a fluorescence donor and acceptor creating a non-fluorescent ground state. url:https://en.wikipedia.org/wiki/Quenching_(fluorescence) A type of analytical ultracentrifugation evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla AUC eco ECO:0006275 analytical ultracentrifugation evidence used in manual assertion true A type of analytical ultracentrifugation evidence that is used in a manual assertion. ECO:SN A type of analytical ultracentrifugation evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla AUC eco ECO:0006276 analytical ultracentrifugation evidence used in automatic assertion true A type of analytical ultracentrifugation evidence that is used in an automatic assertion. ECO:SN A type of fluorescence polarization evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla FP eco ECO:0006277 fluorescence polarization evidence used in manual assertion true A type of fluorescence polarization evidence that is used in a manual assertion. ECO:SN A type of fluorescence polarization evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla FP eco ECO:0006278 fluorescence polarization evidence used in automatic assertion true A type of fluorescence polarization evidence that is used in an automatic assertion. ECO:SN OBSOLETE A type of bait-prey protein pull-down evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla eco ECO:0006279 obsolete bait-prey protein pull-down evidence used in manual assertion true OBSOLETE A type of bait-prey protein pull-down evidence that is used in a manual assertion. ECO:SN OBSOLETE A type of bait-prey protein pull-down evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla eco ECO:0006280 obsolete bait-prey protein pull-down evidence used in automatic assertion true OBSOLETE A type of bait-prey protein pull-down evidence that is used in an automatic assertion. ECO:SN A type of rotary shadowing electron microscopy evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla RS-TEM eco ECO:0006281 rotary shadowing electron microscopy evidence used in manual assertion true A type of rotary shadowing electron microscopy evidence that is used in a manual assertion. ECO:SN A type of rotary shadowing electron microscopy evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla RS-TEM eco ECO:0006282 rotary shadowing electron microscopy evidence used in automatic assertion true A type of rotary shadowing electron microscopy evidence that is used in an automatic assertion. ECO:SN A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla ESI FT-ICR MS eco ECO:0006283 electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence used in manual assertion true A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in a manual assertion. ECO:SN A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla ESI FT-ICR MS eco ECO:0006284 electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence used in automatic assertion true A type of electrospray ionization fourier transform ion cyclotron resonance mass spectrometry evidence that is used in an automatic assertion. ECO:SN EXP A type of magnetic resonance evidence that is used in a manual assertion. DisProt:FedericaQuaglia snadendla eco ECO:0006285 magnetic resonance evidence used in manual assertion true A type of magnetic resonance evidence that is used in a manual assertion. ECO:SN A type of magnetic resonance evidence that is used in an automatic assertion. DisProt:FedericaQuaglia snadendla eco ECO:0006286 magnetic resonance evidence used in automatic assertion true A type of magnetic resonance evidence that is used in an automatic assertion. ECO:SN A type of electron paramagnetic resonance evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla EPR ESR eco ECO:0006287 electron paramagnetic resonance evidence used in manual assertion true A type of electron paramagnetic resonance evidence that is used in a manual assertion. ECO:SN A type of electron paramagnetic resonance evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla EPR ESR eco ECO:0006288 electron paramagnetic resonance evidence used in automatic assertion true A type of electron paramagnetic resonance evidence that is used in an automatic assertion. ECO:SN A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla SDSL eco ECO:0006289 site-directed spin-labelling electron paramagnetic resonance evidence used in manual assertion true A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in a manual assertion. ECO:SN A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla SDSL eco ECO:0006290 site-directed spin-labelling electron paramagnetic resonance evidence used in automatic assertion true A type of site-directed spin-labelling electron paramagnetic resonance evidence that is used in an automatic assertion. ECO:SN A type of deglycosylation assay evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006291 deglycosylation assay evidence used in manual assertion true A type of deglycosylation assay evidence that is used in a manual assertion. ECO:SN A type of deglycosylation assay evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006292 deglycosylation assay evidence used in automatic assertion true A type of deglycosylation assay evidence that is used in an automatic assertion. ECO:SN IPI A type of protein fragment functional complementation evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006293 protein fragment functional complementation evidence used in manual assertion true A type of protein fragment functional complementation evidence that is used in a manual assertion. ECO:SN A type of protein fragment functional complementation evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006294 protein fragment functional complementation evidence used in automatic assertion true A type of protein fragment functional complementation evidence that is used in an automatic assertion. ECO:SN A type of beta galactosidase functional complementation evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006295 beta galactosidase functional complementation evidence used in manual assertion true A type of beta galactosidase functional complementation evidence that is used in a manual assertion. ECO:SN A type of beta galactosidase functional complementation evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006296 beta galactosidase functional complementation evidence used in automatic assertion true A type of beta galactosidase functional complementation evidence that is used in an automatic assertion. ECO:SN A type of GAL4-VP16 functional complementation evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006297 GAL4-VP16 functional complementation evidence used in manual assertion true A type of GAL4-VP16 functional complementation evidence that is used in a manual assertion. ECO:SN A type of GAL4-VP16 functional complementation evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006298 GAL4-VP16 functional complementation evidence used in automatic assertion true A type of GAL4-VP16 functional complementation evidence that is used in an automatic assertion. ECO:SN A type of Raman spectroscopy evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla ROA Raman optical activity eco ECO:0006299 Raman spectroscopy evidence used in manual assertion true A type of Raman spectroscopy evidence that is used in a manual assertion. ECO:SN A type of Raman spectroscopy evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla ROA Raman optical activity eco ECO:0006300 Raman spectroscopy evidence used in automatic assertion true true A type of Raman spectroscopy evidence that is used in an automatic assertion. ECO:SN A type of protein thermal shift assay evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006301 protein thermal shift assay evidence used in manual assertion true A type of protein thermal shift assay evidence that is used in a manual assertion. ECO:SN A type of protein thermal shift assay evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006302 protein thermal shift assay evidence used in automatic assertion true A type of protein thermal shift assay evidence that is used in an automatic assertion. ECO:SN A type of microscale thermophoresis evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla MST eco ECO:0006303 microscale thermophoresis evidence used in manual assertion true true A type of microscale thermophoresis evidence that is used in a manual assertion. ECO:SN A type of microscale thermophoresis evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla MST eco ECO:0006304 microscale thermophoresis evidence used in automatic assertion true true A type of microscale thermophoresis evidence that is used in an automatic assertion. ECO:SN A type of native protein gel electrophoresis evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla native gel BN-PAGE CN-PAGE QPNC-PAGE native PAGE eco ECO:0006305 native protein gel electrophoresis evidence used in manual assertion true A type of native protein gel electrophoresis evidence that is used in a manual assertion. ECO:SN A type of native protein gel electrophoresis evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla native gel BN-PAGE CN-PAGE QPNC-PAGE native PAGE eco ECO:0006306 native protein gel electrophoresis evidence used in automatic assertion true A type of native protein gel electrophoresis evidence that is used in an automatic assertion. ECO:SN A type of turbidity measurement evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006307 turbidity measurement evidence used in manual assertion true A type of turbidity measurement evidence that is used in a manual assertion. ECO:SN A type of turbidity measurement evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006308 turbidity measurement evidence used in automatic assertion true A type of turbidity measurement evidence that is used in an automatic assertion. ECO:SN A type of competitive binding evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla competition assay eco ECO:0006309 competitive binding evidence used in manual assertion true A type of competitive binding evidence that is used in a manual assertion. ECO:SN A type of competitive binding evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla competition assay eco ECO:0006310 competitive binding evidence used in automatic assertion true A type of competitive binding evidence that is used in an automatic assertion. ECO:SN A type of protein unfolding evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla protein denaturation assay eco ECO:0006311 protein unfolding evidence used in manual assertion true A type of protein unfolding evidence that is used in a manual assertion. ECO:SN A type of protein unfolding evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla protein denaturation assay eco ECO:0006312 protein unfolding evidence used in automatic assertion true A type of protein unfolding evidence that is used in an automatic assertion. ECO:SN A type of urea-induced protein unfolding evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla chemical denaturation chemical unfolding eco ECO:0006313 urea-induced protein unfolding evidence used in manual assertion true A type of urea-induced protein unfolding evidence that is used in a manual assertion. ECO:SN A type of urea-induced protein unfolding evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla chemical denaturation chemical unfolding eco ECO:0006314 urea-induced protein unfolding evidence used in automatic assertion true A type of urea-induced protein unfolding evidence that is used in an automatic assertion. ECO:SN A type of pH-induced protein unfolding evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006315 pH-induced protein unfolding evidence used in manual assertion true A type of pH-induced protein unfolding evidence that is used in a manual assertion. ECO:SN A type of pH-induced protein unfolding evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006316 pH-induced protein unfolding evidence used in automatic assertion true A type of pH-induced protein unfolding evidence that is used in an automatic assertion. ECO:SN A type of temperature-induced protein unfolding evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla thermal dentauration thermal unfolding eco ECO:0006317 temperature-induced protein unfolding evidence used in manual assertion true A type of temperature-induced protein unfolding evidence that is used in a manual assertion. ECO:SN A type of temperature-induced protein unfolding evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla thermal dentauration thermal unfolding eco ECO:0006318 temperature-induced protein unfolding evidence used in automatic assertion true A type of temperature-induced protein unfolding evidence that is used in an automatic assertion. ECO:SN A type of cell aggregation evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006319 cell aggregation evidence used in manual assertion true A type of cell aggregation evidence that is used in a manual assertion. ECO:SN A type of cell aggregation evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006320 cell aggregation evidence used in automatic assertion true A type of cell aggregation evidence that is used in an automatic assertion. ECO:SN A type of RNA-protein binding evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006321 RNA-protein binding evidence used in manual assertion true true A type of RNA-protein binding evidence that is used in a manual assertion. ECO:SN A type of RNA-protein binding evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006322 RNA-protein binding evidence used in automatic assertion true true A type of RNA-protein binding evidence that is used in an automatic assertion. ECO:SN A type of fluorescence microscopy evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla eco ECO:0006323 fluorescence microscopy evidence used in manual assertion true true A type of fluorescence microscopy evidence that is used in a manual assertion. ECO:SN A type of fluorescence microscopy evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla eco ECO:0006324 fluorescence microscopy evidence used in automatic assertion true true A type of fluorescence microscopy evidence that is used in an automatic assertion. ECO:SN A type of viscosity measurement evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla viscometry eco ECO:0006325 viscosity measurement evidence used in manual assertion true A type of viscosity measurement evidence that is used in a manual assertion. ECO:SN A type of viscosity measurement evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla viscometry eco ECO:0006326 viscosity measurement evidence used in automatic assertion true A type of viscosity measurement evidence that is used in an automatic assertion. ECO:SN IPI A type of dynamic fluorescence quenching evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla quenching Dexter FRET exciplex eco ECO:0006327 dynamic fluorescence quenching evidence used in manual assertion true true A type of dynamic fluorescence quenching evidence that is used in a manual assertion. ECO:SN A type of dynamic fluorescence quenching evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla quenching Dexter FRET exciplex eco ECO:0006328 dynamic fluorescence quenching evidence used in automatic assertion true true A type of dynamic fluorescence quenching evidence that is used in an automatic assertion. ECO:SN A type of static fluorescence quenching evidence that is used in a manual assertion. DisProt:BalintMeszaros snadendla quenching eco ECO:0006329 static fluorescence quenching evidence used in manual assertion true true A type of static fluorescence quenching evidence that is used in a manual assertion. ECO:SN A type of static fluorescence quenching evidence that is used in an automatic assertion. DisProt:BalintMeszaros snadendla quenching eco ECO:0006330 static fluorescence quenching evidence used in automatic assertion true true A type of static fluorescence quenching evidence that is used in an automatic assertion. ECO:SN A type of high throughput evidence derived from high throughput analysis of differences in alleles of a corresponding gene. GOC rctauber 2017-10-05T07:39:47Z high throughput mutant phenotype evidence eco ECO:0007000 high throughput mutant phenotypic evidence A type of high throughput evidence derived from high throughput analysis of differences in alleles of a corresponding gene. GO:IMP HMP A type of high throughput mutant phenotypic evidence that is used in a manual assertion. GOC rctauber 2017-10-05T07:39:47Z GOECO:HMP HMP high throughput mutant phenotype evidence used in manual assertion inferred from high throughput mutant phenotype eco ECO:0007001 When using the HMP evidence code, the guidelines for IMP should be adhered to (http://geneontology.org/page/imp-inferred-mutant-phenotype) high throughput mutant phenotypic evidence used in manual assertion true true HMP Default A type of high throughput mutant phenotypic evidence that is used in a manual assertion. GO:IMP GOECO:HMP inferred from high throughput mutant phenotype HMP GOECO:HMP inferred from high throughput mutant phenotype GOECO:HMP A type of high throughput evidence resulting from the high throughput analysis of the effect that a given gene has on another gene or genes, and products. GOC rctauber 2017-10-05T07:39:47Z high throughput genetic interaction evidence eco ECO:0007002 high throughput genetic interaction phenotypic evidence A type of high throughput evidence resulting from the high throughput analysis of the effect that a given gene has on another gene or genes, and products. PMID:11822023 HGI A type of high throughput genetic interaction phenotypic evidence that is used in a manual assertion. GOC rctauber 2017-10-05T07:39:47Z GOECO:HGI HGI high throughput genetic interaction evidence used in manual assertion inferred from high throughput genetic interaction eco ECO:0007003 When using the HGI evidence code, the guidelines for IGI should be adhered to (http://geneontology.org/page/igi-inferred-genetic-interaction) high throughput genetic interaction phenotypic evidence used in manual assertion true true HGI Default A type of high throughput genetic interaction phenotypic evidence that is used in a manual assertion. PMID:11822023 GOECO:HGI inferred from high throughput genetic interaction HGI GOECO:HGI inferred from high throughput genetic interaction GOECO:HGI A type of high throughput evidence derived from the high throughput direct measurement of some aspect of a biological feature. GOC rctauber 2017-10-05T07:39:47Z eco ECO:0007004 high throughput direct assay evidence A type of high throughput evidence derived from the high throughput direct measurement of some aspect of a biological feature. ECO:MCC HDA A type of high throughput evidence that is used in a manual assertion derived from the high throughput direct measurement of some aspect of a biological feature. GOC rctauber 2017-10-05T07:39:47Z GOECO:HDA HDA inferred from high throughput direct assay eco ECO:0007005 When using the HDA evidence code, the guidelines for IDA should be adhered to (http://geneontology.org/page/ida-inferred-direct-assay) high throughput direct assay evidence used in manual assertion true true HDA Default A type of high throughput evidence that is used in a manual assertion derived from the high throughput direct measurement of some aspect of a biological feature. ECO:MCC GOECO:HDA inferred from high throughput direct assay HDA GOECO:HDA inferred from high throughput direct assay GOECO:HDA A type of high throughput evidence derived from the high throughput characterization of gene expression. GOC rctauber 2017-10-05T07:39:47Z eco ECO:0007006 high throughput expression pattern evidence A type of high throughput evidence derived from the high throughput characterization of gene expression. GO:IEP HEP A type of high throughput evidence that is used in a manual assertion derived from the high throughput characterization of gene expression. GOC rctauber 2017-10-05T07:39:47Z GOECO:HEP HEP inferred from high throughput expression pattern eco ECO:0007007 When using the HEP evidence code, the guidelines for EXP should be adhered to (http://geneontology.org/page/iep-inferred-expression-pattern) high throughput expression pattern evidence used in manual assertion true true HEP Default A type of high throughput evidence that is used in a manual assertion derived from the high throughput characterization of gene expression. GO:IEP GOECO:HEP inferred from high throughput expression pattern HEP GOECO:HEP inferred from high throughput expression pattern GOECO:HEP A type of protein binding evidence in which radioactive ligands are used to measure receptor-ligand interactions, such as in determining selectivity for a particular ligand. fjungo rctauber 2017-12-15T10:46:19Z radioactive ligand binding assay evidence radiometric ligand-binding assay evidence competitive binding assay evidence eco ECO:0007008 radioligand binding assay evidence A type of protein binding evidence in which radioactive ligands are used to measure receptor-ligand interactions, such as in determining selectivity for a particular ligand. PMID:27471749 IPI A type of radioligand binding assay evidence that is used in a manual assertion. rctauber 2017-12-15T10:48:44Z radioactive ligand binding assay evidence eco competitive binding assay evidence ECO:0007009 radioligand binding assay evidence used in manual assertion true A type of radioligand binding assay evidence that is used in a manual assertion. ECO:RCT A type of combinatorial evidence in which the author draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments. sbello rctauber 2018-02-15T11:17:11Z combinatorial evidence from author knowledge and experimental evidence eco ECO:0007011 combinatorial experimental and author inference evidence true A type of combinatorial evidence in which the author draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments. ECO:RCT A type of combinatorial evidence in which the curator draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments. ZFIN rctauber 2018-02-15T11:17:11Z combinatorial evidence from curator knowledge and experimental evidence eco ECO:0007012 combinatorial experimental and curator inference evidence true A type of combinatorial evidence in which the curator draws a conclusion based on a combination of prior scientific background knowledge and evidence from one or more experiments. ECO:RCT A type of combinatorial evidence from author knowledge and experimental evidence that is used in a manual assertion. rctauber 2018-02-15T11:22:10Z combinatorial evidence from author knowledge and experimental evidence used in manual assertion eco ECO:0007013 combinatorial experimental and author inference evidence used in manual assertion true A type of combinatorial evidence from author knowledge and experimental evidence that is used in a manual assertion. ECO:RCT A type of combinatorial evidence from curator knowledge and experimental evidence that is used in a manual assertion. rctauber 2018-02-15T11:22:10Z combinatorial evidence from curator knowledge and experimental evidence used in manual assertion eco ECO:0007014 combinatorial experimental and curator inference evidence used in manual assertion true A type of combinatorial evidence from curator knowledge and experimental evidence that is used in a manual assertion. ECO:RCT A type of substance quantification evidence where an electrical gradient potential is applied to analyze an analyte of interest, resulting in a measurement amount of electrical current across the potential range applied. SynGO rctauber 2018-02-28T12:11:00Z eco ECO:0007015 voltammetry evidence A type of substance quantification evidence where an electrical gradient potential is applied to analyze an analyte of interest, resulting in a measurement amount of electrical current across the potential range applied. PMID:28127962 IDA A type of voltammetry evidence that is used in a manual assertion. rctauber 2018-02-28T12:12:34Z eco ECO:0007016 voltammetry evidence used in manual assertion true A type of voltammetry evidence that is used in a manual assertion. ECO:RCT A type of fluorescence evidence where a molecule tagged with a fluorescent protein is exposed to ultraviolet or blue light to shift the spectral emission properties for visualization. SynGO rctauber 2018-03-02T09:01:00Z eco ECO:0007017 photoconversion evidence A type of fluorescence evidence where a molecule tagged with a fluorescent protein is exposed to ultraviolet or blue light to shift the spectral emission properties for visualization. ECO:RCT PMID:28574633 IDA A type of photoconversion evidence that is used in a manual assertion. rctauber 2018-03-02T09:05:04Z eco ECO:0007018 photoconversion evidence used in manual assertion true A type of photoconversion evidence that is used in a manual assertion. ECO:RCT A type of immunological assay evidence that involves observation of visible clumping of antibody and antigen into a complex. OMP snadendla 2018-03-14T12:44:11Z agglutination assay evidence ECO:0007019 agglutination test evidence A type of immunological assay evidence that involves observation of visible clumping of antibody and antigen into a complex. URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC380037/ IPI A type of agglutination test evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z agglutination assay evidence ECO:0007020 agglutination test evidence used in manual assertion true A type of agglutination test evidence that is used in a manual assertion. ECO:RCT A type of agglutination test evidence that involves observaiton of visible clumping of antibody and antigen into a complex on a slide. OMP snadendla 2018-03-14T12:44:11Z ECO:0007021 slide agglutination test evidence A type of agglutination test evidence that involves observaiton of visible clumping of antibody and antigen into a complex on a slide. URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC380037/ IPI A type of slide agglutination test evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007022 slide agglutination test evidence used in manual assertion true A type of slide agglutination test evidence that is used in a manual assertion. ECO:RCT A type of agglutination test evidence that results in detection of nonagglutinating antibodies or complement proteins on red blood cells in vivo. OMP snadendla 2018-03-14T12:44:11Z direct antihuman globulin test (DAT) ECO:0007023 direct Coombs test evidence A type of agglutination test evidence that results in detection of nonagglutinating antibodies or complement proteins on red blood cells in vivo. URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/ IPI A type of direct Coombs test evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z direct antihuman globulin test (DAT) ECO:0007024 direct Coombs test evidence used in manual assertion true A type of direct Coombs test evidence that is used in a manual assertion. ECO:RCT A type of agglutination test evidence that results in screening of antibodies against red blood cell antigens (other than the A and B antigens) that are unbound in a patient's serum in vitro. OMP snadendla 2018-03-14T12:44:11Z indirect antiglobulin test (IAT) ECO:0007025 indirect Coombs test evidence A type of agglutination test evidence that results in screening of antibodies against red blood cell antigens (other than the A and B antigens) that are unbound in a patient's serum in vitro. URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/ IPI A type of indirect Coombs test evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z indirect antiglobulin test (IAT) ECO:0007026 indirect Coombs test evidence used in manual assertion true A type of indirect Coombs test evidence that is used in a manual assertion. ECO:RCT A type of agglutination test evidence where some bacteria and viruses cross-link red blood cells and clump together. OMP snadendla 2018-03-14T12:44:11Z ECO:0007027 direct hemagglutination assay evidence A type of agglutination test evidence where some bacteria and viruses cross-link red blood cells and clump together. URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/ IPI A type of direct hemagglutination assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007028 direct hemagglutination assay evidence used in manual assertion true A type of direct hemagglutination assay evidence that is used in a manual assertion. ECO:RCT A type of agglutination test evidence where antiviral antibodies in a patient's serum or in a lab-produced antiserum neutralize the virus and block it from agglutinating the red blood cells. OMP snadendla 2018-03-14T12:44:11Z ECO:0007029 viral hemagglutination inhibition assay evidence A type of agglutination test evidence where antiviral antibodies in a patient's serum or in a lab-produced antiserum neutralize the virus and block it from agglutinating the red blood cells. URL:https://courses.lumenlearning.com/microbiology/chapter/agglutination-assays/ IPI A type of viral hemagglutination inhibition assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007030 viral hemagglutination inhibition assay evidence used in manual assertion true A type of viral hemagglutination inhibition assay evidence that is used in a manual assertion. ECO:RCT A type of immunological assay evidence that results in the detection of presence of specific antibodies in the patient's serum based on the use of complement, a biologically labile serum factor. OMP snadendla 2018-03-14T12:44:11Z ECO:0007031 compement fixation assay evidence A type of immunological assay evidence that results in the detection of presence of specific antibodies in the patient's serum based on the use of complement, a biologically labile serum factor. URL:http://laboratoryinfo.com/complement-fixation-test/ IPI A type of compement fixation assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007032 compement fixation assay evidence used in manual assertion true A type of compement fixation assay evidence that is used in a manual assertion. ECO:RCT A type of immunogical assay evidence that results in detection of specific neutralizing antibodies in a sample. OMP snadendla 2018-03-14T12:44:11Z ECO:0007033 neutralization test assay evidence A type of immunogical assay evidence that results in detection of specific neutralizing antibodies in a sample. PMID:24899440 url:http://www.creative-biolabs.com/drug-discovery/therapeutics/neutralization-assay.htm?gclid=Cj0KEQjwqvvLBRDIt-D7q7iqiOcBEiQAxi68ERRz00a0x9sWSKSLDu7d5-kMi4AdiLNdUq1mXzePdywaArli8P8HAQ) IPI A type of neutralization test assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007034 neutralization test assay evidence used in manual assertion true A type of neutralization test assay evidence that is used in a manual assertion. ECO:RCT A type of transport assay evidence where the rate of copper transport is estimated. OMP snadendla 2018-03-14T12:44:11Z ECO:0007035 copper transport assay evidence A type of transport assay evidence where the rate of copper transport is estimated. URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3689948/ IDA A type of copper transport assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007036 copper transport assay evidence used in manual assertion true A type of copper transport assay evidence that is used in a manual assertion. ECO:RCT A type of staining evidence that involves the use of the redox dye 5-cyano-2,3-ditolyl tetrazolium chloride to evaluate the respiratory activity of cells. OMP snadendla 2018-03-14T12:44:11Z CTC staining ECO:0007037 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence A type of staining evidence that involves the use of the redox dye 5-cyano-2,3-ditolyl tetrazolium chloride to evaluate the respiratory activity of cells. PMID:1622256 IDA A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z CTC staining ECO:0007038 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence used in manual assertion true A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in a manual assertion. ECO:RCT A type of cell growth assay evidence resulting in direct quantification of infectious virons and antiviral substances through the counting of discrete plaques (infectious units and cellular dead zones) in cell culture. OMP snadendla 2018-03-14T12:44:11Z ECO:0007039 plaque assay evidence A type of cell growth assay evidence resulting in direct quantification of infectious virons and antiviral substances through the counting of discrete plaques (infectious units and cellular dead zones) in cell culture. PMID:25407402 IDA A type of plaque assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007040 plaque assay evidence used in manual assertion true A type of plaque assay evidence that is used in a manual assertion. ECO:RCT A type of fluorescence microscopy evidence where the light source is mounted above the specimen and the excitation light passes through the microscope objective lens on its way toward the specimen. OMP snadendla 2018-03-14T12:44:11Z ECO:0007041 epifluorescence microscopy evidence A type of fluorescence microscopy evidence where the light source is mounted above the specimen and the excitation light passes through the microscope objective lens on its way toward the specimen. URL:http://www.rsc.org/publishing/journals/prospect/ontology.asp?id=CMO:0001096|URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4713126/ IDA A type of epifluorescence microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007042 epifluorescence microscopy evidence used in manual assertion true A type of epifluorescence microscopy evidence that is used in a manual assertion. ECO:RCT A type of electron microscopy evidence where a beam of electrons are transmitted through an ultra thin specimen forming an image which is magnified and focused onto an imaging device, such as a fluorescent screen, on a layer of photographic film, or to be detected by a sensor such as a CCD camera. OMP snadendla 2018-03-14T12:44:11Z TEM conventional transmission electron microscopy(CTEM) ECO:0007043 transmission electron microscopy evidence A type of electron microscopy evidence where a beam of electrons are transmitted through an ultra thin specimen forming an image which is magnified and focused onto an imaging device, such as a fluorescent screen, on a layer of photographic film, or to be detected by a sensor such as a CCD camera. ERO:0000329|URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3907272/ IDA A type of transmission electron microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z TEM conventional transmission electron microscopy(CTEM) ECO:0007044 transmission electron microscopy evidence used in manual assertion true A type of transmission electron microscopy evidence that is used in a manual assertion. ECO:RCT With a general growth of the recombinant mycobacterial strains resulting in minimal change, the cell morphology was further examined using the scanning electron microscopy (SEM) technique. As shown in Fig. 5B, the cell lengthened when 20 ng/mL tetracycline was added to the medium to induce expression of the antisense mtrA mRNA (right panel). A type of electron microscopy evidence where a focused beam of high-energy electrons is used to generate a variety of signals at the surface of solid specimens. OMP snadendla 2018-03-14T12:44:11Z ECO:0007045 scanning electron microscopy evidence With a general growth of the recombinant mycobacterial strains resulting in minimal change, the cell morphology was further examined using the scanning electron microscopy (SEM) technique. As shown in Fig. 5B, the cell lengthened when 20 ng/mL tetracycline was added to the medium to induce expression of the antisense mtrA mRNA (right panel). PMID:20843371 A type of electron microscopy evidence where a focused beam of high-energy electrons is used to generate a variety of signals at the surface of solid specimens. URL:https://serc.carleton.edu/research_education/geochemsheets/techniques/SEM.html IDA A type of scanning electron microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007046 scanning electron microscopy evidence used in manual assertion true A type of scanning electron microscopy evidence that is used in a manual assertion. ECO:RCT A type of microscopy evidence where a serial images are taken at regular time points to capture the dynamics of what is being observed. OMP snadendla 2018-03-14T12:44:11Z ECO:0007047 time-lapsed microscopy evidence A type of microscopy evidence where a serial images are taken at regular time points to capture the dynamics of what is being observed. URL:https://www.nature.com/subjects/time-lapse-imaging IDA A type of time-lapsed microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007048 time-lapsed microscopy evidence used in manual assertion true A type of time-lapsed microscopy evidence that is used in a manual assertion. ECO:RCT A type of microscopy evidence where a transparent specimen is illuminated with visible light and small phase shifts in the light passing through the specimen are used to produce an image. OMP snadendla 2018-03-14T12:44:11Z ECO:0007049 phase contrast microscopy evidence A type of microscopy evidence where a transparent specimen is illuminated with visible light and small phase shifts in the light passing through the specimen are used to produce an image. CHMO:0000110 IDA A type of phase contrast microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007050 phase contrast microscopy evidence used in manual assertion true A type of phase contrast microscopy evidence that is used in a manual assertion. ECO:RCT A type of microscopy evidence where a sample is illuminated with transmitted white light from below and observed from above. OMP snadendla 2018-03-14T12:44:11Z ECO:0007051 transmitted light brightfied mircoscopy evidence A type of microscopy evidence where a sample is illuminated with transmitted white light from below and observed from above. BAO:0000457 IDA A type of transmitted light brightfied mircoscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007052 transmitted light brightfied mircoscopy evidence used in manual assertion true A type of transmitted light brightfied mircoscopy evidence that is used in a manual assertion. ECO:RCT A type of microscopy evidence that results in a bright image without glare and minimum heating of the specimen by employing both field and an aperture iris diaphragm for illumination. OMP snadendla 2018-03-14T12:44:11Z ECO:0007053 koehler illumination microscopy evidence A type of microscopy evidence that results in a bright image without glare and minimum heating of the specimen by employing both field and an aperture iris diaphragm for illumination. URL:http://www.gonda.ucla.edu/bri_core/kohler.htm IDA A type of koehler illumination microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007054 koehler illumination microscopy evidence used in manual assertion true A type of koehler illumination microscopy evidence that is used in a manual assertion. ECO:RCT A type of microscopy evidence that results in visualization of living cells and transparent specimens by taking advantage of differences in the light refraction of different parts of the specimen. OMP snadendla 2018-03-14T12:44:11Z DIC microscopy NIC microscopy Nomarski interference contrast microscopy Nomarski microscopy ECO:0007055 differential interference contrast microscopy evidence A type of microscopy evidence that results in visualization of living cells and transparent specimens by taking advantage of differences in the light refraction of different parts of the specimen. URL:http://www.microscopemaster.com/differential-interference-contrast.html IDA A type of differential interference contrast microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z DIC microscopy NIC microscopy Nomarski interference contrast microscopy Nomarski microscopy ECO:0007056 differential interference contrast microscopy evidence used in manual assertion true A type of differential interference contrast microscopy evidence that is used in a manual assertion. ECO:RCT A type of confocal microscopy evidence that results in creation of a continuous confocal multi-colour mosaic from thousands of individually captured images. OMP snadendla 2018-03-14T12:44:11Z EFLCM ECO:0007057 extended field laser confocal microscopy evidence A type of confocal microscopy evidence that results in creation of a continuous confocal multi-colour mosaic from thousands of individually captured images. PMID:18627634 IDA A type of extended field laser confocal microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z EFLCM ECO:0007058 extended field laser confocal microscopy evidence used in manual assertion true A type of extended field laser confocal microscopy evidence that is used in a manual assertion. ECO:RCT A type of confocal microscopy evidence that results in an image that is built up pixel-by-pixel by collecting the emitted photons from the fluorophores in the sample by passing a laser beam through a light source aperture which is then focused by an objective lens into a small area on the surface of the sample. OMP snadendla 2018-03-14T12:44:11Z CLSM LSCM confocal laser scanning fluorescence microscopy confocal-laser scanning microscopy fluorescence confocal scanning laser microscopy scanning confocal fluorescence microscopy ECO:0007059 confocal laser scanning microscopy evidence A type of confocal microscopy evidence that results in an image that is built up pixel-by-pixel by collecting the emitted photons from the fluorophores in the sample by passing a laser beam through a light source aperture which is then focused by an objective lens into a small area on the surface of the sample. URL:http://bitesizebio.com/19958/what-is-confocal-laser-scanning-microscopy/ IDA A type of confocal laser scanning microscopy evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z CLSM LSCM confocal laser scanning fluorescence microscopy confocal-laser scanning microscopy fluorescence confocal scanning laser microscopy scanning confocal fluorescence microscopy ECO:0007060 confocal laser scanning microscopy evidence used in manual assertion true A type of confocal laser scanning microscopy evidence that is used in a manual assertion. ECO:RCT A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by illuminating the sample with a laser beam and the scattered intensity is probed at a certain angle by a detector. OMP snadendla 2018-03-14T12:44:11Z ECO:0007061 light scattering evidence A type of structure determination evidence derived from determining the properties of particles in a solution such as size, shape, structure, molecular weight, diffusion and interaction strength by illuminating the sample with a laser beam and the scattered intensity is probed at a certain angle by a detector. PMID:9013660 url:http://www.lsinstruments.ch/technology/dynamic_light_scattering_dls/ url:http://www.soft-matter.uni-tuebingen.de/index.html?dls.html EXP A type of light scattering evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007062 light scattering evidence used in manual assertion true A type of light scattering evidence that is used in a manual assertion. ECO:RCT A type of light scattering evidence derived by analyzing the fluctuations in the internsity of the scattered light by the particles in motion. OMP snadendla 2018-03-14T12:44:11Z Photon Correlation Spectroscopy Quasi-Elastic Light Scattering ECO:0007063 dynamic light scattering assay evidence A type of light scattering evidence derived by analyzing the fluctuations in the internsity of the scattered light by the particles in motion. PMID:9013660 url:http://www.soft-matter.uni-tuebingen.de/index.html?dls.html EXP A type of dynamic light scattering assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z Photon Correlation Spectroscopy Quasi-Elastic Light Scattering ECO:0007064 dynamic light scattering assay evidence used in manual assertion true A type of dynamic light scattering assay evidence that is used in a manual assertion. ECO:RCT A type of light scattering evidence derived by measuring the average intensity of scattered light by the particles at multiple angles. OMP snadendla 2018-03-14T12:44:11Z Rayleigh scattering ECO:0007065 static light scattering assay evidence A type of light scattering evidence derived by measuring the average intensity of scattered light by the particles at multiple angles. PMID:9013660 EXP A type of static light scattering assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z Rayleigh scattering ECO:0007066 static light scattering assay evidence used in manual assertion true A type of static light scattering assay evidence that is used in a manual assertion. ECO:RCT A type of colony morphology phenotypic evidence resulting from the formation of papillae (microcolonies) that protrude outwards from the main colony by mutant cells. OMP snadendla 2018-03-14T12:44:11Z colony papillation assay evidence ECO:0007067 colony papillation assay phenotypic evidence A type of colony morphology phenotypic evidence resulting from the formation of papillae (microcolonies) that protrude outwards from the main colony by mutant cells. PMID:27447898 EXP A type of colony papillation assay phenotypic evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z colony papillation assay evidence used in manual assertion ECO:0007068 colony papillation assay phenotypic evidence used in manual assertion true A type of colony papillation assay phenotypic evidence that is used in a manual assertion. ECO:RCT A type of staining evidence that is derived from the use of gentian violet as a general biological stain and an acid-base indicator. OMP snadendla 2018-03-14T12:44:11Z gentian violet hexamethyl pararosaniline chloride methyl violet 10B ECO:0007069 crystal violet staining evidence A type of staining evidence that is derived from the use of gentian violet as a general biological stain and an acid-base indicator. BAO:0002468 IDA A type of crystal violet staining evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z gentian violet hexamethyl pararosaniline chloride methyl violet 10B ECO:0007070 crystal violet staining evidence used in manual assertion true A type of crystal violet staining evidence that is used in a manual assertion. ECO:RCT A type of biofilm formation assay evidence derived from in vitro cultivation and evaluation of bacterial biofilms under hydrodynamic conditions of flow. OMP snadendla 2018-03-14T12:44:11Z ECO:0007071 flow cell biofilm assay evidence A type of biofilm formation assay evidence derived from in vitro cultivation and evaluation of bacterial biofilms under hydrodynamic conditions of flow. URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3438488/ IDA A type of flow cell biofilm assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007072 flow cell biofilm assay evidence used in manual assertion true A type of flow cell biofilm assay evidence that is used in a manual assertion. ECO:RCT A type of bait-prey hybrid interaction evidence that involves the detection of protein-protein interaction by fusing the protein target (the "bait") to RNA polymerase and fusing protein or peptide library to be analyzed (the "prey") to DNA-binding domain. OMP snadendla 2018-03-14T12:44:11Z ECO:0007073 bacterial 2-hybrid assay evidence A type of bait-prey hybrid interaction evidence that involves the detection of protein-protein interaction by fusing the protein target (the "bait") to RNA polymerase and fusing protein or peptide library to be analyzed (the "prey") to DNA-binding domain. URL:http://www.pnas.org/content/97/13/7382.full.pdf IPI A type of bacterial 2-hybrid assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007074 bacterial 2-hybrid assay evidence used in manual assertion true A type of bacterial 2-hybrid assay evidence that is used in a manual assertion. ECO:RCT A type of experimental phenotypic evidence that results from the comparison of phenotype profiles (the physical and biochemical traits of organisms in particular environments) across multiple strains; that is, a meta-analysis of a set of phenotypic patterns from many tests in response to a series of changing genetic and/or environmental factors. OMP snadendla 2018-03-14T12:44:11Z ECO:0007075 A phenome is defined as the SET of physical and biochemical traits, or, as the SET of all phenotypes expressed, i.e. a phenome is defined as the sum total of all phenotypic traits. D.S. notes: I think this term is meant to be used for high throughput experiments where a large number of mutants is screened for their ability to grow in a large number of conditions. The individual mutants can then clustered based on the similarity of their phenotypic profiles-whether they grew or didn't grow across all the conditions. The goal being to try to identify genes whose products function in the same biological pathways based on their having similar phenotypes across multiple conditions. phenomic profiling assay evidence A type of experimental phenotypic evidence that results from the comparison of phenotype profiles (the physical and biochemical traits of organisms in particular environments) across multiple strains; that is, a meta-analysis of a set of phenotypic patterns from many tests in response to a series of changing genetic and/or environmental factors. EDAM:topic:3298 PMID:2118507 EXP A type of phenomic profiling assay evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007076 phenomic profiling assay evidence used in manual assertion true A type of phenomic profiling assay evidence that is used in a manual assertion. ECO:RCT A type of experimental phenotypic evidence resulting from studying the physical characteristics of an assemblage of microorganisms growing on a solid surface such as the surface of an agar culture medium. OMP snadendla 2018-03-14T12:44:11Z colony morphology evidence ECO:0007077 colony morphology phenotypic evidence A type of experimental phenotypic evidence resulting from studying the physical characteristics of an assemblage of microorganisms growing on a solid surface such as the surface of an agar culture medium. OMP:0000100 EXP A type of colony morphology phenotypic evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z colony morphology evidence used in manual assertion ECO:0007078 colony morphology phenotypic evidence used in manual assertion true A type of colony morphology phenotypic evidence that is used in a manual assertion. ECO:RCT A type of colony morphology evidence resulting from studying the colony pigmentation. OMP snadendla 2018-03-14T12:44:11Z colony color evidence colony pigmentation ECO:0007079 colony color phenotypic evidence A type of colony morphology evidence resulting from studying the colony pigmentation. URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4671912/ EXP A type of colony color phenotypic evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z colony pigmentation colony color evidence used in manual assertion ECO:0007080 colony color phenotypic evidence used in manual assertion true A type of colony color phenotypic evidence that is used in a manual assertion. ECO:RCT A type of colony morphology phenotypic evidence resulting from measuring the area or diameter of the colony. OMP snadendla 2018-03-14T12:44:11Z colony size evidence ECO:0007081 colony size phenotypic evidence A type of colony morphology phenotypic evidence resulting from measuring the area or diameter of the colony. URL:http://www.nature.com/nrmicro/journal/v4/n4/full/nrmicro1384.html EXP A type of colony size phenotypic evidence that is used in an manual assertion. OMP rctauber 2018-03-14T12:44:11Z colony size evidence used in manual assertion colony area phenotype evidence colony diameter phenotype evidence ECO:0007082 colony size phenotypic evidence used in manual assertion true A type of colony size phenotypic evidence that is used in an manual assertion. ECO:RCT A type of cell growth assay evidence resulting from assessing the sensitivity or resistance of bacteria or fungi to an antimicrobial agent or chemical by measuring the size of the zone of inhibition that results when the test organism is grown on a solid surface in the presence of the antimicrobial agent or chemical. OMP snadendla 2018-03-14T12:44:11Z ECO:0007083 zone of inhibition evidence A type of cell growth assay evidence resulting from assessing the sensitivity or resistance of bacteria or fungi to an antimicrobial agent or chemical by measuring the size of the zone of inhibition that results when the test organism is grown on a solid surface in the presence of the antimicrobial agent or chemical. URL:https://www.ncbi.nlm.nih.gov/pmc/articles/PMC153338/ IDA A type of zone of inhibition evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z ECO:0007084 zone of inhibition evidence used in manual assertion true A type of zone of inhibition evidence that is used in a manual assertion. ECO:RCT A type of zone of inhibition evidence resulting from testing the antimicrobial susceptibility by using predefined, continuous, and exponential gradient of antibiotic concentrations immobilized along a rectangular plastic test strip. OMP snadendla 2018-03-14T12:44:11Z epsilometer test ECO:0007085 Etest evidence A type of zone of inhibition evidence resulting from testing the antimicrobial susceptibility by using predefined, continuous, and exponential gradient of antibiotic concentrations immobilized along a rectangular plastic test strip. URL:http://www.joponline.org/doi/pdf/10.1902/jop.1992.63.7.576 IDA A type of Etest evidence that is used in a manual assertion. OMP rctauber 2018-03-14T12:44:11Z epsilometer test ECO:0007086 Etest evidence used in manual assertion true A type of Etest evidence that is used in a manual assertion. ECO:RCT A type of expression pattern evidence in which translation is measured by the positions of ribosomes active in a cell, identified through deep sequencing of ribosome-protected mRNA fragments. GOC:VW rctauber 2018-03-28T10:27:09Z ribo-seq evidence ribosome footprinting evidence translation profiling translatome profiling eco ECO:0007087 ribosome profiling evidence A type of expression pattern evidence in which translation is measured by the positions of ribosomes active in a cell, identified through deep sequencing of ribosome-protected mRNA fragments. PMID:27015305 IEP A type of ribosome profiling evidence that is used in a manual assertion. rctauber 2018-03-28T10:33:26Z ribo-seq evidence ribosome footprinting evidence eco ECO:0007087 ribosome profiling evidence used in manual assertion true A type of ribosome profiling evidence that is used in a manual assertion. ECO:RCT IMP A type of loss-of-function mutant phenotype evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007089 loss-of-function mutant phenotype evidence used in manual assertion true true A type of loss-of-function mutant phenotype evidence that is used in a manual assertion. ECO:RCT A type of structural similarity evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007090 structural similarity evidence used in manual assertion true true A type of structural similarity evidence that is used in a manual assertion. ECO:RCT IMP A type of gain-of-function mutant phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z gain-of-function mutant phenotype evidence used in manual assertion eco ECO:0007092 gain-of-function mutant phenotypic evidence used in manual assertion true true A type of gain-of-function mutant phenotypic evidence that is used in a manual assertion. ECO:RCT EXP A type of voucher specimen phenotypic analysis evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z voucher specimen analysis evidence used in manual assertion eco ECO:0007093 voucher specimen phenotypic analysis evidence used in manual assertion true true A type of voucher specimen phenotypic analysis evidence that is used in a manual assertion. ECO:RCT A type of positional similarity evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007094 positional similarity evidence used in manual assertion true true A type of positional similarity evidence that is used in a manual assertion. ECO:RCT EXP A type of quantitative trait analysis evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007095 quantitative trait analysis evidence used in manual assertion true true A type of quantitative trait analysis evidence that is used in a manual assertion. ECO:RCT A type of compositional similarity evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007096 compositional similarity evidence used in manual assertion true true A type of compositional similarity evidence that is used in a manual assertion. ECO:RCT A type of developmental similarity evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007097 developmental similarity evidence used in manual assertion true true A type of developmental similarity evidence that is used in a manual assertion. ECO:RCT A type of morphological similarity evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007098 morphological similarity evidence used in manual assertion true true A type of morphological similarity evidence that is used in a manual assertion. ECO:RCT A type of gene expression similarity evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007099 gene expression similarity evidence used in manual assertion true true A type of gene expression similarity evidence that is used in a manual assertion. ECO:RCT IDA A type of methylation-specific polymerase chain reaction evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007100 methylation-specific polymerase chain reaction evidence used in manual assertion true true A type of methylation-specific polymerase chain reaction evidence that is used in a manual assertion. ECO:RCT EXP A type of southern hybridization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007101 southern hybridization evidence used in manual assertion true true A type of southern hybridization evidence that is used in a manual assertion. ECO:RCT IDA A type of intermethylated site amplification evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007102 intermethylated site amplification evidence used in manual assertion true true A type of intermethylated site amplification evidence that is used in a manual assertion. ECO:RCT IDA A type of epitope-tagged protein immunolocalization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007103 epitope-tagged protein immunolocalization evidence used in manual assertion true true A type of epitope-tagged protein immunolocalization evidence that is used in a manual assertion. ECO:RCT IDA A type of co-fractionation evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007104 co-fractionation evidence used in manual assertion true true A type of co-fractionation evidence that is used in a manual assertion. ECO:RCT IDA A type of green fluorescent protein fusion protein localization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007106 green fluorescent protein fusion protein localization evidence used in manual assertion true true A type of green fluorescent protein fusion protein localization evidence that is used in a manual assertion. ECO:RCT IDA A type of yellow fluorescent protein fusion protein localization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007107 yellow fluorescent protein fusion protein localization evidence used in manual assertion true true A type of yellow fluorescent protein fusion protein localization evidence that is used in a manual assertion. ECO:RCT IDA A type of beta-glucuronidase fusion protein localization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007108 beta-glucuronidase fusion protein localization evidence used in manual assertion true true A type of beta-glucuronidase fusion protein localization evidence that is used in a manual assertion. ECO:RCT IDA A type of beta-galactosidase fusion protein localization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007109 beta-galactosidase fusion protein localization evidence used in manual assertion true true A type of beta-galactosidase fusion protein localization evidence that is used in a manual assertion. ECO:RCT EXP A type of thin layer chromatography evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007110 thin layer chromatography evidence used in manual assertion true true A type of thin layer chromatography evidence that is used in a manual assertion. ECO:RCT IDA A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007111 in vitro recombinant protein transcription reconstitution assay evidence used in manual assertion true true A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in a manual assertion. ECO:RCT IDA A type of protein separation followed by direct sequencing evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007112 protein separation followed by direct sequencing evidence used in manual assertion true true A type of protein separation followed by direct sequencing evidence that is used in a manual assertion. ECO:RCT IDA A type of protein separation followed by fragment identification evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007113 protein separation followed by fragment identification evidence used in manual assertion true true A type of protein separation followed by fragment identification evidence that is used in a manual assertion. ECO:RCT IDA A type of heterologous system uptake evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007114 heterologous system uptake evidence used in manual assertion true true A type of heterologous system uptake evidence that is used in a manual assertion. ECO:RCT IDA A type of two-electrode voltage clamp recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007115 two-electrode voltage clamp recording evidence used in manual assertion true true A type of two-electrode voltage clamp recording evidence that is used in a manual assertion. ECO:RCT EXP A type of biochemical trait analysis evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007116 biochemical trait analysis evidence used in manual assertion true true A type of biochemical trait analysis evidence that is used in a manual assertion. ECO:RCT IMP A type of mutant physiological response evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007117 mutant physiological response evidence used in manual assertion true true A type of mutant physiological response evidence that is used in a manual assertion. ECO:RCT IMP A type of mutant visible phenotype evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007118 mutant visible phenotype evidence used in manual assertion true true A type of mutant visible phenotype evidence that is used in a manual assertion. ECO:RCT IDA A type of in vivo assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007119 in vivo assay evidence used in manual assertion true true A type of in vivo assay evidence that is used in a manual assertion. ECO:RCT EXP A type of animal model system study evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007120 animal model system study evidence used in manual assertion true true A type of animal model system study evidence that is used in a manual assertion. ECO:RCT EXP A type of clinical study evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007121 clinical study evidence used in manual assertion true true A type of clinical study evidence that is used in a manual assertion. ECO:RCT IDA A type of in vitro assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007122 in vitro assay evidence used in manual assertion true true A type of in vitro assay evidence that is used in a manual assertion. ECO:RCT IDA A type of enzyme inhibition evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007123 enzyme inhibition evidence used in manual assertion true true true A type of enzyme inhibition evidence that is used in a manual assertion. ECO:RCT EXP A type of Illumina sequencing evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007125 Illumina sequencing evidence used in manual assertion true true A type of Illumina sequencing evidence that is used in a manual assertion. ECO:RCT EXP A type of 454 pyrosequencing evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007126 454 pyrosequencing evidence used in manual assertion true true A type of 454 pyrosequencing evidence that is used in a manual assertion. ECO:RCT EXP A type of SOLiD sequencing evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007127 SOLiD sequencing evidence used in manual assertion true true A type of SOLiD sequencing evidence that is used in a manual assertion. ECO:RCT EXP A type of chain termination sequencing evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007128 chain termination sequencing evidence used in manual assertion true true A type of chain termination sequencing evidence that is used in a manual assertion. ECO:RCT IPI A type of chromatin immunoprecipitation-qPCR evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007129 chromatin immunoprecipitation-qPCR evidence used in manual assertion true true A type of chromatin immunoprecipitation-qPCR evidence that is used in a manual assertion. ECO:RCT EXP A type of 4C evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z circularized chromosome conformation capture evidence used in manual assertion eco ECO:0007130 4C evidence used in manual assertion true true A type of 4C evidence that is used in a manual assertion. ECO:RCT EXP A type of 5C evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z carbon-copy chromosome conformation capture evidence used in manual assertion eco ECO:0007131 5C evidence used in manual assertion true true A type of 5C evidence that is used in a manual assertion. ECO:RCT EXP A type of 3C-qPCR evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z chromosome conformation capture-qPCR evidence used in manual assertion eco ECO:0007133 3C-qPCR evidence used in manual assertion true true A type of 3C-qPCR evidence that is used in a manual assertion. ECO:RCT EXP A type of Hi-C evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007134 Hi-C evidence used in manual assertion true true A type of Hi-C evidence that is used in a manual assertion. ECO:RCT EXP A type of 3C-seq evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z chromosome conformation capture sequencing evidence used in manual assertion eco ECO:0007135 3C-seq evidence used in manual assertion true true A type of 3C-seq evidence that is used in a manual assertion. ECO:RCT EXP A type of environmental perturbation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z environmental perturbation evidence used in manual assertion eco ECO:0007136 environmental perturbation phenotypic evidence used in manual assertion true true A type of environmental perturbation phenotypic evidence that is used in a manual assertion. ECO:RCT EXP A type of tissue ablation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z tissue ablation evidence used in manual assertion eco ECO:0007137 tissue ablation phenotypic evidence used in manual assertion true true A type of tissue ablation phenotypic evidence that is used in a manual assertion. ECO:RCT EXP A type of tissue grafting phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z tissue grafting evidence used in manual assertion eco ECO:0007138 tissue grafting phenotypic evidence used in manual assertion true true A type of tissue grafting phenotypic evidence that is used in a manual assertion. ECO:RCT EXP A type of cytochalasin experiment evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007141 cytochalasin experiment evidence used in manual assertion true true A type of cytochalasin experiment evidence that is used in a manual assertion. ECO:RCT IDA A type of green fluorescent protein immunolocalization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007142 green fluorescent protein immunolocalization evidence used in manual assertion true true A type of green fluorescent protein immunolocalization evidence that is used in a manual assertion. ECO:RCT IDA A type of beta-galactosidase protein immunolocalization evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007143 beta-galactosidase protein immunolocalization evidence used in manual assertion true true A type of beta-galactosidase protein immunolocalization evidence that is used in a manual assertion. ECO:RCT IEP A type of cap analysis of gene expression evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007144 cap analysis of gene expression evidence used in manual assertion true true A type of cap analysis of gene expression evidence that is used in a manual assertion. ECO:RCT IEP A type of nano-cap analysis of gene expression evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007145 nano-cap analysis of gene expression evidence used in manual assertion true true A type of nano-cap analysis of gene expression evidence that is used in a manual assertion. ECO:RCT IDA A type of particle size and count assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007146 particle size and count assay evidence used in manual assertion true true A type of particle size and count assay evidence that is used in a manual assertion. ECO:RCT IDA A type of competitive growth assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007147 competitive growth assay evidence used in manual assertion true true A type of competitive growth assay evidence that is used in a manual assertion. ECO:RCT IDA A type of pulsed-field gel electrophoresis evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007148 pulsed-field gel electrophoresis evidence used in manual assertion true true A type of pulsed-field gel electrophoresis evidence that is used in a manual assertion. ECO:RCT IDA A type of two-dimensional agarose gel electrophoresis evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007149 two-dimensional agarose gel electrophoresis evidence used in manual assertion true true A type of two-dimensional agarose gel electrophoresis evidence that is used in a manual assertion. ECO:RCT EXP A type of plasmid maintenance assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007150 plasmid maintenance assay evidence used in manual assertion true true A type of plasmid maintenance assay evidence that is used in a manual assertion. ECO:RCT IDA A type of specific protein inhibition by antibody evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007151 specific protein inhibition by antibody evidence used in manual assertion true true A type of specific protein inhibition by antibody evidence that is used in a manual assertion. ECO:RCT ISA A type of single exon transcript confirmation via alignment evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007152 single exon transcript confirmation via alignment evidence used in manual assertion true true A type of single exon transcript confirmation via alignment evidence that is used in a manual assertion. ECO:RCT A type of phylogenetic distribution evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007153 phylogenetic distribution evidence used in manual assertion true true A type of phylogenetic distribution evidence that is used in a manual assertion. ECO:RCT IEP A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007154 differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) used in manual assertion true true A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in a manual assertion. ECO:RCT IEP A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007155 differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) used in manual assertion true true A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in a manual assertion. ECO:RCT EXP A type of biological target-disease association via drug that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007156 biological target-disease association via drug evidence used in manual assertion true true A type of biological target-disease association via drug that is used in a manual assertion. ECO:RCT IDA A type of cell staining evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007157 cell staining evidence used in manual assertion true true A type of cell staining evidence that is used in a manual assertion. ECO:RCT A type of visual sequence inspection evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007158 visual sequence inspection evidence used in manual assertion true A type of visual sequence inspection evidence that is used in a manual assertion. ECO:RCT IDA A type of ATP bioluminescence assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007159 ATP bioluminescence assay evidence used in manual assertion true true A type of ATP bioluminescence assay evidence that is used in a manual assertion. ECO:RCT IMP A type of missense mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z missense mutation evidence used in manual assertion eco ECO:0007160 missense mutation pohenotypic evidence used in manual assertion true true A type of missense mutation phenotypic evidence that is used in a manual assertion. ECO:RCT IMP A type of nonsense mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z nonsense mutation evidence used in manual assertion eco ECO:0007161 nonsense mutation phenotypic evidence used in manual assertion true true A type of nonsense mutation phenotypic evidence that is used in a manual assertion. ECO:RCT IMP A type of silent mutation evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007162 silent mutation evidence used in manual assertion true true A type of silent mutation evidence that is used in a manual assertion. ECO:RCT IMP A type of insertion mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z insertion mutation evidence used in manual assertion eco ECO:0007163 insertion mutation phenotypic evidence used in manual assertion true true A type of insertion mutation phenotypic evidence that is used in a manual assertion. ECO:RCT EXP A type of duplication mutation evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007164 duplication mutation evidence used in manual assertion true true A type of duplication mutation evidence that is used in a manual assertion. ECO:RCT IMP A type of frameshift mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z frameshift mutation evidence used in manual assertion eco ECO:0007165 frameshift mutation phenotypic evidence used in manual assertion true true A type of frameshift mutation phenotypic evidence that is used in a manual assertion. ECO:RCT IMP A type of repeat expansion mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z repeat expansion mutation evidence used in manual assertion eco ECO:0007166 repeat expansion mutation phenotypic evidence used in manual assertion true true A type of repeat expansion mutation phenotypic evidence that is used in a manual assertion. ECO:RCT IMP A type of splice site mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z splice site mutation evidence used in manual assertion eco ECO:0007167 splice site mutation phenotypic evidence used in manual assertion true true A type of splice site mutation phenotypic evidence that is used in a manual assertion. ECO:RCT IMP A type of translocation mutation phenotypic evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z translocation mutation evidence used in manual assertion eco ECO:0007168 translocation mutation phenotypic evidence used in manual assertion true true A type of translocation mutation phenotypic evidence that is used in a manual assertion. ECO:RCT IDA A type of in-gel protein kinase assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007169 in-gel protein kinase assay evidence used in manual assertion true true A type of in-gel protein kinase assay evidence that is used in a manual assertion. ECO:RCT IDA A type of macroscopic current trace evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007170 macroscopic current trace evidence used in manual assertion true true A type of macroscopic current trace evidence that is used in a manual assertion. ECO:RCT IDA A type of current density evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007171 current density evidence used in manual assertion true true A type of current density evidence that is used in a manual assertion. ECO:RCT IDA A type of sustained current evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007172 sustained current evidence used in manual assertion true true A type of sustained current evidence that is used in a manual assertion. ECO:RCT IDA A type of use dependence of inactivation evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007173 use dependence of inactivation evidence used in manual assertion true true A type of use dependence of inactivation evidence that is used in a manual assertion. ECO:RCT IDA A type of current clamp recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007174 current clamp recording evidence used in manual assertion true true A type of current clamp recording evidence that is used in a manual assertion. ECO:RCT IDA A type of whole-cell voltage clamp recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007175 whole-cell voltage clamp recording evidence used in manual assertion true true A type of whole-cell voltage clamp recording evidence that is used in a manual assertion. ECO:RCT IDA A type of cell-attached single-channel recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007176 cell-attached single-channel recording evidence used in manual assertion true true A type of cell-attached single-channel recording evidence that is used in a manual assertion. ECO:RCT IDA A type of cell-detached inside-out single-channel recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007177 cell-detached inside-out single-channel recording evidence used in manual assertion true true A type of cell-detached inside-out single-channel recording evidence that is used in a manual assertion. ECO:RCT IDA A type of reconstituted bilayer single-channel patch recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007178 reconstituted bilayer single-channel patch recording evidence used in manual assertion true true A type of reconstituted bilayer single-channel patch recording evidence that is used in a manual assertion. ECO:RCT IDA A type of electroencephalography recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007179 electroencephalography recording evidence used in manual assertion true true A type of electroencephalography recording evidence that is used in a manual assertion. ECO:RCT IDA A type of cell-detached outside-out single-channel recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007180 cell-detached outside-out single-channel recording evidence used in manual assertion true true A type of cell-detached outside-out single-channel recording evidence that is used in a manual assertion. ECO:RCT IDA A type of cut-open oocyte voltage clamp recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007181 cut-open oocyte voltage clamp recording evidence used in manual assertion true true A type of cut-open oocyte voltage clamp recording evidence that is used in a manual assertion. ECO:RCT IDA A type of macropatch voltage clamp recording evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007182 macropatch voltage clamp recording evidence used in manual assertion true true A type of macropatch voltage clamp recording evidence that is used in a manual assertion. ECO:RCT EXP A type of protein mass spectrometry evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007184 protein mass spectrometry evidence used in manual assertion true true A type of protein mass spectrometry evidence that is used in a manual assertion. ECO:RCT IDA A type of cross-streak test evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007185 cross-streak test evidence used in manual assertion true true A type of cross-streak test evidence that is used in a manual assertion. ECO:RCT IDA A type of tethered cell assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007186 tethered cell assay evidence used in manual assertion true true A type of tethered cell assay evidence that is used in a manual assertion. ECO:RCT IDA A type of tumble frequency assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007187 tumble frequency assay evidence used in manual assertion true true A type of tumble frequency assay evidence that is used in a manual assertion. ECO:RCT IDA A type of capillary assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007188 capillary assay evidence used in manual assertion true true A type of capillary assay evidence that is used in a manual assertion. ECO:RCT A type of inference from experimental data evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007189 inference from experimental data evidence used in manual assertion true A type of inference from experimental data evidence that is used in a manual assertion. ECO:RCT A type of inference from phenotype manipulation evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007190 inference from phenotype manipulation evidence used in manual assertion true A type of inference from phenotype manipulation evidence that is used in a manual assertion. ECO:RCT EXP A type of inference by association of genotype from phenotype that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007191 inference by association of genotype from phenotype used in manual assertion true A type of inference by association of genotype from phenotype that is used in a manual assertion. ECO:RCT IDA A type of motility assay evidence that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007192 motility assay evidence used in manual assertion true true A type of motility assay evidence that is used in a manual assertion. ECO:RCT IEA A type of loss-of-function mutant phenotype evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007193 loss-of-function mutant phenotype evidence used in automatic assertion true true A type of loss-of-function mutant phenotype evidence that is used in an automatic assertion. ECO:RCT IEA A type of structural similarity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007194 structural similarity evidence used in automatic assertion true true A type of structural similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of gain-of-function mutant phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z gain-of-function mutant phenotype evidence used in automatic assertion eco ECO:0007196 gain-of-function mutant phenotypic evidence used in automatic assertion true true A type of gain-of-function mutant phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of voucher specimen phenotypic analysis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z voucher specimen analysis evidence used in automatic assertion eco ECO:0007197 voucher specimen phenotypic analysis evidence used in automatic assertion true true A type of voucher specimen phenotypic analysis evidence that is used in an automatic assertion. ECO:RCT IEA A type of positional similarity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007198 positional similarity evidence used in automatic assertion true true A type of positional similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of quantitative trait analysis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007199 quantitative trait analysis evidence used in automatic assertion true true A type of quantitative trait analysis evidence that is used in an automatic assertion. ECO:RCT IEA A type of compositional similarity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007200 compositional similarity evidence used in automatic assertion true true A type of compositional similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of developmental similarity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007201 developmental similarity evidence used in automatic assertion true true A type of developmental similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of morphological similarity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007202 morphological similarity evidence used in automatic assertion true true A type of morphological similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of gene expression similarity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007203 gene expression similarity evidence used in automatic assertion true true A type of gene expression similarity evidence that is used in an automatic assertion. ECO:RCT IEA A type of methylation-specific polymerase chain reaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007204 methylation-specific polymerase chain reaction evidence used in automatic assertion true true A type of methylation-specific polymerase chain reaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of southern hybridization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007205 southern hybridization evidence used in automatic assertion true true A type of southern hybridization evidence that is used in an automatic assertion. ECO:RCT IEA A type of intermethylated site amplification evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007206 intermethylated site amplification evidence used in automatic assertion true true A type of intermethylated site amplification evidence that is used in an automatic assertion. ECO:RCT IEA A type of epitope-tagged protein immunolocalization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007207 epitope-tagged protein immunolocalization evidence used in automatic assertion true true A type of epitope-tagged protein immunolocalization evidence that is used in an automatic assertion. ECO:RCT IEA A type of co-fractionation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007208 co-fractionation evidence used in automatic assertion true true A type of co-fractionation evidence that is used in an automatic assertion. ECO:RCT IEA A type of green fluorescent protein fusion protein localization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007210 green fluorescent protein fusion protein localization evidence used in automatic assertion true true A type of green fluorescent protein fusion protein localization evidence that is used in an automatic assertion. ECO:RCT IEA A type of yellow fluorescent protein fusion protein localization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007211 yellow fluorescent protein fusion protein localization evidence used in automatic assertion true true A type of yellow fluorescent protein fusion protein localization evidence that is used in an automatic assertion. ECO:RCT IEA A type of beta-glucuronidase fusion protein localization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007212 beta-glucuronidase fusion protein localization evidence used in automatic assertion true true A type of beta-glucuronidase fusion protein localization evidence that is used in an automatic assertion. ECO:RCT IEA A type of beta-galactosidase fusion protein localization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007213 beta-galactosidase fusion protein localization evidence used in automatic assertion true true A type of beta-galactosidase fusion protein localization evidence that is used in an automatic assertion. ECO:RCT IEA A type of thin layer chromatography evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007214 thin layer chromatography evidence used in automatic assertion true true A type of thin layer chromatography evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007215 in vitro recombinant protein transcription reconstitution assay evidence used in automatic assertion true true A type of in vitro recombinant protein transcription reconstitution assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein separation followed by direct sequencing evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007216 protein separation followed by direct sequencing evidence used in automatic assertion true true A type of protein separation followed by direct sequencing evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein separation followed by fragment identification evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007217 protein separation followed by fragment identification evidence used in automatic assertion true true A type of protein separation followed by fragment identification evidence that is used in an automatic assertion. ECO:RCT IEA A type of heterologous system uptake evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007218 heterologous system uptake evidence used in automatic assertion true true A type of heterologous system uptake evidence that is used in an automatic assertion. ECO:RCT IEA A type of two-electrode voltage clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007219 two-electrode voltage clamp recording evidence used in automatic assertion true true A type of two-electrode voltage clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of biochemical trait analysis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007220 biochemical trait analysis evidence used in automatic assertion true true A type of biochemical trait analysis evidence that is used in an automatic assertion. ECO:RCT IEA A type of mutant physiological response evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007221 mutant physiological response evidence used in automatic assertion true true A type of mutant physiological response evidence that is used in an automatic assertion. ECO:RCT IEA A type of mutant visible phenotype evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007222 mutant visible phenotype evidence used in automatic assertion true true A type of mutant visible phenotype evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007223 in vivo assay evidence used in automatic assertion true true A type of in vivo assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of animal model system study evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007224 animal model system study evidence used in automatic assertion true true A type of animal model system study evidence that is used in an automatic assertion. ECO:RCT IEA A type of clinical study evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007225 clinical study evidence used in automatic assertion true true A type of clinical study evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007226 in vitro assay evidence used in automatic assertion true true A type of in vitro assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of enzyme inhibition evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007227 enzyme inhibition evidence used in automatic assertion true true true A type of enzyme inhibition evidence that is used in an automatic assertion. ECO:RCT IEA A type of Illumina sequencing evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007229 Illumina sequencing evidence used in automatic assertion true true A type of Illumina sequencing evidence that is used in an automatic assertion. ECO:RCT IEA A type of 454 pyrosequencing evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007230 454 pyrosequencing evidence used in automatic assertion true true A type of 454 pyrosequencing evidence that is used in an automatic assertion. ECO:RCT IEA A type of SOLiD sequencing evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007231 SOLiD sequencing evidence used in automatic assertion true true A type of SOLiD sequencing evidence that is used in an automatic assertion. ECO:RCT IEA A type of chain termination sequencing evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007232 chain termination sequencing evidence used in automatic assertion true true A type of chain termination sequencing evidence that is used in an automatic assertion. ECO:RCT IEA A type of chromatin immunoprecipitation-qPCR evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007233 chromatin immunoprecipitation-qPCR evidence used in automatic assertion true true A type of chromatin immunoprecipitation-qPCR evidence that is used in an automatic assertion. ECO:RCT IEA A type of 4C evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z circularized chromosome conformation capture evidence used in automatic assertion eco ECO:0007234 4C evidence used in automatic assertion true true A type of 4C evidence that is used in an automatic assertion. ECO:RCT IEA A type of 5C evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z carbon-copy chromosome conformation capture evidence used in automatic assertion eco ECO:0007235 5C evidence used in automatic assertion true true A type of 5C evidence that is used in an automatic assertion. ECO:RCT IEA A type of 3C-qPCR evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z chromosome conformation capture-qPCR evidence used in automatic assertion eco ECO:0007237 3C-qPCR evidence used in automatic assertion true true A type of 3C-qPCR evidence that is used in an automatic assertion. ECO:RCT IEA A type of Hi-C evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007238 Hi-C evidence used in automatic assertion true true A type of Hi-C evidence that is used in an automatic assertion. ECO:RCT IEA A type of 3C-seq evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z chromosome conformation capture sequencing evidence used in automatic assertion eco ECO:0007239 3C-seq evidence used in automatic assertion true true A type of 3C-seq evidence that is used in an automatic assertion. ECO:RCT IEA A type of environmental perturbation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z environmental perturbation evidence used in automatic assertion eco ECO:0007240 environmental perturbation phenotypic evidence used in automatic assertion true true A type of environmental perturbation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of tissue ablation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z tissue ablation evidence used in automatic assertion eco ECO:0007241 tissue ablation phenotypic evidence used in automatic assertion true true A type of tissue ablation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of tissue grafting phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z tissue grafting evidence used in automatic assertion eco ECO:0007242 tissue grafting phenotypic evidence used in automatic assertion true true A type of tissue grafting phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of cytochalasin experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007245 cytochalasin experiment evidence used in automatic assertion true true A type of cytochalasin experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of green fluorescent protein immunolocalization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007246 green fluorescent protein immunolocalization evidence used in automatic assertion true true A type of green fluorescent protein immunolocalization evidence that is used in an automatic assertion. ECO:RCT IEA A type of beta-galactosidase protein immunolocalization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007247 beta-galactosidase protein immunolocalization evidence used in automatic assertion true true A type of beta-galactosidase protein immunolocalization evidence that is used in an automatic assertion. ECO:RCT IEA A type of cap analysis of gene expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007248 cap analysis of gene expression evidence used in automatic assertion true true A type of cap analysis of gene expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of nano-cap analysis of gene expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007249 nano-cap analysis of gene expression evidence used in automatic assertion true true A type of nano-cap analysis of gene expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of particle size and count assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007250 particle size and count assay evidence used in automatic assertion true true A type of particle size and count assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of competitive growth assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007251 competitive growth assay evidence used in automatic assertion true true A type of competitive growth assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of pulsed-field gel electrophoresis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007252 pulsed-field gel electrophoresis evidence used in automatic assertion true true A type of pulsed-field gel electrophoresis evidence that is used in an automatic assertion. ECO:RCT IEA A type of two-dimensional agarose gel electrophoresis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007253 two-dimensional agarose gel electrophoresis evidence used in automatic assertion true true A type of two-dimensional agarose gel electrophoresis evidence that is used in an automatic assertion. ECO:RCT IEA A type of plasmid maintenance assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007254 plasmid maintenance assay evidence used in automatic assertion true true A type of plasmid maintenance assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of specific protein inhibition by antibody evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007255 specific protein inhibition by antibody evidence used in automatic assertion true true A type of specific protein inhibition by antibody evidence that is used in an automatic assertion. ECO:RCT IEA A type of single exon transcript confirmation via alignment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007256 single exon transcript confirmation via alignment evidence used in automatic assertion true true A type of single exon transcript confirmation via alignment evidence that is used in an automatic assertion. ECO:RCT IEA A type of phylogenetic distribution evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007257 phylogenetic distribution evidence used in automatic assertion true true A type of phylogenetic distribution evidence that is used in an automatic assertion. ECO:RCT IEA A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007258 differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) used in automatic assertion true true A type of differential geneset expression evidence from microarray experiment (GSEA, Fisher-exact) that is used in an automatic assertion. ECO:RCT IEA A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007259 differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) used in automatic assertion true true A type of differential geneset expression evidence from RNA-seq experiment (GSEA, Fisher-exact) that is used in an automatic assertion. ECO:RCT IEA A type of biological target-disease association via drug that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007260 biological target-disease association via drug evidence used in automatic assertion true true A type of biological target-disease association via drug that is used in an automatic assertion. ECO:RCT IEA A type of cell staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007261 cell staining evidence used in automatic assertion true true A type of cell staining evidence that is used in an automatic assertion. ECO:RCT A type of visual sequence inspection evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007262 visual sequence inspection evidence used in automatic assertion true A type of visual sequence inspection evidence that is used in an automatic assertion. ECO:RCT IEA A type of ATP bioluminescence assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007263 ATP bioluminescence assay evidence used in automatic assertion true true A type of ATP bioluminescence assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of missense mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z missense mutation evidence used in automatic assertion eco ECO:0007264 missense mutation phenotypic evidence used in automatic assertion true true A type of missense mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of nonsense mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z nonsense mutation evidence used in automatic assertion eco ECO:0007265 nonsense mutation phenotypic evidence used in automatic assertion true true A type of nonsense mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of silent mutation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007266 silent mutation evidence used in automatic assertion true true A type of silent mutation evidence that is used in an automatic assertion. ECO:RCT IEA A type of insertion mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z insertion mutation evidence used in automatic assertion eco ECO:0007267 insertion mutation phenotypic evidence used in automatic assertion true true A type of insertion mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of duplication mutation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007268 duplication mutation evidence used in automatic assertion true true A type of duplication mutation evidence that is used in an automatic assertion. ECO:RCT IEA A type of frameshift mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z frameshift mutation evidence used in automatic assertion eco ECO:0007269 frameshift mutation phenotypic evidence used in automatic assertion true true A type of frameshift mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of repeat expansion mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z repeat expansion mutation evidence used in automatic assertion eco ECO:0007270 repeat expansion mutation phenotypic evidence used in automatic assertion true true A type of repeat expansion mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of splice site mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z splice site mutation evidence used in automatic assertion eco ECO:0007271 splice site mutation phenotypic evidence used in automatic assertion true true A type of splice site mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of translocation mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z translocation mutation evidence used in automatic assertion eco ECO:0007272 translocation mutation phenotypic evidence used in automatic assertion true true A type of translocation mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of in-gel protein kinase assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007273 in-gel protein kinase assay evidence used in automatic assertion true true A type of in-gel protein kinase assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of macroscopic current trace evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007274 macroscopic current trace evidence used in automatic assertion true true A type of macroscopic current trace evidence that is used in an automatic assertion. ECO:RCT IEA A type of current density evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007275 current density evidence used in automatic assertion true true A type of current density evidence that is used in an automatic assertion. ECO:RCT IEA A type of sustained current evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007276 sustained current evidence used in automatic assertion true true A type of sustained current evidence that is used in an automatic assertion. ECO:RCT IEA A type of use dependence of inactivation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007277 use dependence of inactivation evidence used in automatic assertion true true A type of use dependence of inactivation evidence that is used in an automatic assertion. ECO:RCT IEA A type of current clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007278 current clamp recording evidence used in automatic assertion true true A type of current clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of whole-cell voltage clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007279 whole-cell voltage clamp recording evidence used in automatic assertion true true A type of whole-cell voltage clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell-attached single-channel recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007280 cell-attached single-channel recording evidence used in automatic assertion true true A type of cell-attached single-channel recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell-detached inside-out single-channel recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007281 cell-detached inside-out single-channel recording evidence used in automatic assertion true true A type of cell-detached inside-out single-channel recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of reconstituted bilayer single-channel patch recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007282 reconstituted bilayer single-channel patch recording evidence used in automatic assertion true true A type of reconstituted bilayer single-channel patch recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of electroencephalography recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007283 electroencephalography recording evidence used in automatic assertion true true A type of electroencephalography recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell-detached outside-out single-channel recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007284 cell-detached outside-out single-channel recording evidence used in automatic assertion true true A type of cell-detached outside-out single-channel recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of cut-open oocyte voltage clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007285 cut-open oocyte voltage clamp recording evidence used in automatic assertion true true A type of cut-open oocyte voltage clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of macropatch voltage clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007286 macropatch voltage clamp recording evidence used in automatic assertion true true A type of macropatch voltage clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein mass spectrometry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007288 protein mass spectrometry evidence used in automatic assertion true true A type of protein mass spectrometry evidence that is used in an automatic assertion. ECO:RCT IEA A type of cross-streak test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007289 cross-streak test evidence used in automatic assertion true true A type of cross-streak test evidence that is used in an automatic assertion. ECO:RCT IEA A type of tethered cell assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007290 tethered cell assay evidence used in automatic assertion true true A type of tethered cell assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of tumble frequency assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007291 tumble frequency assay evidence used in automatic assertion true true A type of tumble frequency assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of capillary assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007292 capillary assay evidence used in automatic assertion true true A type of capillary assay evidence that is used in an automatic assertion. ECO:RCT A type of inference from experimental data evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007293 inference from experimental data evidence used in automatic assertion true A type of inference from experimental data evidence that is used in an automatic assertion. ECO:RCT A type of inference from phenotype manipulation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007294 inference from phenotype manipulation evidence used in automatic assertion true A type of inference from phenotype manipulation evidence that is used in an automatic assertion. ECO:RCT EXP IEA A type of inference by association of genotype from phenotype that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007295 inference by association of genotype from phenotype used in automatic assertion true true true A type of inference by association of genotype from phenotype that is used in an automatic assertion. ECO:RCT IEA A type of motility assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007296 motility assay evidence used in automatic assertion true true A type of motility assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of experimental evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007297 experimental evidence used in automatic assertion true true A type of experimental evidence that is used in an automatic assertion. ECO:RCT IEA A type of expression pattern evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007298 expression pattern evidence used in automatic assertion true true A type of expression pattern evidence that is used in an automatic assertion. ECO:RCT IEA A type of Affymetrix GeneChip evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007299 Affymetrix GeneChip evidence used in automatic assertion true true A type of Affymetrix GeneChip evidence that is used in an automatic assertion. ECO:RCT IEA A type of cRNA to DNA expression microarray evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007300 cRNA to DNA expression microarray evidence used in automatic assertion true true A type of cRNA to DNA expression microarray evidence that is used in an automatic assertion. ECO:RCT IEA A type of expression microarray evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007301 expression microarray evidence used in automatic assertion true true A type of expression microarray evidence that is used in an automatic assertion. ECO:RCT IEA A type of differential methylation hybridization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007302 differential methylation hybridization evidence used in automatic assertion true true A type of differential methylation hybridization evidence that is used in an automatic assertion. ECO:RCT IEA A type of transcript expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z transcriptomics evidence used in automatic assertion eco ECO:0007303 transcript expression evidence used in automatic assertion true true A type of transcript expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of Nimblegen array evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007304 Nimblegen array evidence used in automatic assertion true true A type of Nimblegen array evidence that is used in an automatic assertion. ECO:RCT IEA A type of array-based sequence capture evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007305 array-based sequence capture evidence used in automatic assertion true true A type of array-based sequence capture evidence that is used in an automatic assertion. ECO:RCT IEA A type of qualitative western immunoblotting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z ECO:0007287 protein expression level evidence based on western blot used in automatic assertion eco ECO:0007306 qualitative western immunoblotting evidence used in automatic assertion true true true true A type of qualitative western immunoblotting evidence that is used in an automatic assertion. ECO:RCT IEA A type of direct assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007307 direct assay evidence used in automatic assertion true true A type of direct assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z ECO:0007308 protein expression level evidence used in automatic assertion eco ECO:0007309 protein expression evidence used in automatic assertion true true A type of protein expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of expression library screen evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007310 expression library screen evidence used in automatic assertion true true A type of expression library screen evidence that is used in an automatic assertion. ECO:RCT IEA A type of heterologous protein expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007311 heterologous protein expression evidence used in automatic assertion true true A type of heterologous protein expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of spatial pattern of protein expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007312 spatial pattern of protein expression evidence used in automatic assertion true true A type of spatial pattern of protein expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of DNA to cDNA expression microarray evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007313 DNA to cDNA expression microarray evidence used in automatic assertion true true A type of DNA to cDNA expression microarray evidence that is used in an automatic assertion. ECO:RCT IEA A type of differential hybridization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007314 differential hybridization evidence used in automatic assertion true true A type of differential hybridization evidence that is used in an automatic assertion. ECO:RCT IEA A type of RNA protection assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007315 RNA protection assay evidence used in automatic assertion true true A type of RNA protection assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of nuclease protection assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007316 nuclease protection assay evidence used in automatic assertion true true A type of nuclease protection assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of spatial pattern of transcript expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007317 spatial pattern of transcript expression evidence used in automatic assertion true true A type of spatial pattern of transcript expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of subtractive hybridization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007318 subtractive hybridization evidence used in automatic assertion true true A type of subtractive hybridization evidence that is used in an automatic assertion. ECO:RCT IEA A type of author statement that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007319 author statement used in automatic assertion true true A type of author statement that is used in an automatic assertion. ECO:RCT IEA A type of author statement without traceable support that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco non-traceable author statement used in automatic assertion ECO:0007320 author statement without traceable support used in automatic assertion true true A type of author statement without traceable support that is used in an automatic assertion. ECO:RCT IEA A type of author statement supported by traceable reference that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco traceable author statement used in automatic assertion ECO:0007321 author statement supported by traceable reference used in automatic assertion true true A type of author statement supported by traceable reference that is used in an automatic assertion. ECO:RCT IEA A type of curator inference that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007322 curator inference used in automatic assertion true true A type of curator inference that is used in an automatic assertion. ECO:RCT IEA A type of inference from background scientific knowledge that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007323 inference from background scientific knowledge used in automatic assertion true true A type of inference from background scientific knowledge that is used in an automatic assertion. ECO:RCT IEA An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007324 no evidence data found used in automatic assertion true true An inference that results when research finds no evidence information in the scientific literature, at reference databases, or from other resources that is used in an automatic assertion. ECO:RCT IEA A type of mutant phenotype evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007325 mutant phenotype evidence used in automatic assertion true true A type of mutant phenotype evidence that is used in an automatic assertion. ECO:RCT IEA A type of genetic interaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007326 genetic interaction evidence used in automatic assertion true true A type of genetic interaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of genomic context evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007327 genomic context evidence used in automatic assertion true true A type of genomic context evidence that is used in an automatic assertion. ECO:RCT IEA A type of biological aspect of ancestor evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007328 biological aspect of ancestor evidence used in automatic assertion true true A type of biological aspect of ancestor evidence that is used in an automatic assertion. ECO:RCT IEA A type of biological aspect of descendant evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007329 biological aspect of descendant evidence used in automatic assertion true true A type of biological aspect of descendant evidence that is used in an automatic assertion. ECO:RCT IEA A type of phylogenetic determination of loss of key residues evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007330 phylogenetic determination of loss of key residues evidence used in automatic assertion true true A type of phylogenetic determination of loss of key residues evidence that is used in an automatic assertion. ECO:RCT IEA A type of rapid divergence from ancestral sequence evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007331 rapid divergence from ancestral sequence evidence used in automatic assertion true true A type of rapid divergence from ancestral sequence evidence that is used in an automatic assertion. ECO:RCT IEA A type of physical interaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007332 physical interaction evidence used in automatic assertion true true A type of physical interaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of gene neighbors evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007333 gene neighbors evidence used in automatic assertion true true A type of gene neighbors evidence that is used in an automatic assertion. ECO:RCT IEA A type of Edman degradation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007334 Edman degradation evidence used in automatic assertion true true A type of Edman degradation evidence that is used in an automatic assertion. ECO:RCT IEA A type of 3D cell culture evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007335 3D cell culture evidence used in automatic assertion true true A type of 3D cell culture evidence that is used in an automatic assertion. ECO:RCT IEA A type of 51Cr release assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007336 51Cr release assay evidence used in automatic assertion true true A type of 51Cr release assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of 7-aminoactinomycin staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007337 7-aminoactinomycin staining evidence used in automatic assertion true true A type of 7-aminoactinomycin staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of [3H]-thymidine incorporation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007338 [3H]-thymidine incorporation assay evidence used in automatic assertion true true A type of [3H]-thymidine incorporation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of [3H]arachidonic acid release assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007339 [3H]arachidonic acid release assay evidence used in automatic assertion true true A type of [3H]arachidonic acid release assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of adhesion assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007340 adhesion assay evidence used in automatic assertion true true A type of adhesion assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of adoptive cell transfer evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007341 adoptive cell transfer evidence used in automatic assertion true true A type of adoptive cell transfer evidence that is used in an automatic assertion. ECO:RCT IEA A type of alamarBlue assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007342 alamarBlue assay evidence used in automatic assertion true true A type of alamarBlue assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of allograft transplantation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z allograft transplantation evidence used in automatic assertion eco ECO:0007343 allograft transplantation phenotypic evidence used in automatic assertion true true A type of allograft transplantation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of anion-exchange chromatography evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007344 anion-exchange chromatography evidence used in automatic assertion true true A type of anion-exchange chromatography evidence that is used in an automatic assertion. ECO:RCT IEA A type of annexin-V staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007345 annexin-V staining evidence used in automatic assertion true true A type of annexin-V staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of cognitive assay phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z behavioral assay evidence used in automatic assertion eco ECO:0007346 cognitive assay phenotypic evidence used in automatic assertion true true A type of cognitive assay phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of blocking monoclonal antibody evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007347 blocking monoclonal antibody evidence used in automatic assertion true true A type of blocking monoclonal antibody evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunological assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007348 immunological assay evidence used in automatic assertion true true A type of immunological assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of blocking peptide evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007349 blocking peptide evidence used in automatic assertion true true A type of blocking peptide evidence that is used in an automatic assertion. ECO:RCT IEA A type of blocking polyclonal antibody evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007350 blocking polyclonal antibody evidence used in automatic assertion true true A type of blocking polyclonal antibody evidence that is used in an automatic assertion. ECO:RCT IEA A type of blood test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007351 blood test evidence used in automatic assertion true true A type of blood test evidence that is used in an automatic assertion. ECO:RCT IEA A type of Boyden chamber assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007352 Boyden chamber assay evidence used in automatic assertion true true A type of Boyden chamber assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of bromodeoxyuridine incorporation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007353 bromodeoxyuridine incorporation assay evidence used in automatic assertion true true A type of bromodeoxyuridine incorporation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of nucleotide analog incorporation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007354 nucleotide analog incorporation assay evidence used in automatic assertion true true A type of nucleotide analog incorporation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of caspase assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007355 caspase assay evidence used in automatic assertion true true A type of caspase assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell counting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007356 cell counting evidence used in automatic assertion true true A type of cell counting evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell permeability assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007357 cell permeability assay evidence used in automatic assertion true true A type of cell permeability assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007358 carboxyfluorescein diacetate succinimidyl ester staining evidence used in automatic assertion true true A type of carboxyfluorescein diacetate succinimidyl ester staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of chemiluminescence-linked immunoassay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007359 chemiluminescence-linked immunoassay evidence used in automatic assertion true true A type of chemiluminescence-linked immunoassay evidence that is used in an automatic assertion. ECO:RCT IEA A type of chimeric protein phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z chimeric protein evidence used in automatic assertion eco ECO:0007360 chimeric protein phenotypic evidence used in automatic assertion true true A type of chimeric protein phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of co-electrophoresis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007361 co-electrophoresis evidence used in automatic assertion true true A type of co-electrophoresis evidence that is used in an automatic assertion. ECO:RCT IEA A type of co-localization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007362 co-localization evidence used in automatic assertion true true A type of co-localization evidence that is used in an automatic assertion. ECO:RCT IEA A type of imaging assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007363 imaging assay evidence used in automatic assertion true true A type of imaging assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of co-sedimentation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007364 co-sedimentation assay evidence used in automatic assertion true true A type of co-sedimentation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of colony counting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007365 colony counting evidence used in automatic assertion true true A type of colony counting evidence that is used in an automatic assertion. ECO:RCT IEA A type of comet assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007366 comet assay evidence used in automatic assertion true true A type of comet assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of conditional knockin evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007367 conditional knockin evidence used in automatic assertion true true A type of conditional knockin evidence that is used in an automatic assertion. ECO:RCT IEA A type of knockin evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007368 knockin evidence used in automatic assertion true true A type of knockin evidence that is used in an automatic assertion. ECO:RCT IEA A type of conditional knockout evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007369 conditional knockout evidence used in automatic assertion true true A type of conditional knockout evidence that is used in an automatic assertion. ECO:RCT IEA A type of knockout evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007370 knockout evidence used in automatic assertion true true A type of knockout evidence that is used in an automatic assertion. ECO:RCT IEA A type of constitutively active mutant evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007371 constitutively active mutant evidence used in automatic assertion true true A type of constitutively active mutant evidence that is used in an automatic assertion. ECO:RCT IEA A type of cross-linking evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007372 cross-linking evidence used in automatic assertion true true A type of cross-linking evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein binding evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007373 protein binding evidence used in automatic assertion true true A type of protein binding evidence that is used in an automatic assertion. ECO:RCT IEA A type of crystallography evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007374 crystallography evidence used in automatic assertion true true A type of crystallography evidence that is used in an automatic assertion. ECO:RCT IEA A type of cytochemistry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007375 cytochemistry evidence used in automatic assertion true true A type of cytochemistry evidence that is used in an automatic assertion. ECO:RCT IEA A type of histochemistry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007376 histochemistry evidence used in automatic assertion true true A type of histochemistry evidence that is used in an automatic assertion. ECO:RCT IEA A type of cytochrome C release assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007377 cytochrome C release assay evidence used in automatic assertion true true A type of cytochrome C release assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of 4',6-diamidino-2-phenylindole staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007378 4',6-diamidino-2-phenylindole staining evidence used in automatic assertion true true A type of 4',6-diamidino-2-phenylindole staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of deletion mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z deletion mutation evidence used in automatic assertion eco ECO:0007379 deletion mutation phenotypic evidence used in automatic assertion true true A type of deletion mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of DNA laddering assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007380 DNA laddering assay evidence used in automatic assertion true true A type of DNA laddering assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of RNA dot blot assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007381 RNA dot blot assay evidence used in automatic assertion true true A type of RNA dot blot assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of dominant-negative mutant phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z dominant-negative mutant evidence used in automatic assertion eco ECO:0007382 dominant-negative mutant phenotypic evidence used in automatic assertion true true A type of dominant-negative mutant phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of eTag assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007383 eTag assay evidence used in automatic assertion true true A type of eTag assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of affinity evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007384 affinity evidence used in automatic assertion true true A type of affinity evidence that is used in an automatic assertion. ECO:RCT IEA A type of filter binding assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007385 filter binding assay evidence used in automatic assertion true true A type of filter binding assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of fluorescence in situ hybridization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007386 fluorescence in situ hybridization evidence used in automatic assertion true true true A type of fluorescence in situ hybridization evidence that is used in an automatic assertion. ECO:RCT IEA A type of fluorescence resonance energy transfer evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007387 fluorescence resonance energy transfer evidence used in automatic assertion true true A type of fluorescence resonance energy transfer evidence that is used in an automatic assertion. ECO:RCT IEA A type of gel-filtration evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007388 gel-filtration evidence used in automatic assertion true true A type of gel-filtration evidence that is used in an automatic assertion. ECO:RCT IEA A type of histology evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007389 histology evidence used in automatic assertion true true A type of histology evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunocytochemistry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007390 immunocytochemistry evidence used in automatic assertion true true A type of immunocytochemistry evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunodepletion evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007391 immunodepletion evidence used in automatic assertion true true A type of immunodepletion evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunohistochemistry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007392 immunohistochemistry evidence used in automatic assertion true true A type of immunohistochemistry evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro acetylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007393 in vitro acetylation assay evidence used in automatic assertion true true A type of in vitro acetylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro cleavage assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007394 in vitro cleavage assay evidence used in automatic assertion true true A type of in vitro cleavage assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro deacetylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007395 in vitro deacetylation assay evidence used in automatic assertion true true A type of in vitro deacetylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro defarnesylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007396 in vitro defarnesylation assay evidence used in automatic assertion true true A type of in vitro defarnesylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro demethylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007397 in vitro demethylation assay evidence used in automatic assertion true true A type of in vitro demethylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro desumoylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007398 in vitro desumoylation assay evidence used in automatic assertion true true A type of in vitro desumoylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro deubiquitination assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007399 in vitro deubiquitination assay evidence used in automatic assertion true true A type of in vitro deubiquitination assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro farnesylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007400 in vitro farnesylation assay evidence used in automatic assertion true true A type of in vitro farnesylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro methylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007401 in vitro methylation assay evidence used in automatic assertion true true A type of in vitro methylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro palmitoylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007402 in vitro palmitoylation assay evidence used in automatic assertion true true A type of in vitro palmitoylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro phosphatase assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007403 in vitro phosphatase assay evidence used in automatic assertion true true A type of in vitro phosphatase assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro polyADP-ribosylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007404 in vitro polyADP-ribosylation assay evidence used in automatic assertion true true A type of in vitro polyADP-ribosylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro protein kinase assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007405 in vitro protein kinase assay evidence used in automatic assertion true true A type of in vitro protein kinase assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro sumoylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007406 in vitro sumoylation assay evidence used in automatic assertion true true A type of in vitro sumoylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro transcription assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007407 in vitro transcription assay evidence used in automatic assertion true true A type of in vitro transcription assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro translation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007408 in vitro translation assay evidence used in automatic assertion true true A type of in vitro translation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vitro ubiquitination assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007409 in vitro ubiquitination assay evidence used in automatic assertion true true A type of in vitro ubiquitination assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo acetylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007410 in vivo acetylation assay evidence used in automatic assertion true true A type of in vivo acetylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo cleavage assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007411 in vivo cleavage assay evidence used in automatic assertion true true A type of in vivo cleavage assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo deacetylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007412 in vivo deacetylation assay evidence used in automatic assertion true true A type of in vivo deacetylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo defarnesylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007413 in vivo defarnesylation assay evidence used in automatic assertion true true A type of in vivo defarnesylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo demethylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007414 in vivo demethylation assay evidence used in automatic assertion true true A type of in vivo demethylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo desumoylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007415 in vivo desumoylation assay evidence used in automatic assertion true true A type of in vivo desumoylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo deubiquitination assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007416 in vivo deubiquitination assay evidence used in automatic assertion true true A type of in vivo deubiquitination assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo farnesylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007417 in vivo farnesylation assay evidence used in automatic assertion true true A type of in vivo farnesylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo methylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007418 in vivo methylation assay evidence used in automatic assertion true true A type of in vivo methylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo palmitoylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007419 in vivo palmitoylation assay evidence used in automatic assertion true true A type of in vivo palmitoylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo phosphatase assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007420 in vivo phosphatase assay evidence used in automatic assertion true true A type of in vivo phosphatase assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo protein kinase assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007421 in vivo protein kinase assay evidence used in automatic assertion true true A type of in vivo protein kinase assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo sumoylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007422 in vivo sumoylation assay evidence used in automatic assertion true true A type of in vivo sumoylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo transcription assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007423 in vivo transcription assay evidence used in automatic assertion true true A type of in vivo transcription assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo translation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007424 in vivo translation assay evidence used in automatic assertion true true A type of in vivo translation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo ubiquitination assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007425 in vivo ubiquitination assay evidence used in automatic assertion true true A type of in vivo ubiquitination assay evidence that is used in an automatic assertion. ECO:RCT A type of induced mutation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007426 induced mutation evidence used in automatic assertion true A type of induced mutation evidence that is used in an automatic assertion. ECO:RCT IEA A type of genetic transformation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007427 genetic transformation evidence used in automatic assertion true true A type of genetic transformation evidence that is used in an automatic assertion. ECO:RCT IEA A type of lipid binding assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007428 lipid binding assay evidence used in automatic assertion true true A type of lipid binding assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of luminescence-based mammalian interactome mapping assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007429 luminescence-based mammalian interactome mapping assay evidence used in automatic assertion true true A type of luminescence-based mammalian interactome mapping assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of macroscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007430 macroscopy evidence used in automatic assertion true true A type of macroscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of mammalian 2-hybrid assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007431 mammalian 2-hybrid assay evidence used in automatic assertion true true A type of mammalian 2-hybrid assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of bait-prey hybrid interaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z bait-prey protein pull-down evidence eco ECO:0007432 bait-prey hybrid interaction evidence used in automatic assertion true true A type of bait-prey hybrid interaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of mass spectrometry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007433 mass spectrometry evidence used in automatic assertion true true A type of mass spectrometry evidence that is used in an automatic assertion. ECO:RCT IEA A type of medical imaging evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007434 medical imaging evidence used in automatic assertion true true A type of medical imaging evidence that is used in an automatic assertion. ECO:RCT IEA A type of microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007435 microscopy evidence used in automatic assertion true true A type of microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of motility wound healing assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007436 motility wound healing assay evidence used in automatic assertion true true A type of motility wound healing assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of MTS assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007437 MTS assay evidence used in automatic assertion true true A type of MTS assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of MTT assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007438 MTT assay evidence used in automatic assertion true true A type of MTT assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of multiplex bead-based immunoassay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007439 multiplex bead-based immunoassay evidence used in automatic assertion true true A type of multiplex bead-based immunoassay evidence that is used in an automatic assertion. ECO:RCT IEA A type of natural variation mutant evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007440 natural variation mutant evidence used in automatic assertion true true A type of natural variation mutant evidence that is used in an automatic assertion. ECO:RCT IEA A type of nuclear magnetic resonance evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007441 nuclear magnetic resonance evidence used in automatic assertion true true A type of nuclear magnetic resonance evidence that is used in an automatic assertion. ECO:RCT IEA A type of nuclear fragmentation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007442 nuclear fragmentation evidence used in automatic assertion true true A type of nuclear fragmentation evidence that is used in an automatic assertion. ECO:RCT IEA A type of phage display evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007443 phage display evidence used in automatic assertion true true A type of phage display evidence that is used in an automatic assertion. ECO:RCT IEA A type of phosphoamino acid analysis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007444 phosphoamino acid analysis evidence used in automatic assertion true true A type of phosphoamino acid analysis evidence that is used in an automatic assertion. ECO:RCT IEA A type of peptide affinity enrichment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007445 peptide affinity enrichment evidence used in automatic assertion true true A type of peptide affinity enrichment evidence that is used in an automatic assertion. ECO:RCT IEA A type of peptide array evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007446 peptide array evidence used in automatic assertion true true A type of peptide array evidence that is used in an automatic assertion. ECO:RCT IEA A type of physical examination evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007447 physical examination evidence used in automatic assertion true true A type of physical examination evidence that is used in an automatic assertion. ECO:RCT IEA A type of point mutation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z point mutation evidence used in automatic assertion eco ECO:0007448 point mutation phenotypic evidence used in automatic assertion true true A type of point mutation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of propidium iodide staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007449 propidium iodide staining evidence used in automatic assertion true true A type of propidium iodide staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of fluorescence evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007450 fluorescence evidence used in automatic assertion true true A type of fluorescence evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein dot blot assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007451 protein dot blot assay evidence used in automatic assertion true true A type of protein dot blot assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein microarray evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007452 protein microarray evidence used in automatic assertion true true A type of protein microarray evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein sequencing assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007453 protein sequencing assay evidence used in automatic assertion true true A type of protein sequencing assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of quantitative mass spectrometry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007454 quantitative mass spectrometry evidence used in automatic assertion true true A type of quantitative mass spectrometry evidence that is used in an automatic assertion. ECO:RCT IEA A type of radioisotope assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007455 radioisotope assay evidence used in automatic assertion true true A type of radioisotope assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of radioimmunoassay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007456 radioimmunoassay evidence used in automatic assertion true true A type of radioimmunoassay evidence that is used in an automatic assertion. ECO:RCT IEA A type of restriction fragment detection evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007457 restriction fragment detection evidence used in automatic assertion true true A type of restriction fragment detection evidence that is used in an automatic assertion. ECO:RCT IEA A type of spectrophotometry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007458 spectrophotometry evidence used in automatic assertion true true A type of spectrophotometry evidence that is used in an automatic assertion. ECO:RCT IEA A type of syngeneic transplantation experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007459 syngeneic transplantation experiment evidence used in automatic assertion true true A type of syngeneic transplantation experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of xenotransplantation phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z xenotransplantation experiment evidence used in automatic assertion eco ECO:0007460 xenotransplantation phenotypic evidence used in automatic assertion true true A type of xenotransplantation phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of WST-1 assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007461 WST-1 assay evidence used in automatic assertion true true A type of WST-1 assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of urine test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007462 urine test evidence used in automatic assertion true true A type of urine test evidence that is used in an automatic assertion. ECO:RCT IEA A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007463 terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence used in automatic assertion true true A type of terminal deoxynucleotidyl transferase dUTP nick end labeling assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of tryptic phosphopeptide mapping assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007464 tryptic phosphopeptide mapping assay evidence used in automatic assertion true true A type of tryptic phosphopeptide mapping assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of transgenic organism evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007465 transgenic organism evidence used in automatic assertion true true A type of transgenic organism evidence that is used in an automatic assertion. ECO:RCT IEA A type of tissue microarray evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007466 tissue microarray evidence used in automatic assertion true true A type of tissue microarray evidence that is used in an automatic assertion. ECO:RCT IEA A type of TACE activity assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007467 TACE activity assay evidence used in automatic assertion true true A type of TACE activity assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of enzyme assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007468 enzymatic activity assay evidence used in automatic assertion true true A type of enzyme assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of surface plasmon resonance evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007469 surface plasmon resonance evidence used in automatic assertion true true A type of surface plasmon resonance evidence that is used in an automatic assertion. ECO:RCT IEA A type of restriction landmark genomic scanning evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007470 restriction landmark genomic scanning evidence used in automatic assertion true true A type of restriction landmark genomic scanning evidence that is used in an automatic assertion. ECO:RCT IEA A type of resonant mirror biosensor evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007471 resonant mirror biosensor evidence used in automatic assertion true true A type of resonant mirror biosensor evidence that is used in an automatic assertion. ECO:RCT IEA A type of high-performance liquid chromatography evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007472 high-performance liquid chromatography evidence used in automatic assertion true true A type of high-performance liquid chromatography evidence that is used in an automatic assertion. ECO:RCT IEA A type of ectopic expression evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007473 ectopic expression evidence used in automatic assertion true true A type of ectopic expression evidence that is used in an automatic assertion. ECO:RCT IEA A type of electrophoretic mobility shift assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007474 electrophoretic mobility shift assay evidence used in automatic assertion true true A type of electrophoretic mobility shift assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of reverse transcription polymerase chain reaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z ECO:000108 eco ECO:0007475 reverse transcription polymerase chain reaction evidence used in automatic assertion true true A type of reverse transcription polymerase chain reaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of in vivo polyADP-ribosylation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007476 in vivo polyADP-ribosylation assay evidence used in automatic assertion true true A type of in vivo polyADP-ribosylation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of DNA dot blot assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007477 DNA dot blot assay evidence used in automatic assertion true true A type of DNA dot blot assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of random mutagenesis phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007478 random mutagenesis evidence used in automatic assertion true true A type of random mutagenesis phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of biological system reconstruction evidence by experimental evidence from single species that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007479 biological system reconstruction evidence by experimental evidence from single species used in automatic assertion true true A type of biological system reconstruction evidence by experimental evidence from single species that is used in an automatic assertion. ECO:RCT IEA A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007480 biological system reconstruction evidence by experimental evidence from mixed species used in automatic assertion true true A type of biological system reconstruction evidence by experimental evidence from mixed species that is used in an automatic assertion. ECO:RCT IEA A type of biological system reconstruction evidence based on orthology evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007481 biological system reconstruction evidence based on orthology evidence used in automatic assertion true true A type of biological system reconstruction evidence based on orthology evidence that is used in an automatic assertion. ECO:RCT IEA A type of biological system reconstruction evidence based on homology evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007482 biological system reconstruction evidence based on homology evidence used in automatic assertion true true A type of biological system reconstruction evidence based on homology evidence that is used in an automatic assertion. ECO:RCT IEA A type of biological system reconstruction evidence based on paralogy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007483 biological system reconstruction evidence based on paralogy evidence used in automatic assertion true true A type of biological system reconstruction evidence based on paralogy evidence that is used in an automatic assertion. ECO:RCT IEA A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007484 biological system reconstruction evidence based on inference from background scientific knowledge used in automatic assertion true true A type of biological system reconstruction evidence based on inference from background scientific knowledge that is used in an automatic assertion. ECO:RCT IEA A type of immunogold labelling evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007485 immunogold labelling evidence used in automatic assertion true true A type of immunogold labelling evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunolocalization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007486 immunolocalization evidence used in automatic assertion true true true A type of immunolocalization evidence that is used in an automatic assertion. ECO:RCT IEA A type of flow cytometry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007487 flow cytometry evidence used in automatic assertion true true A type of flow cytometry evidence that is used in an automatic assertion. ECO:RCT IEA A type of enzyme-linked immunoabsorbent assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007488 enzyme-linked immunoabsorbent assay evidence used in automatic assertion true true A type of enzyme-linked immunoabsorbent assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of high throughput mass spectrometry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007489 high throughput mass spectrometry evidence used in automatic assertion true true A type of high throughput mass spectrometry evidence that is used in an automatic assertion. ECO:RCT IEA A type of confocal microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007490 confocal microscopy evidence used in automatic assertion true true A type of confocal microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of wide-field microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007491 wide-field microscopy evidence used in automatic assertion true true A type of wide-field microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunogold labelling electron microscopy assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007492 immunogold labelling electron microscopy assay evidence used in automatic assertion true true true A type of immunogold labelling electron microscopy assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of electron microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007493 electron microscopy evidence used in automatic assertion true true true A type of electron microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunoperoxidase immunolocalization evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007494 immunoperoxidase immunolocalization evidence used in automatic assertion true true A type of immunoperoxidase immunolocalization evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007495 immunoperoxidase immunolocalization electron microscopy evidence used in automatic assertion true true true A type of immunoperoxidase immunolocalization electron microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunofluorescence confocal microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007496 immunofluorescence confocal microscopy evidence used in automatic assertion true true true A type of immunofluorescence confocal microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunofluorescence evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007497 immunofluorescence evidence used in automatic assertion true true A type of immunofluorescence evidence that is used in an automatic assertion. ECO:RCT IEA A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007498 two-dimensional polyacrylamide gel electrophoresis evidence used in automatic assertion true true A type of two-dimensional polyacrylamide gel electrophoresis evidence that is used in an automatic assertion. ECO:RCT IEA A type of alkaline phosphatase reporter gene assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007499 alkaline phosphatase reporter gene assay evidence used in automatic assertion true true A type of alkaline phosphatase reporter gene assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of beta-galactosidase reporter gene assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z LacZ transcript localization evidence used in automatic assertion eco ECO:0007500 beta-galactosidase reporter gene assay evidence used in automatic assertion true true A type of beta-galactosidase reporter gene assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007501 chloramphenicol acetyltransferase reporter gene assay evidence used in automatic assertion true true A type of chloramphenicol acetyltransferase reporter gene assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of chromatin immunoprecipitation-PCR evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007502 chromatin immunoprecipitation-PCR evidence used in automatic assertion true true A type of chromatin immunoprecipitation-PCR evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunoprecipitation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007503 immunoprecipitation evidence used in automatic assertion true true A type of immunoprecipitation evidence that is used in an automatic assertion. ECO:RCT IEA A type of copper-phenanthroline footprinting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007504 copper-phenanthroline footprinting evidence used in automatic assertion true true A type of copper-phenanthroline footprinting evidence that is used in an automatic assertion. ECO:RCT IEA A type of nucleic acid binding evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007505 nucleic acid binding evidence used in automatic assertion true true A type of nucleic acid binding evidence that is used in an automatic assertion. ECO:RCT IEA A type of DNA affinity chromatography evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007506 DNA affinity chromatography evidence used in automatic assertion true true A type of DNA affinity chromatography evidence that is used in an automatic assertion. ECO:RCT IEA A type of DNAse footprinting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007507 DNAse footprinting evidence used in automatic assertion true true A type of DNAse footprinting evidence that is used in an automatic assertion. ECO:RCT IEA A type of fluorescence anisotropy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007508 fluorescence anisotropy evidence used in automatic assertion true true A type of fluorescence anisotropy evidence that is used in an automatic assertion. ECO:RCT IEA A type of ferric uptake regulator titration assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007509 ferric uptake regulator titration assay evidence used in automatic assertion true true A type of ferric uptake regulator titration assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007510 systematic evolution of ligands by exponential amplification evidence used in automatic assertion true true A type of systematic evolution of ligands by exponential amplification evidence that is used in an automatic assertion. ECO:RCT IEA A type of glutathione S-transferase pull-down assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007511 glutathione S-transferase pull-down assay evidence used in automatic assertion true true A type of glutathione S-transferase pull-down assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of beta-glucuronidase reporter gene assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007512 beta-glucuronidase reporter gene assay evidence used in automatic assertion true true A type of beta-glucuronidase reporter gene assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of heteronuclear single quantum coherence spectroscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007513 heteronuclear single quantum coherence spectroscopy evidence used in automatic assertion true true A type of heteronuclear single quantum coherence spectroscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of hydroxyl-radical footprinting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007514 hydroxyl-radical footprinting evidence used in automatic assertion true true A type of hydroxyl-radical footprinting evidence that is used in an automatic assertion. ECO:RCT IEA A type of isothermal titration calorimetry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007515 isothermal titration calorimetry evidence used in automatic assertion true true A type of isothermal titration calorimetry evidence that is used in an automatic assertion. ECO:RCT IEA A type of luciferase reporter gene assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007516 luciferase reporter gene assay evidence used in automatic assertion true true A type of luciferase reporter gene assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007517 methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence used in automatic assertion true true A type of methidiumpropyl-ethylenediaminetetraacetic acid iron (II) footprinting evidence that is used in an automatic assertion. ECO:RCT IEA A type of northern blot evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007518 northern blot evidence used in automatic assertion true true A type of northern blot evidence that is used in an automatic assertion. ECO:RCT IEA A type of methylation interference footprinting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z premethylation interference footprinting evidence used in automatic assertion eco ECO:0007519 methylation interference footprinting evidence used in automatic assertion true true A type of methylation interference footprinting evidence that is used in an automatic assertion. ECO:RCT IEA A type of primer extension assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007520 primer extension assay evidence used in automatic assertion true true A type of primer extension assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of quantitative polymerase chain reaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007521 quantitative polymerase chain reaction evidence used in automatic assertion true true A type of quantitative polymerase chain reaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007522 rapid amplification of cDNA ends polymerase chain reaction evidence used in automatic assertion true true A type of rapid amplification of cDNA ends polymerase chain reaction evidence that is used in an automatic assertion. ECO:RCT IEA A type of S1 nuclease protection assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007523 S1 nuclease protection assay evidence used in automatic assertion true true A type of S1 nuclease protection assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of site-directed mutagenesis phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z site-directed mutagenesis evidence used in automatic assertion eco ECO:0007524 site-directed mutagenesis phenotypic evidence used in automatic assertion true true A type of site-directed mutagenesis phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of survival rate analysis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007525 survival rate analysis evidence used in automatic assertion true true A type of survival rate analysis evidence that is used in an automatic assertion. ECO:RCT IEA A type of ultraviolet light footprinting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007526 ultraviolet light footprinting evidence used in automatic assertion true true A type of ultraviolet light footprinting evidence that is used in an automatic assertion. ECO:RCT IEA A type of xylE reporter gene assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007527 xylE reporter gene assay evidence used in automatic assertion true true A type of xylE reporter gene assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of ad-hoc qualitative phenotype observation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007528 ad-hoc qualitative phenotype observation evidence used in automatic assertion true true A type of ad-hoc qualitative phenotype observation evidence that is used in an automatic assertion. ECO:RCT IEA A type of ad-hoc quantitative phenotype observation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007529 ad-hoc quantitative phenotype observation evidence used in automatic assertion true true A type of ad-hoc quantitative phenotype observation evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell transfection experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007530 cell transfection experiment evidence used in automatic assertion true true A type of cell transfection experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of yeast 2-hybrid evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007531 yeast 2-hybrid evidence used in automatic assertion true true A type of yeast 2-hybrid evidence that is used in an automatic assertion. ECO:RCT IEA A type of Cya fusion reporter assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007532 Cya fusion reporter assay evidence used in automatic assertion true true true A type of Cya fusion reporter assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of super-resolution microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007533 super-resolution microscopy evidence used in automatic assertion true true A type of super-resolution microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of fractionation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007534 fractionation evidence used in automatic assertion true true A type of fractionation evidence that is used in an automatic assertion. ECO:RCT IEA A type of electrophysiology assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007535 electrophysiology assay evidence used in automatic assertion true true A type of electrophysiology assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of mRNA interactome capture evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007536 mRNA interactome capture evidence used in automatic assertion true true A type of mRNA interactome capture evidence that is used in an automatic assertion. ECO:RCT IEA A type of patch-clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007537 patch-clamp recording evidence used in automatic assertion true true A type of patch-clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of whole-cell patch-clamp recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007538 whole-cell patch-clamp recording evidence used in automatic assertion true true A type of whole-cell patch-clamp recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of author statement from published clinical study that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco traceable author statement from published clinical study used in automatic assertion ECO:0007539 author statement from published clinical study used in automatic assertion true true A type of author statement from published clinical study that is used in an automatic assertion. ECO:RCT IEA A type of inference based on individual clinical experience that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007540 inference based on individual clinical experience used in automatic assertion true true A type of inference based on individual clinical experience that is used in an automatic assertion. ECO:RCT IEA A type of biofilm formation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007541 biofilm formation assay evidence used in automatic assertion true true A type of biofilm formation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of microtiter plate biofilm assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007542 microtiter plate biofilm assay evidence used in automatic assertion true true A type of microtiter plate biofilm assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of air-liquid interface assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007543 air-liquid interface assay evidence used in automatic assertion true true A type of air-liquid interface assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of colony biofilm assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007544 colony biofilm assay evidence used in automatic assertion true true A type of colony biofilm assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of Kadouri drip-fed biofilm assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007545 Kadouri drip-fed biofilm assay evidence used in automatic assertion true true A type of Kadouri drip-fed biofilm assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of co-immunoprecipitation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007546 co-immunoprecipitation evidence used in automatic assertion true true A type of co-immunoprecipitation evidence that is used in an automatic assertion. ECO:RCT IEA A type of optogenetic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007547 optogenetic evidence used in automatic assertion true true A type of optogenetic evidence that is used in an automatic assertion. ECO:RCT IEA A type of fluorescent sensor evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007548 fluorescent sensor evidence used in automatic assertion true true A type of fluorescent sensor evidence that is used in an automatic assertion. ECO:RCT IEA A type of genetically encoded fluorescent sensor evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007549 genetically encoded fluorescent sensor evidence used in automatic assertion true true A type of genetically encoded fluorescent sensor evidence that is used in an automatic assertion. ECO:RCT IEA A type of genetically encoded fluorescent electrophysiology assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007550 genetically encoded fluorescent electrophysiology assay evidence used in automatic assertion true true true A type of genetically encoded fluorescent electrophysiology assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007551 genetically encoded fluorescent ion concentration sensor assay evidence used in automatic assertion true true A type of genetically encoded fluorescent ion concentration sensor assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell fractionation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007552 cell fractionation evidence used in automatic assertion true true A type of cell fractionation evidence that is used in an automatic assertion. ECO:RCT IEA A type of extracellular recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007553 extracellular recording evidence used in automatic assertion true true A type of extracellular recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of single-unit extracellular recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007554 single-unit extracellular recording evidence used in automatic assertion true true A type of single-unit extracellular recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of field potential recording evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007555 field potential recording evidence used in automatic assertion true true A type of field potential recording evidence that is used in an automatic assertion. ECO:RCT IEA A type of anti-sense experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007556 anti-sense experiment evidence used in automatic assertion true true A type of anti-sense experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of morpholino experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007557 morpholino experiment evidence used in automatic assertion true true A type of morpholino experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of RNAi evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007558 RNAi evidence used in automatic assertion true true A type of RNAi evidence that is used in an automatic assertion. ECO:RCT IEA A type of pharmacological assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007559 pharmacological assay evidence used in automatic assertion true true A type of pharmacological assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunofluorescence wide-field microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007560 immunofluorescence wide-field microscopy evidence used in automatic assertion true true true A type of immunofluorescence wide-field microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of wide-field fluorescence microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007561 wide-field fluorescence microscopy evidence used in automatic assertion true true A type of wide-field fluorescence microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of over expression analysis evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007562 over expression analysis evidence used in automatic assertion true true A type of over expression analysis evidence that is used in an automatic assertion. ECO:RCT IEA A type of cell-free assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007563 cell-free assay evidence used in automatic assertion true true A type of cell-free assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of fluorescence recovery after photobleaching evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007564 fluorescence recovery after photobleaching evidence used in automatic assertion true true A type of fluorescence recovery after photobleaching evidence that is used in an automatic assertion. ECO:RCT IEA A type of immuno-labelling electron microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007565 immuno-labelling electron microscopy evidence used in automatic assertion true true A type of immuno-labelling electron microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of immunofluorescence super resolution microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007566 immunofluorescence super resolution microscopy evidence used in automatic assertion true true A type of immunofluorescence super resolution microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of co-purification evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007567 co-purification evidence used in automatic assertion true true A type of co-purification evidence that is used in an automatic assertion. ECO:RCT IEA A type of yeast one-hybrid evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007568 yeast one-hybrid evidence used in automatic assertion true true A type of yeast one-hybrid evidence that is used in an automatic assertion. ECO:RCT IEA A type of split-ubiquitin functional complementation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007569 split-ubiquitin functional complementation evidence used in automatic assertion true true A type of split-ubiquitin functional complementation evidence that is used in an automatic assertion. ECO:RCT IEA A type of far-Western blotting evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007570 far-Western blotting evidence used in automatic assertion true true A type of far-Western blotting evidence that is used in an automatic assertion. ECO:RCT IEA A type of affinity chromatography evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007571 affinity chromatography evidence used in automatic assertion true true A type of affinity chromatography evidence that is used in an automatic assertion. ECO:RCT IEA A type of ribohomopolymer binding assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007572 ribohomopolymer binding assay evidence used in automatic assertion true true A type of ribohomopolymer binding assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein:ion binding evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007573 protein:ion binding evidence used in automatic assertion true true A type of protein:ion binding evidence that is used in an automatic assertion. ECO:RCT IEA A type of Southwestern blot evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007574 Southwestern blot evidence used in automatic assertion true true A type of Southwestern blot evidence that is used in an automatic assertion. ECO:RCT IEA A type of Northwestern blot evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007575 Northwestern blot evidence used in automatic assertion true true A type of Northwestern blot evidence that is used in an automatic assertion. ECO:RCT IEA A type of bacterial one-hybrid evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007576 bacterial one-hybrid evidence used in automatic assertion true true A type of bacterial one-hybrid evidence that is used in an automatic assertion. ECO:RCT IEA A type of protein-oligonucleotide microarray binding evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007577 protein-oligonucleotide microarray binding evidence used in automatic assertion true true true A type of protein-oligonucleotide microarray binding evidence that is used in an automatic assertion. ECO:RCT IEA A type of functional complementation evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007578 functional complementation evidence used in automatic assertion true true A type of functional complementation evidence that is used in an automatic assertion. ECO:RCT IEA A type of transgenic rescue experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007579 transgenic rescue experiment evidence used in automatic assertion true true A type of transgenic rescue experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of transient rescue experiment evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007580 transient rescue experiment evidence used in automatic assertion true true A type of transient rescue experiment evidence that is used in an automatic assertion. ECO:RCT IEA A type of suppressor/enhancer interaction phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z suppressor/enhancer interaction evidence used in automatic assertion eco ECO:0007581 suppressor/enhancer interaction phenotypic evidence used in automatic assertion true true A type of suppressor/enhancer interaction phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of double mutant phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z double mutant phenotype evidence used in automatic assertion eco ECO:0007582 double mutant phenotypic evidence used in automatic assertion true true A type of double mutant phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of epistatic interaction phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z epistatic interaction evidence used in automatic assertion eco ECO:0007583 epistatic interaction phenotypic evidence used in automatic assertion true true A type of epistatic interaction phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of functional complementation in heterologous system evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007584 functional complementation in heterologous system evidence used in automatic assertion true true A type of functional complementation in heterologous system evidence that is used in an automatic assertion. ECO:RCT IEA A type of temperature-sensitive mutant phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z temperature-sensitive mutant phenotype evidence used in automatic assertion eco ECO:0007585 temperature-sensitive mutant phenotypic evidence used in automatic assertion true true A type of temperature-sensitive mutant phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of recessive mutant phenotype evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007586 recessive mutant phenotype evidence used in automatic assertion true true A type of recessive mutant phenotype evidence that is used in an automatic assertion. ECO:RCT IEA A type of high throughput mutant phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z high throughput mutant phenotype evidence used in automatic assertion eco ECO:0007587 high throughput mutant phenotypic evidence used in automatic assertion true true true A type of high throughput mutant phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of high throughput genetic interaction phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z high throughput genetic interaction evidence used in automatic assertion eco ECO:0007588 high throughput genetic interaction phenotypic evidence used in automatic assertion true true true A type of high throughput genetic interaction phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of high throughput direct assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007589 high throughput direct assay evidence used in automatic assertion true true true A type of high throughput direct assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of high throughput expression pattern evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007590 high throughput expression pattern evidence used in automatic assertion true true true A type of high throughput expression pattern evidence that is used in an automatic assertion. ECO:RCT IEA A type of radioligand binding assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007591 radioligand binding assay evidence used in automatic assertion true true A type of radioligand binding assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of combinatorial evidence from author knowledge and experimental evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z combinatorial evidence from author knowledge and experimental evidence used in automatic assertion eco ECO:0007592 combinatorial experimental and author inference evidence used in automatic assertion true true A type of combinatorial evidence from author knowledge and experimental evidence that is used in an automatic assertion. ECO:RCT IEA A type of combinatorial evidence from curator knowledge and experimental evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z combinatorial evidence from curator knowledge and experimental evidence used in automatic assertion eco ECO:0007593 combinatorial experimental and curator inference evidence used in automatic assertion true true A type of combinatorial evidence from curator knowledge and experimental evidence that is used in an automatic assertion. ECO:RCT IEA A type of voltammetry evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007594 voltammetry evidence used in automatic assertion true true A type of voltammetry evidence that is used in an automatic assertion. ECO:RCT IEA A type of photoconversion evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007595 photoconversion evidence used in automatic assertion true true A type of photoconversion evidence that is used in an automatic assertion. ECO:RCT IEA A type of agglutination test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007596 agglutination test evidence used in automatic assertion true true A type of agglutination test evidence that is used in an automatic assertion. ECO:RCT IEA A type of slide agglutination test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007597 slide agglutination test evidence used in automatic assertion true true A type of slide agglutination test evidence that is used in an automatic assertion. ECO:RCT IEA A type of direct Coombs test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007598 direct Coombs test evidence used in automatic assertion true true A type of direct Coombs test evidence that is used in an automatic assertion. ECO:RCT IEA A type of indirect Coombs test evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007599 indirect Coombs test evidence used in automatic assertion true true A type of indirect Coombs test evidence that is used in an automatic assertion. ECO:RCT IEA A type of direct hemagglutination assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007600 direct hemagglutination assay evidence used in automatic assertion true true A type of direct hemagglutination assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of viral hemagglutination inhibition assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007601 viral hemagglutination inhibition assay evidence used in automatic assertion true true A type of viral hemagglutination inhibition assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of compement fixation assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007602 compement fixation assay evidence used in automatic assertion true true A type of compement fixation assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of neutralization test assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007603 neutralization test assay evidence used in automatic assertion true true A type of neutralization test assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of copper transport assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007604 copper transport assay evidence used in automatic assertion true true A type of copper transport assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007605 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence used in automatic assertion true true A type of 5-cyano-2,3-ditolyl tetrazolium chloride staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of plaque assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007606 plaque assay evidence used in automatic assertion true true A type of plaque assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of epifluorescence microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007607 epifluorescence microscopy evidence used in automatic assertion true true A type of epifluorescence microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of transmission electron microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007608 transmission electron microscopy evidence used in automatic assertion true true A type of transmission electron microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of scanning electron microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007609 scanning electron microscopy evidence used in automatic assertion true true A type of scanning electron microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of time-lapsed microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007610 time-lapsed microscopy evidence used in automatic assertion true true A type of time-lapsed microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of phase contrast microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007611 phase contrast microscopy evidence used in automatic assertion true true A type of phase contrast microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of transmitted light brightfied mircoscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007612 transmitted light brightfied mircoscopy evidence used in automatic assertion true true A type of transmitted light brightfied mircoscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of koehler illumination microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007613 koehler illumination microscopy evidence used in automatic assertion true true A type of koehler illumination microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of differential interference contrast microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007614 differential interference contrast microscopy evidence used in automatic assertion true true A type of differential interference contrast microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of extended field laser confocal microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007615 extended field laser confocal microscopy evidence used in automatic assertion true true A type of extended field laser confocal microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of confocal laser scanning microscopy evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007616 confocal laser scanning microscopy evidence used in automatic assertion true true A type of confocal laser scanning microscopy evidence that is used in an automatic assertion. ECO:RCT IEA A type of light scattering evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007617 light scattering evidence used in automatic assertion true true A type of light scattering evidence that is used in an automatic assertion. ECO:RCT IEA A type of dynamic light scattering assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007618 dynamic light scattering assay evidence used in automatic assertion true true A type of dynamic light scattering assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of static light scattering assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007619 static light scattering assay evidence used in automatic assertion true true A type of static light scattering assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of colony papillation assay phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z colony papillation assay evidence used in automatic assertion eco ECO:0007620 colony papillation assay phenotypic evidence used in automatic assertion true true A type of colony papillation assay phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of crystal violet staining evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007621 crystal violet staining evidence used in automatic assertion true true A type of crystal violet staining evidence that is used in an automatic assertion. ECO:RCT IEA A type of flow cell biofilm assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007622 flow cell biofilm assay evidence used in automatic assertion true true A type of flow cell biofilm assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of bacterial 2-hybrid assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007623 bacterial 2-hybrid assay evidence used in automatic assertion true true A type of bacterial 2-hybrid assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of phenomic profiling assay evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007624 phenomic profiling assay evidence used in automatic assertion true true A type of phenomic profiling assay evidence that is used in an automatic assertion. ECO:RCT IEA A type of colony morphology phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z colony morphology evidence used in automatic assertion eco ECO:0007625 colony morphology phenotypic evidence used in automatic assertion true true A type of colony morphology phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of colony color phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z colony color evidence used in automatic assertion eco ECO:0007626 colony color phenotypic evidence used in automatic assertion true true A type of colony color phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of colony size phenotypic evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z colony size evidence used in automatic assertion eco ECO:0007627 colony size phenotypic evidence used in automatic assertion true true A type of colony size phenotypic evidence that is used in an automatic assertion. ECO:RCT IEA A type of zone of inhibition evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007628 zone of inhibition evidence used in automatic assertion true true A type of zone of inhibition evidence that is used in an automatic assertion. ECO:RCT IEA A type of Etest evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007629 Etest evidence used in automatic assertion true true A type of Etest evidence that is used in an automatic assertion. ECO:RCT IEA A type of ribosome profiling evidence that is used in an automatic assertion. rctauber 2018-05-14T09:47:55Z eco ECO:0007630 ribosome profiling evidence used in automatic assertion true true A type of ribosome profiling evidence that is used in an automatic assertion. ECO:RCT A type of evidence based on computational logical inference that is used in a manual assertion. rctauber 2018-05-14T09:47:55Z evidence based on computational logical inference used in manual assertion eco ECO:0007631 computational inference used in manual assertion true true true A type of evidence based on computational logical inference that is used in a manual assertion. ECO:RCT IDA A type of transcriptional activation assay evidence that is used in a manual assertion. rctauber 2018-05-18T08:34:35Z eco ECO:0007632 transcriptional activation assay evidence used in manual assertion true true A type of transcriptional activation assay evidence that is used in a manual assertion. ECO:RCT IEA A type of transcriptional activation assay evidence that is used in an automatic assertion. rctauber 2018-05-18T08:34:35Z eco ECO:0007633 transcriptional activation assay evidence used in automatic assertion true true A type of transcriptional activation assay evidence that is used in an automatic assertion. ECO:RCT EXP A type of experimental phenotypic evidence that is used in a manual assertion. rctauber 2018-06-20T02:12:00Z eco ECO:0007634 experimental phenotypic evidence used in manual assertion true true A type of experimental phenotypic evidence that is used in a manual assertion. ECO:RCT IEA A type of experimental phenotypic evidence that is used in an automatic assertion. rctauber 2018-06-20T02:12:00Z eco ECO:0007635 experimental phenotypic evidence used in automatic assertion true true A type of experimental phenotypic evidence that is used in an automatic assertion. ECO:RCT A type of curator inference from authoritative resource based on information located in a queryable database and is optimized for computers. eco ECO:0007636 curator inference from database A type of curator inference from authoritative resource based on information located in a queryable database and is optimized for computers. ECO:RCT A type of curator inference from published work where the reference is to an entry in a compendium that provides summarized information on a subject. eco ECO:0007637 curator inference from encyclopedia A type of curator inference from published work where the reference is to an entry in a compendium that provides summarized information on a subject. url:https://en.wikipedia.org/wiki/Encyclopedia A type of curator inference from encyclopedia where the reference is to a Wikipedia article. eco ECO:0007638 curator inference from Wikipedia A type of curator inference from encyclopedia where the reference is to a Wikipedia article. ECO:RCT A type of curator inference from encyclopedia where the reference is to an Encyclopedia Britannica article. eco ECO:0007639 curator inference from Britannica A type of curator inference from encyclopedia where the reference is to an Encyclopedia Britannica article. ECO:RCT A type of curator inference from encyclopedia in which the reference is to an article in the National Library of Medicine's MedLinePlus encyclopedia. eco ECO:0007640 curator inference from MedlinePlus encyclopedia A type of curator inference from encyclopedia in which the reference is to an article in the National Library of Medicine's MedLinePlus encyclopedia. ECO:RCT A type of curator inference from published work in which the entry comes from a collection of words with definitions, usages, pronounciations, and more. eco ECO:0007641 curator inference from dictionary A type of curator inference from published work in which the entry comes from a collection of words with definitions, usages, pronounciations, and more. url:https://en.wikipedia.org/wiki/Dictionary A type of curator inference from dictionary in which the reference is to an entry in the Oxford Dictionaries. eco ECO:0007642 curator inference from Oxford Dictionary A type of curator inference from dictionary in which the reference is to an entry in the Oxford Dictionaries. ECO:RCT A type of curator inference from dictionary in which the reference is to an entry in the Merriam-Webster Dictionary. eco ECO:0007643 curator inference from Merriam-Webster Dictionary A type of curator inference from dictionary in which the reference is to an entry in the Merriam-Webster Dictionary. ECO:RCT A type of curator inference from dictionary in which the reference is to an entry in the National Library of Medicine's MedLinePlus dictionary. eco ECO:0007644 curator inference from MedlinePlus dictionary A type of curator inference from dictionary in which the reference is to an entry in the National Library of Medicine's MedLinePlus dictionary. ECO:RCT A type of curator inference from published work reporting on research findings. eco ECO:0007645 curator inference from journal publication A type of curator inference from published work reporting on research findings. url:https://en.wikipedia.org/wiki/Scientific_journal A type of curator inference from published work based on a book, which may be a reference to a URL (for ebooks) or a DOI. eco ECO:0007646 curator inference from book A type of curator inference from published work based on a book, which may be a reference to a URL (for ebooks) or a DOI. ECO:RCT A type of curator inference that is from what is generally considered an authoritative source on the topic, including model organism databases, newspaper articles, books, journal publications, etc. eco ECO:0007647 curator inference from authoritative source A type of curator inference that is from what is generally considered an authoritative source on the topic, including model organism databases, newspaper articles, books, journal publications, etc. ECO:RCT A type of manually integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated manually. rctauber 2018-12-04T19:31:00Z eco ECO:0007648 manually integrated combinatorial computational evidence true true A type of manually integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated manually. ECO:RCT A type of manually integrated combinatorial computational evidence that is used in a manual assertion. rctauber 2018-12-04T19:31:00Z eco ECO:0007649 manually integrated combinatorial computational evidence used in manual assertion true true true A type of manually integrated combinatorial computational evidence that is used in a manual assertion. ECO:RCT IEA A type of manually integrated combinatorial computational evidence that is used in an automatic assertion. rctauber 2018-12-04T19:31:00Z eco ECO:0007650 manually integrated combinatorial computational evidence used in automatic assertion true true true A type of manually integrated combinatorial computational evidence that is used in an automatic assertion. ECO:RCT A type of automatically integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated automatically. rctauber 2018-12-04T19:31:00Z eco ECO:0007651 automatically integrated combinatorial computational evidence true true A type of automatically integrated combinatorial evidence in which two or more distinct types of computational evidence are integrated automatically. ECO:RCT RCA A type of automatically integrated combinatorial computational evidence that is used in a manual assertion. rctauber 2018-12-04T19:31:00Z eco ECO:0007652 automatically integrated combinatorial computational evidence used in manual assertion true true true A type of automatically integrated combinatorial computational evidence that is used in a manual assertion. ECO:RCT IEA A type of automatically integrated combinatorial computational evidence that is used in an automatic assertion. rctauber 2018-12-04T19:31:00Z eco ECO:0007653 automatically integrated combinatorial computational evidence used in automatic assertion true true true A type of automatically integrated combinatorial computational evidence that is used in an automatic assertion. ECO:RCT A type of combinatorial evidence in which two or more distinct types of experimental evidence are integrated. rctauber 2018-12-04T19:31:00Z eco ECO:0007654 combinatorial experimental evidence true A type of combinatorial evidence in which two or more distinct types of experimental evidence are integrated. ECO:RCT A type of manually integrated combinatorial evidence in which two or more distinct types of experimental evidence are integrated manually. rctauber 2018-12-04T19:31:00Z eco ECO:0007655 manually integrated combinatorial experimental evidence true true A type of manually integrated combinatorial evidence in which two or more distinct types of experimental evidence are integrated manually. ECO:RCT A type of manually integrated combinatorial experimental evidence that is used in a manual assertion. rctauber 2018-12-04T19:31:00Z eco ECO:0007656 manually integrated combinatorial experimental evidence used in manual assertion true true A type of manually integrated combinatorial experimental evidence that is used in a manual assertion. ECO:RCT IEA A type of manually integrated combinatorial experimental evidence that is used in an automatic assertion. rctauber 2018-12-04T19:31:00Z eco ECO:0007657 manually integrated combinatorial experimental evidence used in automatic assertion true true