{
"cells": [
{
"cell_type": "markdown",
"metadata": {},
"source": [
"# Create molecules from scratch"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"PyRNA allows you to construct easily DNA and RNA molecules. An RNA molecule will automatically convert T residues into U."
]
},
{
"cell_type": "code",
"execution_count": 3,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"my_rna: AGGGGAUUAACCCC\n",
"my_dna: GGTTGGATTAACCCC\n"
]
}
],
"source": [
"from pyrna.features import DNA, RNA\n",
"rna = RNA(name = 'my_rna', sequence = 'AGGGGATTAACCCC')\n",
"print \"%s: %s\"%(rna.name, rna.sequence)\n",
"dna = DNA(name = 'my_dna', sequence = 'GGTTGGATTAACCCC')\n",
"print \"%s: %s\"%(dna.name, dna.sequence)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"RNA and DNA molecules can return their length, are slicable and iterable:"
]
},
{
"cell_type": "code",
"execution_count": 4,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"slice: AG\n",
"length: 14\n"
]
}
],
"source": [
"print \"slice: %s\"%rna[0:2]\n",
"print \"length: %i\"%len(rna)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"You can easily get a single residue:"
]
},
{
"cell_type": "code",
"execution_count": 5,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"G\n"
]
}
],
"source": [
"print rna[3]"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"The sequence can be easily changed by adding a new string at the end:"
]
},
{
"cell_type": "code",
"execution_count": 6,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"AGGGGAUUAACCCCAAA\n"
]
}
],
"source": [
"rna +'AAA'\n",
"print rna.sequence"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"Or by removing some residues from the end:"
]
},
{
"cell_type": "code",
"execution_count": 7,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"AGGGGAUUAACCCC\n"
]
}
],
"source": [
"rna-3\n",
"print rna.sequence"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"An RNA molecule is iterable over its primary sequence:"
]
},
{
"cell_type": "code",
"execution_count": 8,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"residue n1: A\n",
"residue n2: G\n",
"residue n3: G\n",
"residue n4: G\n",
"residue n5: G\n",
"residue n6: A\n",
"residue n7: U\n",
"residue n8: U\n",
"residue n9: A\n",
"residue n10: A\n",
"residue n11: C\n",
"residue n12: C\n",
"residue n13: C\n",
"residue n14: C\n"
]
}
],
"source": [
"for index, residue in enumerate(rna):\n",
" print \"residue n%i: %s\"%(index+1, residue)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"# Create molecules from files"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"With PyRNA, an object pyrna.features.TertiaryStructure is made with a single molecular chain. Since a PDB file can contains several molecules, the function parse_pdb() returns a list of such objects."
]
},
{
"cell_type": "code",
"execution_count": 12,
"metadata": {
"collapsed": false
},
"outputs": [],
"source": [
"h = open('../data/1ehz.pdb')\n",
"pdb_content = h.read()\n",
"h.close()\n",
"\n",
"from pyrna.parsers import parse_pdb\n",
"tertiary_structures = parse_pdb(pdb_content)"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"RNA molecules extracted from PDB files can contain modified residues. PyRNA converts them automatically into unmodified residues, and stores the modification in a dictionary."
]
},
{
"cell_type": "code",
"execution_count": 13,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"A\n",
"GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA\n",
"[('2MG', 10), ('H2U', 16), ('H2U', 17), ('M2G', 26), ('OMC', 32), ('OMG', 34), ('YYG', 37), ('PSU', 39), ('5MC', 40), ('7MG', 46), ('5MC', 49), ('5MU', 54), ('PSU', 55), ('1MA', 58)]\n"
]
}
],
"source": [
"for ts in tertiary_structures:\n",
" print ts.rna.name\n",
" print ts.rna.sequence\n",
" print ts.rna.modified_residues"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"If you want to parse a FASTA file, you have to precise the type of molecules stored. DNA molecules are faster to create since PyRNA will not try to identify modified residues."
]
},
{
"cell_type": "code",
"execution_count": 15,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"sequence of telomerase 1:\n",
"AGUUUCUCGAUAAUUGAUCUGUAGAAUCUGUCAAGCAAAACCCCAAAACCUUACACUGAGAGCAUUUAGCCUGAUUACUCUUUAAAUCAAAUCAGGCAAUAGAGAGAAACUCGAGAGGUGAAAACCCCACAGCAUUCUGAAAUGUAUUUGGGAGUAAUCUCAUAUUAGUUUGCUGUCCUCUCAUCUUUU\n",
"\n",
"sequence of telomerase 2:\n",
"AUCCCCGCAAAUUCAUUCUGUUUGCAUUCAAACAGUCAUUCAACCCCAAAAAUCUAGACCAAAUAUUGUCUUCCCUUCUUGGCACAAACAAAGAAGAGACGCGGGAUAAAGAUACUCCGACGAUUGAUACAAUAUUUAUCAACGGGAGGUCUUACUUUU\n",
"\n",
"sequence of telomerase 3:\n",
"UACCUCCUGUGGAUCCAUUCAGGAUUAAUGAAAUCCUGUCAUUCAACCCCAAAAAUCUUGUCAAAUUAUUGCCUCGUCUUUUGGGCACAAACAAAAGUCACGCAGGAGGUUCAGACAUUCGACAUAAGAUACACUAUUUAUCUUAUGGAAGGUCUAGUUUUU\n",
"\n"
]
}
],
"source": [
"h = open('../data/telomerases.fasta')\n",
"fasta_content = h.read()\n",
"h.close()\n",
"\n",
"from pyrna.parsers import parse_fasta\n",
"#the default type is RNA\n",
"for rna in parse_fasta(fasta_content):\n",
" print \"sequence of %s:\"%rna.name\n",
" print \"%s\\n\"%rna.sequence"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"An object RNA will automatically convert T residues into U."
]
},
{
"cell_type": "code",
"execution_count": 17,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"sequence as a DNA:\n",
"TAACAATCTGCTGAAAGGTACCGTCGGAGGGAGCTTTGTTGCCAGCGCCAGAAACGCCGGTTTAACCAGCGCCGAAGTGAGCGCAGTGATTAAAGCCATGCAGTGGCAAATGGATTTCCGCAAACTGAAAAAAGGCGATGAATTTGCGGT\n",
"\n",
"sequence as an RNA:\n",
"UAACAAUCUGCUGAAAGGUACCGUCGGAGGGAGCUUUGUUGCCAGCGCCAGAAACGCCGGUUUAACCAGCGCCGAAGUGAGCGCAGUGAUUAAAGCCAUGCAGUGGCAAAUGGAUUUCCGCAAACUGAAAAAAGGCGAUGAAUUUGCGGU\n"
]
}
],
"source": [
"h = open('../data/ft3100_from_FANTOM3_project.fasta')\n",
"fasta_content = h.read()\n",
"h.close()\n",
"\n",
"for dna in parse_fasta(fasta_content, 'DNA'):\n",
" print \"sequence as a DNA:\"\n",
" print \"%s\\n\"%dna.sequence\n",
"\n",
"for rna in parse_fasta(fasta_content):\n",
" print \"sequence as an RNA:\"\n",
" print rna.sequence"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"DNA and RNA objects have a rich textual representation in Jupyter notebooks. "
]
},
{
"cell_type": "code",
"execution_count": 18,
"metadata": {
"collapsed": false
},
"outputs": [
{
"data": {
"text/html": [
"1\tUAACAAUCUGCUGAAAGGUACCGUCGGAGGGAGCUUUGUUGCCAGCGCCAGAAACGCCGG\n",
"61\tUUUAACCAGCGCCGAAGUGAGCGCAGUGAUUAAAGCCAUGCAGUGGCAAAUGGAUUUCCG\n",
"121\tCAAACUGAAAAAAGGCGAUGAAUUUGCGGU\n",
""
],
"text/plain": [
""
]
},
"execution_count": 18,
"metadata": {},
"output_type": "execute_result"
}
],
"source": [
"parse_fasta(fasta_content)[0]"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"# Create molecules from databases"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"You can load 3D structures directly from the Protein Databank"
]
},
{
"cell_type": "code",
"execution_count": 19,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": [
"from pyrna.db import PDB\n",
"pdb = PDB()\n",
"pdb_content = pdb.get_entry('1GID')"
]
},
{
"cell_type": "markdown",
"metadata": {},
"source": [
"With PyRNA, a pyrna.features.TertiaryStructure object is made with a single molecular chain. Since a PDB file can contains several molecules, the function parse_pdb returns a list of pyrna.features.TertiaryStructure."
]
},
{
"cell_type": "code",
"execution_count": 20,
"metadata": {
"collapsed": false
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"molecular chain A: GAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC\n",
"molecular chain B: GAAUUGCGGGAAAGGGGUCAACAGCCGUUCAGUACCAAGUCUCAGGGGAAACUUUGAGAUGGCCUUGCAAAGGGUAUGGUAAUAAGCUGACGGACAUGGUCCUAACCACGCAGCCAAGUCCUAAGUCAACAGAUCUUCUGUUGAUAUGGAUGCAGUUC\n"
]
}
],
"source": [
"from pyrna.parsers import parse_pdb\n",
"\n",
"for tertiary_structure in parse_pdb(pdb_content):\n",
" print \"molecular chain %s: %s\"%(tertiary_structure.rna.name, tertiary_structure.rna.sequence)"
]
},
{
"cell_type": "code",
"execution_count": null,
"metadata": {
"collapsed": true
},
"outputs": [],
"source": []
}
],
"metadata": {
"anaconda-cloud": {},
"kernelspec": {
"display_name": "Python [Root]",
"language": "python",
"name": "Python [Root]"
},
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 2
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython2",
"version": "2.7.12"
}
},
"nbformat": 4,
"nbformat_minor": 0
}