[{ "paper_id": "0036b28fddf7e93da0970303672934ea2f9944e7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "005c43980edf3fcc2a4d12ee7ad630ddb651ce6e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For the rapid test, patient throat swab samples were directly applied to assays, and results were read in 20 min.", "There is a critical need for POCT diagnostics in healthcare which can have a positive impact on the quality of life worldwide [20] . POCT devices of interest include smartphones [20] , wearable devices [21] , other complementary metal-oxidesemiconductor (CMOS) imaging devices [22] , and strip readers [23] . Among them, devices integrating with personal computer have revolutionized research in recent decades, and smartphones are now finding increasing application in a wide variety of research domains as they are expedited by the integrated data capture, processing capability (e.g., lab in a phone), operability, compact form, relatively low cost, and very widespread circulation [24] .", "For the H5N1-negative control group, Vietnamese patients with an unknown disease (n = 3), respiratory syncytial virus (RSV) (n = 17), metapneumovirus (MPV) (n = 4), bocavirus (HBO) (n = 2), parainfluenza virus (PIV) (n = 5), human rhinovirus (HRV) (n = 5), co-infection of RSV and coronavirus (CoV) (n = 1), CoV NL63 (n = 2), co-infection of human enterovirus (HEV) and CoV (n =1), and a Korean patient with unknown disease (n = 1) were tested using SRDFDS. This research was approved by the Wonkwang University Hospital Institutional Review Board (approval no.: WKIRB-201607-HRBR-078).", "Supplementary figures. http://www.thno.org/v08p6132s1.pdf", "Program of the NRF funded by the Korean government, MSIP (2014M3A9E2064699).", "Despite the versatile tunability of the emission peaks of QDs in multiplexed diagnostic systems, few reports show their application in clinical diagnostics [29, 30] . Since high-fluorescent QDs are usually synthesized at elevated temperatures in organic solvents, they are only soluble in non-polar organic solvents, which are not suitable for biological applications, water compatibility, and bioconjugation. When QDs are covered with hydrophilic shells using tedious processing [31] , the signal is too weak for the visible readouts of POCT requiring encapsulation of many QDs in an individual nanoparticle [32] ." ] },{ "paper_id": "006be99e337c84b8758591a54f0362353b24dfde", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "I would like to thank David Samols, Irving Kushner, and Stanley Ballou for stimulating discussions; Alan Tartakoff, Kenneth Neet, and Cecil Cooper for technical advice; David Bole for the generous gift of anti-BiP antibody and instructions in its usage; Patricia Kalonick, Judith Preston, and Debra Rzewnicki for technical assistance; and Thomas Massella for the EM. This work was supported by grant No. AR34313 from the National Institutes of Health.", "Received for publication 31 January 1992 and in revised form 23 April 1992." ] },{ "paper_id": "00a00d0edc750db4a0c299dd1ec0c6871f5a4f24", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "00e5a723d44eb9f2698c38b518eff85c00f9753b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "01297dffaf94c1314ca46088f7b829b8383c2f73", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "013d9fb8719d3d3d47738f9f0604f3b643c4df57", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "014e31dce7e3f2b1a7020a5debfbf228182f8b5e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The most common hospital-acquired infections are those associated with surgery; in the gastrointestinal tract, bloodstream, or urinary tract via a catheter; and ventilator-associated pneumonia 4, 5) . Ebola virus, Middle East respiratory syndrome coronavirus, hepatitis B virus (HBV), and norovirus are pathogens that have been linked to occupational infection 6 -9) .", "In the case of accidental infection, the most common routes of pathogen entry are aerosol inhalation, percutaneous inoculation through needles or broken glass, animal bites or scratches, direct contact with contaminated surfaces, and accidental ingestion through a pipette 2, 3) .", "Accidental occupational infections occur in laboratories, hospitals, and animal handling facilities as well as in some industries, pharmaceutical and food production, and agriculture 1) ." ] },{ "paper_id": "0167dddb0e2783a60841b8e6f2b4e4cb981904e2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Expansion of the clinical database of bovine EOE is needed to clarify the etiology of this disease.", "The underlying cause and pathophysiologic mechanism of EOE have not been determined in humans and animals [1, 2, 7] ; possible proposed causes include food allergies and endoparasitism. Interestingly, the typical symptoms of chronic diarrhea continued in the heifer in Case 3 from the lactation period to slaughter, indicating that food allergies are a possible cause of EOE from birth to maturity in cattle.", "In conclusion, to our knowledge, these cases are the first JB cattle cases of idiopathic EOE. The excretion of spherical tissues in the feces may serve as an important and identifiable clinical sign in affected cattle. Idiopathic EOE should be considered a differential diagnosis in cases of chronic obstinate diarrhea in Jb cattle.", "The white blood cell (WBC) counts were 8,800 and 10,500 cells/\u00b5l, and the percentages of eosinophils were 3% and 1%, respectively, which indicated no elevation of eosinophils in the peripheral blood. Parameters reflecting hydration status were all within the normal range. Additionally, although the levels of certain serum biochemical parameters were outside the reference range (e.g., in Case 3, the high GGT concentration [37.0 U/l] was considered to reflect cholangitis diagnosed when the animal was slaughtered), no abnormalities in the biochemical profile of the parameters reflecting albumin and electrolyte levels affected by enteritis were observed. Overall, the results of hematological and biochemical analyses prior to slaughter indicated no signs of inflammatory reaction in 2 of the animals with EOE." ] },{ "paper_id": "018b5b5f732e955d349e14a83481739502ae104c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Respondents to the interviews were aged 15 years and older and were considered key informants of the villages where they resided. They included leaders in the community, at children's health centers, and of farmer and/or fishermen groups, as well as religious and youth leaders. ", "Indirect contact, which includes eating fruit contaminated by bats and/or eating domestic animals infected with disease by flying foxes, also poses potential risks for infection. In Bangladesh, the primary pathway of NiV transmission from bats to people is through consumption by humans of raw date palm sap that has been contaminated with bat saliva [16] . In a study in Africa, NiV was detected in 48% and 3-4% of bat and human samples, respectively, by seroneutralization assay [24] . People who butchered bats for consumption were exclusively seropositive for NiV [24] .", "doi: 10 .1292/jvms. to hunt wild boars or as guard dogs, such that the population of dogs in Garut is comparatively high in Indonesia. A huge nature conservation area, Leuweung Sancang (2,157 hectares), is located on the south coast of Garut District [17] , as shown in Fig. 1 .", "The educational attainment of more than half of the respondents in our study was elementary level. This might be associated with the age of most respondents (over 40 years). The educational level in area (c) seemed to be lower than the other two areas, which is probably because area (c) is a mountainous region with limited access to roads and schools." ] },{ "paper_id": "01aa247284f0baf43293d8ea335b70781365a985", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Quantitative results were expressed as mean \u00b1 SD, and groups were compared by using the one-sample t-test. P values < 0.05 were considered statistically significant. MedCalc software version 16.2 (MedCalc Software bvba, Ostend, Belgium) was used for statistical analysis." ] },{ "paper_id": "01af2562df4acf3113843d039c3b82bb801b1427", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "During the 2014 outbreak, RSV infection was diagnosed by reverse transcriptase polymerase chain reaction using respiratory specimens, and genetic proximity was confirmed by a phylogenetical analysis (15). Eight RSV-infected patients", "The clinical information and chest X-ray findings were retrospectively reviewed from patient medical records within one week of the chest CT scan.", "The medical records and radiological images of the collected cases were retrospectively reviewed, with identifying information removed. This study was reviewed and approved by the Clinical Research Ethics Committee of University of the Ryukyus." ] },{ "paper_id": "01b3d789dbd69fff374842fbe2d7f4150fb3d8f5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "SF213-224 were constructed as follows. First the entire BglII-NcoI fragment of pSF2 was replaced by a synthetic dsDNA fragment (5 0 -GATCTTAATACGACTCAC TATA-GGGCTCATTTAAACTAGTTGAGGGGCCA TATTTCGC-3 0 and 5 0 -CATGGCGAAATATGGCCC CTCAACTAGTTTAAATGAGCCCTATAGTGAGTC GTATTAA-3 0 , sequences forming a SpeI restriction site are underlined). The resulting plasmid pSF208 was opened at the BglII and SpeI sites and oligonucleotides SF226 (5 0 -GATCTTAATACGACTCACT-ATAGGGCTCAGG GAAA-3 0 ) and SF227 (5 0 -CTAGTTTCCCTGAGCCCT ATA-GTGAGTCGTATTAA-3 0 ) were inserted. This yielded pSF212, which was subsequently digested with SpeI and NcoI to insert sets of complementary oligonucleotides corresponding to mutants SF213-224. The sequences of these oligonucleotides are available on request. All mutants were checked by dideoxy sequencing and are listed in Table 1 .", "Although the time scale of folding (milliseconds) may at first seem irrelevant compared to the time scale of translation elongation (seconds) it has recently been reported that the conversion rate between two comparatively stable hairpins ranges from a few seconds to several minutes (39) . Also, slow-folding pseudoknots, 5-350 s, limit the activity of the Hepatitis Delta virus ribozyme (40) . Thus the efficiency of a frameshifter pseudoknot may not be solely dictated by its stability but also by its kinetic properties.", "SF222 by still having C24, was capable of shifting 30% of the translating ribosomes. Thus, it appears that depending on the context deleting C24 is not always beneficial for frameshifting.", "Reactions contained 4 ml of RNA solution, 4.5 ml of reticulocyte lysate (Promega), 1 ml of 35 S methionine (ICN, in vitro translation grade), 0.5 ml of 1 mM amino acids (\u00c0Met) and were incubated for 60 min at 28 C. Samples were boiled for 3 min in the Laemmli buffer and loaded onto 12% SDS polyacrylamide gels. Gels were dried and exposed to phosphoimager screens. Band intensity of 0 frame and \u00c01 frame products was measured using Molecular Imager FX (Biorad) and Quantity One software. Frameshift percentages were calculated as the amount of \u00c01 frame product divided by the sum of 0 and \u00c01 frame products, corrected for the number of methionines, multiplied by 100." ] },{ "paper_id": "01bc7fe59fc7feb0e3d23c716aa23a694a4362a2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "01de46a248049d2fbdc049b686ee5b172301d0fa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "021291da7cf3769e4182317703a95b6c5f7c76f9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "022abf5f202c04e2bbf88d829db9844746e0fb71", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "02450c2c82a1511cb5e1639d3b8438f69bbe11f0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "766 | E. Ahat et al.", "For drug treatment, 5 \u00b5g/ml BFA, 500 ng/ml Noc, 100 \u00b5g/ml CHX, 50 \u00b5M MG132, or 2 \u00b5M monensin was directly applied to the medium alone or in combination for indicated times. Cells were lysed and analyzed by Western blotting.", "In all figures, the quantification results are expressed as the mean \u00b1 SEM from three independent experiments, unless otherwise stated. The statistical significance of the results was assessed using a Student's t test. *, p < 0.05, **, p < 0.01, ***, p < 0.001." ] },{ "paper_id": "02522a1b4512e4d2880a6a551a8dff589d4cb393", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Expression plasmids for viral GPs [24, 25] , lectins [24, 26] , Ctype lectin domain family 5 member A (CLEC5A) [27] , NPC1 [7] , TIM-3 [28] , angiotensin-converting enzyme 2 [24] , and folate receptor \u03b1 [29] were described elsewhere. The plasmid encoding Axl was purchased (ImageGenes). Expression plasmids for human TIM-1, TIM-4, and scavenger receptor A (SR-A) were generated by reverse-transcriptase polymerase chain reaction (RT-PCR) and cloning of products into plasmid pCAGGS. The integrity of all PCR-amplified sequences was confirmed by automated sequence analysis. Antibodies against entry factors were purchased from R&D Systems.", "Cell lines were maintained in Dulbecco's modified Eagle medium or Roswell Park Memorial Institute 1640 medium, supplemented with 5%-10% fetal bovine serum and antibiotics. THP-1 monocytes were differentiated into macrophages by exposure to phorbol-12-myristate-13-acetate (Sigma). Primary human monocyte-derived macrophages (MDMs) were cultured in monocyte differentiation medium: X-VIVO 10 (Lonza) supplemented with 1% human fibrin-depleted plasma and antibiotics. All cells were grown in a humidified atmosphere at 37\u00b0C and 5% carbon dioxide.", "depend on parallel expression of Mer, a scenario in keeping with published findings [39] ." ] },{ "paper_id": "025ed2caa0ae1ab7f04d3479116e6ed2a334938d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Hypothesis/Objectives: The objective is to describe the clinicopathological phenotype of affected Holstein cattle homozygous for the causative apolipoprotein B gene (APOB) mutation.", "Methods: This case review included a full clinical examination, a complete blood count, blood chemistry, and measurements of cholesterol and triglycerides. The animals were euthanized and necropsied. A PCR-based direct gene test was applied to determine the APOB genotype.", "Animals: Six Holstein cattle, 5 calves with a clinical history of chronic diarrhea, and 1 heifer with erosions in the buccal cavity and neurologic symptoms were admitted to the Clinic for Ruminants.", "Conclusions and clinical importance: Suspicion of CD in Holstein cattle is based on the presence of chronic diarrhea with no evidence of primary infections. Confirmation of the associated APOB gene mutation is needed. Additionally, the heifer demonstrated primarily signs of neurologic disease providing an unexpected phenotype of CD." ] },{ "paper_id": "0260e364e040cc9b229b2b4f727bfc2e4d68474d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "02d9be8cdb8499cd90f2c9cee8421b02b2bbba76", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "02eb3dc5054c0dd2ce8faa06d6942484900d76c6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Nucleic Acids Research, 2017 , Vol. 45, No. 5 2677 ", "Indirect immunofluorescence and direct GFP-fluorescence analysis was done as described before (13) . Images were visualized at a Zeiss Axiophot microscope using a 40\u00d7 1.3 oil immersion Plan-Neofluor objective and processed with NIS-Elements BR 3.10 and ImageJ software.", "Data are reported as mean values from at least three biological replicates with error bars denoting standard deviations (SDs). The two groups were compared using a paired twotailed Student's t-test. The significance level was set at P values *P < 0.05, **P < 0.01. Quantification of western blots and radioactive signals was performed using Image Gauge and ImageJ software." ] },{ "paper_id": "02f267368636c422f19d77d3be96de3c0dcbceef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A reverse transcriptase (RT)-PCR was set up to amplify and biotin-label the nucleic acid of human rotavirus A from these clinical samples.", "The ZipScores from up-and downstream zipping were then added; the final NucZipScore = ZipScore downstream+ZipScore upstream.", "Supplementary Data are available at NAR Online.", "Alternatively, the Brownian movements of the two long non-hybridized sections could mechanically stress the remaining base pairs." ] },{ "paper_id": "0322eccb9230a1aad165702457091eb9ae122d55", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0346cb9d0f5b07fe50d9a3cc0378a53f1a87708c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Yuan S. 2015. Statins may decrease the fatality rate of Middle East respiratory syndrome infection. mBio 6(4):e01120-15.", "Downstream of TLR-MYD88 pathways, activation of NF-B is a hallmark of coronavirus infections, and inhibition of NF-B reduced lung infection and significantly increased mouse survival after SARS-CoV infection (7) .", "Despite the opposite functions of TLR4s in AIV and SARS-CoV infections, MYD88 (myeloid differentiation primary response 88; downstream of TLRs) plays an important role in the survival of respiratory virus infections (Fig. 1) . The MYD88 gene was observed to be highly induced by SARS-CoV infection (1). Interestingly, either excessive expression of MYD88 (1) or a deficiency in MYD88 expression (6) resulted in high mortality rates after MERS-CoV infections, implying that a balanced immune response is crucial for survival of respiratory virus infections." ] },{ "paper_id": "035dc4021101af0a19152cb5ea7b40b0c57ed76d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Sia is the name given to the nonulosonic carbohydrate neuraminic acid (Neu) that contains an acetyl group at the fifth carbon position, hence Neu5Ac. In many animal species the acetyl group also undergoes enzymatic transformation to form a glycolyl group -Neu5Gc. Humans lack the enzyme that performs this transformation, however small amounts of Neu5Gc may be incorporated into humans from the diet [18, 19] .", "There are a number of good review articles on this pathway available [59] [60] [61] . These pathways exist in order to distinguish host \"self\" RNA from invading pathogenic RNA (i.e \"non-self\"). The intracellular detection of this RNA was ascribed to two cytoplasmic helicases called RIG-I and melanoma differentiationassociated gene 5 product (MDA5). RIG-I has 2 consecutive caspase activation and recruitment domains (CARD), a central helicase domain and a C-terminal domain (Fig. 3) . Knockout studies showed that RIG-I and MDA5 were able to discriminate between different strains of virus -RIG-I for the ortho, paramyxo and rhabdoviruses and MDA5 for the picornaviruses [62] .", "Nicholls JM \u2022 Influenza and innate immunity www.icjournal.org" ] },{ "paper_id": "036a7af6f90c822210bcac1869a5e85303bb0ef6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Setting: A total of 26 dermatology and sexually transmitted disease (STD) departments, 34 obstetricsgynaecology clinics and 28 urology outpatient clinics selected from 34 hospitals of Shenzhen regarded as our study sites.", "Investigators and quality control staff in our study were trained to ensure that their work complied with standards and methods of this survey. Coding labels, supplies, specimen preservation and transportation strictly abided by the ISO17025 laboratory accreditation standards. The operating procedures were performed in strict accordance with the COBAS AMPLICOR CT/NG Test instructions." ] },{ "paper_id": "03a9a21fad1427fc2dbb6a4969627d0a76459597", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "03afd58d8d29e1c6d008e06e38553079bbdc4d02", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "03d003f7c962aa4f0394e79f38a332662105cdb3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "03d3f764353cecb297c318e55b88be1d5664bf5c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "At the individual level, support is needed to help survivors resume normal lives and to address challenges such as emotional distress, health issues, loss of possessions, and difficulty regaining their livelihoods. 103 ", "Folayan et al forgo their freedom for the public good through quarantine and isolation should be compensated. 39 A broad public debate in each country is, however, required on how best to achieve equity. The outcome of the debate should inform policy and guidelines development.", "The authors report no conflicts of interest in this work" ] },{ "paper_id": "03e8628eb61ff4c66a17673745a7b9c33aece853", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "041adbe00a7ca71fcbc38ff4406297ce86e93a6a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The behavior of the epidemic curve followed the seasonal influenza pattern of sustained and self-limiting transmission.", "The signs and symptoms of influenza are nonspecific: sudden fever, cough, headache, muscle pain, joint pain and coryza 1 with clinical characteristics that vary from asymptomatic cases to severe cases leading to death, making it a challenge to the surveillance system.", "The registrations that did not have the required data filled were excluded from the proportions calculation. Frequencies and proportional distributions of reported cases were presented. When appropriate, the odds ratio of exposure and the 95% confidence interval were calculated.", "We had the same limitations described by several authors that conducted studies using secondary data related to: data quality, difficulty and heterogeneity when filling the disease reporting form, underreporting and inaccuracy of the data collected, registration priority of severe cases or cases of people that belong to risk groups." ] },{ "paper_id": "043aa68f2c784899f71225e8eb233150760a6a54", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The direction of the spread of pandemic influenza was from the southeast to the northwest, indicating how the virus benefited from entering the country through international airports in the coastal areas and spreading further along routes of long-distance domestic travel.", "Analyzing the information gathered and unearthing underlying risk factors provide an opportunity to identify epidemic characteristics and transmission patterns of the pandemic in China, thereby producing useful information for prevention and control measures during future epidemics. In this study, we aimed to characterize the temporal and spatial distribution of pandemic influenza in mainland China, to understand the diffusion pattern of the disease within the country, and to identify risk factors for invasion and local transmission of this disease.", "With the fast-growing public transportation infrastructure and increasing socioeconomic activities, travel has become an important issue in the prevention of emerging airborne infectious diseases such as influenza, especially during the introduction period. Obviously, the presence of airports and high densities of transportation routes coincide with more developed areas (i.e., those with a higher population density and more medical facilities); however, after we corrected for these factors, proximity to airports and the presence of national highways or freeways remained significantly associated with the spread of the infection." ] },{ "paper_id": "04421db3d34e7fd7c7486d66d21b34978a1fb362", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical methods. Mean \u00b1 SEM is depicted in all graphs. A two-tailed unpaired Student's t test was used to determine statistical differences. Statistical significance was assigned to p-values <0.05. All statistical analyses and plots were produced in Prism (GraphPad Software).", "Flow cytometry and cell sorting. The blocking of Fc receptors was performed with 2.4G2 mAb before staining with the indicated surface or intracellular antibodies (BD, BioLegend, and eBioscience). Flow cytometry was performed using an LSR II flow cytometer (BD). NKG2D ligand staining was done using mouse NKG2D-human Ig fusion protein for 30 min at 4\u00b0C, followed by PE-conjugated goat anti-human IgG Fc antibody (Luminex) for 15 min at 4\u00b0C. In proliferation assays, NK cells were labeled with 5-\u00b5M CTV (Invitrogen) before transfer, and labeling was performed according to the manufacturer's protocol (Invitrogen). The data were analyzed using FlowJo software (Tree Star). The enrichment and adoptive transfer of NK cells were performed as previously described (Sun et al., 2012) ." ] },{ "paper_id": "044d6ebfdeacd8fbdd4f039872020cd4adbbe138", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Animals: One hundred dairy calves with naturally acquired BRD.", "Conclusions and Clinical Importance: This study provides guidance for veterinarians selecting diagnostic tests for antemortem identification of pathogens associated with BRD.", "Objective: To evaluate agreement among TTW and NS, NPS, or BAL for identification of viral and bacterial pathogens in dairy calves with BRD." ] },{ "paper_id": "046b480f92a27f809d67c98c77752037f3342d2a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In addition, individuals with low viral load are more likely to be co-infected with other pathogens compared to those with high viral load (57% vs 38.9%) [84] .", "In this review, we examine the current knowledge and recent findings on the taxonomy, biology, epidemiology, pathogenesis and diagnosis methods of HBoV.", "Furthermore, other studies demonstrated that HBoV1 induces IFN-\u03b3 against HBoV VP2 VLPs, IL-10 and IL-13 (Th2 cells) in CD4+ T cells [97, 98] . These findings suggest that HBoV infection can induce production of Th1 and Th2 cytokines. To date, however, the precise mechanisms underlying HBoV-specific T cell immunity have not been defined.", "In conclusion, a better understanding of the natural course of HBoV infection, the implementation of experimental systems to analyse the replication cycle in more detail and the development of specific therapies are important and urgent needs." ] },{ "paper_id": "049364026266fb6b0b8d8a626844823a3036e5b0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In summary, environmental variations constitute an important factor in the occurrence and spread of infectious diseases in general. This is particularly important for arthropod-borne diseases, where environmental changes can influence both their geographic range and the risk of introduction (Sutherst, 2004; Gould and Higgs, 2009; Tabachnick, 2010) .", "www.frontiersin.org", "This work was funded by EU grant HEALTH.2010.2.3.3-3 Project 261391 EuroWestNile.", "In the case of vector-borne diseases, in addition to pathogen and host, infectious cycle requires a third player: the vector. This fact results in a more complex eco-epidemiology. Habitats of arthropod vectors depend on a number of environmental conditions, including range of temperature, humidity, water availability, etc. Arboviruses (i.e., viruses transmitted by arthropod vectors), are distributed necessarily in areas where populations of competent vectors (i.e., vectors which are able to spread the disease to new hosts) are abundant enough. Each arthropod vector species occupies a particular ecological niche within specific environmental conditions, so that its distribution can be greatly affected by changes in temperature, rainfall, humidity, plant coverage, etc. (Randolph and Rogers, 2010; Weaver and Reisen, 2010) .", "Clinical manifestations range from subclinical infection to acute illness that can be fatal. Expression of BT disease reflects a variety of virus, host, and vector factors (MacLachlan, 2004) . Clinical signs in sheep include pyrexia, tachypnea, nasal discharge, and lethargy. Pathology is characterized by generalized edema, hemorrhage, especially in lymph nodes, lungs, heart, and skeletal muscle and necrosis on the surface of the oro-nasal mucosa and gastro-intestinal tract (reviewed in MacLachlan et al., 2009) ." ] },{ "paper_id": "04c77d3ae97fcb0cb3d82480c5f75513f6266662", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study was conducted as a prospective cross-sectional observational study. A prior sample size calculation was not performed." ] },{ "paper_id": "04e156a83cb3b0b2da2ed07eec1a669be53575b5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There are several kinds of reporting dyes used for probe-based real-time PCR assays based on fluorescence energy wavelength. This facilitates multiplexing by combining different reporting dyes. Theoretically, multiplex real-time PCR can simultaneously detect up to four different targets in the same sample [18] . Nevertheless, there is a size limit for the PCR product (usually less than 200 bp) in order to maintain stable sensitivity [141] . The primers and probes should thus be carefully designed when a multiplex real-time PCR assay is performed. \"Cross-talk\" between different dyes due to close proximity in fluorescence energy wavelength is another factor to take into consideration when multiplexing.", "6 virus particles per mL) in the specimen for virus detection (i.e., low sensitivity) and cannot concurrently evaluate multiple samples [38] . The collection of fecal samples from clinically ill animals with acute diarrhea is important for successful EM. The cost of electron microscopes and requirement of skilled laboratory personnel is still a challenge for EM use as a routine An overview of calf diarrhea -infectious etiology, diagnosis, and intervention 7 diagnostic test. Nevertheless, EM is a tool to use when diarrhea with an unknown infectious cause is encountered.", "The invasion of C. parvum into enterocytes induces changes in intestinal cytoskeleton structures, such as loss of microvilli and shortening of columnar epithelial cells, leading to severe villous atrophy in infected animal [54] . Damage to the intestinal epithelium causes prolonged malnutrition and reduced growth rates in affected calves due to malabsorption and fermentation of undigested milk in the intestinal lumen [96] . These result in considerable economic losses in cow-calf production.", "Cow nutrition is closely associated with weak labor, amount of milk production, dystocia, and calf growth. Inadequate feed intake and macro-or micro-nutrient deficiencies during the last trimester increase calf morbidity and mortality rates because most fetal growth occurs during last 2 months of gestation [89, 90] . The quality and quantity of colostrum is associated with body condition score (BCS). A BCS near 5 (on a scale of 1\u223c10) is acceptable for multiparous cows and a score of 6 for primiparous cows at calving is desirable [70] . Recently, cow nutrition has been shown to impact the transition of the calf into adult life as well as fetal growth and development [48] . Calves born to underfed cows have poor growth performance, low productivity, and higher susceptibility to disease. In another study, heifer calves born to cows fed supplemental protein during the last trimester were found to have greater pregnancy performance later in life compared to the control group [83] ." ] },{ "paper_id": "05248494136966d79614f475f8e5bb0880a20bf7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "054831a6a11886b5ad44cac71d17e367721a2b5b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Enrichment of Cytoplasmic and Nuclear Proteins by Subcellular Fractionation-Cell pellets were resuspended in a cold cytoplasmic lysis buffer (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 0.5 mM EDTA, 0.5% Nonidet P-40, EDTA-free Complete protease inhibitor mixture (Roche Applied Science)) and incubated for 10 min on ice. The su-pernatant containing predominantly cytoplasmic proteins was collected after a 3-min centrifugation at 2,000 \u03eb g at 4\u00b0C. The remaining pellet was resuspended in radioimmune precipitation assay buffer (50 mM Tris, pH 7.5,150 mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, EDTA-free Complete protease inhibitor mixture (Roche Applied Science)) and incubated for 30 min at 4\u00b0C. The supernatant containing predominantly total nuclear protein was collected after a 2-min centrifugation at 13,000 \u03eb g at 4\u00b0C. Both fractions were incubated for 5 min at 4\u00b0C in a sonicating water bath.", "Gel Electrophoresis and In-gel Digestion-Each sample was reduced in SDS-PAGE loading buffer containing 10 mM DTT and alkylated in 50 mM iodoacetamide prior to being boiled, then separated by one-dimensional SDS-PAGE (4 -12% Bis-Tris Novex minigel, Invitrogen), and visualized by colloidal Coomassie staining (Novex, Invitrogen). The entire protein gel lane was excised and cut into 10 gel slices each. Gel slices were subjected to in-gel digestion with trypsin (36) . The resulting tryptic peptides were extracted by 1% formic acid, acetonitrile; lyophilized in a SpeedVac (Helena Biosciences); and resuspended in 1% formic acid.", "Trafficking Analysis of P and M2-1 Proteins-The P and the M2-1 genes were amplified by reverse transcription-PCR from total RNA extracted from HRSV A2-infected cells. Complementary DNA served as a template for PCR amplification and was subcloned into TOPO TA vector pCR2.1 (Invitrogen). The P gene was then cloned into the cyan fluorescent vector pECFP-C1 (Clontech), and the M2-1 gene was cloned into pTri-ExNeo vector (Novagen). The orientation of the insert was confirmed by sequencing (data not shown). A549 cell monolayers were grown on glass coverslips in 12-well dishes, transfected with 2 g/well plasmid using Lipofectamine 2000 in Opti-MEM (Invitrogen) according to the manufacturer's instructions, and added to antibioticfree media. After 24 h at 37\u00b0C, the transfection mixture was removed. The plates were then incubated as described above for a further 24 h. Control wells of transfection only and media only were included to assess any background reactivity. Nuclei were stained with propidium iodide (Invitrogen), and coverslips were mounted onto glass slides with glycerol." ] },{ "paper_id": "0568c55234a6ad2585fe3ac5f3c51260194af7ec", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cross reactions with DENV were evaluated using anti-Den- ", "Nonstructural 1 (NS1) and Envelope (E) proteins were used as diagnostic target of anti-ZIKV. The particular NS1 sequence (354 aa) and E sequence (261 aa) were obtained from the Swiss Institute of Bioinformatics (http://viralzone.expasy.org).", "To produce hybridoma cell-secreted monoclonal antibodies (mAbs), we used a cell fusion technique according to an established protocol [30, 31] . Mouse myeloma cells (SP2/0 cell; ATCC #CRL 1581) were fused with spleen cells from the donor mice using 50% polyethylene glycol (Sigma Chemical Co.). After incubation with hypoxanthine, aminopterin, and thymidine media (Sigma Chemical Co.), supernatants of hybridoma cell culture were screened by ELISA using the recombinant ZIKV NS1 or E proteins (1 \u03bcg/ml) as an antigen. After subcloning with limiting dilutions, selected hybridoma colonies were transferred into 25 cm 2 tissue culture flasks (Nunc, Roskilde, Denmark) with RPMI-1640 medium (Gibco/BRL) containing 10% FBS (Gibco/BRL)." ] },{ "paper_id": "058b7249ce7acc1c14c989cb2d8db27435f81363", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "I am very grateful for the help of friends and colleagues that provided valuable input and support for this letter.", "Citation Fouchier RAM. 2015. Studies on influenza virus transmission between ferrets: the public health risks revisited. mBio 6(1):e02560-14.", "I am active in the field of research on influenza virus transmission via respiratory droplets or aerosols between ferrets, funded by the European Union and NIAID/NIH. I am an inventor on a patent related to influenza virus reverse genetics." ] },{ "paper_id": "058e306088e83c58ee30b43f0e102a45463351fe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "When the outbreak of human infections with an emerging avian influenza virus (H7N9) occurred in mainland China in early 2013, inter-and intra-organizational communication in and between government agencies was carried out to control avian influenza virus transmission to humans at poultry farms or wet markets. As a result, Taiwan CDC coordinated with the animal health authorities and local governments to ban vendors from slaughtering and selling live poultry at traditional markets, which has successfully protected people from avian influenza infections since 2013. This was a successful case of communication and engagement across multiple sectors.", "Taiwan has built a comprehensive information network for infectious disease surveillance and reporting. Combined databases, such as the National Health Insurance data and Taiwan CDC's data warehouse for infectious disease surveillance and warning, are routinely used for decision making, risk communication, and epidemic control purposes. Since 2012, a national policy of government open data has further guided health authorities' communication strategies to enhance the transparency and integration of information from diverse resources. 9 In so doing, citizens are provided with increased resources to make well-informed health decisions for themselves and for the wider community through civic participation. For example, people now have easy electronic access to 203 government datasets for information on 14 groups of infectious diseases topics. 10 All of this information is easy to read, free to use, in open document format, and free for value-added analysis.", "A weekly press conference is held to communicate the latest information on communicable diseases to reporters, with a well-trained spokesperson from Taiwan CDC fielding questions from the journalists. In addition to the regular press conferences, during a particular pandemic period 2 special briefing sessions have been organized to update reporters about epidemic situations and what the government is doing RISK AND OUTBREAK COMMUNICATION to prepare for it. This has helped reporters become more informed about the evolution of the public health situation at hand so that, should a pandemic occur, they would be able to produce more accurate and constructive reports.", "There were no confirmed cases of Ebola or MERS in Taiwan, so the purpose of risk communication was to control the infectious diseases outside of the borders and to detect any imported case early to avoid community spread. Several risk communication strategies were implemented, including: (1) issuing travel notices and releasing news to remind citizens going abroad to have greater vigilance, (2) providing travelers with updated information and health education materials at airports and travel clinics to remind them about disease prevention when visiting affected areas, and (3) displaying posters or scrolling texts at quarantine stations of the international seaports and airports." ] },{ "paper_id": "05a12a1fb4a86a4158ad027b911092cfc25bc40b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Natural polymers based on polysaccharide, such as pullulan [73] [74] [75] , alginate [76] , and chitosan [77] [78] [79] [80] [81] [82] , have been explored for nanoparticle vaccine preparations.", "Liposomes are self-assembled, spherical vesicles consisting of a phospholipid bilayer and an aqueous inner core [14, 15] . They are prepared from phospholipids with fatty-acid chains of defined length and saturation. The choice of phospholipids and the addition of cholesterol influence liposomal stability and performance [16] [17] [18] . The vesicles can have a unilamellar structure with one layer of phospholipids or a multi-lamellar structure with several concentric phospholipid shells. This platform is highly versatile for cargoes delivery and allows for incorporation of hydrophilic molecules in the inner core and hydrophobic molecules within the phospholipid bilayers. Antigens and adjuvants may thus be incorporated into liposomes based on their lipophilicity [19, 20] .", "Chitosan-based nanoformulations have been widely adopted for vaccine development, examples of which include vaccines against Clostridium botulinum type-A neurotoxin [56] , Neospora caninum [88] , HBV [77] , and Newcastle disease [81] . The polysaccharide polymer has also been applied to enhance the potency of DNA vaccines against viral, bacterial, and parasite infections [78, 80, 82] .", "Although synthetically prepared nanoparticles have yet to show the level of ordered antigen arrangement found on viruses and virus-like particles derived from cell culture systems [181, 182] , ongoing studies continue to demonstrate emerging techniques to couple antigens of interest to nanocarriers. In the last section of the review, we review commonly used methods for coupling antigens with nanoparticles. These strategies may spur novel approaches for preparing nanoparticle vaccines." ] },{ "paper_id": "05b5ca303bd262f2a8e7d9d05d203f023867d0ed", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The following S. cerevisiae strains were used in this study: SF838-1D-8A1 (MATch, phoSA ::LEU2, ade6, gal2) , pho8A::LEU2, ade6, gal2, , JHRY20-1A-13 AgA (MATot, steJ3A::LEU2, dap2A:: HIS3, , JHRY20-1ASA1 (MATtx, phoSA::LEU2, , phoSA::LEU2, and CRY2-8A (MATot, kex2A::URA3, pho8A:: LEU2, trpl) .", "ALP ~i !i i i !\u0129i i !!~i i i !\u0129!i i i !i !!~i i i i i i \u0129\u0129!!!~!~!i i i i i i i i i !i !i !~!!~i i i i i i i i i i !i i !~!~i !~\u0129i i i DPAP A NI A-ALP NI PEP4 I c C i0", "The JoulTlal of Cell Biology, Volume 121, 1993 " ] },{ "paper_id": "05cc87a56d714cc75ce393c73f3076d3f8a463b5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In this study, for determination of diagnostic criteria of FIP for CNS infected cases using the FCoV antibody test, we examined anti-FCoV antibody titers in CSF and sera from cats with neurological signs.", "We were not able to obtain more detailed information, such as other examination results and clinical signs, from the attending veterinarians regarding the cats examined. Additional epidemiological investigations are necessary to more accurately and efficiently diagnose FIP using anti-FCoV antibody testing of CSF samples.", "Substances with a molecular weight smaller than 160,000, such as immunoglobulin G antibodies and albumin, enter the brain relatively easily from circulating blood, and their levels reportedly range from 1/256 to 1/2,048 of that in serum in subjects with a normal blood brain barrier (BBB) [5, 11, 21] . Hence, CSF antibody should be simultaneously examined with serum antibody." ] },{ "paper_id": "05cf81cc55f7a6f80902a671cac49d85af9782ed", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "I n late 2002, severe acute respiratory syndrome coronavirus (SARS-CoV) crossed the species barrier from animals to humans. SARS first struck in Guangdong Province, China, and was officially recognized by the World Health Organization (WHO) in February 2003. After its introduction into human populations in Hong Kong in February 2003, the virus spread across the globe within weeks. A number of superspreading events occurred in several health care settings during the epidemic. When SARS was declared to have been contained (5 July 2003) , there were 8,098 confirmed SARS cases, and 774 of these patients died from the disease. After this catastrophic event, one of the most frequently asked questions was whether SARS would come back.", "Kindler et al. report that HCoV-EMC has faster replication kinetics than SARS-CoV in HAE cells (5) . SARS-CoV has a mean incubation period of about 5 days in humans. This relatively \"long\" incubation period allowed the identification and isolation of SARS patients before they became highly infectious during the SARS epidemic. If HCoV-EMC has a very efficient replication rate in the upper human respiratory tract, the potential use of quarantine and isolation policy to contain a possible epidemic would be extremely limited.", "It is not known whether HCoV-EMC is going to be fully established in humans. Extensive efforts have been made and will continue to be needed to fight against this possible epidemic. If we are \"lucky\" enough to control this novel disease, more resources should be allocated to different areas of coronavirus studies. Currently, we know some animal coronaviruses in wildlife only at the nucleotide level. In fact, the number of bat species tested for coronaviruses is only a fraction of the total number (\u03fe1,200) of bat species. In addition, there is a lack of biological/biochemical characterization of these animal viruses. Ideally, we should develop an effective universal strategy to treat and prevent human infections caused by animal coronaviruses. The phylogenetic relationships of coronaviruses (Fig. 1) suggest that there have been a number of introductions of animal coronaviruses (e.g., SARS-CoV and 229E) into humans in the past. The great diversity of coronavirus in bats will surely increase the odds of yet another zoonotic event occurring in the future.", "Since the first discovery of HCoV-EMC as the etiological agent of this novel severe respiratory disease (1, 2), researchers have used various strategies to understand virus entry and its replication capability in mammalian cell lines (3, 4) . In the absence of autopsy reports of patients who died from HCoV-EMC, our understanding of virus tropism and pathogenesis in humans is inadequate. Kindler et al. (5) describe the efficient infection and replication of HCoV-EMC in differentiated human primary airway epithelial (HAE) cell cultures in vitro. This model was used to culture other human coronaviruses such as HCoV-OC43 and HCoV-NL63 (6). This well-characterized primary culture system exhibits high physiological relevance, reflecting the anatomy of the human conducting airway (7) , and allows better understanding of the cellular tropism of this newly emerged virus." ] },{ "paper_id": "05df6a79e61e69b9113ffa6a667c3fb9b2680e70", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To clarify this point, we used Akata cells overexpressing a dominant-negative mutant of the adaptor protein MyD88 (DN-MyD88). 16 Table 1 ) by quantitative real-time polymerase chain reaction (qRT-PCR) and confirmed activation of STAT3 by western blot (data not shown).", "qRT-PCR (Taqman). Total RNA was extracted from 10 6 cells with the RNeasy Kit (Qiagen) and DNA was removed with DNA-free (Ambion Europe, Huntingdon, Cambridgeshire, UK). 1 mg of the purified RNA was used to generate cDNA with the High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems, ", "Collectively, we validated our microarray data showing that triggering with ODN CpG-2006 activates Akata cells to induce CD40 and STAT3 expression. Moreover, our results indicated that both ODNs used here act in a MyD88dependent manner and that the ODN lacking CpG motifs activates Akata cells to a similar extent as the ODN containing CpG motifs. " ] },{ "paper_id": "05e5a2bca07922fe0bd52185f4ccaae1b8b154f6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Viral culture MERS-CoV isolates from nasal swabs were grown on African green monkey kidney (Vero) cells. 2,31,32 Samples were inoculated in Vero cells at a multiplicity of infection of 1.0 for 1 h. Unattached viruses were removed by washing the cells twice in serum-free Gibco minimum essential medium (Thermo Fisher Scientific, Inc.). The monolayer cells were maintained in minimum essential medium with 1% fetal calf serum. All infected cell lines were incubated at 37 6 C for 5 days. Cytopathic effects were examined on days 1, 3, and 5 by inverted light microscopy.", "All serum samples were tested for MERS-CoV IgG antibodies using Euroimmun ELISA (Euroimmun AG, L\u00fcbeck, Germany). Samples were applied at a 1:101 dilution and incubated in the wells of microtiter strips coated with the purified spike protein subdomain S1 antigen of MERS-CoV. A ratio of .1.0 was considered to be positive.", "The nucleotide sequence of the genome of the camel MERS-CoV in this study has been submitted to the GenBank sequence database under accession NO KT751244. " ] },{ "paper_id": "0612bb6d157e8cd266943d84daf110c46a56aa23", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All subjects answered a questionnaire to provide basic information such as age, gender, education years, subjective health status, and medical illness status. The subjective health status was scored from 1 (very healthy) to 5 points (very unhealthy), and the medical illness status was answered with disease or no disease.", "Assessment tools for measuring chronotype include selfreport questionnaires such as the Morningness-Eveningness Questionnaire (MEQ) and physiological tools such as Dim Light Melatonin Onset (DLMO) and polysomnography", "Prior to the study, all participants completed informed consent. All questionnaires were interview-based, administered by trained research assistants following a standardized protocol. Participants were administered the Korean version of Mini-Mental State Examination for Dementia Screening (MMSE-DS) 35 to screen for cognitive impairment. This study was approved by the Institutional Review Board of the institute where the research was conducted." ] },{ "paper_id": "06137bb1e53080493b33c1b749b59848cddc05fc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Site-directed mutagenesis was performed using the Quikchange II site-directed mutagenesis kit (Stratagene) according to the manufacturer's instructions." ] },{ "paper_id": "065497953c64b5163eb29e9a4fe78534f244ca26", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "066178ded1d6d540be366e6468bc01e78e605a81", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Avian infectious bronchitis virus (IBV) is a highly contagious pathogen of chickens that replicates primarily in the upper respiratory tract. Secondary replication also occurs in the lower respiratory tract and non-respiratory epithelial cells of the alimentary tract, kidney, and gonads, suggesting various pathologies depend on the type of infected tissue [1] . IBV infection affects egg production of laying hens and growth of broiler chickens, leading to economic losses in the poultry industry that cannot be ignored [3] . IBV is spread by aerosol and is endemic in many countries where chickens are farmed.", "Genotyping of avian infectious bronchitis virus (IBV) was performed on trachea and kidney samples of six chickens obtained from a single farm in Japan. Using two primer sets targeting the spike (S) protein gene, the S1 and S2 regions of DNA fragments were amplified. Sequences of amplified S1 fragments extracted from both organs were identical among the six chickens, showing a JP-I genotype. Sequences of amplified S2 fragments differed between trachea and kidney samples. The kidney profile showed a group IV genotype, whereas the trachea profile showed an unclassified group. This result showed that two different IBVs infected the six chickens. The first IBV infection induced poor protective immunity in this farm, permitting a second IBV infection to occur.", "It is unclear why S2 sequences differed between the kidney and trachea samples of the six chickens, although the S1 sequences were similar (Fig. 1) . One hypothesis is that the primer set for S2 can amplify a wider variety of IBVs than S1. Namely, the S1 primer pair amplified IBV (Far East, JP-I genotype) that is a unique population in kidneys and a minor population in the trachea, but may not amplify the major population of IBV co-infecting the trachea. However, the S1 primer pair, which we used, is synthesized on the conserved region of the S1 gene and is frequently used for IBV genotyping worldwide [1, 9] . Therefore, primer Fig. 3 . Phylogenetic tree based on the partial S gene sequences. Phylogenetic tree analysis based on the nucleotide sequences of amplified S1 (A) and S2 (B) regions were performed using the unweighted pair group method with arithmetic mean (UPGMA) method. Naming of groups followed previous publications [9] [10] [11] [12] [13] . Sequences of representative IBV were either downloaded through NCBI, PubMed, Nucleotide-searching site, or obtained by our own sequencing." ] },{ "paper_id": "06c89f69aa7b5f9648d2c1543b8246fe9c3610cf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "06f075e64c8861491ea4de2f98b606866f54a752", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "None.", "ReFeRenCes" ] },{ "paper_id": "07054fdca599b609a0fd99007a13a5133145449c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "07241235ee553a5b165ed19b2091101128eca805", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "077a70059a89059bace1150d779cc911a2229c60", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "MERS-CoV-infected Vero cell lysates were run on SDS-PAGE and subsequently transferred onto a nitrocellulose membrane as described previously (26, 27) , and detailed information is provided in the Supplementary Material.", "MERS-CoV-infected and non-infected Vero cells were lysed with lysis buffer (0.5% SDS and 1% \uf062-mercaptoethanol) and ", "Four-week-old BALB/c (H-2 b ) female mice were purchased from Nara-Biotec Co. Ltd. The mice were maintained at an animal facility under specific pathogen-free conditions. All the experiments involving the animals were carried out with the approval from the Institutional Animal Care and Use Committee of Hallym University (Hallym2016-51) . The mice were intraperitoneally immunized three times at 10-day intervals with 200 \uf06dl of the Spike-492 peptide (50 \uf06dg) or Spike-492 (L506F) peptide (50 \uf06dg) and the Lipoplex (O) complex (17, 22, 23) ." ] },{ "paper_id": "077d5a9302762a66842c6bdf13912433954ca723", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "where Sc.s. is the mean cell surface on thin-section, The surface to volume ratio was found according to formula:", "SEM. Statistical calculations were performed by determining the SEM for the pooled stereological data for each condition as described in the Results.", "(4)" ] },{ "paper_id": "08079db5747d09016612f319e154ff81c4d9aef5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "PAMs were fixed with cold methanol-acetone ", "All experiments were performed with at least three independent replicates. Data were analyzed with SPSS 16.0 and GraphPad Prism software (version 5.0) by Student's t-test and one-way ANOVA. P<0.05 was considered statistically significant." ] },{ "paper_id": "08f6c419a42b6c922108349af6c1b2aaf2cc62b2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "091b857ba8a07eca145ae411f7202ca3a4d970df", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors declare no conflicts of interest in this work. ", "Different mechanisms might contribute to the debilitation in host defense of the respiratory tract against bacteria following viral infection. Some of the mechanisms have been extrapolated from studies conducted in animal models of sequential infections by respiratory viruses and several bacterial pathogens.", "Hendaus et al relevant to the topic of interest. Finally, the search was limited to studies of disease in humans that were published in English and Spanish from 1918 to the end of 2014 ( Figure 1 )." ] },{ "paper_id": "092880cc76f470dd9cca8233d83c884c0c5edf94", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "096c2c85e046f4ebb34552e0a21bcd69907d1b81", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "097e78073b154805e74de8245008ee3f91c24af2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In addition to their wide variation in viral characteristics, respiratory RNA viruses are also remarkable in their epidemiological variety. They differ in (1) their outbreak calendar, where some are seasonal and others are year-round, (2) their patient profile, whether infant, geriatric, or otherwise healthy adults, and (3) the morbidity and/or mortality associated with infection.", "The first nucleoside analog developed for respiratory viral infection was ribavirin, but despite its approval for use in RSV, its utility for treating severe viral infections remains low. Therefore, the concept of nucleoside analogs against respiratory viruses remains relatively new and needs to be further explored.", "Human metapneumovirus and human RSV are nonsegmented, negative strand RNA viruses from the Pneumoviridae family of the order Mononegavirales. The polymerases from this class of viruses are multifaceted with multiple enzymatic functions contained within a single protein. It exists as part of a ribonucleoprotein complex, or replicase, composed of L, N, P, and M2-1 proteins in complex with RNA. These include RNA synthesis activities carried out by an RdRp domain but also include capping and methylation functions." ] },{ "paper_id": "0994b9aa851f17dc1c6af309973fe189118ab6c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Abbreviations used in this paper: LC-MS/MS, nano-capillary HPLC ion trap mass spectrometry; PS, phosphatidylserine; rhSLPI, recombinant human secretory leukocyte protease inhibitor; RNAi, RNA-mediated interference; siRNA, small interfering RNA; SLPI, secretory leukocyte protease inhibitor.", "Nano-Capillary HPLC Ion Trap Mass Spectrometry (LC-MS/MS). Membrane protein fractions from monocyte (2-10 \u03eb 10 9 ) or macrophage (2-10 \u03eb 10 9 ) coimmunoprecipitations were pooled and separated on SDS-PAGE. The gels were stained with colloidal blue, destained, photographed, and the desired protein band(s) was marked before storage at 4 \u040a C. The gels were analyzed with LC-MS/MS of in-gel tryptic digests for subsequent protein identification by database searching (Wistar Institute). The output from the National Center for Biotechnology Information and nonredundant database search using SEQUEST consists of peptide sequences matched to protein(s) in the database searched by correlated predicted and observed peptide fragmentation patterns." ] },{ "paper_id": "09c84b9de7fc5c3fed4736e7a3cd45e112377042", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "09cec865941962acf6060e72ef9c477c196c4c3b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "09d9038625c7a2e0aa27f9f04cd7f4b2d7ec6f11", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "09da5dea6fa9b08b2eb1549e85cbc7e29fd3f2f8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "09e6d442b7da6f36e3c7a82a056d8d61e27b1050", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0a098b3876e799d9b21608e26e80d05aa9ec6475", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0a19aacc124c9c42d66d481a9d0c837a76a252e6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0a296d80d8a8c0408c1ea9559c0f0589fb35cb03", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The status of a combination of astrovirus with other gastrointestinal viruses was assessed by RT-PCR.", "The PCR products of expected sizes were purified and then cloned into pMD18-T plasmid vectors (Takara Bio, Inc.), which were then used to transform competent Escherichia coli Top 10 cells. The recombinant plasmids were submitted in duplicate for DNA sequencing to Invitrogen Biotech (Beijing, China). Editing and assembly of nucleotide sequences were performed using the SeqMan program included in the Lasergene 7 Genomics Suite (DNAstar, Inc., Madison, WI, U.S.A.).", "Samples: A total of 211 rectal swabs were collected from calves, aged 0-6 months, with mild to severe diarrhea from five industrial farms (3 dairy and 2 water buffalo) in Guangxi province, China. All samples were collected in sterile tubes containing 10 ml of 1/100 antibiotic 10 mM phosphatebuffered saline and transported on ice to our laboratory within 24 hr. Samples were homogenized by vortexing for 5 min at room temperature and centrifuged at 3,000 \u00d7 g for 15 min at 4\u00b0C, and then, the supernatant was aliquoted and stored at \u221280\u00b0C until assayed." ] },{ "paper_id": "0a2ded6cbd632857d491140a57f2773c3610b10b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This paper was handled and processed by the European Editorial Office (ISFM) for publication in JFMS Open Reports", "MRI of the brain was performed using a 1.5 T magnet (Philips Ingenia CX). All slices were 3 mm thick with a 0.3 mm slice gap. Sagittal, dorsal and transverse T2-weighted (T2W) images were acquired. Transverse images for fluid-attenuated inversion recovery (FLAIR), T2*W, T1-weighted before and after intravenous administration of contrast medium (gadobutrol 0.1 mmol/kg bodyweight [Gadovist;", "Bayer]) and proton-density weighted sequences were obtained." ] },{ "paper_id": "0a449e173239afb38816257e1a53811b47bf13f4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0a64b2c55fc2091358da4f83ac6fdc7701ddb46e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u00c01 PRF (FS%) was calculated as follows:", "The dual-fluorescent reporter system recapitulates data obtained using a dual-luciferase reporter system", "The experiments were repeated using our previously described dual luciferase assay system (39) to compare the results obtained using the dual fluorescent reporter system. Side by side comparisons shown in Figure 3B demonstrate strong agreement between the two assay systems. These results match our previous findings for these conditions where 60 mg/ml anisomycin inhibited \u00c01 PRF, rpl11-Y52\u00c1 promoted increased \u00c01 PRF and rpl11-92-6A promoted decreased \u00c01 PRF. This independent validation underscores the potential for the less expensive and scalable dual fluorescence methodology to accurately detect changes in frameshifting." ] },{ "paper_id": "0aa3eda0fb09bf9f55864fc2b9157b9317f62323", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Because of long geographical distances, two approaches were used for data collection: i) technical visits to the facilities involved with border surveillance, which included questionnaire applications and direct observations of the operational procedures and facility structures; ii) application of online questionnaires for those facilities that could not be visited. For both approaches, questionnaires were developed in English and, subsequently, translated into Spanish and Portuguese.", "Acknowledging the vulnerability of introducing and spreading potential public health events through land borders, the International Health Regulations (IHR) recommends that countries sharing common borders should consider establishing bilateral or multilateral agreements about strengthening surveillance actions at ground crossings 7 .", "The epidemics of severe acute respiratory syndrome (SARS), pandemic influenza (H1N1) and Middle Eastern Respiratory Syndrome (MERS-CoV) hit the world with a high pathogenic potential in recent years, providing a warning to nations of the speed with which these epidemics can move across the globe 1-3 . Everyday, nations are more internationally connected 4 . On February 1, 2016, for the fourth time in history, the World Health Organization (WHO) declared a public health emergency of international concern (PHEIC) to make a joint global effort to control the outbreak caused by Zika virus (ZIKV) in Latin America and the Caribbean 5,6 . These facts reiterated the need for governments and international agencies to build and strengthen the surveillance of infectious diseases at all levels, from national to international, thus facilitating the timely detection, response, and communication of disease outbreaks on a global scale 4 ." ] },{ "paper_id": "0ace222a6c33986dfe57d3f24779fe5f674724c7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0ad29b032fe87db2641893f4cc880c22f2107712", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Safety assessments were in the case of adverse events, and included laboratory tests (hematology, biochemistry, and urinalysis) and vital sign assessments (systolic blood pressure, diastolic blood pressure, and pulse rate).", "Acute respiratory illness (ARI) is a self-limiting viral disease that causes mild symptoms such as fever, shivering, chills, malaise, and dry cough. Rhinovirus and coronavirus (50%-70%) are the most common viruses, followed by influenza virus (20%-35%), and adenovirus (5%-10%) (1, 2) . Most influenza-associated deaths occur in persons aged 65 yr or older with associated chronic disease (3) . Vaccination to prevent influenza is particularly important for elderly persons who are at an increased risk for severe complications from influenza (4) .", "Recently, KRG was shown to be capable of enhancing cellmediated immune responses by T lymphocytes and activating natural killer cells in immunomodulation and anticancer pathways. Two clinical studies for the immune response with ginseng or KRG have been conducted (7) (8) (9) . In addition, treatment of Pseudomonas aeruginosa pneumonia in rats with ginseng was found to reduce bacterial load and lung pathology, as well http://dx.doi.org/10.3346/jkms.2012.27. 12.1472 as to increase immunoglobulin G2a in serum. They suggest that the antimicrobial properties of ginseng are due to its induction of Th1-like responses (10) .", "This study was a 12 weeks, randomized, double-blind, placebocontrolled clinical trial at the onset of the influenza season at the Chonbuk National University Hospital (Fig. 1 ). Subjects who responded and met the inclusion criteria during a telephone screening interview were scheduled for a baseline visit. The evaluation included a physical examination, electrocardiogram, and screening blood parameter study. In addition, subjects were scheduled for a screening visit (within 3 weeks) where the informed consent was reviewed and signed. A random number between 1 and 100 was generated by a computer for each subject. The randomization codes were hidden from all subjects, research staff, investigators and pharmacists until all the data were analyzed." ] },{ "paper_id": "0adc0c7498f0ebbb3c8f1c662da34605d5f91fe2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0adc2dfd5f26656ce3527dbb5dec379d44d0601e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This retrospective study was conducted at the University of Michigan Health System (Ann Arbor, MI) and Karmanos Cancer Center (Detroit, MI). Approval was granted by the institutional review board at each center.", "We conducted descriptive data analyses for all variables. Student's t test, Fisher's exact test, and one-way analysis of variance were used to determine differences between groups. All statistical analyses were completed using SPSS software, version 24.0 (SPSS, Inc., Chicago, IL)." ] },{ "paper_id": "0ae1cad5b20badf8dcea32e8c80209b8948d1e49", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(F) shows representative western blots confirming efficient knock-down, and showing accumulation of IAV proteins under knock-down conditions. ", "Detailed methods are provided in the online version of this paper and include the following: Bercovich-Kinori, A., Tai, J., Gelbart, I.A., Shitrit, A., Ben-Moshe, S., Drori, Y., Itzkovitz, S., Mandelboim, M., and Stern-Ginossar, N. (2016) . A systematic view on influenza induced host shutoff. eLife 5, e18311.", "Chaimayo, C., Dunagan, M., Hayashi, T., Santoso, N., and Takimoto, T. (2018) . Specificity and functional interplay between influenza virus PA-X and NS1 shutoff activity. PLoS Pathog. 14, e1007465. were resuspended in 500 ml RIPA buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Igepal, 0.5% sodium deoxycholate, 0.1% SDS) with protease inhibitor cocktail (P8340, Sigma) and lysed at 4 C for 1 h with gentle agitation, followed by passing through a 21-gauge needle. Lysates were cleared by centrifugation at 4 C for 20 min at 20,000 x g." ] },{ "paper_id": "0ae7bedff3dfbfc1ccaeb5b662bbace00ae16b33", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Blood samples were collected into EDTA and heparin and analysed by an automated haematology impedance analyser (Vet ABC; Scil) and by a VetScan VS2 chemistry analyser (Abaxis), respectively. Only mild hyperproteinaemia (84.0 g/l; reference interval 54-82 g/l) was present. Blood smear examination and urine analysis were unremarkable.", "The first case of FeL was reported in 1912 in Algeria, 8 and it was not until the past two decades that case reports and epidemiological studies established a description of clinical FeL including skin or mucocutaneous lesions and lymphadenomegaly. 1 In contrast, fewer data are available regarding the treatment, monitoring and prognosis of FeL.", "The clinical signs gradually improved by month 1 (Figure 4a ) and resolved by month 2, with no clinical relapses evident at the completion of treatment (Figure 4b ) nor up until the end of the follow-up period at month 14." ] },{ "paper_id": "0afa3ea846396533c7ca515968abcfea3f895082", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.01817-14/-/DCSupplemental. Figure S1 , EPS file, 1.8 MB.", "Serum SAA was measured by ELISA (ab157723; Abcam, Cambridge, England)." ] },{ "paper_id": "0b064096b51c4cada7b64af37eae826b7e7c9649", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "5A), the predominant cell type infected exhibited the morphology and anatomical location of oligodendroglia and was similar in both groups (Fig. 6B) . These data suggested that anti-CD25 treatment did not alter viral tropism.", "Brains were homogenized in Dulbecco's PBS using ice cold Tenbroeck tissue homogenizers (Wheaton Science Products, Millville, NJ). After centrifugation at 450g for 7 min at 4 \u00b0C supernatants were stored at \u221280 \u00b0C. Cell pellets were suspended in RPMI medium containing 25 mM HEPES, pH 7.2 and used for the analysis of CNS inflammation as described below. Brain derived supernatants were used to determine virus titers by plaque assay on monolayers of the continuous Delayed Brain Tumor (DBT) astrocytoma cell line as described (Fleming et al., 1986; Kapil et al., 2009; Phares et al., 2012) ", "CNS derived cell pellets resuspended in RPMI medium containing 25 mM HEPES (pH 7.2) were adjusted to 30% Percoll (Pharmacia, Piscataway, NJ). Cells were separated from myelin debris by centrifugation at 850g for 30 min at 4 \u00b0C onto a 70% Percoll cushion. Cells from the 30%/70% interphase were collected, washed and analyzed by flow cytometry or for cytolytic activity. Single cell suspensions from CLN were obtained as described (Bergmann et al., 1999; Kapil et al., 2009; Phares et al., 2012) ." ] },{ "paper_id": "0b2c383c48f644edcb7c4dcf40046bd58dd5e0f8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Due to the limited regeneration of cardiomyocytes [1] , stem cells have been the premier choice for promoting myocardial regeneration.", "Echocardiograms were acquired at 4 h and 21 days after ischemia/reperfusion surgery with a Philips CX30 ultrasound system and L15-7io transducer (Philips; Amsterdam, Netherlands). The individual who performed the echocardiography and analysis was blinded to the treatment each animal received. Animals were anesthetized with 1.5% isoflurane during echocardiography. Ejection fraction was measured using Simpson's method using B-mode images to measure ventricular volume.", "Supplementary figures and tables. http://www.thno.org/v08p1869s1.pdf" ] },{ "paper_id": "0b627ea5840e5e48709565840313984dc900af8d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In considering what is to follow, several caveats should be borne in mind:", "\"The stepwise coevolutionary process results in extreme specialization and complex defense mechanisms. . .specialization is likely to increase the rate of speciation that may occur in both host and parasite\" (Price, 1980) \"Host specificity thus is an ideal prerequisite for rapid speciation\" (Mayr, 1963) ." ] },{ "paper_id": "0b90f302993b075229dbe5f9bc03a180b2e2632f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0bcc4d843bd37ae1c8623e45dab6fff11263f798", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0c3068b22cb2cb50114316f9fed2738a943d2435", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This systematic review was conducted using the Cochrane Collaboration's approach [20] and was reported complied with the Preferred Reporting Items for Systematic Reviews and Meta-Analyses checklist. [21] Ethical approval and patient informed consent were not necessary because all data were obtained from previous studies.", "We scanned reference lists of each eligible study to find relevant publications fulfilling the inclusion criteria. We also retrieved conference proceedings and dissertation abstracts to identify unpublished studies.", "Retrieved records including titles and abstracts were screened independently by 2 review authors (LP and P-WR) using EndNote 5.0 software after removal of duplications. Studies were selected in accordance with predefined criteria, and full texts of eligible studies were downloaded. Discrepancies were resolved via discussion or in consultation with the lead reviewer (D-YK)." ] },{ "paper_id": "0c83fb7b5413cd36d8ca958f15e7640636c8e730", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Viral titration was conducted in 96-well microplates by using 10-fold serial dilutions, and CPEs were observed under a microscope at 5 days post-inoculation (DPI). The viral titers were calculated according to the Reed and Muench method and expressed as the 50% tissue culture infectious dose (TCID50/mL).", "PED has been reported in many countries including Korea, and PEDV, which causes severe diarrhea in piglets, has led to enormous economic losses in the Korean pig industry. A total of 669 cases of the disease occurred between 2000 and 2015, and two large epidemics were observed in 2003 and 2014 (Fig. 7) . In 2014, 169 PED outbreaks causing high mortality were identified, officially, and more than 33,600 piglets were infected with PEDV at 169 Korean pig farms.", "Animal ethic committee of Animal and Plant Quarantine Agency (APQA; Gimcheon, Korea) approved the animal experimental design (approval No. 2015-283)." ] },{ "paper_id": "0c88aef176b70c6b11a51028124680237a6e5abd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Background. Acute upper respiratory tract infections are a common cause of emergency department (ED) visits and often result in unnecessary antibiotic treatment.", "Immunosuppressed 17 (18) 17 (17) Abbreviations: BMI, body mass index; CHF, congestive heart failure; COPD, chronic obstructive pulmonary disease; RP, respiratory panel. a Missing BMI measurements due to lack of height measurements for some patients.", "There were also several strengths to this study, including the rigorous experimental study design, relatively rapid TAT given the current state of the art, and generation of preliminary data for future more rigorous multicenter clinical trials evaluating the implementation of rapid respiratory panels in EDs and other acute care settings.", "Supplementary materials are available at Open Forum Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author." ] },{ "paper_id": "0c92f5b237572a3461ae2205a62ba7622c07a6ab", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Not applicable.", "The authors declare no conflict of interest, financial or otherwise. " ] },{ "paper_id": "0caa109e0faf5c5fefe81a8108e1199058cb3a27", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0ce1f213337247a67628f95cf699bdabddc94d9c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "IFIT proteins (300 nM) were incubated with 40S ribosomal subunits (160 nM) for 15 minutes at 37 C in 200 ml reaction mixtures containing buffer B. The reaction mixtures were then subjected to centrifugation through 10-30% sucrose density gradients in a Beckman SW55 rotor at 53 000 rpm for 90 min. Fractions that corresponded to ribosomal complexes were trichloroacetic acid precipitated and analyzed by sodium dodecyl sulphatepolyacrylamide gel electrophoresis SDS-PAGE using the NuPAGE 4-12% Bis-Tris Gel System (Invitrogen) with subsequent fluorescent SYPRO (Invitrogen) staining. Assembled complexes were separated by centrifugation through 10-30% SDGs as described above. 43S complex formation was analyzed by scintillation counting of an aliquot of each fraction.", "The promoters of most IFIT genes contain one to four IFN-stimulated response elements (ISRE), typically located within 200 bp upstream of the transcription start site, that are recognized by IFN regulatory factors, leading to rapid induction of transcription. A few IFIT genes, including human IFIT1B, lack ISRE-containing promoters and are not transcriptionally induced by IFN or dsRNA (11, 12) . Sequence similarity between the different IFIT proteins within a species is high (44-98% identity) (11), but they are differentially expressed depending on the cell and tissue type, respond differently to IFN and different viruses, and have different effects on replication of individual viruses, suggesting that different IFITs have non-redundant functions in the host response to viral infection (e.g. [19] [20] [21] [22] [23] .", "Native rIFIT1B was purified from RRL on the basis of its activity in binding to cap0-Stem-MVHL-STOP mRNA, which was monitored by primer extension. The 40-50% ammonium sulfate precipitation fraction of the 0.5 M KCl ribosomal salt wash that was prepared from 1 l of RRL (Green Hectares, Oregon, WI, USA) (43) was dialyzed against buffer A (20 mM Tris-HCl, pH 7.5, 10% glycerol, 2 mM DTT, 0.1 mM EDTA)+100 mM KCl and applied to a DE52 column equilibrated with buffer A+100 mM KCl. rIFIT1B was eluted by buffer A+250 mM KCl. This fraction was applied to a P11 column equilibrated with buffer A+100 mM KCl, and rIFIT1B was eluted between 250 and 400 mM KCl. This fraction was applied to a FPLC MonoQ HR 5/5 column. Fractions were collected across a 100-500 mM KCl gradient. rIFIT1B was eluted at $250 mM KCl. rIFIT1B-containing fractions were applied to a hydroxyapatite column. Fractions were collected across a 20-500 mM phosphate buffer gradient. rIFIT1B was eluted at $180 mM phosphate buffer. rIFIT1B-containing fractions were applied to a FPLC MonoS HR 5/5 column. Fractions were collected across a 50-500 mM KCl gradient. rIFIT1B was eluted at $170 mM KCl. rIFIT1B-containing fractions were concentrated on Microcon YM30 (Millipore)." ] },{ "paper_id": "0cea2b0d9b7187e2c5a596ed433be46208186d32", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The IDBD management system allows users to access the biomarker database without registration. However, user registration is required for adding and editing database contents, and user support can be obtained by e-mailing graduate@korea.ac.kr. Readers are encouraged to contact us if they wish to provide new data for inclusion in IDBD, assist with curation or have any suggestions for improvements.", "IDBD was developed as a relational database using Oracle 10g applications (12) on the Windows operating system. Two open source softwares, the Apache HTTP Server and Apache Tomcat, were used as HTTP server and servlet container for Web service, respectively. Perl scripts were used to provide common gateway interface for sequence alignment using ClustalW, and Java applet was used to link Jmol for displaying 3D models. IDBD can be publicly accessed from any Web browser at http://biomarker.cdc. go.kr and http://biomarker.korea.ac.kr.", "In order to advance our understanding of biomarkers and the roles in early infection processes, we have developed an integrated user-friendly relational database that catalogs putative and validated biomarkers relates them to infectious diseases processes. In addition, we have added value by hosting various bioinformatics tools that can be used to analyze and visualize the biomarker data. This freely accessible resource will be a valuable research tool and a contribution to improved public heath." ] },{ "paper_id": "0cf8f70367fc77ea444519b2d9ed108765edd25f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0d0af538cf60b6330d1eb7f5da52bef9ea30fd9c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "W e are gratified that Ron Fouchier has joined (1) the important effort to quantify the risks (2-5) of the creation of potential pandemic pathogens, including ferret-transmissible variants of influenza A/H5N1. However, we disagree with many aspects of his assessment.", "between 0 and the value obtained by dividing 3 by the number of observed lab-years (7) .", "(iii) As with reduced transmissibility, the assertions of reduced lethality are inconsistent with early statements about the experiments. NSABB member Michael Imperiale was quoted in Science as saying in 2012, \"What Ron [Fouchier] is saying now is not what was in the paper. We were led to believe by the paper that aerosol transmission is also lethal.\" (30) . This view was shared by at least one reporter who attended the Malta presentation of the results (36) ." ] },{ "paper_id": "0d0ca66887cfd2b3a09f5205cdcbaa4479f17337", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Thus, to have a more accurate view about the occurring IB viruses a broader scale molecular analysis is necessary from time to time, at least for the S1 gene, of geographically or epidemiologically representative IBV strains.", "Furthermore, two S1 sequences of GenBank origin, Eg/ 12197B/2012 (KC533683) and Eg/12120s/2012 (KC533684), showed the very same recombinant pattern as the D1456-like viruses and, accordingly, grouped together with these on the respective phylogenetic trees (Figs. 1 and 2) .", "The location of the larger recombinant fragment overlapped with two reported antigenic domains of the S1 gene, according to Koch et al. (1990) while the shorter recombinant fragment overlapped with one antigenic domain (Fig. 4) . Both recombinant fragments were located outside the portion that is flanked by the XCE primers.", "Tissue homogenate in PBS (1:10 dilution) was prepared from the organs with Ultra-Turrax (IKA, Staufen, Germany), filtered through Sterile Millex Filter Unit (22 lm, Merck Millipore, Carrigtwohill, Ireland), and 200 ll of the homogenate was inoculated in the allantoic cavities of embryonated chicken eggs, and incubated for 6-7 days at 37 C and candled daily. A sample was considered positive for IBV if the embryos in the inoculated eggs showed typical lesions, that is, stunting and curling of the embryos, and by PCR (Capua et al. 1999 )." ] },{ "paper_id": "0d3de075e16c6d2e02c68e541b4d2654c78bea04", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "On our examination, he had no fever. On auscultation, a widespread reduced vesicular murmur and basilar rales in the left lung were found. On palpation, there was inguinal lymphadenopathy. The remainder of the physical examination was unremarkable.", "Oxygen saturation by pulse oximetry was 93% on room air and blood gas analysis showed a mild hypoxaemia, with an arterial oxygen tension (PaO 2 ) of 61 mmHg with respiratory alkalosis (pH 7.46, carbon dioxide tension 32 mmHg and bicarbonate 23.2 mmol\u22c5L \u22121 ), and therefore with a standard PaO 2 of 48 mmHg.", "What would be your further investigations for a patient with these features?" ] },{ "paper_id": "0dc475f4419836c2dc352073498f56ae982170a0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Chi-square tests and SPSS Statistics 17.0 (SPSS, Chicago, IL, USA) were used for statistical analysis, while P < .05 was considered statistically significant." ] },{ "paper_id": "0dc8d11784da63b899dbb2b404be4efd330e4ac3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This work was supported by grants from the \"Knowledge Innovation Program\" (No: Y014P31503) and the \"100 Talent Program\" (No: Y316P11503) from the Chinese Academy of Sciences and the Shanghai Pasteur Foundation.", "Ebola virus was firstly discovered in 1976 with the outbreaks in Democratic Republic of Congo and Sudan, 113, 114 but the outbreak in Africa in 2013 made it a public concern again. 115 There have been several strategies for the Ebola vaccine development, of which the Ad vectors are selected as a priority.", "No potential conflicts of interest were disclosed." ] },{ "paper_id": "0df0d5270a9399cf4e23c0cdd877a80616a9725e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Coronaviruses are a group of enveloped viruses with a positive-sense, single-stranded RNA and viral particles resembling a crown e from which the name derives. They belong to the order of Nidovirales, family of Coronaviridae, and subfamily of Orthocoronavirinae (Carlos, Dela Cruz, Cao, Pasnick, & Jamil, 2020) . They can affect mammals, including humans, causing generally mild infectious disorders, sporadically leading to severe outbreaks clusters, such as those generated by the \"Severe Acute Respiratory Syndrome\" (SARS) virus in 2003 in mainland China, and by the \"Middle East Respiratory Syndrome\" (MERS) virus in 2012 in the Kingdom of Saudi Arabia and in 2015 in South Korea (Gralinski & Menachery, 2020) .", "A recent coronavirus outbreak has started since December 29th , 2019 in Wuhan, Hubei province, People's Republic of China, and has progressively expanded to various parts of China and has reached as well other countries, including Japan, South Korea, Thailand, Vietnam, Malaysia, Singapore, Nepal, Cambodia, the Philippines, Russia, the United Arab Emirates, Australia, Canada, the United States of America and Europe (France, Germany, Italy, UK, Finland and Sweden). So far, the new virus has infected more than 31,000 people and killed at least 636 of them (National Health Commission of the People's Republic of China, 2020).", "None." ] },{ "paper_id": "0e18097a83b2801c4865c72065b7933fa24face3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0e1c055e39c45d7cef611b6bd17fb67c249ed742", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Since Pr\u00bdAjT; M is independent from the structure , we need to optimize only Pr\u00bdAjT; ; MP\u00bdjT; M:", "where ex-over str () is the expected overlap of with all structures from all sequences. Formally, this is defined by ex-over str \u00f0\u00de", "Here, p u " ] },{ "paper_id": "0e2c97d34c8c6042f26cc11e83e1a2fbac521203", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00047-14/-/DCSupplemental.", "Text S1, PDF file, 0.2 MB. Figure S1 , PDF file, 2.4 MB. Figure S2 , PDF file, 0.8 MB. Figure S3 , PDF file, 1.9 MB. Figure S4 , PDF file, 0.2 MB. Table S1 , PDF file, 0.2 MB." ] },{ "paper_id": "0e63d19fa3d2ebfcc7cdb06f85225ae0489acf8e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0e78935692851b0466f5a9234adb024e7735c8a3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We thank Tikki Pang, Lee Kuan Yew School of Public Policy, National University of Singapore, for useful comments and suggestions in the preparation of this manuscript.", "Disease or pathogen-specific public health diagnostic laboratories established to support world health organization (WHO)-specific disease surveillance programs and vaccine-preventable diseases, e.g., national influenza, poliovirus and measles laboratories, led to the 'compartmentalization' of laboratory diagnostic services, segregation of functions, and duplication of facilities and equipment. The situation is further complicated by the siting of various pathogen-specific diagnostic laboratories in different buildings or institutes or different locations within a country, thus preventing more cost-effective measures of sharing common equipment and reagents, clinical samples, information and human resources. Finally, the problem is compounded by policy makers and laboratory managers lacking flexibility and not allowing these disease or pathogen-specific laboratories to adopt a more generic approach in the investigation of infectious disease outbreaks.", "Regardless of the category, with some exception for category 4b, effective early detection, identification, characterization, containment, control and ultimately prevention of the emerging infectious diseases will require a good, functional national public health surveillance system. The system needs to be well supported by a network of primary public health and clinical/medical diagnostic laboratories that are coordinated by a national public health reference laboratory with real-time and harmonious communication between the laboratories and epidemiological surveillance units." ] },{ "paper_id": "0e7c4297d1710cac2a64886cb9a748777b0cd03d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Baby hamster kidney cells (BHK-21, clone 15) were cultured as monolayers in Dulbecco's modified Eagle's medium supplemented with 10% (vol/vol) calf serum, 100 units of penicillin/ml, 100 g of streptomycin/ml, and 10 mM HEPES (pH 7.2) at 37\u00b0C and 5% CO 2 .", "Aedes albopictus C6/36 cells were cultured as monolayers in Leibovitz's L-15 medium supplemented with 10 mM HEPES (pH 7.2), 100 units of penicillin/ml, 100 g streptomycin/ml, and 10% (vol/vol) fetal bovine serum at 30\u00b0C.", "Cell fractionation, protein precipitation, and quantitation. Fractionation of cultured cells was performed using the Qproteome cell fractionation kit (Qiagen, Valencia, CA) following the manufacturer's instructions. Proteins from each fraction were methanol precipitated, resuspended in 8 M urea, 100 mM Tris-HCl buffer (pH 8.8), and quantified using the DC protein assay kit (Bio-Rad, Hercules, CA)." ] },{ "paper_id": "0eed9647904ba87a841a177c12a0238faf5c2bd0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0f0bb7346d45679cc1bb2435c66d5ad3ef52c108", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. All the experiments were performed in triplicate. Data are expressed as the mean \u00b1 standard error of the mean. All the data were statistically analyzed using Student's t test. P<0.05 was considered to indicate a statistically significant difference. GraphPad Prism 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA) was used for statistical analysis.", "Sepsis is a systemic inflammatory response syndrome associated with a high rate of mortality (1) . The incidence of sepsis has been increasing over the last two decades. This increase has been more marked in developed countries, where 6-30% of patients in Intensive Care Units suffer from sepsis (2) . Sepsis remains the leading cause of mortality in patients in Intensive Care Units (3) and the associated burden of care incurs financial burden. However, the pathogenesis of sepsis remains to be fully delineated and effective therapies are lacking. A state of immunosuppression induced by sepsis has been demonstrated in clinical and experimental sepsis (3) , with the majority of patients who have succumbed to sepsis-associated mortality showing evidence of immunosuppression and unresolved septic foci (4) .", "Sepsis remains a threat to human health, primarily due to a lack of effective therapies (3). With current treatment options, the mortality rate of patients with sepsis remains high at ~30%, and mortality rates increase directly with disease severity (24) . A previous worldwide survey of relevant pathogens in intensive care units found that the majority of patients with sepsis had blood cultures positive for Gram-negative bacteria (25) . LPS, a component of the outer leaflet of the outer membrane of Gram-negative bacteria, is a key molecule in the induction of sepsis. Therefore, the present study used LPS to simulate sepsis induced by Gram-negative bacteria infection." ] },{ "paper_id": "0f2e41a966ec7d622762dc64ba63009e00a69bd5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "3.578(9) \u00c2 10 5 0.01377 (3) 38.50(7) 2978/10 4.531(4) \u00c2 10 5 4.38(1) \u00c2 10 24 0.967 (3) The number in parentheses is the standard error in the last significant digit.", "Supernatants were harvested following a 25 min spin at 2000 g. The antibodies were purified from the supernatants using Protein G HP columns (Amersham, Piscataway, NJ, USA) by fast protein liquid chromatography (FPLC). The purified IgGs were quantified in BCA protein assays, analyzed on SDS gels, and assayed for the presence of endotoxin using a chromogenic Limulus Amebocyte Lysate test (Lonza, Rockland, ME, USA). If necessary, the preparations were passed through polymyxin B gel columns (Detoxi-Gel, Pierce 20344) for endotoxin removal.", "Sequences in bold indicate codons requiring multiple nucleotide substitutions. Table III . Surface plasmon resonance analysis" ] },{ "paper_id": "0f34670b6327305bb3d66de79d1aa96a5d8de2b2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0f506a74e190c45a399f382c153919612fa1ef5b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In Vivo Mouse DC Stimulation-Two \u03bcg of CpG-A (ODN2216; Invivogen) and 12 \u03bcL DOTAP (Santa Cruz Biotechnology) were mixed with 100 \u03bcL of PBS and administered intravenously (i.v.) by tail vein injection. Control mice received 12 \u03bcL DOTAP with PBS. Spleens were harvested and analyzed 6 hours after inoculation.", "Bar graphs indicate mean \u00b1 SD. Statistics determined by t-test. *p < 0.05, **p < 0.01, ****p < 0.0001.", "Bar graphs indicate mean \u00b1 SD; nd, not detected. Statistics determined by one-way ANOVA with Tukey's multiple comparison test. *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001. " ] },{ "paper_id": "0f6091029a2cc8ddd6a5c6ee18de7478b73daab2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This work (project code: INV11) was supported by the Consejo Nacional de Ciencia y Tecnolog\u00eda (CONACYT) Programa de Apoyo al Desarrollo de la Ciencia, Tecnolog\u00eda e Innovaci\u00f3n en Paraguay (BID 1698/OC-PR).", "Supplementary material is available on the publisher's web site along with the published article.", "Declared none." ] },{ "paper_id": "0f67baef306ea56d7b574059fb72ff68affb0246", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "These authors contributed equally to the work.", "Nascent transcripts produced by RNA polymerases universally carry a 5 0 triphosphate (5 0 ppp). Processed RNA molecules, such as rRNAs and tRNAs, generated from precursors whose 5 0 segments were removed by nucleolytic cleavage, carry a 5 0 monophosphate (5 0 p). In several types of cellular and viral RNAs, the 5 0 end is further modified enzymatically, by a variety of modification enzymes, to introduce various chemical structures that are collectively dubbed as the \"5 0 caps\". This cap is absent in bacterial and archaeal transcripts." ] },{ "paper_id": "0f8f7f09b42b4b45e128591191176aa358f29b1b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0f90aed025cdf162b89014244740266ce67a3f47", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Baseline characteristics were presented as medians (interquartile ranges) for continuous variables and percentages for categorical variables, as appropriate. All statistics analyses were performed with SAS statistical software, version 9.2 (SAS Institute Inc., Cary, USA).", "We retrospectively assessed data collected 2000 through 2012, from Taiwan NHIRD. Taiwan has implemented a singlepayer, compulsory National Health Insurance program in 1995, which includes reimburses of outpatient visits, hospital admissions, prescriptions for 99% of Taiwanese population. All contracted institutions must file claims according to standard formats, which are subsequently transformed into NHIRD." ] },{ "paper_id": "0f9341750af1f556fdfee5d61d707278005663ca", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "0fc5801b4cdc21c018c93aa3cbc9b601491fdeb4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Perlman S. 2013. The Middle East respiratory syndrome-how worried should we be? mBio 4(4):e00531-13.", "Events occurring immediately after MERS-CoV binds its DPP4 Perspective receptor appear to be similar to those reported for other coronaviruses. Cleavage of the surface glycoprotein must occur to expose the fusion peptide and to effect virus-cell membrane fusion and nucleocapsid release into the cytoplasm. Several host proteases, including cathepsin B and members of the TMPRSS family, have been implicated in this process (15) .", "Arguably, the most important outcome will be the development of drugs or vaccines that target a broad array of coronaviruses and not just a single virus. Events over the past 10 years show that coronaviruses are not only widespread in nature but also able to cross species to infect new hosts and can cause severe disease in humans. Having tools in hand before such events occur is critical for public health." ] },{ "paper_id": "102e8dd2d010be4e7f39f8e2d0c84190ee87d9e2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This work was funded by Public Health Service grants P30DA015625 and P51RR000166 from the National Institutes of Health.", "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00134-11/-/DCSupplemental. ", "RNA preparation and next-generation sequencing. Total RNA was extracted from 5 \u03eb 10 6 cells per sample using a mirVana kit (Applied Biosystems/Ambion, Austin, TX), and the quality and concentration of the RNA were determined by an Agilent 2100 Bioanalyzer. Samples were submitted for sequencing to IlluminaFastTrack Sequencing Services (Hayward, CA). cDNA libraries were generated using Illumina mRNA-SEQ kit. The quality and concentration of these libraries were determined by an Agilent 2100 Bioanalyzer. The libraries were clonally amplified on a cluster generation station using Illumina version 4 cluster generation reagents to achieve a target density of approximately 300,000 (300K)/mm 2 in a single channel of a flow cell. The resulting libraries were then sequenced on a Genome Analyzer IIx using Illumina version 4.0 sequencing reagents which generated single reads of 75 nucleotides (nt). Image analysis, base calling, and error estimation were performed using Illumina Analysis Pipeline (version 2.6)." ] },{ "paper_id": "103228b102f34e60c7057cc68069d00194959837", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Rel. IFITM3 protein", "Immunofluorescence confocal microscopy. Cells were seeded (15,000/well) in Lab-Tek II chamber slides (Thermo Fisher) overnight and treated with DMSO, rapamycin (20 uM), or rapamycin and bafilomycin A1 (1uM) for four hours followed by fixation/permeabilization with Cytofix/Cytoperm (BD) for 20 minutes. Primary antibodies were diluted in Odyssey blocking buffer in PBS (Li-Cor) and incubated with cells for 30 minutes at room temperature. Cells were washed and incubated with Alexa Fluor-labeled secondary antibodies for 30 minutes at room temperature." ] },{ "paper_id": "104e60eede9e4016c243f20f4541a33852ea3d1c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Demographic information and clinical courses of the patients; information regarding combined diseases; results of blood tests; cerebrospinal fluid (CSF) examinations; electroencephalography (EEG); and brain imaging techniques such as MRI (including DWI) were analyzed. Detection of RSV was performed using real-time reverse transcription-polymerase chain reaction, with samples obtained by nasopharyngeal swabbing (AdvanSure, LG, Seoul, Korea).", "We identified a total of 1,193 children who were diagnosed with laboratory-confirmed RSV infection during the study period; 35", "Descriptive statistics were used to analyze demographic data. The continuous variables are presented as mean\u00b1standard deviation. The statistical analysis was performed using IBM SPSS Statistics ver. 21.0 (IBM Co., Armonk, NY, USA). The incidence reported by national RSV surveillance during the study period was used for comparison with the incidence pattern of this study." ] },{ "paper_id": "1052ac76b8c769749a3400eb9479e34a35407eae", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "105b993dee9f9e44637daa2d43e66f3ba3039fbf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A number of virologic and", "ON VIRAL DISEASE EMERGENCE.", "Based in references [2, 3, 6, 8, 11-16, 19, 25, 34, 36, 49, 58, 59] ." ] },{ "paper_id": "106203869ac3c318d5ec8a2644d469d71e98f056", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "107ff91ec95dea35a80145aebbe5322c08c57e5e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For rhinoviruses, there are also additional limitations related to the number of serotypes circulating and the lack of broad (14) .", "In this context, we tested three different protocols, including one that differentiated HRV form HEV by nested-PCR (2), in samples that were discordant when tested with two other protocols (17, 20) .", "Virus diagnostic procedures using cell culture are limited by the expertise of the diagnostic laboratory and the time required to obtain a result. As such, viral culture has a limited place in routine diagnostic microbiology, although these assays must still be considered in reference or research laboratories." ] },{ "paper_id": "11217ee4e2bcf58f21011db8ff3d166aad2691ca", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Type Genus-Rhinonicteris J.E. Gray, 1847 Type genus is Rhinonicteris J.E. Gray, 1847:16, which was included in J.E. Gray's (1866:81) supra-generic grouping, the Rhinonycterina, which he called \"leaf-nosed bats\". Correct generic spelling was discussed by Simmons (2005:378) and resolved by Armstrong (2006) , see also Mahoney and Walton (1988:127 ) (see derivato nominis section of the supplementary information for further discussion).", "Overcoming Impediments to Resolution . doi:10.1093/molbev/msu329 MBE because a re-examination of the holotype showed that it was misidentified originally and actually best assigned to Hipposideros ) (see table 1 for full classification) .", "Performance Evaluation: Removal of Outliers and Differential Resolving Power of Introns and Exons?" ] },{ "paper_id": "116c94dd67777e0c9806ef56974157060f5cca4b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The patient signed the informed consent for a kidney biopsy and reporting his case publicly.", "The patient was treated with 180 \u03bcg of pegylated interferonalpha on hospital day (HOD) 1 and 1,800 mg of ribavirin (600 mg every 8 hours) daily from HOD 3 to HOD 7. Anti-viral treatment was discontinued thereafter because of sustained fever and thrombocytopenia (lowest platelet count was 56,000/\u03bcL).", "The IDMS traceable SCr level was 0.9 mg/dL (the estimated glomerular filtration rate was 83.9 mL/minutes/1.73 m 2 ) on HOD 125. A urine dipstick test was negative for albumin and 2+ blood at that time, and the ACR and PCR were 5.8 and 105.6 mg/g Cr, respectively." ] },{ "paper_id": "11888535f2eb67c15d08783b164def90aa47a3bd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Six-Seven-weeks-old female BALB/c mice were purchased from Vital River Laboratories (Beijing, China).", "All data generated or analyzed during this study are included in this published article.", "Statistical analysis was performed using two-way analysis of variance with the GraphPad Prism (version 5.0; GraphPad Software, San Diego, CA, USA) software package. P-values < 0.05 were considered representative of statistically significant differences." ] },{ "paper_id": "11a6f813fa996f0baa670ecc66875602f971eef1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In the paper we describe the manifestation and etiology of the respiratory tract infections in five infants in whom the diagnosis of SCID had been established.", "In all the children affected, chest X-rays (CXR) showed bilateral interstitial infiltrations and progressive parenchymal infiltrations with decreased aeration of the lungs. In HRCT imaging, they manifested as a white-glass pattern or as consolidated infiltrations with atelectasis. The radiographic features of destruction of the lung parenchy- ", "The authors declare no conflict of interest." ] },{ "paper_id": "11af78fdd83655124c3b5acce4cfb92f0aafe4f6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "11def60675b38fbb811f2b7a9ad62f5d938c8956", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "11ebffa99e4b093c6304549246b534983012f909", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Among 129 KD patients, respiratory virus polymerase chain reaction was performed in 107 patients. Respiratory virus panel included influenza A and B, adenovirus, parainfluenza virus types 1 through 4, respiratory syncytial virus types A and B, bocavirus types 1 through 4, coronavirus NL 63, OC 43, and 229E, enterovirus, human metapneumovirus, and rhinovirus types A, B, and C.", "All patients with KD were examined for inflammatory markers such as total white blood cell count, neutrophil count, neutrophil/ lymphocyte ratio, ESR, CRP, lactate dehydrogenase (LD), and B-type natriuretic peptide (BNP).", "This was a retrospective study and we evaluated a relatively small number of adenovirus-positive KD patients; further prospective studies with larger numbers of patients are warranted to confirm our results." ] },{ "paper_id": "11f3cdbb678b326042e1d0c38887a34a2177ddfe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Twenty cats and their owners were ultimately included in the trial and pertinent information on each cat is given in Table 1 and on the entire trial group in Figure 1 . Cats presented to the study with varying degrees of pretesting by their primary-care veterinarians. This testing usually included a complete blood count (CBC) with total plasma protein, globulin (G), albumin (A), A:G; serum chemistry profile and analysis of effusions, including total protein, actual or estimated cell count, and type of inflammatory cells. Additional testing had been performed on a small proportion of cats and included FIPV antibody titers, abdominal or thoracic ultrasound, biopsies of diseased tissue and quantitative real-time PCR (qRT-PCR) on effusions.", "The 3CLpro sequences of pretreatment viral RNA obtained 25 days (CT16), 139 days (CT02), 149 days (CT12) and 231 days (CT10) later at the time of necropsy were also compared. No differences were observed in 3CLpro over this time. Sequences also remained unchanged in CT02, CT16 and CT12 from the times of presentation to necropsy. The viral 3CLpro from lung and spleen of cat CT10, which relapsed twice over 8 months and retreated, had an Asp-to-Ser substitution at position 25 and a Lys-to-Asp substitution at position 260 compared with virus from pre-treatment abdominal fluid. The exact effects of these mutations on protease function are currently being investigated. It is reported that genetic evolution of viral protein quasi-species arises over time in patients chronically infected with an RNA virus (HCV) and may lead to sporadic amino acid changes. 11", "Weight gain was a simple and accurate measure of growth and improvement of health. The value of monitoring this parameter was typified by CT04, the oldest cat in the trial (Figure 4a ). Cat CT04 presented with significant weight loss of 30%. It gained weight after each round of treatment, began to lose weight shortly before each disease relapse, and regained and added to its weight after each treatment. It regained all its lost weight after 9.3 months off and on treatment (4.8 kg to 7.19 kg). All kittens in sustained remission steadily gained weight during and after antiviral treatment, indicating normal growth continued with antiviral treatment (Figure 4b ). One long-term survivor was spayed (CT15) and two castrated (CT17, 20) without complications during their disease remissions.", "This study was conducted under protocol 18731 approved by the Institutional Animal Care and Use Committee and the Clinical Trial Review Board of the Veterinary Medical Teaching Hospital Clinical Trials Committee, University of California, Davis. This protocol detailed the conditions of the testing of a novel protease inhibitor, GC376, in client-owned cats. Each owner was required to read and consent to the conditions of the trial (supplementary material)." ] },{ "paper_id": "120be7888e94409082f16c372c818d66e558d33e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Diagnoses: Histologic examination revealed massive fibrinous exudation with organization within alveolar spaces and scattered neutrophilic infiltrates, which was consistent with AFOP.", "Interventions: This patient was treated with prednisolone therapy.", "Outcomes: Chest radiograph improvement and symptom improvement, including fever and respiratory symptoms, was observed after 2 week of oral prednisolone treatment. After 9-month of treatment, the patient was asymptomatic with stable disease and improved quality of life." ] },{ "paper_id": "12267e4378cb6c21255f204fb40b9daaa02ab09b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Animals: Eight puppies from a research breeding facility negative for these pathogens.", "Conclusions and Clinical Importance: Vaccine status should be considered when interpreting respiratory agent PCR results if modified live vaccines have been used. Development of quantitative PCR and wild-type sequencing are necessary to improve positive predictive value of these assays by distinguishing vaccinate from natural infection.", "Results: Nucleic acids of all 3 organisms contained in the topical vaccine were detected from both samples multiple times through 28 days after vaccination with higher numbers of positive samples detected between days 3 and 10 after vaccination." ] },{ "paper_id": "12666bbfb4382c1c684087fa6343d5c03cea8584", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Minor points:", "Major comments:" ] },{ "paper_id": "129fe5d1e963bc655146edf42a382819deca0ce6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "131af5ab50551638e3ce9a8c615b9b4364f2f34e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "dustry in Asia (13, 14) . During this ongoing outbreak, new strategies are desperately needed to understand pathogenic mechanisms and the functions of viral genes and to provide new technologies to combat this disease.", "To generate the ORF3 deletion RFP construct, the tdTomato gene was amplified by PCR with flanking PEDV sequence and then inserted using native restriction sites into PEDV-F. PEDV-F-\u232cORF3-RFP was cultured and sequenced to ensure seamless replacement of ORF3 with RFP containing the ORF3 TRS.", "family of viruses that is devastating animal and human populations. It is possible that genetic manipulation of recombinant PEDVs will enable studies that can significantly enhance our understanding of the role of coronavirus genetics in the transmission, virulence, and pathologies that are central to both animal and human health and disease prevention." ] },{ "paper_id": "13531a593bf382e8e4f605622db4f7f2c6ef92a9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1369823dbf5f34fd8e2f5d5bba470711dfca4032", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1376526470f18216200ecd6c375d9913942fa362", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Histology. Tissue samples of intestine, stomach, lung, kidney, spleen, and liver were fixed in 10% (vol/vol) phosphate-buffered formalin for 24 to 36 h, dehydrated in graded ethanol, embedded in paraffin, cut in 5-m sections, and mounted onto glass slides. The sections were deparaffinized, rehydrated, and then stained with hematoxylin and eosin. Slides were examined by conventional light microscopy." ] },{ "paper_id": "138e18baf12e4e92b67ab7dee321d2b149f236ed", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "13b16688b86661a6165f9c688c4f45893b7e47c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analyses were performed using GraphPad Prism 5 (GraphPad Software, San Diego, CA). Data were analyzed by analysis of variance (ANOVA) or Student's t test. All group results are expressed as mean plus or minus SEM, if not stated otherwise. The paired Student's t test was used for the comparison of group values and discriminatory parameters, where appropriate. Survival data was analyzed with SPSS software (version 16.0; SPSS Inc., Chicago, IL, USA) by using the Kaplan-Meier method and compared using a Log-rank Test. p values less than 0.05 were considered significant.", "Anti-CD4, anti-biotin, anti-CD25 and anti-CD14 magnetic microbeads were from Miltenyi Biotec. All cells were cultured in complete media consisting of RPMI 1640 supplemented with 10% heat-inactivated fetal bovine serum (FBS), penicillin (100 U/mL), streptomycin (100 \u03bcg/mL), 1\u00d7GlutaMAX (Gibco) and 1% MEM non-essential amino acids, 1% sodium pyruvate (Hyclone).", "Peripheral blood mononuclear cells (PBMC) were isolated from adult peripheral buffy coats (Gulf Coast Regional Blood Center) by Ficoll gradient centrifugation. Tregs were purified from PBMC by positive selection using directly conjugated anti-CD25 magnetic microbeads with AutoMACS (Posseld2 program)." ] },{ "paper_id": "13bcbfda70f3fae9fc63e5a041e4f3dba700b95c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Infectious diseases cause approximately one quarter of all deaths worldwide each year (Fauci and Morens, 2012) . These include the \"big three\"-HIV/AIDS, tuberculosis, and malaria-which account for 10% of all deaths. They also include emerging diseases such as Ebola, Middle East Respiratory Syndrome, and methicillin-resistant Staphylococcus aureus. Infections are caused by microbial pathogens from different domains of the tree of life-viruses, bacteria, or eukaryotes. All share the ability to colonize their hosts and cause pathology through their interactions with host cells.", "There are two predominant approaches for combating infectious diseases. One is to stimulate the immune system to prevent or reduce the impact of infection, for example, through vaccination. Another is to reduce or eliminate an existing infection with drugs that kill the infectious agent and/or enhance the immune response.", "Thus it appears that developing drugs that target host components is a viable strategy to combat infectious diseases, and this may prove complementary to the traditional approach of developing antimicrobials that target pathogen proteins. Although potential drawbacks of such a strategy include the risk of toxicity to the host, potential benefits may include an increased flexibility in developing combination therapies and a reduced capacity of the pathogens to become resistant to drug treatment." ] },{ "paper_id": "13cc84dcf620af030f92f4240637ba43a84004e9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The principles and procedures of the fluorescence recovery afar photobleaching (FRAP) technique have been discussed before (22, 23, 33) .", "Since the fluorescence was compared domain by domain (i.e., apical to apical) in unextracted and detergent extracted cells, it was assumed that detergent extraction does not modify the membrane folding and no correction for membrane folding was used. The validity of this assumption was confirmed at the EM level (see Fig. 1 C) .", "extracted from the basal surface under the same conditions." ] },{ "paper_id": "13e343269547d19b3be05976232fd5cd627e1d80", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ethical approval was obtained from the Clinical Research Ethics Committee of the Shanghai Pulmonary Hospital. Permission to conduct the study in the selected center was also obtained. The subjects participated voluntarily in the study and were informed of its purposes. A written informed consent was obtained from every eligible subject.", "Sputum bacteria culture and sensitivity test 20 were performed before and after the treatment, so did the hematuria routine, liver and kidney function test, and chest X-ray examination. Patients' clinical symptoms, signs and adverse reactions, hemogram and other parameters were recorded daily after treatment.", "The purpose of cost-effectiveness analysis was to determine the treatment plan with the least cost for certain treatment effect, which was represented by the cost per unit of " ] },{ "paper_id": "13e6c9b0730b53139910cfa6835ae4c460a30851", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "13f055e666f5a05c1f18856409f9b8f4ac4ae4ce", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Other analytical procedures Sodium dodecylsulfate (SDS)-polyacrylamide gels were performed by the method of Laemmli (1970) . Protein concentrations were determined by the method of Bradford (1976) .", "Based on the measured inhibition constants, the affinity for the disaccharide was 1000-fold higher than for any of the monosaccharides tested.", "The polymerase chain reaction was carried out using a mouse cDNA panel and Advantage 2 DNA polymerase from ClonTech-Takara Bio Europe (Saint-Germain-en-Laye, France) under the standard reaction conditions described by the manufacturer. Forward and reverse oligonucleotide primers, obtained from Invitrogen (Paisley, UK), were 5ccagggctggacgccaccaccacc-3\u2032 and 5\u2032-ctggggtcactaaagcatgcact ggtcagg-3\u2032. Following an initial denaturation at 95\u00b0C for 1 min, 40 cycles of 95\u00b0C for 30 s and 68\u00b0C for 1 min were executed, and the products were resolved on a 2% agarose gel containing ethidium bromide." ] },{ "paper_id": "140e6d0298bfcd1e825a4b81dcabc50d1658357a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1425915f5f44c6e2bb0753cbe0531cbcbad46d13", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1430ebabc4bb953366b635cd4a8adf9956c2f86b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "143381fcb7566228ad053f619d03efdfbc2668b3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "147de820d90c0ce89fb5ae6836ea1794b808fdf2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "148a0ab3b9bb851a56bbe926abed11c0d71fc61c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The protocols of both studies were reviewed and approved by Royal Canin Internal Ethics Committee." ] },{ "paper_id": "14b07f164039eddabc4f3932a873bcbccb2108f4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Searching for strains based on direct submission metadata for those viruses annotated with such data returns strain records and genome sequences matching the query criteria.", "Supplementary Data are available at NAR Online. Supplementary Table 1 , Supplementary Figures 1-5 .", "The goal of the BRC program is to provide the necessary data, bioinformatics tools and workflows to enhance ongoing basic and applied research. By integrating the data with a variety of computational analysis tools free of charge to the virology research community, complex analyses that take advantage of cross-referenced data within the ViPR database become possible.", "Viral disease outbreaks tend to occur every several years in the human population (1) (2) (3) (4) . During such outbreaks, identification of the causative agent and comparative genomic analysis can be critical to limiting the spread of the virus and identifying suitable treatment options. While the first lines of defense against such outbreaks are clinical reporting and automated surveillance, 'wet lab' experimentation of viral isolates is also important. Bioinformatics tools and database resources that provide information about the genomic structures and phenotypic characteristics of known viruses can make this process more efficient by supporting data mining for the development of hypotheses worthy of in-depth laboratory experimentation on the emerging strain." ] },{ "paper_id": "14c6f99cf0ec54c78447ad5a8403e3ee2708176f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "HIV was first reported in China in 1985. Since then, the HIV epidemic has been concentrated in most at-risk populations (MARPs), including injection drug users (IDUs), commercial sex workers (CSWs) and their clients, men who have sex with men (MSM) and former plasma donors who became infected because of unsafe donation practices.", "International support has not only been provided to governmental agencies, but also to Chinese domestic NGOs, civil society organization or grassroot organizations. From 2005 to 2008, 11.8 million USD was provided for their activities, including training and prevention interventions.", "A second challenge is accomplishing needed work while still exploring new models. In the past, some locations looked at cooperation projects as a way to provide funding for routine work. These locations failed to take full advantage of innovative projects. It is a challenge for China to take full advantage of international projects requiring the flexible piloting of new ideas and new technology while still completing routine work." ] },{ "paper_id": "14c9ca5bf096d03bde8e8ffe88c7419ef5b79b13", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Given a slippery sequence p in s, a candidate x is a substring of s of the form x = pu, for various lengths of u.", "We downloaded the yeast genome sequences from NCBI (accessions: NC_001133, . . . , NC_001148, NC_ 001224; all versions are dated 24 January 2007) and extracted 6199 annotated ORFs with a total length of 8.76 MB. Each ORF was analyzed by KnotInFrame and for each ORF the five best predictions were stored and used in the comparison.", "Supplemantary Data are available at NAR Online.", "Definitions. Let s be a DNA sequence of length n. We require neither a start codon nor frame information. s i; j \u00bd is a substring of s starting at position i and ending at position j, and s\u00bdi; n is called a suffix of s. A slippery sequence in s is a substring s\u00bdi; i \u00fe 6 that matches the consensus slippery motif of the form X XXY YYZ, where the spacer marks the zero-frame codons, XXX stands for any three identical nucleotides, YYY for either three As or three T/Us and Z for any nucleotide." ] },{ "paper_id": "14e7bfe37c331fdf83f54808418cae7129a653a0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Feline infectious peritonitis (FIP) is a common disease in cats and some non-domestic felids that is caused by feline coronavirus (FCoV) 1 . This virus is included in the Coronaviridae family, a group of enveloped positivestranded RNA viruses 1 . Although FIP manifests itself in effusive or noneffusive forms, the basic lesion is the same, a pyogranulomatous inflammation and vasculitis 1 . Testing by immunofluorescence assay, ELISA, electron microscopy, RT-PCR and sequence analysis may be useful in supporting a diagnosis of FIP 1,2 .", "Since 2006, some ferrets with clinical signs and visceral lesions similar to those in cats with FIP have been reported [2] [3] [4] [5] . All cases in these reports were found in either Europe or the United States, and no case had been reported i n J a p a n . R e c e n t l y , w e e n c o u n t e r e d a c a s e o f pyogranulomatous inflammation in the mesentery of a male ferret that was similar to the cases previously reported. This paper describes the histopathological features of our ferret, which is the first reported case of feline infectious peritonitis-like pyogranuloma in ferrets in Japan.", "Fecal-oral exposure seems to be the likely route of transmission for this coronavirus 2 . All the ferrets we purchased were bred in individual cages, and the ferret in this report had a short latency period in our laboratory. Accordingly, we consider that the risk of infection in our laboratory is low but it is unclear how the ferret became infected. To our knowledge, this disease resembling FIP in a ferret has not previously been reported in Japan, and therefore this is apparently the first case in Japan." ] },{ "paper_id": "14e878a6400d8320e2c781a76edc4a14f4cec1df", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Viruses are the most common etiology of ARIs in children. 6, 7 These include rhinovirus (RhV), respiratory www.mjhid.org Mediterr J Hematol Infect Dis 2019; 11; e2019059", "Medical history and demographic data were obtained from the patients and their medical records. A respiratory sample was collected and stored at -80\u00b0C for viral assessment. The study was approved by the Institutional Review Board (IRB) of the AUBMC, and written informed consent was obtained from all parents.", "Nucleic acid extraction and viral detection. Nucleic acid was extracted from clinical specimens by using the QIAamp MinElute Virus Spin kit (Qiagen) according to the manufacturer's protocol. A 200 \u00b5l aliquot of each specimen was used for nucleic extraction. Specimens were then analyzed by the ResPlex II panel (Qiagen) using the manufacturer's protocol." ] },{ "paper_id": "151b29e4b482ad11ee11e83cec4f3faebb8124c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Reagents 2-iminothiolane (2-IT), m-maleimidobenzoyl-N-hydroxysulfosuccinimide ester (sulfo-MBS), Amino Ethyl-8 Reagent, HRP, and DAB were purchased from Pierce Chemical (Rockford, IL). Fluorescein 5-isothiocyanate (isomer 1), and Slow Fade were purchased from Molecular Probes (Eugene, OR). Glutaraldehyde, osmium tetroxide, and EMbed 812 kits were purchased from Electron Microscopy Sciences (Fort Washington, PA). Cy3.18 was purchased from Biological Detection Systems (Pittsburgh, PA). Balanced salt solutions and other reagents used in the preparation of media were purchased from GIBCO BRL (Gaithersburg, MD). Chromatographic matrices were purchased from Pharmacia LKB Biotechnology (Piscataway, N J). All other reagents were purchased from Sigma Chem. Co. (St. Louis, MO).", "1,1 '-dioctadecyl-3,3,3',3'-tetramethylindocarbocyanine-labeled LDL (DiI-LDL) was prepared according to the method of Pitas et al. (1981) and kindly provided by Drs. J. N. Myers and I. Tabas (Columbia University, NY) .", "each particle of Tfl0 must be displacing several 125I-Tf particles and by inference binding several TfR." ] },{ "paper_id": "153c3a86e8939de3ca0331ea95b68f8bb4a3e395", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Members of the rab/YPTI/SEC4 gene family", "Hiss-tagged rabla(N124D protein was prepared as described (Nuoffer et ai., 1994) .", "After transport in vitro, permeabilized NRK cells were fixed for 30 rain with 3 % paraformaidehyde and 0.1% glutaraldehyde, pH 7.4, in 0.1 M phosphate buffer, washed briefly in PBS, and processed for immunodiffusion or indirect immunogold labeling of ultrathin cryosections." ] },{ "paper_id": "1560d77c8e16b3b283f328b1c3de5513014522e9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "+ + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +", "Conflict of interest relevant to this article was not reported." ] },{ "paper_id": "157d6b204fdc9b7ea26cdbffea19197b0faaa31f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "15ac0bdac1ae44bf9d833b2156761082915fb642", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Abbreviations: Corona, coronavirus; RSV, respiratory syncytial virus; Para, parainfluenza virus; MFI, median fluorescence intensity.", "involved enterovirus/rhinovirus (78%), consistent with results of previous studies [12, 13] , and 43% of these cases involved enterovirus/rhinovirus and RSV.", "In conclusion, the two Luminex assays performed comparably for most pathogens, with the NxTAG RPP having the advantages of being able to detect atypical bacteria and having better diag-nostic sensitivity for certain viruses.", "The NxTAG RPP detected the presence of M. pneumoniae in one of the samples included in this study. This finding was con-firmed by using a commercial real-time PCR assay for Mycoplasma, the Venor GeM qEP Mycoplasma detection kit (Minerva Biolabs GmbH, Berlin, Germany). Subsequent sensitivity testing using the lyophilized 10 colony-forming units (CFU) Sensitivity Standards (Minerva Biolabs GmbH) showed that NxTAG assay was capable of detecting M. pneumoniae strain down to 10 CFUs/ PCR." ] },{ "paper_id": "15d061338f90460e59acb68d6cd52f5e776e53c1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "15d87194ff22d1a52809b2c2332aa3e11a6fcd4a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For additional Materials and Methods, please refer to the Supplementary Materials.", "Supplementary materials are available at The Journal of Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author. ", "Hepatitis B virus (HBV) infection is a severe health burden, with approximately 2 billion infected people and >250 million chronically infected carriers [1] . HBV is the major cause of chronic liver diseases, the primary causative agent of hepatocellular carcinoma, and responsible for 887 000 deaths worldwide annually [2] . Despite the availability of vaccines and drugs, chronic hepatitis B is still an incurable disease. HBV is a small, enveloped, hepatotropic DNA virus belonging to the family Hepadnaviridae [3] ." ] },{ "paper_id": "15e262dad93d5086e9fcb6a1267dec5189f5c1fe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The UNITAID Constitution directs the initiative to dedicate at least 85% of its spending on products for lowincome countries.", "The Open AIDS Journal, 2010, Volume 4 39 more easily and quickly; and patients in developing countries get faster access to better, more affordable treatments.", "Today, however, the treatment landscape is more complex." ] },{ "paper_id": "15f57ae58cbfdd0616c570508ce0471bc4dacebe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "15f99a27eec125edd5f2c431344f01883ff72129", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Phase I studies of a synthetic, consensus DNA plasmid vaccine A single MERS-CoV vaccine candidate, full-length S protein consensus DNA vaccine GLS-5300, has progressed to human clinical trials ( Table 2) . A total of 75 participants were assigned to one of 3 dose levels: 0.67 mg, 2 mg, or 6 mg administered on day 0, week 4, and week 12 via intramuscular (IM) injection and followed by electroporation (EP). Additional studies to assess the relative immunogenicity of intradermal (ID) vaccine administration and followed by EP will provide details as to optimal vaccine dosing.", "Vaccine candidates in development include live-attenuated viral vaccines; live chimeric vaccines; purified inactivated (killed) vaccines (PIV); viral vectored vaccines based on measles, adeno-associated virus (AAV), vesicular stomatitis virus (VSV), and vaccinia platforms; subunit and nanoparticle protein based vaccines; and nucleic acid vaccines using both DNA and mRNA approaches 138, 139 (see also the World Health Organization listing at http://www.who.int/immunization/research/ vaccine_pipeline_tracker_spreadsheet/en/). As of the date of this review, pre-clinical data for one PIV vaccine, an attenuated live-virus vaccine, 3 DNA vaccines, 2 mRNA vaccines, 2 separate AAV-based vaccine (Ad5 and Ad52), and a subunit vaccine have been published. [140] [141] [142] [143] [144] [145] [146] [147] Three DNA vaccines, an mRNA vaccine, and a PIV vaccine have advanced into Phase I clinical trials ( Table 3) .", "Both diseases had the advantage of occurring at a time when multiple platform technologies were existent. 154 Many platforms could respond to a new pathogen after only minimal genetic modification. Experience has allowed more classical vaccines to also undergo rapid modification, although in some cases structural considerations (e.g., protein structure and antigen presentation) or unique adverse events (e.g., eosinophilc pulmonary inflammation induced by whole inactivated SARS virus vaccines at the time of viral challenge 158 ) were required." ] },{ "paper_id": "16320b30b2f068bc2d7bc9cf2f2da87261f041b4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "165792449dc650fba4a923f3a94a851754a7bcb7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1685a03eac1fe5f949aa6b7889e02dadf9d3f90f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00698-13/-/DCSupplemental. Text S1, DOC file, 0.1 MB. Figure S1 , TIF file, 1 MB. Figure S2 , TIF file, 0.8 MB. Figure S3 , TIF file, 1.8 MB. Figure S4 , TIF file, 1.5 MB. Figure S5 , TIF file, 0.6 MB. Figure S6 , TIF file, 2.6 MB. Figure S7 , TIF file, 3.2 MB. Figure S8 , TIF file, 2.4 MB. Figure S9 , TIF file, 0.8 MB.", "Microarray data accession number. The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus (58) and are accessible through GEO Series accession number GSE48831 (http: //www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc\u03edGSE48831)." ] },{ "paper_id": "1694b4f8e456f966ff1fe215161bae59e59148df", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "169eb7d3419808c29066e6e5ed091a8d54bc214a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For competition assays, U3 snoRNA was transcribed by T7 RNA polymerase (Fermentas T7 transcription kit K0411) and labelled with [a-32 P]UTP. The labelled U3 snoRNA was preincubated with AtFib2 in binding buffer for 10 min, and then competitors were added and incubation was continued for 10 min. After electrophoresis, gels containing radiolabelled RNA were dried and exposed to a Phosphoimager (Fujifilm Fla-300), and the intensity of RNA bands were quantified (with Aida/2D Densitometry).", "AtFib2 RNA binding was additionally analysed in competition assays. Figure 2G shows that a radiolabelled U3 snoRNA can be released from the complex with AtFib2 by TMV RNA, 18S rRNA and 26S rRNA, although 18S rRNA was a less efficient competitor.", "Supplementary Data are available at NAR Online. " ] },{ "paper_id": "16c8b4fe2b6ae40077de377027c4fdf6a27a0744", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "16d4d6332fb5f17df0c487e2c9202716d01889be", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "16dd2eb417bbac88ac2235efe705761a57807ae6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There was not off-label antimicrobial use. ", "https://orcid.org/0000-0003-0259-7210" ] },{ "paper_id": "17114faf3bbc2a82ef49762ce4f3f922cb213f4e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "174f63ff45fc7bbecf0f559200761ad76691b6fb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Alaternin-2-O-\u03b2-D-glucopyranoside (29) 34", "Chryso-obtusin-2-O-\u03b2-D-glucopyranoside (7) 36", "Obtusifolin Rubrofusarin (47) 49 Rubrofusarin" ] },{ "paper_id": "176fa00106dc0e7b0ef19c0b606aa80cd14e4057", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "HepG2 cells were reverse-transfected with corresponding constructs using Lipofectamine 3000 and Opti-MEM (Life Technologies).", "I nterferons (IFNs) are an essential part of the innate immune response, which is the first line of defense against pathogens. The induction of IFNs leads to activation of the JAK/STAT signaling pathway and expression of interferonstimulated genes (ISGs) in the infected and the surrounding cells. This response can limit viral spread through mobilization of cellular defense mechanisms and elimination of infected cells (Parkin and Cohen 2001; Levy and others 2011) .", "IFN-l4 protein sequences were analyzed with free online tools-Clustal W for sequence alignment and BoxShade for annotating amino acid similarities. Analysis of leader peptides was performed with online SignalP 4.1Server (Petersen and others 2011) , and PSORT II analysis of nuclear localization signals and intracellular localization was performed with PSORT server (http://psort.hgc.jp/) (Nakai and Horton 1999) . Statistical analysis and graphical presentation of results were done with GraphPad Prism 6 (GraphPad).", "We used information based on our earlier sequencing of the genomic DNA for chimpanzee IFN-l4 (GenBank JX867772 and NM_001276259) and cynomolgus (crabeating macaque; Genbank KC525948). Sequences for orangutan, marmoset, elephant, panda, megabat, cow, dog, and pig were only derived from the UCSC Genome browser and not validated by sequencing. Commercial genomic DNA sample for rhesus was obtained from Zyagen and used for Sanger sequencing of the predicted IFN-l4 ORF." ] },{ "paper_id": "17bfdf17f46ae63e52c3e7c085bac97057e9ae61", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org/ lookup/suppl/doi:10.1128/mBio.00759-15/-/DCSupplemental.", "Text S1, DOCX file, 0.1 MB.", "Transient-replication assay. For quantification of the replication efficiency of subgenomic replicons containing a firefly luciferase gene, luciferase activity contained in cell lysates was determined at different time points after electroporation as described elsewhere (49) ." ] },{ "paper_id": "17c135abc3c6a212ba22ae3d3750e4a396933022", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "17c30925f6e62319c5049126e8fddbc1410e9983", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Several different sources of antisera were initially tested for quantitative immunoprecipitation of lysosomal hydrolases from rodent islets. Based on these trials, experiments using antisera to cathespin L (from Dr. C. Gabel, Pfizer Research, Groton, CT), cathespin B (from Dr. A. Saluja, Beth Israel Hospital, Boston, MA), and cathespin D (from Dr. S. Diment, New York University, New York) were performed in mouse islets. ~glucuronidase, which was too low for reliable detection in mouse islets, was immunoprecipitated from rat islets (antiserum from Dr. R. Ganschow, University of Cincinnati, OH). The precipitation reagent used was either protein A agarose or Zysorbin (Zymed, San Francisco, CA). Immunoprecipitates were dissolved in SDS gel sample buffer and analyzed by 12% acrylarnide SDS-PAGE, followed by fluorography.", "The C-peptidedInsulin (C/I) ratios from media collected during the 60-120min chase period from control islets or those treated with zinc or chloroquine, were measured by specific immunoprecipitation using antisera to insulin and rat C-peptide as described previously (Kuliawat and Aryan, 1992) . Data from the supplier (Linco) and our own preliminary studies indicate that the anti-C-peptide precipitation may under-recover rat and mouse C-peptides, especially C-peptide-1, so that the C/I ratios >unity are nevertheless likely to be underestimates. However, neither ehloroquine nor zinc treatment of islets influences the subsequent immunoprecipitation step per se (data not shown).", "tion of/~-cell secretagogues (Fig. 1) . Thus, although a small fraction of lysosomal enzymes may exist in B-granules (Ira et al., 1989) , mechanisms exist for the selective storage of regulated secretory proteins (Kelly, 1985) and lysosomal enzymes (Kornfeld and Mellman, 1989) in largely nonoverlapping steady-state distributions." ] },{ "paper_id": "17c738edd73de72b15a2ca40132e7747d38fb221", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "17da3a159054b31e3da81a51ab9ccc26e18bd266", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ACKNOWLEDGMENTS. Authors thank Mr. N. Uchiyama for his efforts in preparing the original design of the PACT device. We also thank Mr. K. Ohnuki for for his instructive suggestions. This research is supported by the Matching Planner Program from Japan Science and Technology Agency, JST. ", "FCV-F9 (VR-782, 40 nm diameter) virus used in the study is a vaccine strain. Crandell Rees feline kidney (CRFK) cells were used for culturing and measurement of the virus. Cells were cultured in Eagle MEM (Nissui, Tokyo, Japan) containing 5% fetal bovine serum (Nichirei Bioscience Inc., Tokyo, Japan), 0.3% Tryptose Phosphate Broth (BD Biosciences, Sparks, MD, U.S.A.), and antibiotics (100 U/ml of Penicillin and 100 \u00b5g/ml of Streptomycin).", "PACT was developed as an air purification technique and, for example, has been shown to be effective in removing toxic substances in cigarette smoke. It has also recently been utilized to inactivate bio-aerosols employing plasma technology [5] . We investigated whether PACT has a virucidal effect against an airborne, infectious virus and found that aerosolized FCV was inactivated by PACT and the FCV titer could be reduced to below the detection limit depending on conditions." ] },{ "paper_id": "17f00e096a5f3ce94278a77011e6f38d7a47c618", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Subsequently, absorbance of the sample was measured at 450 nm in a microplate reader (Tecan). The experiments were repeated three times.", "Authors declare no conflicts of interest for this article. " ] },{ "paper_id": "17fd86bef40a55871ecfc83dc845f3a988bf4aaa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplementary textexperimental procedures Figures S1 to S7 Tables S1", "\u2020 These authors contributed equally to this work www.pnas.org/cgi/", "CedV, HeV and NiV soluble receptor-binding proteins (sG) were each coupled to specific magnetic microspheres following a standard manufacturer protocol (Bio-Rad) and mixed together. Henipavirus sG coupled microspheres were incubated with serial diluted human monoclonal antibody, m102.4, at indicated concentrations and incubated at room temperature with agitation. Wells were washed with PBS-Tween (0.05%) then incubated with biotinylated anti-human IgG (1:10,000), agitated, washed and finally incubated with streptavidin-phycoerythrin (PE). The PE signal for each sG-coupled microsphere -hm102.4 complex was detected as a median fluorescence intensity (MFI) by a Bio-Plex 200 machine (Bio-Rad). The graph is a representation of two independent experiments performed in technical triplicates. Hercules, CA) machine using Luminex xMAP technology." ] },{ "paper_id": "1863b855d1e87b1a2b85a88c71c0b8753619f0b2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "amino-terminal signal sequence or membrane-spanning domains. Analysis by BLAST and COILS2.1 (Lupas et al., 1991) indicated that a region of Vps38 has some probability to form a coiled coil structure (not shown).", "Steady-state levels of Pma1, CPY, and Kex2 were analyzed in cell lysates, prepared from mid-log cultures by vortexing with glass beads, as de-scribed previously (Chang and Slayman, 1991) . Samples were normalized to lysate protein using the Bradford assay (Bio-Rad Laboratories, Hercules, CA). After separation by SDS-PAGE, samples were transferred to nitrocellulose for Western blot with rabbit antibodies against Pma1, CPY, or Kex2, and 125 I-protein A (Amersham Corp., Arlington Heights, IL).", "The Journal of Cell Biology, Volume 138, 1997" ] },{ "paper_id": "18aa7bfcf8b4dfcad03cf4836aaaa5345d6cfdc7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cells. NIH/3T3 murine fibroblasts (CRL-1658) obtained from ATCC (Manassas, VA) were maintained in DMEM containing 10% fetal calf serum. PC-3 human prostate carcinoma cells were maintained in Ham's F12 media containing 10% fetal calf serum.", "Western blotting. Transfected cells were lysed and total cellular protein extracted using M-PER solution (Pierce Biotechnology, Rockford, IL) containing protease inhibitor cocktail (Roche, Welwyn Garden City, UK). Protein concentration was determined by BCA assay; 20 \u03bcg of total protein was loaded onto each well of a 12% SDS-PAGE gel and run at 170 V for 40 minutes. The proteins were transferred to a nitrocellulose membrane and blocked in 5% dried milk in Tris-buffered saline pH 7.4, 0.1% Tween 20 (TBST) at room temperature for 60 minutes. The blot was then washed three times with TBST and incubated with mouse anti-LacI clone 9A5 primary antibody (Millipore UK, Watford, UK) diluted 1 in 1,000 at room temperature for 2 hours. The blot was then washed three times with TBST and incubated with goat antimouse IgG-HRP secondary antibody (Dako, Ely, UK) diluted 1 in 5,000 at room temperature for 1 hour. The blot was washed and the bands visualized by chemiluminescence using ECL western blotting detection reagent (GE Healthcare, Little Chalfont, UK) on a ChemiImager (Alpha Innotech, San Leandro, CA), and analyzed using Fluorchem 8000 software. Each blot was stripped and reprobed with sc-5286 anti-\u03b1-tubulin antibodies (Santa Cruz Biotechnology, Santa Cruz, CA) diluted 1:1,000 as a protein loading control.", "The strategy adopted to develop a lac-regulated luciferase expression model was based on that previously performed by Scrable et al. 33, 34 Briefly, transgenic lines comprising HDLacO-Luc and LacIR were generated and then subsequently crossed to produce double transgenic (HDLacOLuc x LacIR) offspring." ] },{ "paper_id": "18cdd1a1d97483f2cb8a1586b2d4858dab46efa2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Human infection with the Middle East respiratory syndrome coronavirus (MERS-CoV), a positive-sense single-stranded RNA virus of the family Coronaviridae, was first reported in 2012 [1]. Since then, more than 2,200 laboratory-confirmed cases have been described with an estimated 35.5% case-fatality rate [2] . Middle East countries appeared to be mainly affected by the life-threatening pathogenicity of the virus, but some exported cases were also reported in Asia, Europe, and the United States of America [1,3]. Given zoonotic transmission of the virus from dromedary camels to humans and its lethality in humans [1], vaccines and/or antivirals should be prepared, but no approved medical countermeasures are available, yet.", "In line with the pathogenic mechanisms reported with MERS-CoV [4], such as acute respiratory symptoms and local immune responses, viral antagonism against host innate immune responses may be of great significance in terms of the pandemic potential and host range restriction of the virus. Viral antagonism had been already described for , and, of the MERS-CoV proteins, protein 4a was suggested responsible for its role against RNA-dependent protein kinase-mediated antiviral immunity and activation of retinoic acidinducible gene I and Melanoma Differentiation-Associated protein 5 of host cells [6, 7] . The antagonistic effects of MERS-CoV protein 4b were also demonstrated against nuclear factor-\u03baB-dependent immunity and RNase L activation of host cells [8, 9] . As shown for influenza and Zika viruses [10, 11] , the species-specific effects of viral antagonism of MERS-CoV on J Vet Sci.", "The 4a and 4b proteins of the Middle East respiratory syndrome coronavirus (MERS-CoV) have been described for their antagonism on host innate immunity. However, unlike clustering patterns of the complete gene sequences of human and camel MERS-CoVs, the 4a and 4b protein coding regions did not constitute species-specific phylogenetic groups. Moreover, given the estimated evolutionary rates of the complete, 4a, and 4b gene sequences, the 4a and 4b proteins might be less affected by species-specific innate immune pressures. These results suggest that the 4a and 4b proteins of MERS-CoV may function against host innate immunity in a manner independent of host species and/or evolutionary clustering patterns." ] },{ "paper_id": "18d7f4c8e204349b39a037c19874cff1b34d0f97", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The coordinates and diffraction data have been deposited into the Protein Data Bank with accession code 4L72.", "Purified RBD and DPP4 were mixed for 1 h and then loaded to Superdex 200 column. The complex was collected and concentrated to ~10 mg/ml in HBS buffer (10 mM HEPES, pH 7.2, 150 mM NaCl) for crystallization. Crystals were successfully grown at room temperature using the sitting drop vapor diffusion method by mixing equal volumes of protein and reservoir solution containing 25% (w/v) polyethylene glycol 1500. Crystals were frozen in liquid nitrogen with cryoprotectant (well solution plus 20% (v/v) glycol) before data collection. Diffraction data were collected at the BL17U beam line of the Shanghai Synchrotron Research Facility (SSRF). Diffraction data were indexed, integrated and scaled with the program HKL2000 [20] .", "The structure was determined by the molecular replacement method with PHASER [21] in CCP4 suite [22] . The search models are DPP4 extracellular domain structure (PDB code 2G63) and SARS-CoV RBD structure deleting the receptor-binding loop (PDB code 2AJF). Density map improvement by atoms update and refinement was performed with ARP/wARP [23] , and automatic model extension of the missing receptor-binding subdomain of MERS-CoV was carried out with BUCCANNER [24] . At the final stages of model building and refinement, glycans were added based on the electron densities. Structure validation was performed with PROCHECK [25] . All structural figures were made with Py-Mol [26] ." ] },{ "paper_id": "1919f9569a8e073accc1c8a105ec36a56ddf569c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1999185dad27d52562c1dfe77bb72f06bdaf5084", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "19e9fcce4b442e7bef53c6cec0aee71a1c565943", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was approved by the Institutional Review Board (IRB) of Samsung Medical Center (IRB No. 2017-10-002-003). Informed consent was waived since only overall statistical data was used without review of medical records of individual patients." ] },{ "paper_id": "19fb39e16fc35b4ca36825636d018beda55d3d42", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1a2900a53677a6c68ff37167c31ca33ad219acdb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Five female BALB/c mice (6-week old) were purchased from Orient Bio Incorporated (Korea). The animal room was maintained at 22 \u00b1 2 o C (relative humidity, 50% \u00b1 10%) and illuminated using a 12-h day/12-h night cycle. The experiments were performed in accordance with the Code of Laboratory Animal Welfare Ethics, National Research and Quarantine Service, Korea (NVRQS).Experimental design was approved by the NVRQS Animal Welfare Committee.", "Fluoroquinolones (FQs) have been widely used as human and veterinary drugs, especially for the prevention and treatment of various infectious diseases in domestic animals, poultry, and fish [21] . FQs act through inhibition of DNA-gyrase, abolishing activity by interfering with the DNA rejoining reaction [3, 14] . The widespread use of FQs has led to contaminating residues in foodstuffs derived from treated animals, which can induce unwanted reactions such as erythema, burning, and itching in humans and animals [25] . Furthermore, antibiotics released into the natural ecosystem can modify the local environmental microbiota by changing the composition or activity [1, 23] . Many regulatory agencies have established a maximum residue limit for FQs in milk, meat, and other foods [5, 6] . For example, the maximum sum of enrofloxacin (ENR) and its metabolite ciprofloxacin in muscle was set at 100 \uf06dg/kg for all animal species in the European Union [14] .", "Bovine serum albumin (BSA), enrofloxacin, ciprofloxacin, difloxacin, sarafloxacin, pefloxacin, norfloxaicin, keyhole limpet hemocyanin (KLH), N-hydroxysuccinimide (NHS), triethylamine, carbonate-bicarbonate buffer, Tween 20, glutaraldehyde solution (Grade II, 25%), glycine, Freund's complete adjuvant/incomplete adjuvant, and 1-ethyl-3-(dimethylaminopropyl)carbodiimide hydrochloride (EDC) were purchased from Sigma-Aldrich (USA). Goat anti-mouse IgG was purchased from Abcam (UK). An EZ-Link Plus Activated Peroxidase kit was purchased from Thermo Scientific (USA). 3, 3', 5, 5'-tetra-methylbenzidine (TMB) solution was purchased from KPL (USA). Amine-functionalized MNPs (160 nm) were acquired from Nanobric (Korea). A HiTrap Protein G HP kit was obtained from GE Healthcare (UK).", "To produce the ascites fluid, hybridoma cells in medium were intraperitoneally injected into a mature female BALB/c mouse that had previously been injected with 0.5 mL of pristine. After 14 days, the ascites fluid was collected, and monoclonal IgG from ascites was purified using Protein G column chromatography (GE Healthcare). The isotype of the purified antibody was determined using a mouse mAb isotyping kit (Roche) according to the manufacturer's instructions. The ENR mAb was conjugated to horseradish peroxidase (HRP) using an HRP labeling kit (Thermo Scientific), then stored at \u221220 o C until use.", "As a light molecule with a molecular mass of 359.4, enrofloxacin must be conjugated with a carrier protein to elicit the immune response, which an animal uses to produce the desirable antibodies. Szurodoki et al. indicated that,among the carrier proteins for immunogens, KLH is generally a potent immunogen [28] . KLH conjugate was also found to much more accurately stimulate the corresponding region of the protein and to induce the synthesis of larger amounts of specific antibody than a BSA conjugate [7, 12] . Therefore, we prepared to conjugate ENR with KLH for an immunogen and ENR with BSA for a coating antigen using the NHS method [15, 22, 29] ." ] },{ "paper_id": "1a39379895d1e136f64c7b79ef2204de094dfa75", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The PLEX-ID/Flu assay has been recently developed to enable the detection and typing of influenza viruses based on the RT-PCR/electrospray ionization mass spectrometry technology.", "The influenza A(H1N1)pdm pandemic in 2009 resulted in the development of a number of assays, such as single/multiplex real-time RT-PCR [3] [4] [5] [6] or microarray systems [7, 8] , allowing the rapid detection and typing of influenza virus in human specimens. Sensitive and rapid diagnostic or typing assays are essential for appropriate patient management, particularly high risk patients, and the use of appropriate antiviral therapy." ] },{ "paper_id": "1a3ac4ed56c42714b04e97e0e5e11a93c5a91508", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "After labeling, monolayers were washed twice with Moscona's PBS (36) and cells were scraped offthe dish into an SDS solution (20 mM Tris-HCl, 7.4, 2% SDS) and sonicated 10-30 s in a Heat Systems-Ultrasonics Instrument with a microtip (Heat Systems-Ultrasonics, Inc. Plainview, NY). The suspension was boiled for 2 min and centrifuged (2 min at 15,000 g) in an Eppendorf 5412 to remove unsolubilized material. The supernatant was diluted fourfold with 50 mM Tris-HCl 7.4, 190 mM NaCI, 6 mM EDTA, 2.5% Triton X-100, 0.02% NAN3, and 100 U/ml Trasylol (Solution A).", "Immuneprecipitation: Cell extracts were incubated with lgG fractions (300 ~g/ml) at room temperature for l h and at 4\"C for 14 h before addition of protein-A-sepharose CL-4B beads. After incubation for 3 h at room temperature, the beads were sedimented, washed three times with Solution A containing 0.2% SDS, and boiled for 2 min in a solution of 10% SDS, l M dithiothreitol, 2 mM EDTA.", "RNA Extraction: Clone 9 hepatocytes or GH 3.1 pituitary cells were homogenized in a solution containing 5 M guanidine thiocyanate plus 100 mM mercaptoethanol at pH 5.0 (58). RNA was separated by centrifugation through 0.2 vol of 5.7 M CsCl2 as described by Liu et al. (32) . Similarly, total RNA was prepared from control rats starved for 18 h or from rats sacrificed 15-24 h after partial bepatectomy (l 6)." ] },{ "paper_id": "1a6e69772e4e79d9106015988c0d6ed48dc25ceb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Although the consequences of several caspase protein cleavages have been elucidated, they remain elusive so far for others (Table 4) .", "Caspase Cleavage as a Way for Viruses to Replicate and Spread: Live and Let Die Unlike the expression of antiapoptotic products, the requirement of apoptosis for viruses to survive is a way more counterintuitive strategy that yet has been evolved by several viruses and involves caspase cleavage (Table 2) .", "Apoptosis induction by infected cells is meant to jeopardize viral replication. Therefore, many viruses have developed strategies to inhibit this process through various mechanisms. Among them, inhibiting caspase activity through the cleavage of viral proteins constitutes an effective way to achieve apoptosis suppression (Table 1) .", "Herpex simplex virus 1 (HSV-1) causes lifelong infections affecting between 50 and 90% of the global population. HSV-1 exerts antiapoptotic properties against numerous stimuli. But some variants including d120 mutant induce apoptosis and under these conditions, infected cell protein no. 22 (ICP22 or M r 37,500 protein) leads to an additional product (M r 35,000) that can result in vitro from ICP22 cleavage by caspase 3. 49 Neither the identity of the caspase site nor the biological relevance of ICP22 cleavage has been further investigated yet." ] },{ "paper_id": "1a7676018fd73150a122c2afb1362324dbab4918", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Frozen prostate cancer samples were sectioned onto slides. Cell nuclei were isolated in situ with ice-cold cytoskeleton buffer (CSK: 300 mM sucrose, 100 mM NaCl, 10 mM PIPES, 3 mM MgCL 2 , 1 mM EGTA and 0.5% Triton X-100) (28) . The slides were fixed by dipping in ice-cold methanol for 3 min, followed by ice-cold acetone. After air drying the slides, they were allowed to age for at least 1 week in ethanol.", "DNA-FISH was carried out according to a method for single copy loci detection (28) . The protocol was adapted with few modifications, using 50-mer oligonucleotides specific to the loci of interest and labeled with a desired hapten. Two probes were used for FISH for breakapart assay. A probe located at the promoter region of TMPRSS2 was labeled with biotin (Bio/GACTCCA GGAGCGCTCCCCAGAATCCCCTTCCTTAACCCA AACTCGAGCC). The other probe at exon 2 of ERG was labeled with 5 0 -6-carboxyfluorescein (56FAM) (56FAM/ GATCTTTGGAGACCCGAGGAAAGCCGTGTTGA CCAAAAGCAAGACAAATG). Detection of probes was achieved by using antibodies conjugated to quantum dots (Qdot) against the hapten label. Conditions were optimized to use a combination of two antibodies (1 : 200) obtained from Invitrogen-Molecular Probes TM (Qdot 655 \u00c3 sheep anti-Bio primary antibody conjugate; Qdot 525 \u00c3 Goat anti-FITC whole IgG primary antibody conjugate). Image acquisition was done with a Zeiss Axioplan 2e microscope (Carl Zeiss, Inc.). All pictures in the corresponding three channels were deconvolved and optical sections merged to produce 2D pictures using Axiovision 4.0 software (Carl Zeiss, Inc.) and Image J (Rasband, W.S., ImageJ, U. S. National Institutes of Health, Bethesda, MD, USA, http://rsb.info.nih.gov/ij/, 1997-2006.)", "Institutes of Health (CA119335 to UCSD NanoTumor Center of Excellence for Cancer Nanotechnology, CA133634 to Y. T. Liu, NS034934 to" ] },{ "paper_id": "1aaa45043de59cda6c14acd355518c688f37b374", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Programs now include disaster exercises, semester-long courses for professional students, web-based simulation exercises, and large-scale high-fidelity curricula that utilize human simulators and actors.", "Station A Station A covers airway management, dressing care, IV infusion management, and urinary catheter care (\u00b1 additional basic skills as required).", "Station C Station C features human patient simulation." ] },{ "paper_id": "1b58422e266ab9339c919119923229d080f27360", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The levels of various markers in the pleural effusion samples are expressed as the mean \u00b1 standard deviation (SD) or shown as the median (interquartile range). Group comparisons were made using the nonparametric Kruskal-Wallis test. Differences were considered statistically significant when p < 0.05. Statistical analysis was performed using statistical software (SPSS, Chicago, IL, USA).", "Pleural effusions from 125 patients were processed in our laboratory from August 2010 to December 2011. All pleural effusions were designated as transudates or exudates according to Light's criteria [12] . Definitive diagnosis of tuberculous, pneumonia, or adenocarcinoma effusions for the exudate was verified by examining effusion biochemistry, cytology, acid-fast staining, and clinical follow-up. The study was performed with the approval of the Institutional Review Board of Mackay Memorial Hospital. Informed consent was obtained from all patients.", "For each pleural effusion sample, the routine pleural analyses included total protein, lactate dehydrogenase (LDH), glucose, and white blood cell (WBC) count. In addition, the activities of ACE, ACE2, and gelatinases (MMP-2 and MMP-9) in the pleural effusions were measured." ] },{ "paper_id": "1b7520912fbd483ef60014fe0e7f0d0c2df1d07e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1badb9da3cd92175be22f42538742c07f58eb5f8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1be90a46380a03cc53bacd389834702db88ac79b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The viral space displays enormous diversity but high redundancy", "For this representation, the differences between two codon usages (P\u00bc(p 1 ,y,p 59 ), Q\u00bc(q 1 ,y,q 59 )) were measured using their KL divergences (DKL, Kullback-Leibler divergence), where D KL \u00f0PjjQ\u00de \u00bc P 59 i\u00bc1 p i log p i =q i ; and D KL \u00f0QjjP\u00de \u00bc P 59 i\u00bc1 q i log q i =p i :", "Supplementary information is available at the Molecular Systems Biology website (www.nature.com/msb)." ] },{ "paper_id": "1bed4f8a5412cfa315b0936705a647059ceaec62", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1bf18631b9c161ea2834b3d7c8ea42875319d18c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Specific overlapping RT-PCR reactions were set up to amplify a 1,554-bp fragment covering the gene region ORF3, ORF4a, and ORF4b, and these genes were sequenced from additional MERS-CoV-positive swab samples from which full-genome sequences were not obtainable because of lower viral loads. The primers used were 5\u2032-GAGGAATACGACCTCGAGC-3\u2032 (forward) and 5\u2032-TTGGA-GAATGGCTCCTCTTC-3\u2032 (reverse) for ORF3 to ORF4a and 5\u2032-ACAAAAGCTTTGGCCAAACAGG-3\u2032 (forward) and 5\u2032-CAGC-TAAAGCAGCTACATAGC-3\u2032 (reverse) for ORF4a to ORF4b.", "The full and partial genome sequences were aligned using Geneious V8.0.5 (https://www.geneious.com/). The MERS-CoV full genomes were phylogenetically analyzed using PhyML and BEAST.", "Clonality Classification of Loci Observed in MERS-CoV Genomes. A maximum-likelihood phylogeny of 291 complete or nearly complete MERS-CoV genomes was recovered with PhyML (5) under a HKY+\u0393 (9, 10) model of nucleotide substitution. ClonalFrameML (11) was used to reconstruct ancestral sequences on nodes in the PhyML phylogeny and to map substitutions onto individual branches. Each substitution was classified as apparently occurring once in the phylogeny (likely to have arisen via mutation), more than once (likely to be part of a recombined tract), or a reversion from a substitution occurring ancestrally (even more likely to be part of a recombined tract)." ] },{ "paper_id": "1bfdb418d0771a30669663e4fa7bc18f5745d780", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Each of the subjects' DNA was extracted from whole blood at the time of diagnosis using QIAamp DNA Blood Mini Kit (Gene Company LTD., Chai Wan, Hong Kong). DNA fragments were amplified through polymerase chain reaction (PCR), which was carried out in a total volume of 10 L containing 50 ng of genomic DNA, 200 mM dNTPs, 0.3 mM/mL of each primers (5\u2032 -CTGGAGACCACTCCCATCCTTTCT); (5\u2032 -GATGTGGCCATCACATTCGTCAGAT) in PCR buffer with 0.5 units Taq DNA polymerase (Takara, Shiga, Japan). After the initial denaturation step (10 min at 95\u2103), 35 cycles were repeated for 30 sec at 94\u2103, 30 sec at 52\u2103, 90 sec at 72\u2103, and 5 min at 72\u2103. DNA fragments were then separated by electrophoresis on 2.5% agarose gel.", "Two dimensional echocardiography was done to evaluate cardiac complications. Coronary arterial lesion was defined as following: 1) inner diameter that is >3 mm in children <5 yrs old and >4 mm in children \u22655 yrs old; 2) internal diameter of a segment \u22651.5 times that of an adjacent segment; or 3) lumen with irregular surface. Among these patients, 17 showed coronary dilatations and 38 did not.", "Student's t-test was used to compare the demographic characteristics between the two groups. Chi square test and Fisher exact test were performed to compare the genotype and allelic frequencies between the two groups. Its frequencies were compared by odds ratio. p value less than 0.05 was considered significant." ] },{ "paper_id": "1bfeba839c9c98eb6e49ceb13cfcdba28620a61d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Aprotinin, colchicine, carbonyl cyanide m-chlorophenylhydrazone (CCCP), cytochalasin D, TPCK-trypsin, and soybean trypsin inhibitor were obtained from Sigma Chem. Co. (St. Louis, MO). Brefeldin A was from Epieentre Technologies (Madison, WI). Stock solutions of reagents were stored at -20\u00b0C.", "A useful model protein for studying Golgi retention signals has been the M glycoprotein (formerly called El) of the avian coronavirus infectious bronchitis virus (IBV)k Coronaviruses bud into the intermediate compartment or Golgi complex of mammalian cells (Griffiths and Rottier, Please address all correspondence to Dr. Carolyn Machamer, Department of Cell Biology and Anatomy, The Johns Hopkins School of Medicine, 725 N. Wolfe Street, Baltimore, MD 21205.", "Indirect immunofluorescence staining of transiently transfected COS-7 ceils was performed as described (Machamer and Rose, 1987; Machamer and Rose, 1988) . Gml and related mutants were detected using a monoclonal anti-VSV G antibody (5/~g/ml; Lefrancois and Lyles, 1982) followed by Texas red-conjugated, affinity-purified goat anti-mouse IgG (10 /zg/ml; Jackson Immuno Research Laboratories Inc., Avondale, PA)." ] },{ "paper_id": "1c202f2c3924d86f516deecda1d47f55d08337da", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1c3abd60f3deefb350c36d0f51ba2ae27eff56b5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The predicted mVCs are stored as metagenome scaffolds and they remain under their corresponding metagenome datasets (i.e. metagenome 'Taxon OID'). Thus, metagenome 'Taxon OIDs' can also be accessed the same way that any iVG and specific mVCs can be retrieved from the 'Scaffold Search' tool of the 'Find Genomes' tab ( Figure 1) .", "The habitat type classification is based on 11 distinct manually curated habitat terms (e.g. air, freshwater, marine, host-associated human, host-associated plants, terrestrial soil) previously described (11) . This classification allows the selection of mVCs from samples that belong to a single habitat type ( Figure 3C ).", "In order to alleviate some of the existing resource limitations, and enable the community to access and analyze an expanded version of the recently emerging viral genomics data we have developed IMG/VR, an integrated viral analysis system, within the Integrated Microbial Genomes with Microbiome samples (IMG/M) data management system (20) .", "The ecosystem classification is based on a previously developed five-tier hierarchical classification system (21) . All metagenome data sets are organized in three main classes of the top ecosystem tier: engineered, environmental and hostassociated; and then further divided into sub-tiers called ecosystem category, ecosystem type, ecosystem subtype and specific ecosystem (31) ( Figure 3A) . Currently, 78.3% of the mVCs belong to environmental samples, while 16.3% and 5.4% correspond to host-associated and engineered, respectively. Users can navigate through all samples at once or just reduce the search to any specific ecosystem class or category (i.e 'Environmental Terrestrial' Figure 3B ), and from there, select particular types, subtypes or specific ecosystems." ] },{ "paper_id": "1c3d3ea935a9625190ebf6f76b035999b03e03f0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1c468d9576bd22e199c4fe2028856afabb3746a7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Background. Parainfluenza virus (PIV) is a common cause of acute respiratory tract infections, but little is known about PIV infection in children and adults in Africa, especially in settings where human immunodeficiency virus (HIV) prevalence is high.", "Conclusions. Parainfluenza virus causes substantial severe respiratory disease in South Africa among children <5 years of age, especially those that are infected with HIV.", "The 3 PIV serotypes (1, 2, and 3) were found to cocirculate throughout the year and differed from year to year; seasonal peaks were observed for PIV-3 between September and November, which is spring in South Africa (Figure 1 ). The percentage of specimens testing positive for any PIV type varied by year, with a higher proportion of SARI positive for PIV in 2009 ", "The second and third analyses models were built using manual backward elimination in which nonsignificant variables were removed from the model one at a time starting with the variables with smallest magnitude of effect until all remaining variables had a P value of <.05. Covariates with a P value of <.2 at univariate analysis were assessed for significance with multivariable analysis; statistical significance was assessed at P < .05 for all multivariable models. Two-way interactions were assessed by inclusion of product terms for all variables remaining in the final additive models. For each univariate analysis, we used all available case information. For important variables in the HIV association and AF analyses that had substantial missing data, namely HIV infection status, we multiply imputed that variable as well as any variables that were incomplete and associated with HIV using chained equation multiple imputation over 10 iterations. When adjusting for respiratory viral coinfection in our models, we evaluated coinfection with each virus separately and also as a combined variable of coinfection with any of the tested viruses." ] },{ "paper_id": "1ca4dc2cbd2171a1b471d103caa4bb5d1f057eef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1ce2ec3b5d92a3f2ace27a00bde0165ba6761aa0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1ce4231aeefd5ac1caef8246df9984b7455d16df", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Month", "Number of deaths within 7 days (n) Ratio of deaths in 2015 (%)", "A. Monthly number of emergency room visits and deaths within 7 days of myocardial infarction." ] },{ "paper_id": "1cf06efb631fff1394f207cd3ad09376ed85f8cb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1cfa24297a36bcd526ad00635440d59bce705a17", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Fecal samples were thawed and suspended to 0.1 g/mL in chilled extraction buffer (PBS, 0.05% Tween 20, 1x complete protease inhibitor cocktail (Roche)). Suspensions were vortexed, nutated for 30 min at 4 C, cleared of cellular debris by centrifugation at 16,000 \u00a3 g for 10 min at 4 C, and stored at \u00a120 C.", "deviations above the value for the pre-immune serum.", "None. " ] },{ "paper_id": "1cfcdcf2a3783b9adba2b091bd50c5d8ac3252ff", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data were analyzed by unpaired t-test or ANOVA followed by the Dunnett's multiple comparison tests using Prism (Graph-Pad). P-value ,0.05 is considered statistically significant. ", "Vacuolar ATPase-inhibiting anti-influenza nanoparticles of host-directed therapeutics may be enhanced by surface modifications of drug-loaded nanoparticles. 53 For instance, influenza virus targeting by nanoparticles was recently demonstrated with a cell membrane-coated nanoparticle. 54 The strategy may be applied to further facilitate antiviral drug targeting. Future studies are warranted to further validate and improve the nanoparticle-based antiviral treatments.", "For TEM observation, negative staining was applied. First, 10 \u00b5L nanoparticles was added to glow-discharged grid and the droplet was placed on the grid for 30 seconds. Then, 10 drops of ddH 2 O was applied to the grid to wash away the excessive nanoparticles. Subsequently, the grid was stained with 10 \u00b5L of 1% uranyl acetate for 30 seconds and the staining was subsequently removed by wicking with a piece of filter paper. Nanoparticle size and zeta potential were determined by DLS using Malvern Zetasizer Nano ZS (Malvern Instruments, Malvern, UK) following the manufacturer's instructions. Each measurement was made with 1 mL of the nanoparticles at 1 mg/mL in water in a folded capillary zeta cell (Malvern Panalytical, DTS1070)." ] },{ "paper_id": "1d81eea0f16b71d643336838cd22e51125bf05ef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "His-tagged EF-G was purified from pET24b-fusA in E. coli BL21(DE3) as described (41) .", "Standard free-energies at zero force were computed for each trajectory according to", "U-G C-G C-G U-A U-A C-G C-G G-C G-C U-A C-G U-A A-U G-U A-U A-U G-C G-U A A G 12 G C A A46" ] },{ "paper_id": "1d8907508d6c233f454408abbfd624a9fda81f37", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1da4278cead869b78e5bf6205013a8407944f1f6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1dfb38c44ff4bd4534b37c8f42f3e18c282e66e7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "GO-BP enrichment analysis revealed that UBE2D4 and TUBGCP3 were primarily associated with cell differentiation, phylogeny and RNA stability, whereas CENPO may participate in intercellular communication (data not shown).", "Principal component analysis (PCA). PCA is a procedure used to emphasize principal components (uncorrelated variables) in a multivariate dataset. Raw data with k-dimension subspace were mapped to n dimensions space (k1630 cases of MERS-CoV infection and >580 associated deaths had been reported worldwide, mostly in Saudi Arabia [9, 10] ." ] },{ "paper_id": "1f263aae1c1dcc053a85fc4444f0bc02a01e5b68", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1f26b5e8291ea1ddc0a3131e8f93f7272093799e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Additionally, LDPs have performed with a high degree of accuracy and interlaboratory agreement. Blinded PT samples were distributed to 383 laboratories as part of a CAP PT survey for analysis of HSV; 91.6% correctly identified HSV-2, and 7.8% identified HSV, but not noting the subtype; an overall accuracy of 99.4% was obtained. Previous proficiency surveys showed similar results for samples containing HSV1. Over 90% of the laboratories used LDPs. 10 ", "These disorders are heterogeneous, which can lead to clinical diagnostic uncertainty or error; hence, large multigene panels are particularly useful to cover the spectrum of genes that may cause a clinical disorder. Importantly, the identification of pathogenic variants in affected individuals can inform medical management of family members and can identify those at risk early and also release negative individuals from clinical screening. 111 Genetic testing can also identify phenocopies such as Fabry disease, which can masquerade as isolated HCM. While Fabry disease is rare, disease-modifying treatment is available, and therefore, genetic testing provides essential clinical information for these patients.", "A total of 111 laboratories recently participated in a CAPsponsored proficiency assessment of NGS cancer panel testing (NGSST-A-2016), with data collection on 10 gene mutations (AKT1, ALK, BRAF, EGFR, FBXW7, IDH1, KIT, KRAS, NRAS, and PIK3CA). Of 1010 genotyping calls across the spectrum of mutations tests, 993 (98.3%) were called concordantly (unpublished data). 88 ", "The author(s) received no financial support for the research, authorship, and/or publication of this article.", "In addition to continuous quality assessment of the \"wet laboratory\" procedures, ongoing national and international efforts to share data, and construct and maintain up-to-date curated databases for variant interpretation, are critical for quality care. As new mutations and variants are detected, interpretation and assessment of clinical impact, including determination of the clinical importance of variants of undetermined significance, is critical. Rapid generation of genomic data, disorganized data sharing, and a lack standardization have created challenges, and a more consistent approach to clinical sequence interpretation is needed, along with centralized and openly accessible databases for sequence and clinical information." ] },{ "paper_id": "1f2bfec9b985a04dc2645ceabc4e5e456a9ad9a5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "1f3b676368e5c9a1582ab624cbf0884c383fddd2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "DNA templates were linearized by BamHI digestion and purified by successive phenol/chloroform extraction and column filtration (Qiagen, Benelux). SP6 polymerase directed transcriptions were carried out in 50 ml reactions containing $2 mg linearized DNA, 10 mM NTPs, 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 10 mM DTT, 6 mM MgCl 2 , 2 mM spermidine, 6 U of RNase inhibitor (RNAsin, Promega, Benelux) and 15 U of SP6 polymerase (Promega, Benelux). After an incubation period of 2 h at 37 C, samples were taken and run on agarose gels to determine the quality and quantity of the transcripts. Appropriate dilutions of the reaction mix in water were directly used for in vitro translations. Alternatively, transcripts were purified by phenol/chloroform extraction and isopropanol precipitation and quantified by UV absorption as described previously (14) .", "Ribosomal frameshifting is a translational recoding event in which a certain percentage of ribosomes are forced to shift to another reading frame in order to synthesize an alternative protein. This switch occurs at a specific position on the mRNA, called the slip site or slippery sequence, and can be either forwards (+1) or backwards (\u00c01). The nature and efficiency of frameshifting depends on several factors, including tRNA availability and modifications, and mRNA primary and secondary structure (1, 2) .", "Experiments were carried out in duplicate using seriallyin water-diluted mRNAs with final concentrations of 5 nM. Reactions contained 4 ml of an RNA solution, 4.5 ml of rabbit reticulocyte lysate (RRL, Promega), 0.25-1 ml of 35 S methionine (Amersham, in vitro translation grade), 0.5 ml of 1 mM amino acids lacking methionine and were incubated for 60 min at 28 C. Samples were boiled for 3 min in 2\u00c2 Laemmli buffer and loaded onto 12% SDS polyacrylamide gels. Gels were dried and exposed to phosphoimager screens. Band intensity of 0-frame and \u00c01 frameshift products was measured using a Molecular Imager FX and Quantity One software (Biorad). Frameshift percentages were calculated as the amount of \u00c01 frameshift product divided by the sum of 0 and \u00c01 frame products, corrected for the number of methionines (10 in the 0-frame product and 28 in the fusion product), multiplied by 100." ] },{ "paper_id": "1f475d5dbca18aa9710ca227dad58204cc1f21f3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Graphical Abstract Highlights d We describe cooperative neutralization and in vivo protection d Cooperativity turns non-neutralizing ebolavirus antibodies into potent neutralizers d A hotspot for antibody cooperativity identified on Ebola virus glycoprotein", "was more evident at lower concentrations (CI, 0.05-0.5 and DRI, 35-2 for FVM04 concentrations of 0.05-5 mg/mL; Figures S2D-S2F ).", "The 2014 Ebola virus (EBOV) disease (EVD) epidemic claimed over 11,000 lives, underscoring the need for effective therapeutics for this deadly virus and other members of the family Filoviridae that have caused human outbreaks in the past-Sudan virus (SUDV), Bundibugyo virus (BDBV), and Marburg virus (MARV) (Rougeron et al., 2015) . Monoclonal antibodies (mAbs) targeting the filovirus glycoprotein (GP) are among the most promising countermeasures for filoviruses ." ] },{ "paper_id": "1f541a086ac9bc30df8ee2060f958691fb4a0667", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Blood samples were collected using EDTA containing blood tubes and treated with sucrose lysis buffer and the nuclear cell pellets were stored at -80\u00b0C until DNA extraction. Genomic DNA was extracted from whole blood using the QIAamp DNA extraction kit (Qiagen Hilden, Germany, Cat no. 51304) according to the manufacturer's instructions.", "Statistical Package for Social Sciences (SPSS) version 14.0 was used for statistical analysis. The quantitative results were expressed as means \u00b1 standard deviation (SD). For comparing quantitative results between two groups, independent t-test was used, and for more than two groups ANOVA and post hoc least significant test (LSD) were used. Qualitative results were expressed as number (No.) and percent (%). Pearson chi-square test (\u03c7 2 ) was used for statistical analysis of the qualitative data. Differences were considered to be significant when the p-value was \u2264 0.05.", "Forward primer 5'GCCATTACCTTTGACTCTTCTGT3', Reverse primer 5' CCTGTTGGTAGTCCTTGTATT-TAGTATC3' and the probe sequence was as follows: AGAAACTTCCAGCCCATGAGCCG." ] },{ "paper_id": "1f5c1597a84ed1d4f84c488cd19098a091a3d513", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(https://www.who.int/westernpacific/emergencies/covid- 19) .", "This ", "The author declares no conflict of interests " ] },{ "paper_id": "1f71a8f9029056b6e7656ebd885ccce476e2f623", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "I nfectious diseases continue to be major health concerns worldwide: hepatitis C, AIDS, malaria, and tuberculosis (TB) are ongoing pandemics. A third of the world population is currently infected with the TB bacillus; millions of people are infected by influenza virus annually; and even though therapeutic drugs have slowed the threat of HIV-1, there is still no definitive cure or viable vaccine in sight. Although influenza virus vaccines provide protection, they must be reformulated annually, and the time lag from the spread of a pandemic virus to the availability of a vaccine is far too long. A universal vaccine against influenza virus is needed to limit high levels of morbidity and mortality. Newly emerging infectious diseases, such as swine H1N1 influenza, avian H5N1 influenza, severe acute respiratory syndrome (SARS), and dengue fever are a constant threat; and bacterial infections, such as the recurrent Salmonella outbreaks in the food industry, are costly to society.", "The technologies, computational methods, and genome information needed to successfully implement this approach now exist. Technologies such as next-generation sequencing have opened the door to sequencing total transcriptomes, encompassing mi-croRNAs, long noncoding RNAs, and mRNAs. This has raised the possibility that a previously unappreciated class of RNAs-the long noncoding RNAs-may play important roles in the host response to virus infection (4) . Proteomic technologies and accompanying informatics pipelines are evolving rapidly, with throughput and sensitivity approaching that of microarrays. Metabolomics, glycomics, lipidomics, and phosphoproteomics are young and comparatively undeveloped, but the promise is unlimited and the potential unprecedented. Moreover, the appropriate in vitro and in vivo experimental systems to generate useful pathogen-host interaction models are now available. Each of the four NIAID Systems Biology Centers has taken a unique approach to implementing this new research paradigm as outlined below.", "As highlighted in a recent review, systems biology is already making important contributions to cancer research (7) . The approach has been used to identify network motifs that can accurately predict the development of distant metastases in breast cancer patients-tumors that may develop years after the primary tumor and which frequently prove fatal. A network-centric approach has also identified specific oncogenes in certain types of B-cell lymphomas, and a multiscale mathematical model has been developed to test the efficacy of different radiation protocols, which has led to improvements in radiation therapies for colorectal cancer. The cancer field was one of the first research communities to aggressively embrace (and fund) the use of systems biology. We believe that the infectious disease community will build on the resulting substantial systems biology methodologies and insights to claim similar successes in the near future. We invite your thoughts and comments on this perspective." ] },{ "paper_id": "1f7394c2575f1eb1a196c9f19cd4b57ddd05789b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00524-12/-/DCSupplemental. Figure S1 , PDF file, 0.4 MB. Figure S2 , PDF file, 0.1 MB. Figure S3 , PDF file, 0.2 MB. Figure S4 , PDF file, 0.1 MB. ", "Citation Chan JM, Rabadan R. 2013. Quantifying pathogen surveillance using temporal genomic data. mBio 4(1):e00524-12." ] },{ "paper_id": "1f7f3e09db31be0bc73e921a1034ec9de0d52ebe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Left: Spotting layout for a multiparameter analysis, Right: False-colored picture of an assay with CRP present as analyte.", "Peptide assay specificity assessed by different antibodies specific against the described targets (Reprinted from (9), License number 2982331327162).", "Results of a on-chip helicase-dependent amplification of two pathogens (Reprinted from (11), License number 2982330906644)." ] },{ "paper_id": "1f8144c7b80bb22a8af2478791657d4cbaa8d802", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Results of the phylogenetic analysis of the deduced amino acid sequences obtained for the 22 Korean strains and 10 reference coronaviruses are summarized in Fig. 1 ", "Korean strains belonged to four genetic clusters based on the description of the reference CCV strains of Table 2 . These included a unique Korean CCV cluster (cluster I), CCV type II and TGEV cluster (cluster II), intermediate cluster between CCV type I and II (cluster III), and CCV type I cluster (cluster IV).", "In summary, genetic differences of the M gene from Korean CCV strains were identified. Data from this investigation provide a platform for the molecular identification of different Korean CCV strains. Further sequence analysis needs to be extended to other parts of the genomes of CCV and FCoV field strains to obtain more detailed information about the predilection sites of such recombination and mutation events." ] },{ "paper_id": "1fe6e8c22714c1484434a2b5b334bedf7f216739", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ATP concentration wa~s.determined in cell lysates using the luciferinluciferase assay (Boehringer GmbH) according to the manufacturer's instructions.", "In addition, they show that M~ can be resolved as a distinct intermediate between M0 and M3, the Golgi form.", "large number of ~-cop-containing buds and vesicular profiles.", "For the quantitation of PDI labeling, micrographs were taken in a systematic fashion and the density of gold labeling estimated by point counting (Griffiths, 1993) ." ] },{ "paper_id": "200eee0824f97c373a016370a5292af80121f351", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Osteonecrosis is a condition characterized by bone marrow ischemia and cell death which may subsequently lead to insufficiency fracture and secondary osteoarthritis requiring palliative surgery (1, 2) .", "Among 50 included patients, 32 (0.64%) were female and 18 (0.36%) were male with a mean\u00b1SD age of 37.3 \u00b1 12.3 years (range 14-65 years)." ] },{ "paper_id": "2011e171a1664541e88ec5333849781130565135", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2024ea5609babbd8769ee9f1898e825306b49cfe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A strain of Iranian ETEC was isolated from diarrhea samples of newborn calves that was positive for the K99 antigen. It was provided by Faculty of Veterinary Medicine, Ferdowsi University of Mashhad, Mashhad, Iran, and confirmed by biochemical and molecular tests. Genomic DNA of ETEC was extracted by using a DNA extraction kit (Bioneer, Korea). One pair of specific primer was designed and synthesized by Macrogen (South Korea) as follows: FanC-Forward: 5'-CGCGGAT CCGC-GGCGAATACAGGTACTATTAACTT-3' and FanC-Reverse:", "The t-test was used to detect significant differences between means of ELISA absorbance for determination of specific IgY antibody. Also, a repeated measure ANOVA was used to compare the means of ELISA absorbances between weeks. P-value<0.05 was considered significant." ] },{ "paper_id": "2041dc24bd4022a90b0b441ed6f1024f3e16dc77", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "CONFLICTS OF INTEREST. The authors have no potential conflicts of interest to declare with respect to the research, authorship, and/or publication of this article.", "Bovine coronavirus (BCoV) is a member of the order Nidovirales, family Coronaviridae, subfamily Coronavirinae, genus Betacoronavirus, species Betacoronavirus-1. This species also includes Human coronavirus OC43, Porcine hemagglutinating encephalomyelitis virus, Equine coronavirus, and Canine respiratory coronavirus [1] .", "The Animal Care and Use Committee of the National Institute of Animal Health approved all animal procedures prior to the initiation of this study (authorization number: 11-083)." ] },{ "paper_id": "2060cb027399ce2ff97b6f9d17b932aa16dd0844", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Here, we propose a study to seek a useful and relatively non-invasive marker (i.e., serum EDN [sEDN] ) to predict favorable responses to nebulized budesonide or montelukast, common treatment options for young children with asthma.", "Montelukast was the chosen treatment for the OBS group because it has been reported that ICS is less effective in non-atopic populations. 21 Furthermore, from our clinical experience montelukast is preferred over ICS by both physicians and patients in Korea and Japan.", "At initial enrollment and when exhibiting asthma or upper respiratory infection symptoms at regular visits, nasopharyngeal swabs were collected and total RNA from common respiratory viruses was extracted and identified using a multiplex PCR system (Seeplex RV12 Ace Detection; Seegene, Seoul, Korea) that identifies adenovirus ( " ] },{ "paper_id": "20a7363b3ad53472952cc80c03489ff56b7178bc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For Canterbury participants, a research team member made phone contact with potential participants within 2 weeks of identification, obtained consent and conducted the first interview. A follow-up questionnaire was mailed at 4 weeks postvaccination.", "An SAE is defined as any untoward medical occurrence that: results in death; is life-threatening; requires inpatient hospitalisation or causes prolongation of existing hospitalisation; results in persistent or significant disability/incapacity; is a congenital anomaly/birth defect; or requires intervention to prevent permanent impairment or damage.", "Since the two regions recruited and collected data in different ways, we have not attempted to analyse any differences." ] },{ "paper_id": "20c05a8e1616b61a78300ee5911bc70bd1c952d3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Corosolic Acid and Lagerstroemin versus Tannic Acid and PGG: Which are More Bioactive?", "Corosolic acid -0", "Insulin 1 nM 156 *Activity of b-PGG was arbitrarily assigned as 100." ] },{ "paper_id": "20dd62d0387e8b4231d67af2eaf757767492656e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In 1986, it was proposed that cytokines released by activated T-lymphocytes initiate and maintain the psoriatic process by stimulating keratinocyte proliferation [3] . Since that time it has become clear that, Hanaa Rasmy, Nancy Mikhael, Somaia Ismail upon stimulation, keratinocytes are also able to secrete an array of different cytokines with a variety of functional effects on both themselves and other cell types, including T-lymphocytes [4] .", "Total RNA was extracted using QIA amp RNA extraction kit provided by QIAGEN worldwide companies. The concentration and purity of RNA was determined by measuring its absorbance at 260 nm (A 260 ) and 280 nm (A 280 ) in a UV visible spectrophotometer. Total RNA (2 \u03bcg) was reversetranscribed to cDNA with High-Capacity cDNA Archive kit provided by Applied Biosystems. cDNAs were stored at -20\u00b0C until real-time quantitative PCR was performed.", "Psoriasis is a chronic inflammatory condition which is the result of persistent stimulation of T cells by antigens of epidermal origin [1] . This persistent stimulation of T cells is the result of interaction between T cells, antigen-presenting cells, i.e. Langerhans cells, and antigens, and comprises the following steps: primary signals (signal 1) including T-cell receptor stimulation by peptide antigen, costimulation (so-called accessory signals) (signal 2) and T helper type 1 (Th1) differentiation and proliferation [2] .", "All data were collected from the patient charts and entered into a computerized spreadsheet. The fit of the data to the normal distribution was tested with Kolmogorov-Smirnov test. Since the distribution of the data was significantly different from normal, nonparametric statistics were further used. Comparisons were made using Mann-Whitney U, Kruskal Wallis and Wilcoxon signed ranks tests between variables adjusted for appropriate covariates, and Spearman rank correlation coefficients were calculated between the assessed variables. The null hypothesis was rejected with a two sided p value of < 0.05. All analyses were performed with SPSS 11.0 for Macintosh (Statistical Package for the Social Sciences. SPSS Inc., Chicago, IL, USA)." ] },{ "paper_id": "20f863c8fc0ff956ea9f902a2f9d1299ab8514a6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In the original GIB, Common Object Request Broker Architecture (CORBA) was used for internal communication. However, CORBA was not needed for GIB-V because of remarkable advances in hardware performance that solved the problems associated with managing the large quantity of data.", "Virus genome analysis has a long history. In 1977, Frederick Sanger successfully sequenced the entire genome of Phage fphiv;X174 (1). Since that time, a huge number of virus genomes have been sequenced. Virus genome sequences provide researchers with important information needed to analyze virus evolution, pathogenicity and diversity (2) (3) (4) .", "GIB-V can be accessed from http://gib-v.genes.nig.ac.jp/. Registration is not necessary, and use of the database is free." ] },{ "paper_id": "2105c805d6a0a560348c1bb6bf620685944ba9dc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "of (benzylidene-hydrazono)-1,4dihydropyridines with \u03b2-amyloid, acetylcholine, and butyrylcholine esterases. Bioorg. Med. Chem. 18, 2049 -2059 . Angelisov\u00e1, P., Drbal, K., Horejs\u00ed, V., and Cern\u00fd, J. (1999 . Association of CD10/neutral endopeptidase 24.11 with membrane microdomains rich in glycosylphosphatidylinositolanchored proteins and Lyn kinase. Blood 93, 1437-1439. Araki, W., Kitaguchi, N., Tokushima, Y., Ishii, K., Aratake, H., Shimohama, S., Nakamura, S., and Kimura, J. (1991) . Trophic effect of \u03b2-amyloid www.frontiersin.org", "In the context of this review it is important to mention another cholesterol and ganglioside enriched membrane domain, which share some similarity but are physically and functionally distinct from the lipid rafts, the tetraspanin-enriched microdomains (TEMs). Tetraspanins are a large family of small membranespanning proteins (Yanez-Mo et al., 2011) , numbering at least 32 family members in mammals. They are involved in a whole range of cellular processes, from cell morphology and motility to signaling pathways (Hemler, 2005) .", "It has traditionally been difficult to reach any kind of consensus concerning the definition of lipid rafts. However, in 2006 at the Keystone Symposium on Lipid Rafts and Cell Function in Colorado it was agreed that \"membrane rafts are small (10-200 nm), heterogeneous, highly dynamic, sterol, and sphingolipid-enriched domains that compartmentalize cellular processes. Small rafts can sometimes be stabilized to form larger platforms through proteinprotein and protein-lipid interactions\" (Pike, 2006) . The long, saturated acyl chains of sphingolipids allow tight packing hence their juxtaposition with the kinked, unsaturated acyl chains of bulk membrane phospholipids leads to phase separation (Brown and London, 2000) . The cholesterol molecules can act as \"spacers,\" filling any gaps in sphingolipid packing (Simons and Ikonen, 1997) ." ] },{ "paper_id": "21337e54a7d02b12aea5f5835648d69aef32701e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "pBS-U6-Apa1. They also thank Johanie Charbonneau, Pascal Chartrand, Dominic Dulude, Alexey Karetnikov and Stephen Michnick for stimulating discussions and for critical reading of this manuscript. ", "Deleting two different regions has an opposite effect on the HIV-1 5 0 UTR IRES activity", "The IRES located in the 5 0 UTR of HIV-1 RNA is functional in Jurkat T cells" ] },{ "paper_id": "214d64d4237818509b17cb5ac82107116407b2e0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "siMDA5, Qiagen validated siRNA (S103649037). siControl and siRIG-I were synthesized by the custom design service of Qiagen.", "Supplementary Data are available at NAR Online: Supplementary Figures 1-7 , Supplementary Methods and Supplementary References (18, (50) (51) (52) ." ] },{ "paper_id": "2159d7f128a1995e7131a8d4f036fcb3cec6e332", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors declare no conflict of interest." ] },{ "paper_id": "216dbed8787845bd23a22cc2dd10964aef95fe71", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2176706829fb93fa471a706137b138e8766b4f32", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Received for publication 10 November 1982 and in revised form 28 March 1983. ", "Rats. Lewis female RT1 ~ rats, 6-8 wk old, were purchased from Harlan Sprague Dawley, Inc., Indianapolis, IN." ] },{ "paper_id": "219fb67386566e8bd98da17b591ae91ffc1f2b0d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "21a164b5e3d241d8d34eb335bf8db56dc945fea6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Similarly, a large proportion of survey respondents reported moderate or great familiarity with many components of the intervention, including accountability agreements (96%), performance targets (98%) and reporting requirements (94%).", "Conditions and processes that offer the greatest opportunity for improvement", "Site-A stood out as a particularly strong example of this:" ] },{ "paper_id": "21a19241ff8c8602a9cd610ceea62e746a6493e2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No patient involved." ] },{ "paper_id": "22238e30828eb4613d777bea7bd3ff321aae450c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. Extracted data were managed in a Microsoft Access database and were analyzed with standard parametric and nonparametric techniques. Data for categorical variables were compared with Yates' corrected \u03c7 2 analysis, and data for continuous variables were analyzed for significant differences with the Student t test or, in the case of non-normally distributed parameters, the Mann-Whitney rank sum test. Differences between groups of continuous variables were compared using one-way analysis of variance (ANOVA) or Kruskal-Wallis one-way ANOVA on ranks. All statistical tests were 2-sided. Statistical computations were performed with SigmaStat 2.03 software (SPSS Inc., Chicago, IL). The level of significance was set at p < 0.05.", "\u27a3 Many travel-acquired infections are preventable by specifi c behaviours, vaccines, or chemoprophylactic medications, so interventions and policies that encourage uptake of pretravel advice should be promoted." ] },{ "paper_id": "22694a0a131da58c1a82a0d2d1556e0ccd8617c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2271485cae8757f2abdb1c2d012bb892c5421ba4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "However, despite these efforts, this novel virus was able to spread via infected people traveling within China and internationally. Furthermore, the mechanism of spillover that led to human infection is still uncertain, although it has all the hallmarks of a bat-origin SARS-related coronavirus (SARSr-CoV) [4] . This leads us to two questions that we need to think \u204e Corresponding author. through even now to get ready to prevent the next 2019-nCoV-like pandemic:", "Dealing with the risk of future epidemics and pandemics requires a global effort. China is located within a major 'emerging disease hotspot' in Southeast Asia, but there is also a high risk of future diseases originating in sub-Saharan Africa, South Asia and Latin America [24] . Furthermore, the drivers of disease emergence are human activities that are expanding on a global scale, including deforestation, agricultural intensification and the wildlife trade. This has led to an exponential increase in the frequency of animal-human contact and likelihood of novel disease emergence and spread, suggesting that pandemics will become more frequent and more devastating in the future. These threats face all countries because once diseases emerge, they travel rapidly and freely through our global networks of travel and trade. We look forward to continued collaboration among scientists from China and the rest of the world, and to helping develop these new strategies to preventing the next pandemic.", "The first question is why did this virus spread so rapidly, and how can we deal with this risk? China has changed significantly since the emergence of SARS in 2002-2003. The economy has expanded, and many people have become wealthier, leading to an expansion of air and high-speed train travel. It is estimated that 3 billion individual journeys were planned during the Lunar New Year holiday (Chunyun), around 80 million of these being flights. The flight habits of Chinese citizens have changed alsowith many more flying internationally for business or tourism. In addition, since 2003, there has been an increase in travel between China and African countries, across Southeast Asia and into the New World as part of China's expansion of business and trade. This largely explains why the virus was able to spread out of China much more rapidly than SARS-CoV, which took over 2 months to move to Hong Kong then to the rest of the world." ] },{ "paper_id": "2272b370fe7b1e730af1659f9e3099c451b1a21d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2285bbcea934e093b35c23152a3314aab4969ddd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The TCEM practice guideline was published in 1996. There were about 134 injection types of herbal remedies being used in China.", "In Qing Dynasty, two TCM masters deserve the most credit in developing theoretical framework of TCM for the diagnosis and treatment of infectious diseases. One is Ye Tian Shi, who wrote Wen Re Run (Treatise on Epidemic Febrile Diseases) and developed Wei Qi Ying Xue Bian Zheng (the differentiation of wei-qi-yingxue syndromes). Another is Wu Ju Tong, who wrote Wen Bing Tiao Bian (The Differentiation of Epidemic Febrile Diseases) and set up San Jiao Bian Zheng (the differentiation of sanjiao syndromes). [7] Their clinical methodologies are widely accepted and have become the guidelines for clinical practices dealing with epidemic febrile diseases." ] },{ "paper_id": "22c00b12361acc7b59c2874d165c8f9bcee54b5d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Tzu Chi Medical Mission Project 106-06-03, Buddhist Tzu Chi Medical Foundation.", "Peter S. Temes emphasizes that the following three aspects should be considered in education reform: Keeping it real, making it new, besides, recruiting and retaining the right teacher [25] . Strategies and practices in education reform that are established on the basis of a realistic understanding fulfil ", "A medical education that highly integrates clinical learning in basic curriculum facilitates context-based reflection. By establishing highly integrated courses with case-based learning and integrating the experiential learning of medical students regarding their medical knowledge, skills, and attitude, students can be guided to develop self-awareness and achieve self-regulated learning, which can enhance their confidence in clinical competency.", "Taiwan's medical education program has undergone five main transformations [ Table 1 ], as revealed by an analysis of the program design from various perspectives: First, the program previously emphasized individual discipline, but currently, the program emphasizes clinical case integration. Second, the program was previously based on those of other countries, but currently, the program is witnessing a transformation in accordance with Taiwan's higher education environment. Third, the program involved a one-stage learning process, but it currently involves a two-stage learning course, including undergraduate and PGY. Fourth, the program previously involved a superior elite education approach, and this has currently been transformed into a scientific education approach involving liberal humanism. Finally, the program previously applied a uniform teaching approach, and this has been replaced by a diverse, proactive, and innovative learning environment [9] ." ] },{ "paper_id": "22dce3fab7317bb2a8ff48f0da6f2c9717dc6ed9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Previous studies have reported a significant association between the onset and severity of astrovirus infections and age in young puppies (5-7 weeks old) [7] , mink (3 weeks old) [6] and children (under 2 years old) [20] .", "Between February and December 2010, samples of dog feces (n=91) were collected from two animal shelters and three animal hospitals located in Seoul and the Gyeonggi region of South Korea. All dogs were aged between 1 and 24 months and were suffering from diarrhea. Infection with canine parvovirus (CPV) and canine coronavirus (CCoV) was diagnosed by PCR using previously described primer sets [9, 23] .", "Therefore, the aims of the present study were to examine the prevalence, genetic diversity and geographical relationships between CAstVs and CKoVs in Korean dogs." ] },{ "paper_id": "22f98765239b02e3e5810fd976971ca87bab092b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "231ba154ea0d9a668c5c5e7e5732c4f223608f6d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "23b89b2ee6a5870dd94c479b892cda6a54c8ab6f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Galactosyl transferase assays were done as described in Brew et al . (1975) .", "To identify slowly sedimenting synaptic vesicles, Sl and PIM fractions were applied to 5-25 % glycerol gradients as described in Clift-O'Grady et al . (1990) , except substituting buffer C without BSA for buffer A and adding a 0.4-ml 2 M sucrose pad . After centrifuging 1 h at 218,000 g, gradient fractions were collected, TCA precipitated, fractionated by PAGE, transferred to nitrocellulose, and probed with anti-synaptophysin (SY38), followed by 1251 goat anti-mouse IgG .", "For equilibrium gradients, -0 .2 ml of sample was applied to a 0.5-1 .5 M sucrose gradient with 0.4 nil, 2 M, and 0.4 ml, 2 .25 M buffered sucrose pads and centrifuged 16-17 h at 32 .5 k rpm in a SW55Ti rotor (except in Fig . 6 where the 2 .25 M sucrose pad was omitted) . The density of each fraction was calculated by measuring refractive index of each fraction ." ] },{ "paper_id": "23cc9704b77903e3ec5e9ecb81ebf83b3a231c4c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "23fcb75440f439f30f656e0c6b47c6f565f32ef2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "23ffba1251c42cd4311635ab25afeba065146568", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Using the Bioedit 7.0.5.3 software (6), the GsuI (BpmI) restriction enzyme was selected which is able to cleave the ", "This study aimed to evaluate the use of a restriction enzyme assay as a specific, sensitive and practical tool to differentiate genotypes of BCoV for the molecular epidemiology of BCoV-caused diseases.", "This article reports the use of the GsuI restriction enzyme to differentiate genotypes of Bovine Coronavirus (BCoV), based on an 18-nucleotide deletion of S1-coding region found in one of the two genotypes. It was concluded that this assay can be used as a rapid tool for BCoV genotypes differentiation." ] },{ "paper_id": "2407834245c872e91a78cdb9bd63ac8f81a49231", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Animals. The present study was approved by the Institutional Animal Care and Use Committee of Shanghai University of Traditional Chinese Medicine (Shanghai, China), and all procedures were performed in accordance with the National Institute of Health's guidelines (14) . A total of 46 male 8-week-old Wistar rats with a mean weight of 200\u00b110 g were provided by the Shanghai SLAC Laboratory Animal Co., Ltd.", "Protein extraction and western blot analysis. Plasma membrane proteins were extracted from adipose tissues using a radioimmunoprecipitation assay lysis buffer (cat no. 89900, Pierce; Thermo Fisher Scientific, Inc., Waltham, MA, USA), total protease inhibitor and phosphatase inhibitor, as described previously (16) . Protein concentration was measured using a commercial bicinchoninic acid assay kit and a microplate reader at 570 nm. Subsequently protein (40 \u00b5g/lane) was separated by 10% SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA Statistical analysis. All data are presented as the mean \u00b1 standard error of the mean. For multiple comparisons, differences were analyzed using one-way analysis of variance followed by Tukey's multiple comparison test. P<0.05 was considered to indicate a statistically significant difference. All statistics were analyzed using Graphpad Prism version 6.0 (GraphPad Software, Inc., La Jolla, CA, USA).", "Histopathology. Adipose tissues were collected at 11 weeks and fixed in 4% formalin at room temperature for 24 h, embedded in paraffin and sliced serially into sections 5-\u00b5m thick. To determine adipocyte size, hematoxylin and eosin staining was conducted on EATs at room temperature for 30 min. Five visual fields were randomly selected from each section with an Olympus BX51 light microscope (Olympus Corporation, Tokyo, Japan) and examined using Image-Pro Plus version 6.0 (Media Cybernetics, Inc., Rockville, MD, USA) to determine the average adipocyte diameter. Toluidine blue staining was also performed on EATs for 1 h by briefly submerging tissue sections in 0.1% aqueous toluidine blue (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) at room temperature, the histological images were used to quantify the number of mast cells present, as previously described (15) . Mast cell numbers were counted using a light microscope and were presented as cell numbers/mm 2 ." ] },{ "paper_id": "241348149ec43ddce1d3033145b00307db56aea0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data are expressed as mean \u00b1 SD, and statistical analysis was performed with analysis of variance (ANOVA). A statistical difference was accepted as significant if P < 0.05.", "The rat lung tissues were homogenated using liquid nitrogen, and total lysates were obtained from rat lung tissue by RIPA lysis buffer (Beyotime Inc, Jiangsu, China). Equivalent amounts of protein (30 \u03bcg) of each sample were separated by electrophoresis using 12% SDS-polyacrylamide gels. After being transferred onto 0.22 \u03bcM nitrocellulose filter membranes and blocked in 5% skimmed milk, the bands were then incubated with the corresponding primary antibodies (ACE-2, TGF-\u03b2).", "The concentrations of ANG-(1-7) in lung tissue were measured using ELISA kits (R&D Systems Inc., MN, USA) according to the manufacturer's instructions." ] },{ "paper_id": "246f59ddffedd4a166b9317dee38bdf6077b2f3f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Submit your manuscript here: http://www.dovepress.com/drug-design-development-and-therapy-journal Drug Design, Development and Therapy is an international, peerreviewed open-access journal that spans the spectrum of drug design and development through to clinical applications. Clinical outcomes, patient safety, and programs for the development and effective, safe, and sustained use of medicines are a feature of the journal, which has also been accepted for indexing on PubMed Central. The manuscript management system is completely online and includes a very quick and fair peer-review system, which is all easy to use. Visit http://www.dovepress.com/testimonials.php to read real quotes from published authors. ", "Drug Design, Development and Therapy Dovepress submit your manuscript | www.dovepress.com Dovepress 2255 O r i g i n a l r e s e a r c h open access to scientific and medical research Open access Full Text article http://dx." ] },{ "paper_id": "24709e4ba406a998d011ea9b31d33279bbabedb5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "beamsize of between 0.03 \u00c2 0.03 mm 2 and 0.06 \u00c2 0.07 mm 2 , depending on the size of the crystals. On I24, the X-ray beam was homogenized with a 0.25-mm carbon plate and focused downstream from the crystal. Using 0.1 s exposure times and 100% beam transmission, typically 4-15 useful images could be collected from a crystal (Table 1) .", "PaSTRy assay. Thermofluor experiments 25 were performed with an MX3005p RT-PCR instrument (Agilent). SYTO9 and SYPROred (both Invitrogen) were used as fluorescent probes to detect the presence of RNA and the exposed hydrophobic regions of proteins, respectively. Fifty-microlitre reactions were set up in a thinwalled PCR plate (Agilent), containing 0.5-1.0 mg of the CVA16 virus, 5 mM SYTO9 and 3 \u00c2 SYPROred in PBS (pH 7.4), and the temperature ramped from 25 to 99\u00b0C, with fluorescence recorded in triplicate at 1\u00b0C intervals ( Supplementary Fig. S4 ).", "(d-f) Structural differences in VP1 (blue) and VP3 (red) due to capsid expansion and VP1 egress (d, mature EV71; e, empty 80S-like EV71; f, 135S-like CAV16). Note especially the changes in the VP3 GH loop, which is labelled. As appropriate, the rough inner and outer boundaries of the shell are marked as grey arcs (panels (a,d-f))." ] },{ "paper_id": "247161ad51b7f362e9cadfcd39e94dd6a1a26ca3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In panel (f), the 100% represents the count of deaths or cured cases. ", "We summarise the officially reported data from Wuhan, China in Figure 2 . There is an increasing trend of daily new confirmations and deaths. We argue that these data were heavily impacted by availability of medical supplies and health care workers.", "where" ] },{ "paper_id": "24bc853dce27cbe938ca42aefdaa4e788df30481", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Blood samples were collected aseptically for a CBC and blood culture each morning, and feces were collected each morning for culture. Any calf still alive on day 4 was euthanized for sample collection. Samples collected at necropsy for culture included ileal contents, ileal tissue, mesenteric lymph nodes, and bile. Ileal tissue also was collected for histology, immunohistochemistry (IHC), and assessment of barrier function in Ussing chambers.", "An appropriately filled 2 mL EDTA collection tube was used for the CBC.", "Unstained, formalin-fixed paraffin-embedded ileal sections were stained using a mouse monoclonal anti-Salmonella antibody and standard IHC techniques. A serial section was included on each slide in which the primary antibody was omitted and replaced with the blocking serum to assess nonspecific staining. Sections were deparaffinized and rehydrated, then treated with a 3% H 2 O 2 /70% MeOH block followed by a protein block (#MP-7402: normal horse serum, Vector, Burlingame, California). " ] },{ "paper_id": "24d4cd7729a8df22c9cab12f20e96aa9bf1332a2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Studies have suggested higher incidences of nonspecific reactive hepatitis in men than in women, but no sex-specific differences were found in the present study [11] .", "Comparing respiratory virus-specific differences between the groups A total of 131 patients (24.6%) were infected by respiratory syncytial virus A, 128 patients (24.1%) \u2021 increase rate of AST or ALT was calculated only in in AST or ALT elevated group.", "Statistical analyses were performed using PASW Statistics ver. 18.0 (IBM Co., Armonk, NY, USA). Continuous variables were analyzed using the unpaired 2-tailed t-test or analysis of variance, and categorical data were analyzed by using the chi-square test or Fisher exact test. A p-value less than 0.05 was considered statistically significant in all tests.", "We believe that one of the merits of this study is our exhaustive investigation of all patients admitted to a single university hospital for lower respiratory tract infection, and that it more clearly observed virus-specific features by excluding cases of double infections." ] },{ "paper_id": "24df3883c547f5976077bc7a924eec9ae8fa9e71", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In the replicative cycle of RNA viruses, the crucially important process of RNA-templated RNA synthesis is generally performed by an RNA-synthesizing complex of viral enzymes (1, 2) . Commonly, its core subunit is a single RNA-dependent RNA polymerase (RdRp) that drives the production of template strands for replication, new genome molecules, and-in many RNA virus groupsalso subgenomic (sg) mRNAs. This canonical RdRp is structurally conserved among RNA viruses and widely accepted to drive catalysis of phosphodiester bond formation via a well-established reaction mechanism involving two metal ions that are coordinated by aspartate residues in its motifs A and C (3) (4) (5) .", "Alignments of nsp8 sequences were made using Muscle (16) . Sequences used included the alphacoronaviruses human CoV 229E (NC_002645), human CoV NL63 (NC_005831), and bat CoV HKU8 (NC_010438); the betacoronaviruses SARS-CoV Frankfurt-1 (AY291315), mouse hepatitis virus A59 (MHV, NC_001849) and human CoV OC43 (NC_005147); and the gammacoronaviruses beluga whale CoV SW1 (NC010646), turkey CoV (NC_010800) and avian infectious bronchitis virus (IBV, AJ311317).", "The (functional) implications of these observations are not clear at present, but additional structural studies will likely be required to address these issues in detail, and gain insights that may aid in explaining the in vitro results presented here. Likely, such experiments will also offer further information regarding the residues that are involved in nucleotide positioning, Mg 2+ coordination and RdRp chemistry." ] },{ "paper_id": "24ec3df6486c04e0eb67d213475f3f1b20fe9fec", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "252878458973ebf8c4a149447b2887f0e553e7b5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Infection with N. veterana might have followed inhalation in this dog, or alternatively, it might have followed ingestion of a contaminated penetrating foreign body, especially as the dog had a history of chewing sticks. The latter could also have explained the gagging behavior that was initially observed, which was otherwise unexplained. Additionally, culture of the focal jejunal mass grew Lactobacillus acidophilus as well as Candida, suggesting the possibility of perforation secondary to direct trauma or the inflammatory lesion itself. Histopathology of the jejunal mass revealed no evidence of plant or foreign material. Finally, it is possible that the organism was introduced by direct cutaneous inoculation, such as from a plant awn or other penetrating organic matter.", "Early detection and intervention is critical for patients with opportunistic infections secondary to immunosuppression. The identity of the organism to the species level in this dog was facilitated by MALDI-TOF MS and led to initiation of appropriate antimicrobial treatment sooner than traditional gene sequencing methods. The clinical utility of MALDI-TOF MS could have broader applications, particularly in animals with uncommon infections that are slow-growing and fastidious. In this case, successful treatment of disseminated N. veterana infection was possible with proper antimicrobial treatment and might be facilitated if underlying immunosuppressive drug treatment can be discontinued. ", "On initial evaluation at the VMTH (day 0), the dog was febrile (103.7\u00b0F) and had a moderate right thoracic limb lameness. Pain was elicited on palpation of the caudal thoracic vertebral spine, dorsal and lateral flexion of the cervical spine, and on elbow extension bilaterally. Mild joint effusion was noted in the tarsi, carpi, and elbows. A CBC was performed, and the only hematologic abnormality was leukocytosis (38,350 cells/uL, reference range, 6,000-13,000 cells/uL) characterized by a mature neutrophilia (36,433 cells/uL, reference range, 3,000-10,500 cells/uL). Arthrocentesis of the carpus, tarsus, elbow, and stifle revealed mild-to-moderate nondegenerate neutrophilic inflammation (neutrophils comprised 44-75% of total nucleated cells present). No microorganisms were observed. Examination of CSF obtained from the cisternal space revealed no abnormalities. No other diagnostics were performed. A diagnosis of primary immune-mediated polyarthritis (IMPA) was made, and an immunosuppressive dose of prednisone (1.1 mg/kg PO q12h) and tramadol (2.8 mg/kg PO q8-12h as needed) were prescribed at the time of discharge (day 2)." ] },{ "paper_id": "254270af7f396d35475aee946cc1b3f9a3694e29", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Caspase-3 staining Splenocytes were cultured ex vivo for 4 h in RPMI 1640. Cells were then stained for surface markers, fixed, permeabilized, and stained with PE Active Caspase-3 Apoptosis Kit (BD PharMingen).", "The Gene Ontology Resource website (http://geneontology.org/), AmiGO2 version 2.4.26, was used as source of annotated ISGs. Search criteria were as follows: search \"ontology,\" species \"Mus musculus,\" and GO terms response to type I IFN (GO:0034340), cellular response to type I IFN (GO:0071357), response to IFN\u03b2 (GO:0035456); and cellular response to IFN\u03b2 (GO:0035458; Table S1 ). The downloaded gene sets were filtered for duplicated entries to obtain the numbers of genes listed below. As an additional ISG gene set, the GO set \"response to type I IFN\" was downloaded from MSigDB. This MSigDB gene set contains mouse orthologues of human genes of the Homo sapiens GO gene set.", "Cytokine in vivo treatments C57BL/6 mice were infected with Cl13 (2 \u00d7 10 6 PFU) and recombinant mouse IL-27 comprising both functional subunits (R&D Systems) or recombinant mouse IL-35 comprising both functional subunits (Adipogen), each at the specified concentration, administered daily by intraperitoneal injection on 0-8 dpi." ] },{ "paper_id": "254c09779d5d51cd41becfb1ef4d3fcb08a0ba8f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "25576dd63e9bdf1bef094279010e378d096d40f2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All National Institute of Allergy and Infectious Diseases (NIAID) Integrated Research Facility (IRF) and SAB animal facilities and animal programs are accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International. The study protocols were reviewed and approved by the SAB and NIAID IRF Institutional Animal Care and Use Committees in compliance with all applicable federal regulations governing the protection of animals and research.", "With SAB-139", "For fluorescence reduction neutralization assay-50% (FRNA 50 ) and plaque reduction neutralizing test-50% (PRNT 50 " ] },{ "paper_id": "2559cb0b4a2175212495ab7d44d9305db4a06c05", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ZBD-HEL1 may have been a critical event to facilitate the genome expansion of ancestral small-sized nidoviruses, thus setting the stage for the subsequent ExoN-driven expansion towards even larger nidovirus genomes (19, 57) .", "The nsp10-nucleic acid complex: towards the dsRNA unwinding mechanism", "Among +RNA viruses, whose RdRps generally have a high error rate, nidoviruses stand out for their large to very large genome size (13-32 kb) . Consequently, the replication fidelity of nidoviruses, in particular coronaviruses, has been the subject of intense study. Most recently, the identification of a unique 3 0 -to-5 0 exoribonuclease (ExoN) activity has provided the basis for the hypothesis that a primitive proofreading mechanism operates to promote the fidelity of RNA-dependent RNA synthesis in nidoviruses with >20 kb genomes (21) (22) (23) (24) (25) (26) (27) ." ] },{ "paper_id": "259f3f6bc30f4fce9f20d4ca222e2d5d04b5377d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Abbreviation EBV, Epstein-Barr virus.", "Monoclonal antibody technology has undergone rapid and innovative reinvention over the last 30 years. Application of these technologies to human samples revealed valuable therapeutic and experimental insights. These technologies, each with their own benefits and flaws, have proven indispensable for immunological research and in our fight to provide new treatments and improved vaccines for infectious disease.", "In the future, monoclonal antibody technology promises to become higher throughput and more efficient, allowing scientists to screen for exceedingly rare antibody specificities and B cell subsets. Furthermore, in combination with technologies evolving in vitro, valuable human antibodies may become further optimized, both in terms of their specificity and stability. For instance, researchers are currently trying to stabilize antibodies so that they can survive extreme temperatures, allowing field medics to have access to these treatments without concern for degradation when ideal storage conditions are not available." ] },{ "paper_id": "25a01c665ab20de80b75d48a2f71081666bca429", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "25a10dcacb257ac926ad42124f605189b3789d3f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "25aad84c22269cf7221d0c22737e2e01a36ec51b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In conclusion, G-rich sequences can have a major impact on slippage and its directionality.", "Interest in the potential of synthetic compensatory frameshifting near the sites of frameshift mutations to ameliorate a subset of genetic disease, prompted the testing of complementary oligonucleotides for frameshift stimulatory effects (60) (61) (62) (63) . Whether sequences that can bind to DNA, such as CRISPR-cas nickase mutants (64, 65) , would create a counterpart partial 'roadblock' structure for slippage stimulation, merits future work.", "Evolutionary selected transcription slippage is utilized in the expression of viruses such as the Paramyxoviruses, Sendai virus and Parainfluenza virus (3, 4) , the Filovirus, Ebola virus (5) (6) (7) , the large Potyviridae family (8-10), chromosomal genes such as Thermus thermophilus dnaX (11) , numerous genes in an endosymbiont (12) , a variety of bacterial Insertion Sequences (13) (14) (15) (16) , several medically important plasmid genes of Shigella flexneri (17) (18) (19) , and counterpart chromosomal toxin secretion genes in Citrobacter rodentium and Yersinia pseudotuberculosis (20) . Further, an extensive bioinformatic analysis of bacterial genomes has revealed many candidates that have yet to be experimentally explored (13, 15, 16) . Transcriptional indel errors are relevant to certain disease states (21) (22) (23) (24) (25) and maybe significant for aging (26, 27) ." ] },{ "paper_id": "25c88fafba786f31d034614ba0f6efce5c687594", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The characteristics of the 14 hospitals are presented ", "Hospitals with an RRS showed a statistically significant ", "The " ] },{ "paper_id": "25fd0362dfe0a62ca9ee6f9f634e24ef9a527dfc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Noticeably, known cases of recoding in Archaea [recently reviewed in (19) ] are limited to termination codon readthrough events that regulate the incorporation of the 21st and 22nd amino acids selenocysteine and pyrrolysine, respectively (20) (21) (22) (23) .", "No archaeal genes regulated by translational programmed frameshifting and ribosome hopping have been identified experimentally so far; therefore, if compared with the others domains of life, the study of translational recoding in Archaea is still at its dawn.", "reported that these elements, alone or in combination, enhance frameshifting by pausing the translating ribosome on the slippery sequence (4, 18) .", "The expression values of fucA1 gene were normalized to the values determined for the 16S rRNA gene. Absolute expression levels were calculated as fucA1/16S ratio in YSM and YGM cells, respectively. Relative mRNA expression levels (YSM/YGM ratio) were calculated as ( fucA1/ 16S ratio in YGM cells)/(fucA1/16S ratio in YSM). Each cDNA was used in triplicate for each amplification.", "In vitro translation assays were performed essentially as described by Cond\u00f2 et al. (28) . The samples (25 ml final volume) contained 5 ml of S.solfataricus cell extract, 10 mM KCl, 20 mM Tris-HCl, pH 7.0, 20 mM Mg acetate, 3 mM ATP, 1 mM GTP, 5 mg of bulk S.solfataricus tRNA, 2 ml of [ 35 S]methionine (1200 Ci/mmol at 10 mCi/ml) and $10 pmol of each mRNA. The mixtures were incubated at 70 C for 45 min. After this time, the synthesized proteins were resolved by electrophoresis 12.5% acrylamide-SDS gels and revealed by autoradiography of the dried gels on an Instant Imager apparatus." ] },{ "paper_id": "2606e22c2560b4cc0909c102ee356d562d78a9f3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Programmed ribosomal frameshifting (PRF) is a translational recoding phenomenon historically associated with viruses and retrotransposons. A PRF signal stochastically redirects translating ribosomes into a new reading frame (i.e. by +1 or \u00c01 nt) and, in the typical viral context, these signals allow ribosomes to bypass the usual in-frame stop codon and continue synthesis of a C-terminally extended fusion protein. As with most basic molecular mechanisms, although first described in viruses, it is becoming increasingly apparent that PRF is much more widespread and is likely employed by organisms representing every branch in the tree of life [for reviews see (1) (2) (3) (4) ].", "Pknots (24) was used to predict the minimum free energy (MFE) 'fold' of each motif hit identified by RNAMotif. Each motif hit identified by RNAMotif was folded by pknots and assigned a predicted MFE value (MFE in kcal/mol) and a predicted secondary structure.", "randomized ORFs using the observed CDS codon usage bias; diNuc, randomized ORFs generated using the observed CDS dinucleotide frequency. A total of 100 randomized replicate genomes were generated for each of the seven methods (700 random genomes total, $6.5 billion nucleotides). As was done for the natural S.cerevisiae genome, RNAMotif was used to search these randomized genomes.", "All software was compiled and run on one or more of the following systems: Dell Precision 620, 2\u00b7 PIII XEON 866 MHz running Mandrake Linux 10.\u00b7; Apple Power Macintosh, 2\u00b7 G4 1.4 GHz PowerPC running OS X Tiger; SGI Cluster 64\u00b7 MIPS R14K 600 MHz running Irix 6.5; SGI Altix 3000, 64\u00b7 1.5 GHz Itanium II running Linux-64. Supercomputing resources were made available courtesy of The National Cancer Institute's Advanced Biomedical Computing Center in Frederick, MD (ABCC, http://www.abcc.ncifcrf.gov). Unless otherwise noted, data mining and analysis was carried out using scripts written in PERL (www.perl.org), each of which are available on request. In all cases, data is stored in a mySQL 4.\u00b7 relational database (www.mysql.com) referred to as the PRFdb (http://dinmanlab.umd.edu/prfdb)." ] },{ "paper_id": "26360be96ced1f242e01966b0d152c32544f3d60", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "26b49bdf0c3d50386ae603783e9674b7349852df", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "formation which has functional enzymatic activity. It is apparent that the VP7 sequence from amino acids 51-111 is necessary and sufficient for the retention of VP7 in the ER and also serves to retain a normally secreted protein in this compartment.", "dhl/Am) was secreted from the cell (Figs. 5 and 6 ) and exhibited endo-H resistant glycosylation (Fig. 5) . These results along with those in the previous section indicate that two regions in VP7 are necessary for ER retention, namely a segment within the domain of amino acids 51-61 and another within the region 62-111.", "The plasmid pMSal04 (12) containing the full length cDNA coding sequence of mouse salivary a-amylase (a gift from O. Hagenbuchle, Swiss Institute for Experimental Cancer Research, Lausanne, Switzerland), was used in the construction of both the amylase transcription vector Am/ pGEM3 (pGEM3 was obtained from Promega Biotec, Madison, WI), and the expression vector pJC/Am. The plasmid pMSal04 was cut with Pst I and the 1,626-bp fragment containing the full length amylase coding region was isolated and cloned into the Pst I site of the pGEM3 transcription vector." ] },{ "paper_id": "26b944ce8d2f033704c7aeef38b0c128c0dd18be", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Bioactive peptides cleaved from the egglaying hormone precursor in the bag cell neurons of", "Bag cell clusters were isolated and fixed in 1% glutaraldehyde, 2% paraformaldehyde, 1% DMSO, 0.3 M sucrose in 0.1 M Na cacodylate buffer, pH 7.4, for 90 min at 4\u00b0C. The sheath was then dissected from the cluster, and the cluster was washed in 0.05 M Na Acetate, pH 5, and incubated in 0.1% cytidine monophosphate (Sigma Chemical Co., St. Louis, MO) or glycerophosphate (Sigma Chemical Co.) and 0.15 % lead nitrate in 0.05 M Na acelate, pH 5, for 90 rain at 37\u00b0C (Novikoff et al., 1971) . Results were similar for both of the labels, and control preparations without substrate showed no lead precipitate. Clusters were washed with 0.1 M Na cacodylate, pH 7.4, osmicated in 2% OsO4 in 0.05 M Na cacodylate, pH 7.4, for 1 h, and then dehydrated and embedded as described above. Thin sections (80-100 nm) were cut and stained with 2 % uranyl acetate followed by lead nitrate before visualization on a transmission electron microscope (410; Philips Electronic Instruments, Inc.).", "250-750-g Aplysia were obtained from Sea Life Supply (Sand City, CA)." ] },{ "paper_id": "26cb41132d945aa5cff35a80761daf086a4375e0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "26f94b094ce4d39665edddef1942f04dd041f363", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "26fec23192bed03196a134abb20b8b197a2acc42", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Taken together, these results suggest that microglia under acute systemic inflammation present a highly activated state, which is heterogeneous and distinct from neurodegenerative diseaseassociated profiles.", "Adult microglia were isolated from brains of C57BL/6N mice at age ", "Expanded View for this article is available online." ] },{ "paper_id": "276ff0fe5b27771bb52e6fec57cfe7b6430c3b1d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Open Access This is an Open Access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 3.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/3.0/ ", "The study was designed as a cross-sectional, repeated study over a period from December 2009 to November 2013. It consisted of three different substudies.", "The analyses were performed using JMP V.8 (SAS Institute Inc., Cary, North Carolina, USA)." ] },{ "paper_id": "27c190c3d4fc0884a3b9d79774ee61a0c305c540", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Bands were located on the dried gels by alignment with an exposed X-ray film, excised, rehydrated, and extracted with tissue solubilizer TS1 (Zinsser Analytic, Frankfurt, FRG) as described (58) .", "Published procedures were used for preparing plasmid DNA (35) ; saltwashed, gradient-purified INV (35) ; and an S-135 of a cell extract from Escherichia coli K12 strain MC4100 (38) grown at 30\"C (35) . DNAdependent protein synthesis using the S-135 was performed in 25-/~1 reactions as described previously (37) . When the lacYgene was to be expressed, cAMP was added from a 12. " ] },{ "paper_id": "27d6ec2664104ba3347a3991ce63d20ebae32d39", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "He had a history of cough variant asthma, but did not take any regular medication, and otherwise healthy. On admission (June 2, 2015), the physical examination revealed a body temperature of 38.8\u00b0C, a respiratory rate of 22 breaths per minute, a pulse of 78 per minute, and a blood pressure of 118/71 mmHg. Chest radiography showed patchy consolidation in the upper zone of the left lung. His pneumonia progressed, and on June 8, he developed shortness of breath, his arterial oxygen saturation decreased below 90%, requiring oxygen supplementation, and chest radiography showed multiple con- solidations in the both lungs. On June 10, he was intubated and mechanical ventilation was started. His hypoxemia worsened rapidly, and veno-venous extr acorporeal membrane oxygenation support was started since June 11. On July 2 (day 35 of his illness), real-time RT-PCR for MERS-CoV turned negative, and was removed from the isolation unit. He recovered gradually.", "In summary, we isolated MERS-CoV from a patient with severe pneumonia who had been infected during the Korean outbreak in 2015. We also obtained full-length sequence of the The evolutionary history was inferred by using the maximum likelihood method based on the Tamura-Nei model (16) . Evolutionary analyses were conducted in MEGA6 (17 ", "Middle East respiratory syndrome coronavirus (MERS-CoV) is a betacoronavirus causing a severe acute respiratory infection (1, 2) . It was first isolated from the sputum of a patient with severe pneumonia in Saudi Arabia in 2012 (3) . Since then, 26 countries have reported 1,618 laboratory-confirmed cases of infection with MERS-CoV to the World Health Organization (WHO), including 579 fatalities (4) ." ] },{ "paper_id": "27d9e8f9f893c005e551b219680b7832eac40fca", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The de-escalation approach is generally recommended when high incidence of resistant pathogens in neu-", "The epidemiology of drug-resistant pathogens is important for establishing strategies for prophylaxis and initial empirical antimicrobial therapy. Because domes-tic data are limited to single-institution and retrospective studies, multicenter nationwide studies of the epidemiology of bacterial infections in Korea are required.", "Examples of therapy Antimicrobial prophylaxis" ] },{ "paper_id": "27ee5b4647398fd11e7044166a9d68aca391ebcf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A better understanding of these newly discovered antiviral factors may open new avenues towards the design of drugs that repress the spread of viruses whose genomes have already integrated.", "Keeping the density of glycoprotein molecules on the virus surface low is a property of some viruses that is particularly pronounced for HIV-1, and is thought to provide a selective advantage during immune evasion [20] . It is unclear whether the drawback of reduction of virion infectivity, induced by 90K-mediated paucity of Env embedded in particles, is outweighed by improved immune escape. More work is warranted to fully understand the impact of 90K on HIV-1 infection." ] },{ "paper_id": "280c43e8272c97d38089e567dbf1881430e60dd9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The ability of the copolymers for binding siRNA was evaluated by electrophoresis through 2% agarose in TAE buffer (40 mM Tris-HCl, 1 v/v% acetic acid, and 1 mM EDTA) at 100 V for 20 min. The siRNA bands were stained with ethidium bromide and imaged using a VersaDoc Imaging System (Bio-Rad Laboratories).", "Assessment of siRNA delivery and targeted gene silencing mediated by P1, P2, and P3 copolymers by flow cytometry", "No potential conflicts of interest were disclosed." ] },{ "paper_id": "281b4272005dbc998e36b034b7fb528c9ba038cd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "CEL I /Surveyor TM enzyme.", "Use TdT enzyme to add oligonucleotide tail (e.g. oligo-dA) to 3\u2032OH ends, to serve as primer anchor", "Un-digested fragments Digested fragments", "Sequencing is often considered the gold standard for comprehensive mutation analysis. Multi-capillary electrophoresis, re-sequencing arrays or pyrosequencing provide platforms for highly parallel genetic analysis (7) (8) (9) (10) (11) (12) (13) . However, the expense associated with these techniques is currently high both for instrumentation and for runningcosts. Since somatic mutations for most genes are relatively rare events it can be inefficient to scan for mutations using expensive approaches that in several cases provide unnecessary data (14, 15) . Another issue with direct sequencing or re-sequencing arrays is the difficulty *To whom correspondence should be addressed. Tel: +1-617-525-7122; Fax: +1-617-587-6037; Email: mmakrigiorgos@partners.org \u00df 2007 The Author(s) This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/2.0/uk/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited." ] },{ "paper_id": "2823d7523188f052070c565fc1e5b9c35899f658", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was approved by the institutional review board of the Keimyung University Dongsan Medical Center (IRB No. 2014-09-054). Informed consent was exempted by the board.", "In order to identify the underlying cause of ALTE, various diagnostic investigations were performed during hospitalization. On the day of admission, blood samples were analyzed for complete blood count (CBC) with bacterial culture, blood gas analysis with electrolytes, and C-reactive proteins. In addition, respiratory virus reverse transcription polymerase chain reaction (RV RT-PCR) using nasopharyngeal aspirate, Rotavirus antigen test in stool, urinalysis with culture, cerebrospinal fluid (CSF) analysis, and chest radiography were all utilized. RV RT-PCR included tests for metapneumovirus, adenovirus (A-F), coronavirus 229E/OC43, parainfluenza virus 1/2/3, influenza A/B virus, rhinovirus, respiratory syncytial virus A/B, and bocavirus. Electrocardiograms (ECG), 2-dimensional echocardiograms, upper gastrointestinal studies, electroencephalograms (EEG), brain image studies, and tests for metabolic disease were ordered on an individual patient basis." ] },{ "paper_id": "284541395ddc07d44ccd2d3da2ba060505a01407", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Aggregated proteins, overabundant proteins, and certain microbial proteins can induce selective autophagy through ubiquitination that binds LC3 via SQSTM1/p62 (sequestosome 1). [78] [79] [80] The autophagic sequestration of invading bacteria is an important innate immune mechanism. Intracellular Salmonella, Mycobacterium, Streptococcus, and Legionella-containing vacuoles or bacteria are ubiquitinated, and subsequent binding of SQSTM1/p62 delivers the bacteria to autolysosomes for degradation. [81] [82] [83] [84] [85] E. chaffeensis inclusions were not ubiquitinated as monoclonal antibody FK2 that recognize both mono-and poly-ubiquitinated proteins did not label the inclusions (Fig. S7 ). Taken together, our observations suggest that E. chaffeensis induces autophagy independent of MTOR, ULK1 or PRKA, and ubiquitination-induced signaling pathways.", "inclusions with RAB5-containing vesicles, suggesting the recruitment and retention of RAB5 endosomes during E. chaffeensis replication and expansion of the inclusion (Fig. 9B to D). In uninfected cells, GFP-RAB5 showed smaller diffuse puncta than in infected cells (RAB5A shown in Fig. 9E ).", "No potential conflicts of interest were disclosed." ] },{ "paper_id": "285423e1a13bb2e1b98795cc6bb0cb6f54c0f8fd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "28698e9d58d0b455cfa1adb28be25bc7f9286859", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The author declares no conflict of interest." ] },{ "paper_id": "2891c813ce4dd156d5f56736db5a10a2065c9167", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "*Address correspondence to this author at the The School of Chinese Medicine for Post-Baccalaureate, I-Shou University, Kaohsiung, Taiwan; Tel: +886-7-6151100 ext. 7063; Fax: +886-7-6155150; E-mail: huangks@isu.edu.tw Compared to a free drug, the advantages of a nano-scale drug delivery system include increasing bioavailability, reduced drug amount and frequency and reduced systemic side effects [39] . In hence, active targeted drug delivery combined nano-technological carrier platforms is a better way to prolong, localize, target with the pathogenic sites and reduction of drug side-effects [40] .", "In modern life, human are always threaten by infectious diseases [1] [2] [3] [4] [5] [6] . Bacteria, virus and fungi are the critical reasons to infectious diseases [7] [8] [9] [10] [11] . Bacteria served many diseases by the food route [12] . In Germany, Escherichia coli in Fenugreek sprouts exported from Egypt caused 48 deaths from 2011 to 2012 [13] . Virus could cause various diseases including human immunodeficiency virus (HIV) [14, 15] and influenza [16, 17] . Fungi like Cryptococcus neoformans could lead to chronic liver disease [18] . Luckily, with the development of safe vaccines and antibiotics, the infectious diseases seemed to be totally cured by these therapies [19] . However, there are some adverse drug effects if patients take these drugs at common dose or overdose such as insomnia [20] , osteoporosis [21] , headache [22] and liver failure [23] . Furthermore, these pathogens with a very fast doubling cycle develop a mechanism for becoming resistant to a specific drug at a glance [24] . In hence, scientists are trying to find new approachs to solve aforementioned problem urgently.", "The authors confirm that this article content has no conflict of interest.", "Nanoparticles including metal and non-metal nanoparticle were systematized by our previous review [80] . Both of them have many unique physicochemical properties including extremely small size [81, 82] , huge surface to mass ratio [83] , high reactivity and a distinctive interaction with biological systems [84] . Nanoparticles have been demonstrated to elevate drug stability, bioavailability, targeting and uptake [85] . Particles less than 5 nm are rapidly expelled from the circulation by extravasation and larger particles have limited diffusion in the extracellular space [86] . In hence, the development of nanoparticles containing medicines has made it possible to increase the therapeutic index of many compo-nents using suited ligand to arrive the intention site [87] . Nanoparticles binding ligands could enhance antiviral activity and improve cytotoxicity, low water solubility, and rapid clearance from circulation of the free drug [88] . The details of studies to treat microbes by nanoparticles with binding ligands are summarized in (Table 2 )." ] },{ "paper_id": "2892aee133b8b4037ace7ec6dfe6cab17e466292", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A key question remains \"what is the real number of people infected since many cases may be mild or asymptomatic?\" A recent modelling estimated the population attack rate to be between 0.75 per 100,000 to 15.8 per 100,000 analysing rates down to prefecture level in China . Any determination of incidence will likely be an underestimate since it will not include mild and asymptomatic cases. Accuracy of such estimates will depend on the development of sensitive and specific serologic tests.", "The SARS-CoV outbreak originating from China in 2003 was first reported to the global health community by ProMED (ProMED, 2003; Carrion and Madoff, 2017; Hamer et al., 2017) . It took six weeks for the authorities to acknowledge the outbreak had spread significantly from Guangdong throughout China after cases were reported from Hong Kong, Hanoi, Singapore, and Toronto.", "Li Wenliang, a face to the frontline healthcare worker. The first doctor to notify the emergence of the SARS-CoV-2, (COVID-19), outbreak", "Global public health security is of primary importance to prevent outbreaks of diseases with epidemic potential and every effort to detect, report, and institute infection prevention and control measures should be made. Astute clinicians, access to laboratories with state of the art tools, and openness, transparency and quick reporting are crucial components of this response (Kavanagh, 2020) . This requires an open flow of information and collaboration between laboratory experts and clinicians on the frontline who may be the first to observe unusual clustering of cases or uncommon clinical presentations, both of which should be reported immediately." ] },{ "paper_id": "28d987c4ec40dafc05993e3a209ea4266f270f28", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Text S1. Materials and Methods; Details of Sarcocystis neurona metabolic reconstruction; and apicoplast SNP differences.", "(i) 1. For further details on the implementation of modeling, please refer to (12) ." ] },{ "paper_id": "29445ecd280247f79d6cebe0c3b4d06796e72eb9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Porcine deltacoronavirus (PDCoV) has emerged in several pig-raising countries and has been a causative pathogen associated with diarrheal diseases in South Korea since 2014. In the present study, we were able to isolate and cultivate a Korean PDCoV strain (KNU16-07) in cell culture and investigate its pathogenicity. PDCoV-inoculated piglets showed watery diarrhea accompanied by acute enteritis in the natural host. Sequencing analysis demonstrated the genetic stability of KNU16-07 for at least thirty serial passages.", "The PDCoV nucleocapsid (N) antigen was prepared from PK-PDCoV-N cells stably expressing the PDCoV N protein as described previously [8] . The cell lysate supernatant containing recombinant N protein was purified by using a HiTrap TALON crude column (GE Healthcare, USA) according to the manufacturer's instructions. The purified protein was concentrated with Amicon Ultra centrifugal filters 10K (Millipore, USA) and the final product was used as the antigen. PDCoV N-specific monoclonal antibodies (MAbs) were produced by immunizing 4-week-old male BALB/c mice as described previously [12] .", "Porcine deltacoronavirus (PDCoV) is a newly emerging enterotropic swine coronavirus that causes acute enteritis in nursing piglets [7, 10] . PDCoV was first identified in Hong Kong, China in 2012 and, subsequently, has emerged in most major swine-producing nations in Asia and North America [11, 13, 14] . The presence of PDCoV in South Korea was first announced in early 2014 [7] . Our previous report indicated that monoinfection by PDCoV and coinfection by PDCoV and porcine epidemic diarrhea virus (PEDV) are common in pig herds in South Korea [4] ." ] },{ "paper_id": "29484085aa4df22fec44839b58dcdce03f1c3e82", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "298a64fc7158cb78592bd96d53b4e58fbf562276", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "September 8th, 2018, South Korea reported the first MERS-CoV case since the end of an outbreak in 2015, suggesting that MERS-CoV is still a worldwide threat (WHO, 2018) .", "In their study, mice transfected with the human DPP4 gene became significantly less susceptible to MERS-CoV infection after", "only one animal exhibited moderate ciliary loss in the nasal mucosa ( Figure 9a , Table 1 ) on day 4 p.i." ] },{ "paper_id": "29ead3f1e4f24c9158b65d37a4ba9d839fb9028c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "cattle, colostrum, fecal score, immunity, milk", "Recent legislation, including the Federal Veterinary Feed Directive in 2017 13 and the California Senate Bill-27 in 2018, 14 was enacted into law and recommended judicious use of antibiotics in food producing animals.", "Background: Nonantibiotic alternatives providing local gut immunity have been recommended for managing calf diarrhea." ] },{ "paper_id": "29f72afab8b9894bede98ed862d87595374099c7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(QDYNHDRDIVPPR), Eval162 (IAKTALKVLPQL), Eval418 (LWGEIWNTVKGLI), Eval655", "(IWGALLSGVADLL) and Eval967", "Data are expressed as the mean \u00b1 standard deviation from at least three separate experiments." ] },{ "paper_id": "2a0861490e83f24375ca14187de9617594666850", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cell Lines. HeLa (ATCC CCL 2.2; American Type Culture Collection, Rockville, MD); MOLT-4 (human T cell lymphobhstic leukemia; ATCC CRL 1582); HEp-2 (human epidermoid carcinoma ceils), and HepG2 (human hepatic carcinoma, ATCC HB 8065) cells were maintained in RPMI 1640 supplemented with 10% FCS, 2 mM t-glutamine, and 5/~g/ml gentamycin sulfate.", "V 601 AAGAGGGAGCTGGGA~GAAGCT GGGCGAGCTGCAGGAGAAGCTGAGCGAGCTGAAGGA~GGTGGAGCTGAA~TC~T~A~A~A~CA~G 195 K R E L G K K L G E L Q E K L S E L K g T V E L K S Q E A Q S L Q Q Q R D Q Y L 721 GGACACCTGCAGCAGTATGTGGCCGCCTATCAGCAGCTGACCTCT GAGAAGGAGGTGCTC-CATAATCAGCTACTGCTGCAGACCCAGC ~GT~A~A~A~AG 235 G H L Q Q Y V A A Y Q Q L T S E K E V L H N Q L L L Q T Q L V D Q L Q Q Q E A Q 841 GGCAAAGCGGTGGCCGAGATGGCCCGCCAAGAGTTGCAGGAAACCCAGGAGCGCCT GGAAGCTGCCACCCAGCAGAA~ ~AGTT~AT~TC~ 275 G K A V A E H A R Q s 5 Q E T Q E R L E A A T Q Q N Q Q L R A Q L S L M A H P G 961 GAAGGAGATGGACT GGACCGGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAGGAGGCGGTGGCAGT~A~T~C~A~~~TG 315 E G D G L D R E E E s D E E E s s s s A V A V P Q P M P S I P s D L E S R s A H 1081 GTGGCATTTTTCAACTCAGCTGTAGCCAGTGCC GAGGAGGAGCAGGCAAGGCTACGT GGGCAGCTGAAGGAGC~T~T~T~A~T ~T~ TC~AG 355 V A F F N S A V A S A g g E Q A R L R G Q L K g Q R V R C R R L A H L L A S A Q 1201 AAGGAGCCTGAGGCAGCAG~AGCCCCAGGGACC GGGGGTGATTCTGTGTGTGGGGAGACCCACCGGGCCCTGCAGGG~T~A~ ~TAT~ATG 395 K E P s A A A P A P G T G G D S V C G s T H R A L Q G A M E K T. Q S R F H E L M 1321 CAGGAGAAGGCAGACCTGAAGGAGAGGGTAGAGGAACTGGAACATCGCTGCATCCAGCTTTCTGGAGAGACAGACACCATT GGA~GTACA~T~A~AGA~A~A~ G 435 Q E K A D v. K E R V E E L E H R C I Q L S G E T D T I G E Y I A L Y Q S Q R A V 1441 CTGAAGGAGCGGCACCGGGAGAAC-GAGGAGTA~ATCAGCAGGCTGGC~AAGACAAGGAGGAGATGAA~T~T~T~~~~ 475 L K s R H R E ) E E Y I S R L A Q D K g E M K V K L L E L Q E L V L R L V G D R", "DNA Subcloning and Sequence Determination. Purified )~7_ap clones were subcloned in vivo into pBluescript plasmids using R408 helper phage as recommended in the manufacturer's instructions (Stratagene Inc., La Jolla, CA). The nucleotide sequence was determined using the dye primer cycle sequencing kit and DNA sequencer (373A; Applied Biosystems, Inc., [ABI], Foster City, CA). Oligonucleotide primers were synthesized with a DNA synthesizer (380B; ABI). DNA sequences were determined in both strands and compiled using the alignment program SeqEd (ABI).", "Human Sera. Sera from patients with Golgi autoantibodies were obtained from serum banks at the University of Calgary (Calgary, Alberta), The Scripps Research Institute (La Jolla, CA), and Immuno Concepts Inc. (Sacramento, CA). The serum samples were stored at -20 or -70~ The specificity of the autoantibodies for Golgi antigens was first identified on the basis of indirect immunofinorescence (IIF) microscopy (4) . Control sera were randomly selected from a bank of 2,000 female Red Cross blood donors (37) or sera pooled from healthy volunteers." ] },{ "paper_id": "2a0dccbe06cd6c48fdafcae920f220b3fdccab41", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "1 . Abbreviations used in this paper: BiP, immunoglobulin heavy chain binding protein; CgB, chromogranin B ; GAG chain, glycosaminoglycan chain ; hsPG, heparan sulfate proteoglycan; PDI, protein disulfide isomerase ; SgH, secretogranin II ; TGN, trans-Golgi network .", "Chanat and Hutwer Aggregation-mediating Sorting of Secretary Proteins 151 1", "vesicles contaminating the fractions of the velocity gradient containing TGN vesicles." ] },{ "paper_id": "2a17719f2c1d211a651060441bda8bc1c052e2aa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "IAP-binding motifs are found in pro-apoptotic proteins and function in the abrogation of caspase inhibition by inhibitor of apoptosis proteins in apoptotic cells LIG_BIR_III_1 LIG_BIR_III_2 LIG_BIR_III_3 LIG_BIR_III_4", "A proline-rich motif binding to EVH1/WH1 domains of WASP and N-WASP proteins LIG_HCF-1_HBM_1", "The AGCK docking motif mediates intramolecular interactions to the PDK1 Interacting Fragment (PIF) pocket, serving as a cis-activating module LIG_AGCK_PIF_2 LIG_AGCK_PIF_3", "protein structure annotated, giving more detailed information about the biological context of the respective motif." ] },{ "paper_id": "2a1c5b2541cb958a6280094aa3c1cd2e414fb468", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A reduction in immune cell infiltration would also result in diminished neuroinflammation. Reactive astrocytosis and microgliosis are considered major hallmarks for neuroinflammation. Staining for astrocytes with GFAP and microglia with Iba-1 can then be used to assess changes in mean area fraction staining to quantify neuroinflammation (Figure 3) .", "Ensure that \"Limit to threshold\" is unchecked and \"Display label\" is checked. Click \"OK\" when complete. 5. To obtain measurements, go to Analyze > Measure. A \"Results\" popup box will appear and this data can be saved as is or copied into another program. For analysis, compare \"Area fraction\" values between treatment groups.", "The authors have nothing to disclose." ] },{ "paper_id": "2a23841a09149d099f936ecc2edf913b9d2dc2ce", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2a2a9ae443755df9e1d930c75c2023f0b1780a51", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2a584d39eb8b164d066dbc8e7496c9a9ff39bc30", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Young mice (6-8 wk) were treated i.n. with LPS (E. coli O111:B4) at 0.1 \u00b5g/mouse in 50 \u00b5l for 7 d.", "Middle-aged mice (10-13 mo) were treated with N-Acetyl-l-Cysteine (Sigma-Aldrich; 100 mg/kg, i.p.) for 7 d.", "In situ CFSE and OVA-FITC staining. CFSE and OVA-FITC were purchased from Molecular Probes. CFSE was diluted to a concentration of 8 mM in DMEM, and then administered i.n. (50 \u00b5l) 6 h before infection (Legge and Braciale, 2005; Zhao et al., 2011) . OVA-FITC was dissolved in PBS, and 200 \u00b5g were administered i.n. in 75 \u00b5l." ] },{ "paper_id": "2a5b2e11c10d35b22cb2965f62ccc79e61eeb77b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2a771153af1b6fd5e71dc23f5db7c83bb5a3f231", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Saccharomyces cerevisiae strains used in this study are listed in Table I . Yeast cells were grown in YPD [1% (wt/vol) Bacto yeast extract (Difco Laboratories Inc., Detroit, MI), 2 % (wt/vol) polypeptone (Nihon Seiyaku, Tokyo, Japan), and 2% (wt/vol) glucose] or in MVD [0.67% yeast nitrogen base without amino acids (Difco Laboratories) and 2% glucose] medium supplemented appropriately. MCD medium is MVD containing 0.5% casamino acids (Difco Laboratories Inc.).", "Yeast Sec12p is a type II transmembrane", "Signals, or special structural motifs, are essential for correct sorting of proteins in a cell. During membrane traffic in the secretory pathway, vesicles dynamically cycle between organelles. The sorting processes in such vesicular traffic should also be understood from the viewpoint of recognition of signals." ] },{ "paper_id": "2aa0a28e4246f367ffe104837e755b28d2021f45", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The in vivo diagnosis of H1N1 infection was confirmed by real-time RT-PCR (rRT-PCR) test using nasopharyngeal swab specimens, in accordance with guidelines from the Centers for Disease Control and Prevention (CDC) [10] .", "In summary, our report of cancer patients highlights the severity of the Influenza A (H1N1) pandemic in this vulnerable population and the urgent need to establish specific protocols of care and management strategies designed to face this health care challenge. funding Conselho Nacional de Desenvolvimento Cient\u00edfico e Tecnol\u00f3 gico (CNPq)." ] },{ "paper_id": "2ae023dbcedb660475c4de1033343196265fd42c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A 12-year-old spayed female domestic shorthair cat was evaluated for a 3-week history of abdominal distension. Chyloabdomen secondary to pancreatic carcinoma was diagnosed. The cat was palliatively managed using rutin and a low-fat diet. The etiology, diagnosis and management of chyloabdomen are discussed.", "In human and veterinary medicine, chyloabdomen is a rare condition. It results from leakage of lipid-rich lymph into the peritoneal cavity, secondarily to obstruction or increased permeability of lymphatic vessels. In cats, it is believed to be mostly of neoplastic origin. Medical investigation relies on a systematic approach and definitive diagnosis often requires histopathological samples. This report describes the exploration and management of a chyloabdomen secondary to pancreatic carcinoma in a 12-year-old cat.", "Case Details A 12-year-old neutered female domestic shorthair cat was referred for evaluation of an abdominal effusion. The owners reported an abdominal distension of three weeks duration, with conservation of general demeanor and appetite. The referring veterinarian detected an abdominal effusion. A chyloabdomen was suspected, according to the gross appearance of the liquid. The cat was housed mainly outside. Her vaccination status was not up-to-date. On physical examination, the cat was bright, alert and normothermic. The body condition score was of 4 out of 9 and she had an unkempt haircoat. A marked abdominal distension was noted. No pain was elicited on abdominal palpation. Cardiorespiratory parameters were within normal limits. Abdominocentesis was performed under sedation. Approximately 300 mL of milky fluid were removed. Triglycerides content in the effusion was highly increased (102.84 g/L; reference range 0.30-1.60). The cytologic analysis of the fluid showed 1000 erythrocytes/\u00b5L and 1500 leukocytes/\u00b5L, including neutrophils (48%), monocytes (40%) and small, mature lymphocytes (12%). No bacteria nor neoplastic cells were visualized. Based on these findings, chyloabdomen was confirmed." ] },{ "paper_id": "2b36f467dee97f9675e187cabd4e4585e7ab17f2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supported in part by Serendipity Award SA29/0513 from the Dunhill Medical Trust.", "IFN\u03b3 interferon gamma", "T cell helper type 1" ] },{ "paper_id": "2b5a2503522ac52b24f3475d69719626993d9dab", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ausiello et al 35 released a method for extended and controlled delivery of parathyroid hormone to a patient in need, involving implanting a medical device into the patient, the medical device comprising a substrate, a plurality of reservoirs in the substrate, and a release system contained in each of the reservoirs, wherein the release system comprised parathyroid hormone, and controllably releasing a pharmaceutically effective amount of the parathyroid hormone from the reservoirs.", "Drug Design, Development and Therapy 2013:7 945-952 Drug Design, Development and Therapy Dovepress submit your manuscript | www.dovepress.com Dovepress 945 R e v i e w open access to scientific and medical research Open Access Full Text Article" ] },{ "paper_id": "2ba882c9ddb5e9db8ebb0db536788bff66b67f14", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The proteomic complexity of tumors must be fully understood to develop more effective therapeutic strategies.", "Funding SRYC acknowledges support from Fondo de Investigaciones Sanitarias (P1170185 and PI 14/01320), Redes Tem\u00e1ticas de Investigaci\u00f3n Cooperativa en Salud (RTICC, RD 12/0036/0057), Generalitat de Catalunya (AGAUR, 2014, 1131), and CIBERONC 2017.", "Conflict of interest The authors declare that they have no conflict of interests." ] },{ "paper_id": "2bae24fa42f6bd7e9a241b4456296f3af0ee4b2c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "As mentioned above, most GBMs present acutely, with relatively few clear indications of the oncoming pathogenesis ", "There is little mention of circulating lipid species as putative biomarkers for GBMs, but 24S-hydroxycholesterol is among ", "submit your manuscript | www.dovepress.com" ] },{ "paper_id": "2bd481afbcdbbc5c78d67ed1f7204b09c1f83da1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Korean J Pediatr 2017;60 (7) :208-215", "No significant difference in LVEDD, LVESD, and FS was found Korean J Pediatr 2017;60 (7):208-215", "No potential conflict of interest relevant to this article was reported." ] },{ "paper_id": "2bfb845e6afaaa4d43ebd7a79dc3e092e0168d29", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2c074099e6063fd2570cb173900da087fba991f5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Respiratory failure following HSCT presents on a spectrum", "Cryptogenic organizing pneumonia (COP) is an interstitial and airspace disease with symptoms mimicking classic pneumonia. Imaging findings include nodular lesions, ground glass attenuation, and patchy peribronchovascular, peripheral, bandlike consolidative distributions [64, 94] . Biopsy reveals chronic alveolar inflammation and exten sive granulation of the alveolar ducts and small airways [94] . Bronchoscopy is useful to distinguish COP from infectious pneumonia, and analysis of lavage fluid reveals a predo minant lymphocytosis [95] . Previously referred to as bron chiolitis obliteransorganizing pneumonia, COP is a distinct entity from the bronchiolitis obliterans syndrome (BOS), which is discussed separately and should not be confused.", "Other therapies with inconclusive utility include inhaled corticosteroids, intravenous immune globulin, TNF\u03b1 in hibitors, cyclosporine, and tacrolimus [4] . Extracorporeal photophoresis is a promising therapy with increasing evidence suggesting its potential benefit [108, 109] . Lung trans plantation for advanced BOS has been reported [110113] ." ] },{ "paper_id": "2c0813f50214197ccbeae857bb05217ade8aae82", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2c2f0107d55f1c770896c982d59e0bfa035fd4d7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All the experiments were conducted in accordance with the Guidelines for the Care and Use of Laboratory Animals of Azabu University.", "In conclusion, Dempo-PCR can identify a wider range of existing pathogens quickly and easily compared to one assayone pathogen test. Considering multiple etiology of PRDC, screening by Dempo-PCR would help us determine treatment and prevention measures. This detection system may provide an alternative testing method that is simpler, faster, and more comprehensive than existing assays.", "The objective of this study is to develop a system based on TaqMan real-time PCR that can detect 17 pathogens, including viruses and bacteria, associated with porcine respiratory diseases in one run." ] },{ "paper_id": "2c70242370bc27a555b206e5bd62b68f1edb772d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "sures to remove or reduce the holes in many other slices in order to effectively prepare against future emerging infectious diseases including MERS. The WHO sent a high-level message to the Korean government including 11 recommendations [5] . These recommendations can serve as references in redesigning the health care and public health systems in Korea.", "Perspective Since the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea (hereafter Korea) began on May 11, 2015, a total of 186 persons have been infected by the MERS coronavirus, 38 of whom have died. With this number, Korea becomes second only to the Kingdom of Saudi Arabia in the ranking of cumulative MERS cases. In this paper Korea's unique experience of an outbreak of MERS will be summarized and discussed briefly.", "Since the Middle East respiratory syndrome (MERS) outbreak in the Republic of Korea (hereafter Korea) began on May 11, 2015, a total of 186 persons have been infected by the MERS coronavirus (MERS-CoV), 38 of whom have died [1] . Korea is thus second only to the Kingdom of Saudi Arabia in the ranking of cumulative MERS cases. As the MERS epidemic in Korea has been considered a public health emergency, crisis, or disaster, several policy suggestions for public health system reform are now under discussion [2] . In this paper the unique characteristics of the public health system and social phenomena associated with the MERS outbreak outside the Middle East will be summarized and discussed briefly." ] },{ "paper_id": "2cf45a5a4224dbf38d537eace1f6d49327e3487d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2cf60380bb05becd140053f71fa4cc4e4eaa0d5f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The ortholog groups are further processed to create multiple sequence alignments (MSAs) using MUSCLE (34) with default parameters. Phylogenetic estimations using the neighbor-joining method (35) were created based on trimmed alignments using PHYLIP (36) . Trees were validated by bootstrapping (37) using a minimum of 100 replicates.", "The five categories of viruses studied by PATRIC are all positive-strand ssRNA viruses, with the exception of Lyssaviruses, which have negative-strand ssRNA genomes. While there are no reports of any of these viruses being weaponized, they represent the causative agents for a number of emerging and reemerging diseases including Severe Acute Respiratory Syndrome (SARS), rabies and transmissible gastroenteritis. Recombinant vaccines for these viruses are either still in development or unavailable in areas where these infections are endemic or epidemic, compounding the public health risk.", "Pathway analysis can also yield clues to pathogenesis by comparing virulent and avirulent strains and examining the roles of genes not present in both strains.", "Results of the genome analysis pipeline are merged with original GenBank or RefSeq features for automated interpretation. A decision tree is used to classify genes into categories based on the level of agreement between the various prediction methods. Genes that are unambiguously predicted by multiple methods are automatically 'finalized', creating new 'gene', 'CDS' and/or '[t/r]RNA' features. The remaining genes are marked for manual curation. For viral genomes, an abbreviated pipeline is executed that emphasizes sequence alignment for gene identification and employs GeneMarkHMM optimized for mammalian (host) genomes." ] },{ "paper_id": "2cfdb63ea48ecc4c871cc7d61b5f5361cfd8f287", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Viral gene sequencing and analysis were conducted as follows. In brief, Viral DNA was extracted directly from samples using the AxyPrep\u2122 Body Fluid Viral DNA/RNA Miniprep Kit (Axygen, Wujiang, China), according to the manufacturer's directions.", "Bocaparvoviruses frequently infect animals through the fecal-oral route, causing respiratory and gastrointestinal symptoms in young animals and humans [15] , but are often subclinical in adults [3] . So far, bocaparvoviruses have identified from a variety of vertebrate hosts including humans [8] , cows [4] , pigs [5, 25, 26] , gorillas [10] , chimpanzees [27] , California sea lions [16] , dogs [9, 13, 22, 24] , cats [13, 21, 30, 34] , bats [33] , rats [14] , and pine martens [32] , which suggested that the bocaparvoviruses have a very broad host range.", "Bocavirus belongs to the genus Bocaparvovirus, subfamily Parvovirinae, family Parvoviridae, a small and non-enveloped virus approximately 25 nm in diameter [7] , with a linear single strand DNA genome of approximately 5.4 kb [1, 6] . Bocavirus are unique among Parvoviridae as they contain a third ORF between the non-structural and structural-coding regions [11, 17, 23] . Previously, the genus Bocavirus was originally named according to the initial two members, bovine parvovirus (BPV) and minute virus of canines (MVC) [2, 19, 20, 28, 29] . And now, the genus of bocavirus is reclassified as Bocaparvovirus based on the proposal of Cotmore et al [7] . Currently, the bocaparvoviruses consist of carnivore bocaparvovirus, pinniped bocaparvovirus, primate bocaparvovirus, ungulate bocaparvovirus, and unclassified bocaparvovirus [20] . And the feline bocaviruses belong to carnivore bocaparvovirus 3 and unclassified bocaparvovirus, respectively [20] ." ] },{ "paper_id": "2d1300359d8ec1682b0b6bdb51df4604a7ed4930", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ethical approval was not necessary, because we obtained patients' consent for study before transportation." ] },{ "paper_id": "2d4246494e250c90bb5721a35e2b0a8e20100f20", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Genotypes that have not been described in humans but are isolated from other mammals (e.g., camels) are not considered here. The substitution rate of HEV was estimated between 3 and 5 \u00d7 10 -3 ssy with differences observed between genotypes (Brayne, Dearlove, Lester, Kosakovsky Pond, & Frost, 2017) .", "A provisional phylogenetic tree was constructed (see below), and exceptionally long branches were checked in detail; these were without exception isolates of animal origin, which were subsequently removed. The final datasets contained 134 HAV genomes, 2,542 HCV genomes, and 557 HEV genomes.", "None declared.", "We and Prevotella oralis, a Gram-negative member of the class Bacteroidia.", "TMW designed the study, produced Figures 2-6 , wrote the first draft of the manuscript, and interpreted the data; S-RJ produced and curated the required datasets and produced Figure 1 ; MR advised on software tools for all figures, interpreted the data, and edited the manuscript; DWU ensured funding, advised on all figures, interpreted the data, and edited the manuscript." ] },{ "paper_id": "2d5eaeaa1aa523394ce7697d3cbe98381a2c1559", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Caspase-1 activity was measured using colorimetric assay (BioVision, Mountain View, CA). The assay is based on spectrophotometric detection of the chromophore p-nitroanilide (pNA) after cleavage by caspase-1 from the labeled substrate YVAD-pNA. The pNA light emission can be quantified using ", "Data are expressed as mean AE SD. Statistical comparisons were performed by one-way ANOVA or two-tailed Student t test. Survival rates were analyzed with the Kaplan-Meier test. SPSS16.0 was used for statistical analyses. A P value <0.05 was considered to be statistically significant." ] },{ "paper_id": "2dc628f8092de38b705b1c159ef93a45425f9643", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "How to produce such \"fuzzy vaccines\" is a challenge worth meeting.", "The concepts described here are the product of numerous discussions with my students over many years with whom I have had the privilege to collaborate with. I especially thank Dr. Anna Roitburd-Berman, Dr. Yael Weiss-Ottolenghi and Chen Piller for their critical comments and assistance in making this article possible.", "ARTICLE HISTORY" ] },{ "paper_id": "2def385170922c5786ea00a64f0c139460d23e2c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "sf9 insect cells (Spodoptera frugiperda) (Invitrogen, San Diego, CA) were cultivated as monolayer or suspension in Grace's medium (Invitrogen, USA) supplemented with 10% heat-inactivated fetal bovine serum (Invitrogen, Carlsbad, CA), 1% penicillin/ streptomycine (100U/ml) and 0,1% pluronic F-68 (Invitrogen, USA) and maintained in anaerobic conditions at 27\u00b0C. Cultures in suspension were additionally maintained with constant shaking at 100 rpm. HepG2 cells from ATCC were cultivated in DMEM medium +L-glutamine (Invitrogen, USA) supplemented with FBS and 1% penicillin/streptomycine and maintained at 37\u00b0C with 5% CO2 and 95% humidity.", "Cells and cultures. Axenic HM1: IMSS trophozoites were maintained in TYI-S-33 medium supplemented with 15% of adult bovine serum (Biofluids International Inc., MD, USA) and 3% of Diamond's vitamin mix (JRH Biosciences, Kansas, USA) in anaerobic conditions and incubated at 37\u00b0C . Trophozoites virulence was maintained trough successive passages into hamster\u00b4s liver and recovering trophozoites from the induced ALA.", "Liver histology. Seven days after the challenge, hamsters were sacrificed under anesthesia and the liver excised. General liver damage was recorded by macroscopic features, weight, distribution and size of abscesses. Coronal cuts from whole liver were fixed in 4% formaldehyde-PBS during 24 h, whereas others fragments were included in Tissue Freezing Medium (Leica) and cut in 10 \uf06d for Hematoxylin-Eosin staining.", "Statistical analysis. The comparison of the infection rates between the immunized groups and their respective sham controls was done using Fisher's exact test. The Kruskal-Wallis test was used to compare antibody levels between groups. A P value < 0.05 was considered statistically significant in these analyses. All statistical analyses were performed using SPSS statistical software version 19.0." ] },{ "paper_id": "2dfd4bdcf53215a88599651441351138f99089b6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Aging lung", "The authors report no conflicts of interest in this work.", "Morbidity and mortality " ] },{ "paper_id": "2dfdbf2d6b77426866feaf93486327d372fd27c7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2e16617b3004017c0f1c2fcbb140d70444fee083", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Continuous data were expressed as mean\u00b1standard deviation (SD) and compared using the Mann-Whitney U test. Non-continuous data were expressed as numbers and percentages and were analyzed using the chi-square or Fisher exact test. To evaluated factors associated with a 30-mortality, logistic regression analysis was used. Factors with p-value <0.1 in univariate analysis were entered into multivariate analysis. All data were analyzed using the SPSS software version 18.0 (SPSS Inc., Chicago, IL, USA).", "The aim of this study was to compare the characteristics and clinical outcomes of patients with pulmonary ARDS infected with influenza vs. other respiratory viruses.", "The present study has several limitations. First, this study was conducted at a single center and analyzed data retrospectively, therefore selection bias cannot be excluded. Second, the site obtaining respiratory sample was not the same, therefore, whether respiratory viruses were pathogens cannot be ac-curately distinguished. The miss to detect respiratory viruses by multiplex RT-PCR cannot be ruled out. Third, the change in clinical decision by identifying respiratory viruses was not evaluated as in a previous study 5 . Fourth, the prone position was performed in the low proportion of patients with ARDS compared to a recent study 1 ." ] },{ "paper_id": "2e45740f4d2001e92d14d657feef0191f769cb61", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "NOTE: Data presented as n (%). a Tests performed were cultures of sputum and blood, antigen testing of urine, and PCR analysis of upper airway swabs.", "b Patient reported data." ] },{ "paper_id": "2e85e487853731cc083f75a7b86e7649a7e2272c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "LGTV qPCR primer 5 0 -TGTTCTCCATTGTCGGGTTAG-3 0 IDT N/A", "LGTV qPCR probe 5 0 -/56-FAM/TGAGGTTAA/Zen/ CGTGGCCATGCTCAT/3IABkF-3 0", "Other mRNA LNP vaccines (POWV and controls) Moderna (current paper) N/A (Invitrogen). Vero cells were passaged in DMEM supplemented with 5% FBS and 100 U/mL P/S. Raji B lymphoblast cells stably expressing the C-type lectin DC-SIGNR (Raji-DCSIGNR) were cultured in RPMI 1640 medium (Invitrogen) supplemented with 7% FBS and 100 U/mL P/S." ] },{ "paper_id": "2e8fcc213e690efe461306e2bc37eec6c4151315", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2ea1b31d8e9b2d8e4f980c0fd269f75dad4d1d75", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Implementation project leaders tend to prefer voluntary, intrinsic motivation-focused strategies (26) . For example, supportive strategies such as reminders, decision support, and rewards were mostly effective. Moreover, combined strategies were recognized as more effective than were single strategies (27) .", "Our participants' intentions were positive in terms of willingness, perceived importance, realistic insight, and belief that hand hygiene will save lives.", "Data were entered into SPSS v.20 by a professional data entry clerk and revised and cleaned by another clerk. The data were then analyzed using IBM SPSS software (v.20). Categorical variables were described using frequency and percentages. Continuous variables were summarized using mean9standard deviation. Chi-square test was used for comparing proportions. Student t-test/ANOVA was used for comparing means. Statistical significance was set to 0.05 or less and a confidence interval of 95%.", "Although the English language is the official language of communication in the work environment in KAMC, English is a second language to most HCWs, and this might affect how participants responded to the survey tool. We did not identify any language barriers during the pilot testing of the data collection tool." ] },{ "paper_id": "2ea88246c467b56b00c2a792dbf3120299a624c7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2ead29b6cd37834fcfae2fcd41acbffc821f85ae", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "One can take the examples of epidemics of Middle East Respiratory Syndrome Coronavirus -MersCov-and Ebola, for which no secondary case has been reported in France.", "Thus, there is little evidence to support the theories by which migrants would expose the host population to significant infectious risk. However, human diseases acquire a social status based on their perceived risk that determines their acceptability (31) .", "The WHO established a Department of Pandemic and Epidemic Diseases in 2011 to better prepare for and respond to EIDs.", "The risk of emerging infections such as dengue in a risk zone was estimated at 1% for one month of travel (7)." ] },{ "paper_id": "2eefde0ef2d54748b892970703c15b798192274e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In recent years influenza viruses have circulated in seasonal (H3N2, H1N1) and avian (including H5N1) forms. There has been concern that Influenza A (H5N1), a worldwide cause of large poultry outbreaks, which by December 2009 had affected 467 persons (282 deaths), would drift or shift to become the next pandemic strain [1] . However in April 2009 'Swine flu' caused by a new strain of influenza A, Pandemic (H1N1) 2009 emerged.", "This has now become the dominant strain producing an illness that is transmitted in the same way as seasonal influen-", "This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited. za, which in most cases is mild, which can be effectively treated with antiviral drugs and for which a vaccine is now available. By the end of 2009 many countries were still reporting disease activity and an impact on health-care services [2] .", "Stories about the new H1N1 case in town appeared daily and reflected public anxiety. The media can play an important role in allaying the fears of the community by providing adequate and accurate information. The installation of thermal scanners at points of entry has their limitations, and is not recommended by the WHO. Studies indicate many of its drawbacks, including a low positive predictive value of 3.5% [2] .", "Generally it will not be appropriate to conduct contact tracing of patients or to provide anti-viral prophylaxis. However if there has been a particular type of contact between a healthcare worker and a patient (for example intubation) or a patient is at high risk of severe or complicated infection, then further risk assessment is indicated with a view to offering prophylaxis. An alternative approach, if practical, is to monitor exposed persons and administer antiviral treatment when symptoms develop. When a vaccine becomes available the first priority should be to immunize healthcare staff." ] },{ "paper_id": "2ef7ce66fc8445aa7bfabc121193e2ae0091fecb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2f45403508d925c6fd337bd53f0842e1340a6fcd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "2ff89400f9bff213ae066c12daa59d5a40fa6257", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Creatine kinase (normal range 24-173 IU/L) and aldolase (1.0-7.5 IU/L) were determined using an automated kinetic assay. Leukocyte count, lactate dehydrogenase, alanine aminotransferase and aspartate aminotransferase were also assessed. The erythrocyte sedimentation rate and C-reactive protein levels were evaluated using the Westergren and nephelometry methods, respectively. Autoantibodies against cellular components were determined with indirect immunofluorescence using Hep-2 cells as the substrate. Autoantibody anti-Jo-1 was determined using the Western blotting method.", "This study was partially supported by the Federico Foundation.", "Constitutional symptoms, skin changes (e.g., heliotrope, Gottron's papules, ulcers, photosensitive, calcinosis, and vasculitis), joint involvement (arthralgia and/or arthritis), and gastrointestinal (dysphagia) and respiratory (dyspnea on moderate exertion) manifestations were analyzed.", "All of the HZ patients initially received intravenous acyclovir (30 mg/kg/day)." ] },{ "paper_id": "2ffacfd58f57a95344119c15d27560cdeaea2285", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cell culture, transfection, and RNAi HeLa cells were grown in DMEM (Invitrogen) supplemented with 10% FBS. To examine localization of GFP-or mCherry tagged proteins, cells were plated on glass coverslips in a 24-well plate at \ue07a80% confluency and transfected using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Each transfection contained 400 ng of DNA. Transfected cells were examined 24 h after transfection. For esiRNA experiments, cells were seeded at 50% confluency and transfected using 10 nM of each esiRNA and Lipofectamine RNAiMAX (Invitrogen). Cells were examined 48-72 h after transfection. For RNAi rescue experiments, cells were transfected with esiRNA, incubated for \ue07a36 h until cells had reached \ue07a80% confluency, then transfected with mCherry-Sec61\ue062 and various GFP-tagged EndoU constructs. For siRNA experiments, cells were seeded at 50% confluency and transfected with 5 nM siRNA using Lipofectamine RNAiMAX (Invitrogen). Cells were examined 72 h after transfection.", "Monitoring rate of replication and nuclear envelope formation in CSF extract CSF extracts were depleted of XendoU or control IgG, and Cy5-dCTP (GE Healthcare) was added to extracts at a concentration of 1 \u00b5M. Samples", "Abbreviations used in this paper: CSF, cytostatic factor; esiRNA, endoribonucleaseprepared siRNA; rRNA, ribosomal RNA; snoRNA, small nucleolar RNA; wlm, washed light membrane.", "The resulting reads were reduced to unique reads (we assumed that all perfectly matching reads were the result of PCR duplication) using a custom Perl script. Reads were the aligned to the X. laevis rRNA precursor (gi|65056, gi|64487, gi|65094, gi|65095) using Bowtie (Langmead et al., 2009) . Reads aligning to X. laevis rRNA were subtracted using a custom Perl script. The remaining reads were aligned to a draft assembly of the X. laevis genome (7.0 downloaded from Xenbase, June 2013) using tophat2. Reads aligning to transcripts were counted using Cufflinks." ] },{ "paper_id": "2ffddf5caaef38207b58710a93ee8361518813c9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3041dc5ba951755241ae7e75ade271188033d4de", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "BFA was isolated in crystalline form from FL-24 fungi (Tamura et al., 1968 ", "First, the effect of various glycosidases that do not affect the" ] },{ "paper_id": "304397b339265e6096999d27e83cefb84842e8f2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3061f05203159384dfbb2fd9b1d9a1ca7b98c8a6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "One of the limitations of this plan was the lack of an integrated national structure for recording information and lessons learned from events and crises, resulted in some information being inaccessible.", "Most of the residential structures in the rural areas and the cities of Varzaghan, Ahar, and Herris were mortar and mud or masonry material buildings. The largest casualty in this earthquake was caused by the destruction of mud, mortar or brick rural buildings that simplest technical criteria had not been considered, and non-structural parts such as walls and false ceilings had severe damage. Geological features of the earthquake, the facilities of the area and damage to humans are summarized in Table 1 .", "The following criteria have been used for comparison of earthquakes: The first criterion is the comparison of seismology, geotechnical and texture data; the second criterion is the magnitude of the human damage caused by 3 earthquakes; the third criterion: the notification process and rapid warning system of the medical emergency services system; the fourth criterion: the coordination and pre-hospital Emergency system's surge capacity program; the fifth criterion: distribution system and transfer of patients and injured." ] },{ "paper_id": "3062cebd70447841d68c48fe83f0eb51b07a761d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "DCs were cultured as described elsewhere [21] . Human CD14 1 monocytes were cultured in RPMI 1640 with 20 ng/mL rhuGM-CSF (First Link) and 25 ng/mL rhuIL-4 (eBioscience). The appropriate phenotype of immature DC (ie, lacking CD14 1 but expressing major histocompatibility complex class I and class II and DC-SIGN) was confirmed.", "DENV supernatant was precleared with protein A-agarose for one h at 4\u00b0C. Bead-free supernatant was incubated with 10 lg of 4G2 at 4\u00b0C for 2 h followed by protein A-agarose for 1 h. The beads were washed with .05% Tween/PBS 3 times and eluted with nonreducing loading buffer. The sample was run on nonreducing 10% Sodium dodecyl sulfate (SDS) polyacryramide gels and electroblotted onto nitrocellulose membrane (Amersham). Glycan types on DENV proteins were determined using the DIG Glycan Differentiation Kit (Roche).", "The pcDNA3-LL-SIGN plasmids expressing 7 (N7) and 5 (N5) tandem neck region repeats or a mixture of N7 and N5 plasmids (ratio 1:1) were transfected into 293T cells using the Fugene6 (Roche). L-SIGN expression was verified with L-SIGN-specific antibody (clone 120604, R&D Systems).", "The global prevalence of the dengue virus (DENV) has grown dramatically in recent decades, and it is now endemic in .100 countries, with some 2.5 billion people at risk of infection. Dengue is an arthropod-borne flavivirus that can be subdivided into the 4 major serotypes (DEN-1-DEN-4). Most dengue infections either are asymptomatic or lead to a self-limiting febrile illness, dengue fever. In some cases the illness is more severe, leading to dengue hemorrhagic fever (DHF) with severe plasma leakage and bleeding that can be life threatening." ] },{ "paper_id": "3062fc222bccc8c520612d9d6c9b91f048be12b8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "30c0e6db2173676aae3b5a5fcdf9243903c536c1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study is a cross-sectional study conducted at the Prince Mohammed International Airport in Al-Madinah Al-Munawwarah, Saudi Arabia between August and September 2014. Data were collected by semistructured questionnaires during personal interviews. Non-random purposive sampling was conducted to target workers at higher risk of acquiring infection from travellers.", "\u202b\u0628\u0646\u202c \u202b\u0645\u062d\u0645\u062f\u202c \u202b\u0627\u0623\u0644\u0645\u064a\u0631\u202c \u202b\u0645\u0637\u0627\u0631\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u0648\u0633\u0644\u0648\u0643\u202c \u202b\u0645\u0639\u0631\u0641\u0629\u202c \u202b\u062a\u0642\u064a\u064a\u0645\u202c \u202b\u0627\u0623\u0644\u0647\u062f\u0627\u0641:\u202c \u202b\u062e\u0627\u0644\u0644\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631\u202c \u202b\u0627\u0645\u0644\u0646\u0641\u0630\u0629\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0629\u202c \u202b\u0627\u0644\u0635\u062d\u0629\u202c \u202b\u0648\u0637\u0648\u0627\u0631\u0626\u202c \u202b\u0622\u0644\u064a\u0627\u062a\u202c \u202b\u0639\u0646\u202c \u202b\u0627\u0644\u062f\u0648\u0644\u064a\u202c \u202b\u0639\u0628\u062f\u0627\u0644\u0639\u0632\u064a\u0632\u202c \u202b4102\u0645.\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u202c \u202b\u062d\u062c\u202c \u202b\u0645\u0648\u0633\u0645\u202c \u202b\u0628\u0646\u202c \u202b\u0645\u062d\u0645\u062f\u202c \u202b\u0627\u0623\u0644\u0645\u064a\u0631\u202c \u202b\u0645\u0637\u0627\u0631\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0627\u0644\u0633\u062a\u0637\u0627\u0644\u0639\u064a\u0629\u202c \u202b\u0627\u0644\u062f\u0631\u0627\u0633\u0629\u202c \u202b\u0647\u0630\u0647\u202c \u202b\u062c\u0631\u064a\u062a\u202c \u064f \u202b\u0623\u202c \u202b\u0627\u0644\u0637\u0631\u064a\u0642\u0629:\u202c \u202b\u0623\u062b\u0646\u0627\u0621\u202c \u202b\u0648\u0630\u0644\u0643\u202c \u202b\u0627\u0644\u0633\u0639\u0648\u062f\u064a\u0629\u202c \u202b\u0627\u0644\u0639\u0631\u0628\u064a\u0629\u202c \u202b\u0627\u0645\u0644\u0645\u0644\u0643\u0629\u202c \u202b\u0627\u0645\u0644\u0646\u0648\u0631\u0629\u060c\u202c \u202b\u0627\u0645\u0644\u062f\u064a\u0646\u0629\u202c \u202b\u0627\u0644\u062f\u0648\u0644\u064a\u060c\u202c \u202b\u0639\u0628\u062f\u0627\u0644\u0639\u0632\u064a\u0632\u202c \u202b\u062c\u0645\u0639\u202c \u202b\u0645\u062a\u202c \u202b\u0644\u0642\u062f\u202c \u202b4102\u0645.\u202c \u202b\u0633\u0628\u062a\u0645\u0628\u0631\u202c \u202b\u0625\u0644\u0649\u202c \u202b\u0623\u063a\u0633\u0637\u0633\u202c \u202b\u0645\u0646\u202c \u202b\u0627\u0644\u0641\u062a\u0631\u0629\u202c \u202b\u062e\u0627\u0644\u0644\u202c \u202b\u0627\u062d\u0644\u062c\u202c \u202b\u0645\u0648\u0633\u0645\u202c \u202b\u0648\u0642\u062f\u202c \u202b\u0627\u0644\u0634\u062e\u0635\u064a\u0629.\u202c \u202b\u0628\u0627\u0645\u0644\u0642\u0627\u0628\u0627\u0644\u062a\u202c \u202b\u0627\u0644\u0642\u064a\u0627\u0645\u202c \u202b\u0623\u062b\u0646\u0627\u0621\u202c \u202b\u0627\u0633\u062a\u0628\u064a\u0627\u0646\u202c \u202b\u0645\u0623\u0644\u202c \u202b\u0637\u0631\u064a\u0642\u202c \u202b\u0639\u0646\u202c \u202b\u0627\u0644\u0628\u064a\u0627\u0646\u0627\u062a\u202c \u202b\u0627\u062d\u062a\u0643\u0627\u0643\u202c \u202b\u0644\u0647\u0645\u202c \u202b\u0623\u0634\u062e\u0627\u0635\u202c \u202b\u0645\u0642\u0627\u0628\u0644\u0629\u202c \u202b\u0625\u0644\u0649\u202c \u202b\u0639\u0634\u0648\u0627\u0626\u064a\u202c \u202b\u0627\u0644\u063a\u064a\u0631\u202c \u202b\u0627\u0644\u0639\u064a\u0646\u0627\u062a\u202c \u202b\u0627\u062e\u062a\u064a\u0627\u0631\u202c \u202b\u0647\u062f\u0641\u202c \u202b\u0623\u0643\u062b\u0631\u202c \u202b\u0627\u0645\u0644\u0633\u0627\u0641\u0631\u064a\u0646\u202c \u202b\u0645\u0646\u202c \u202b\u0627\u0644\u0639\u062f\u0648\u0649\u202c \u202b\u0627\u0646\u062a\u0642\u0627\u0644\u202c \u202b\u062e\u0644\u0637\u0631\u202c \u202b\u0627\u0645\u0644\u0639\u0631\u0636\u0646\u064a\u202c \u202b\u0648\u0623\u0648\u0644\u0626\u0643\u202c \u202b\u0628\u0627\u0645\u0644\u0633\u0627\u0641\u0631\u064a\u0646\u060c\u202c \u202b\u0645\u0628\u0627\u0634\u0631\u202c \u202b\u063a\u064a\u0631\u0647\u0645.\u202c \u202b\u0645\u0646\u202c \u202b\u0627\u0644\u0630\u0643\u0648\u0631\u202c \u202b\u0627\u0645\u0644\u0634\u0627\u0631\u0643\u0646\u064a\u202c \u202b\u0646\u0633\u0628\u0629\u202c \u202b\u0628\u0644\u063a\u062a\u202c \u202b\u0648\u0642\u062f\u202c \u060c\u064b \u202b\u0634\u062e\u0635\u0627\u202c 186 \u202b\u0627\u0644\u062f\u0631\u0627\u0633\u0629\u202c \u202b\u0634\u0645\u0644\u062a\u202c \u202b\u0627\u0644\u0646\u062a\u0627\u0626\u062c:\u202c \u202b\u0645\u062e\u062a\u0644\u0641\u0629\u202c \u202b\u0642\u0637\u0627\u0639\u0627\u062a\u202c 8 \u202b\u0641\u064a\u202c \u202b\u064a\u0639\u0645\u0644\u0648\u0646\u202c \u202b\u0627\u0644\u0628\u062d\u062b\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0645\u0644\u0634\u0627\u0631\u0643\u0646\u064a\u202c \u202b\u0643\u0627\u0646\u202c \u202b\u0648\u0644\u0642\u062f\u202c .92.5% \u202b\u0627\u0644\u0642\u0637\u0627\u0639\u202c \u202b\u0625\u0644\u0649\u202c \u202b\u064a\u0646\u062a\u0645\u0648\u0646\u202c \u202b\u0627\u0644\u0628\u062d\u062b\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0645\u0644\u0634\u0627\u0631\u0643\u0646\u064a\u202c \u202b\u0645\u0646\u202c 26% \u202b\u0643\u0627\u0646\u202c \u202b\u062d\u064a\u062b\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631\u060c\u202c \u202b\u0623\u0643\u062b\u0631\u202c \u202b\u0635\u062d\u064a\u0629\u202c \u202b\u0627\u0644\u063a\u064a\u0631\u202c \u202b\u0628\u0627\u0644\u0642\u0637\u0627\u0639\u0627\u062a\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0648\u0646\u202c \u202b\u0643\u0627\u0646\u202c \u202b\u0648\u0644\u0642\u062f\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631.\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u202c \u202b\u0627\u0644\u0635\u062d\u064a\u202c \u202b\u0628\u0627\u0645\u0644\u0642\u0627\u0631\u0646\u0629\u202c \u202b\u0648\u0630\u0644\u0643\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631\u202c \u202b\u0639\u0645\u0644\u0647\u0645\u202c \u202b\u0623\u062b\u0646\u0627\u0621\u202c \u202b\u0628\u0627\u0644\u0639\u062f\u0648\u0649\u202c \u202b\u0627\u0635\u0627\u0628\u062a\u0647\u0645\u202c \u202b\u0627\u062d\u062a\u0645\u0627\u0644\u064a\u0629\u202c \u202b\u0645\u0646\u202c \u064b \u202b\u0642\u0644\u0642\u0627\u202c \u202b\u0627\u0645\u0644\u0639\u062f\u064a\u0629\u202c \u202b\u0627\u0623\u0644\u0645\u0631\u0627\u0636\u202c \u202b\u0623\u0643\u062b\u0631\u202c \u202b\u0648\u0643\u0627\u0646\u062a\u202c .)p=0.023( \u202b\u0627\u0644\u0635\u062d\u064a\u202c \u202b\u0628\u0627\u0644\u0642\u0637\u0627\u0639\u202c \u202b\u0628\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u0628\u0644\u063a\u062a\u202c \u202b\u062d\u064a\u062b\u202c \u202b\u0627\u0644\u0641\u064a\u0631\u0648\u0633\u064a\u202c \u202b\u0627\u0625\u0644\u064a\u0628\u0648\u0627\u0644\u202c \u202b\u0645\u0631\u0636\u202c \u202b\u0627\u062d\u0644\u062c\u202c \u202b\u0645\u0648\u0633\u0645\u202c \u202b\u0623\u062b\u0646\u0627\u0621\u202c \u202b\u0644\u0644\u0645\u062e\u0627\u0648\u0641\u202c \u202b\u0627\u0645\u0644\u062b\u064a\u0631\u0629\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u0645\u0646\u202c 30% \u202b\u0628\u0627\u0644\u0639\u062f\u0648\u0649\u202c \u202b\u0625\u0635\u0627\u0628\u062a\u0647\u0645\u202c \u202b\u0645\u0646\u202c \u202b\u0627\u0644\u0642\u0644\u0642\u0646\u064a\u202c \u202b\u0627\u0623\u0644\u0634\u062e\u0627\u0635\u202c \u202b\u0646\u0633\u0628\u0629\u202c \u202b\u0623\u0628\u062f\u0649\u202c \u202b\u0648\u0644\u0642\u062f\u202c \u202b\u0627\u0623\u0644\u062e\u0631\u0649.\u202c \u202b\u0627\u0644\u0642\u0637\u0627\u0639\u0627\u062a\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u0645\u0646\u202c \u202b\u0648%74\u202c \u202b\u0627\u0644\u0635\u062d\u064a\u060c\u202c \u202b\u0627\u0644\u0642\u0637\u0627\u0639\u202c \u202b\u0645\u0639\u0631\u0641\u062a\u0647\u0645\u202c \u202b\u0639\u062f\u0645\u202c \u202b\u0627\u0644\u0635\u062d\u064a\u202c \u202b\u0628\u0627\u0644\u0642\u0637\u0627\u0639\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u0627\u0644\u063a\u064a\u0631\u202c \u202b\u0627\u0623\u0644\u0634\u062e\u0627\u0635\u202c \u202b\u0645\u0646\u202c 47% \u202b\u062d\u0648\u0627\u0644\u064a\u202c \u202b\u0646\u0633\u0628\u0629\u202c \u202b\u0648\u0643\u0627\u0646\u062a\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631.\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0629\u202c \u202b\u0627\u0644\u0635\u062d\u0629\u202c \u202b\u0637\u0648\u0627\u0631\u0626\u202c \u202b\u062d\u0627\u0627\u0644\u062a\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0645\u0644\u062a\u0628\u0639\u0629\u202c \u202b\u0628\u0627\u0622\u0644\u0644\u064a\u0627\u062a\u202c \u202b\u0627\u0644\u0642\u0637\u0627\u0639\u0627\u062a\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0629\u202c \u202b\u0627\u0644\u0635\u062d\u0629\u202c \u202b\u0628\u0637\u0648\u0627\u0631\u0626\u202c \u064b \u202b\u0645\u062a\u0639\u0644\u0642\u0627\u202c \u064b \u202b\u062a\u062f\u0631\u064a\u0628\u0627\u202c \u202b\u062a\u0644\u0642\u0648\u0627\u202c \u202b\u0627\u0644\u0630\u064a\u0646\u202c \u202b\u0627\u0623\u0644\u0634\u062e\u0627\u0635\u202c \u202b\u0627\u0623\u0644\u0634\u062e\u0627\u0635\u202c \u202b\u0646\u0633\u0628\u0629\u202c \u202b\u0639\u0646\u202c \u202b\u0627\u0625\u0644\u062d\u0635\u0627\u0626\u064a\u0629\u202c \u202b\u0627\u0644\u0646\u0627\u062d\u064a\u0629\u202c \u202b\u0645\u0646\u202c \u202b\u0648\u0627\u0636\u062d\u0629\u202c \u202b\u0628\u0635\u0648\u0631\u0629\u202c \u202b\u0623\u0642\u0644\u202c \u202b\u0635\u062d\u064a\u0629\u202c \u202b\u0627\u0644\u063a\u064a\u0631\u202c .)p<0.00001( \u202b\u0627\u0644\u0635\u062d\u064a\u202c \u202b\u0627\u0644\u0642\u0637\u0627\u0639\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0644\u062a\u062f\u0631\u064a\u0628\u202c \u202b\u0630\u0644\u0643\u202c \u202b\u062a\u0644\u0642\u0648\u0627\u202c \u202b\u0627\u0644\u0630\u064a\u0646\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u0648\u062a\u062f\u0631\u064a\u0628\u202c \u202b\u062a\u062b\u0642\u064a\u0641\u202c \u202b\u0639\u0644\u0649\u202c \u202b\u0627\u0644\u062a\u0631\u0643\u064a\u0632\u202c \u202b\u064a\u0646\u0628\u063a\u064a\u202c \u202b\u0628\u0623\u0646\u0647\u202c \u202b\u0627\u0644\u062f\u0631\u0627\u0633\u0629\u202c \u202b\u0623\u0638\u0647\u0631\u062a\u202c \u202b\u0627\u062e\u0644\u0627\u0645\u062a\u0629:\u202c \u202b\u0643\u0645\u0627\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631.\u202c \u202b\u0639\u0645\u0644\u0647\u0645\u202c \u202b\u0623\u062b\u0646\u0627\u0621\u202c \u202b\u0627\u062d\u0645\u0644\u062a\u0645\u0644\u0629\u202c \u202b\u0627\u0644\u0635\u062d\u064a\u0629\u202c \u202b\u0627\u0645\u0644\u062e\u0627\u0637\u0631\u202c \u202b\u0645\u0639\u0631\u0641\u0629\u202c \u202b\u0639\u0644\u0649\u202c \u202b\u0628\u0627\u0645\u0644\u0637\u0627\u0631\u202c \u202b\u0627\u0644\u0635\u062d\u0629\u202c \u202b\u0628\u0637\u0648\u0627\u0631\u0626\u202c \u202b\u0627\u0644\u0639\u0627\u0644\u0642\u0629\u202c \u202b\u0630\u0627\u062a\u202c \u202b\u0627\u0644\u062a\u0639\u0644\u064a\u0645\u0627\u062a\u202c \u202b\u0644\u0646\u0634\u0631\u202c \u202b\u0622\u0644\u064a\u0629\u202c \u202b\u0628\u062a\u0641\u0639\u064a\u0644\u202c \u202b\u0627\u0644\u0628\u062f\u0621\u202c \u202b\u0648\u064a\u0646\u0628\u063a\u064a\u202c \u202b\u0627\u0645\u0644\u0637\u0627\u0631.\u202c \u202b\u0642\u0637\u0627\u0639\u0627\u062a\u202c \u202b\u0643\u0644\u202c \u202b\u0641\u064a\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0644\u0646\u064a\u202c \u202b\u062c\u0645\u064a\u0639\u202c \u202b\u0639\u0644\u0649\u202c \u202b\u0627\u0644\u0639\u0627\u0645\u0629\u202c Objectives: To evaluate the knowledge and behavior of workers at a Saudi airport regarding public health emergency measures applied during Hajj season.", "Data collection. Data were collected using a semistructured questionnaire. The questionnaire was constructed by a focus group including 4 consultants from the community and family medicine. Closedended and open-ended questions were utilized, including questions measuring demographics, level of knowledge, practice and attitude relating to public health preventive measures at points of entry. The questionnaire was constructed in Arabic language. The questionnaire was piloted on 20 individuals )10 males and 10 females( and additional questions and choices were conducted according to the piloting findings. All questionnaires were filled out during personal interviews. All interviews were conducted by 3 trained interviewers. There was no audio recording of conducted interviews. However, notes of the open-ended responses were taken during the interviews and were transcribed by the interviewers." ] },{ "paper_id": "30d2d2d37c2a884db55ab21d1cbd92abcff95fa2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data are reported as means \u00b1 SD. The differences were evaluated by a two-tailed Student t-test (2 groups) or one-way analysis of variance (ANOVA) followed by the Tukey post hoc test (3 or more groups) using the SPSS software (version 9.0, USA) (27) . Statistical significance was set at P < 0.05.", "Newborn Sprague-Dawley rats (18-20 g) were supplied by the Animal Center of Guangzhou Medical University. Rats were housed and used in accordance with our institutional guidelines for animal care and the Guide for Animal Care of the National Institutes of Health. Dulbecco's modified Eagle's medium (DMEM), fetal bovine serum (FBS), and TRIzol were purchased from Gibco BRL (USA). Trypsin was obtained from Amersco (USA). Alpha-sarcomeric actin was purchased from Santa Cruz Biotechnology (USA). The SYBR \u00ae GreenPCR Master Mix was obtained from Applied Biosystems (USA). The Thermo ScriptRT-PCR kit was purchased from Invitrogen (USA). [ 3 H]-leucine (Leu) was obtained from the China Institute of Atomic Energy (China) and recombinant Ang II and HGF were purchased from Sigma (Germany).", "The cardiomyocyte medium was changed to serum-free DMEM for 24 h. The cardiomyocytes were then treated with different concentrations of Ang II (0.01-10 \u00b5M) and HGF (1, 10, 100 ng/mL) for 48 h in order to explore the most appropriate concentrations of each factor." ] },{ "paper_id": "30f5bfe5ca79c2e25e5dca95d8dfe473b780a51a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Interestingly, in a previous study [10] , hexon-modified virus with incorporation of the His 6 peptide into HVR8 was reported to be viable. Our result with HVR8 is contradictory, evidently due to the differences in the peptides sequences and their lengths. Further, while the two studies are made with changes within HVR8, the specific locations of the incorporations differ as well. Notably our study uses a foreign sequence inserted between Asn437 and Gly438 ( Fig. 1) , while Wu et al. [10] placed His 6 between Pro431 and Trp439 substituting for 7 aa residues of hexon.", "The virus was amplified by passaging in HEK 293 cells and purified by CsCl gradient centrifugation [23] . The concentration of virus particles (VP) in purified virus preparations was determined by measuring the optical density at 260 nm as previously described [24] , whereas numbers of infectious particles (IP) were determined by the tissue culture infective dose 50 (TCID 50 ) method [25] . ", "Human adenovirus type 5 (hAd5) vector has been shown to be an excellent vaccine delivery system in humans and animals [1, 2] . The replication-defective (E1-deleted) and replication-competent (E3-deleted) hAd5 have both been used as vaccine delivery vectors. For biosafety concerns, a replication-defective hAd5 is considered to be more suitable for vaccination. Replication-defective vectors may also have deletion in the E3 region to increase the amount of foreign DNA that can be inserted. Conventional strategy for the expression of a vaccine antigen by adenoviral vector includes insertion of the foreign gene expression cassette into the E1 region. This antigen is expressed as transgene after the infection of permissive cells with recombinant adenovirus." ] },{ "paper_id": "30fd1c06ba7ba3777ee5a348dfc0ee8343f4fdb2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.", "The author(s) received no financial support for the research, authorship, and/or publication of this article.", "SARI surveillance started in Yemen in October 2010 by establishing 2 sentinel surveillance sites: one site at Al Jumhory General Tertiary Hospital located in Sana'a city (2 500 000 population) and another site at Al Wahdah Pediatric Tertiary Hospital located in Aden city (921 809 population)." ] },{ "paper_id": "310e6155d1d7856c824b0304dea2ca5ec637c2bf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "actin polymerization and phagosome formation in addition to disrupting membrane trafficking in macrophages (5) ." ] },{ "paper_id": "31390ea0f2fc73d3cd3fee80ca0de765ddd68429", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "On our study HRSV outbreaks presented defined seasonality, occurring in winter, early spring and late autumn periods, being these data similar to previous obtained results (3, 22, 27 Knowledge about HMPV seasonality is limited in Brazil.", "Knowledge of the trends and seasonality of respiratory viral infections in the community could be a first step to confer information for health care providers, to facilitate the implementation of strategies to prevent and minimize transmission, and also introduce early therapeutic options to high risk patients (13) ." ] },{ "paper_id": "314f4b76581376bc7b40e69a9f0bc9153298cb8e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "317f324d1116fd3d2d4933450d87528207846e36", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "319004f23d1af4357edb2a3862f2619be23a21a6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "319017db7033f2754fd403feb01c1fa2b26f38cc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "319b8c97174d684a0e0f50dff4ecfdab294d2a05", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Pearson's Chi-squared test with Yates' continuity correction was applied to infer non-casual distributions of categorical variables. All statistical analyses were performed using R software, setting the significance level to P < 0.05." ] },{ "paper_id": "31db09417c093cb1d87d4dfbbc2bef73716194e7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study is restricted in that it involved a limited number of patients, and more importantly, this is a retrospective and non-comparative study targeting high-risk patients, for which the conditions for establishing a control group were not favorable.", "\u2212 12 \u2212 ", "No potential conflicts of interest relevant to this article are reported." ] },{ "paper_id": "3230a822ceaf337c5137d32e1505878910621991", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Flu, HRV, PIV 1, PIV 3, PIV 4, ADV and HCoV (except SARS-CoV) usually cause upper respiratory tract infections (URTI), whereas RSV, hMPV and PIV 2 have been frequently associated to lower respiratory tract infections (LRTI) [18] .", "Overall, viral diagnosis in outpatients with mild ARI is not probably cost-effective, and should not be routinely performed, except for studies from surveillance programs or of epidemiological interest.", "Other parameters have to be considered for the purification of RV genomes. The extractor must be versatile so that it allows extraction from a wide range of respiratory samples and from variable sample volume. Indeed, lysis buffer must be provided independently by the manufacturer to inactivate respiratory specimens in biosafety cabinets if samples are fed in open containers into the instrument.", "These instrument purify viral DNA and RNA from a broad range of respiratory samples (nasopharyngeal aspirates and swabs, sputum, bronchoalveolar lavages,\u2026). Contaminations are reduced since the system is closed, which avoids splashing and generation of aerosols and drops. Many of these systems include ready-to-run, prefilled cartridges with all reagents required for the purification procedure. Setup is rapid and saves time. Commercial assays for the simultaneous processing of a maximum of 8 up to 96 samples are available.", "Luminex xTAG \u00ae RVP was the first panel that received the FDA approval. The version RVP Fast has shortened the initial time of 8-10 h required to accomplish the whole procedure. The RVP Fast assay incorporates multiplex RT-PCR using primers with universal tags. The amplified product is hybridized to a bead array conjugated to specific probes. Detection is performed using a streptavidin-Rphycoerythrin conjugate. Each bead population detects a unique viral target by hybridisation to a specific anti-tag. A signal (median fluorescence intensity) is generated for each bead population [40] . These fluorescence values are analyzed by using xTAG \u00ae data analysis software for RVP Fast (TDAS RVP Fast) to establish the presence or absence of viral targets in each sample. A recent version of the xTAG RVP Fast panel (RVP v2) is CE marked and identifies 19 viral types and subtypes, which now includes Flu A(H1N1)pdm09." ] },{ "paper_id": "32412ffe52eb41da8ecfed314b703c49fd041f5c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3290019883fad88c1c40279e2783a739dc7363fa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "32b8b12a0247b3413442631d5a1bee05a4e5d689", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ABBREVIATIONS: ARDS = acute respiratory distress syndrome; BLA = biologics license application; EMR = electronic medical record; IT = information technology; PR = pathogen reduction; SDP(s) = single-donor platelet(s); TA-GVHD = transfusionassociated graft-versus-host disease.", "As the administrative notifications and discussions progressed, we met with physicians caring for both low-and high-risk/-acuity patients (Fig. 1) . The latter represented the patient groups considered the most vulnerable to adverse events of any sort and included stem cell transplant/oncology patients, solid organ transplant candidates/patients, patients admitted to intensive care units (including the neurologic, surgical, medical, and cardiothoracic units), the emergency department, obstetrics, pediatrics (including neonatal and pediatric intensive care units), and geriatric services. Nursing staff and business associates (formerly ward clerks) were also involved in these discussions.", "In this article, we explain the steps and ramp-up strategies we employed to implement PR PLTs on an institutionwide basis. We also address what we believe are some key factors others may wish to consider as they investigate the process of converting to an all PR PLT inventory." ] },{ "paper_id": "32d98992b213139fc36d2ff05af879b112e230f6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u2022 Coronavirus can cause severe immune thrombocytopenic purpura (ITP). \u2022 Intracerebral haemorrhage is an uncommon presentation of ITP. \u2022 Intravenous immunoglobulin and steroids are very effective treatments for severe ITP.", "Immune thrombocytopenic purpura (ITP) is an autoimmune disorder that causes isolated thrombocytopenia. Many viruses have been identified as triggering the autoimmune process, including HIV, MCV, EBV, parvovirus, rubella and measles. However, ITP in association with coronavirus infection has not previously been reported. We describe the case of a healthy man who presented with severe ITP complicated by intracranial haemorrhage following upper respiratory tract infection. An infection screen revealed coronavirus infection.", "Coronavirus is not a well-known cause of immune thrombocytopenia even though it may possibly cause severe ITP. Therefore, a respiratory viral panel test should be used in the initial assessment of a patient with immune thrombocytopenia." ] },{ "paper_id": "32f0f51772fb98f4cdf1a9c3ba578b86e75d79cc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "the digestive system) and replenish ''qi'' to remove ''heat'' and toxic substances, to moisturize the lungs and arrest coughing and to relieve spasms and pain' (2) . In addition, it is widely used as a flavoring adjuvant in drug preparations and an ingredient of cigarettes for its taste and property to reduce irritation (2, 3) .", "Arsenic is present in both pentavalent arsenate and trivalent arsenite. Trivalent arsenite is known to be more toxic than pentavalent arsenate (19, 20) .", "One way analysis of variance (ANOVA) procedures were used to assess significant differences among the treatment groups. For each significant effect of treatment, the Tukey test was used for comparisons of multiple group means. The criterion for statistical significance was set at P50.05 or P50.01." ] },{ "paper_id": "33842ff07428db8111b5c1aa9421d7272f523602", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "33bf14aff364a7ce589e97d8021006f940b1f899", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "T his letter addresses some concerns about two recent articles published by the same authors in mBio (1, 2), specifically many uncertainties regarding the potential applicability of their epidemiological data, which were obtained from dromedary camels (DCs) infected with Middle East respiratory syndrome coronavirus (MERS-CoV), to human public health.", "T his letter addresses some concerns about two recent articles published by the same authors in mBio (1, 2) , specifically many uncertainties regarding the potential applicability of their epidemiological data, which were obtained from dromedary camels (DCs) infected with Middle East respiratory syndrome coronavirus (MERS-CoV), to human public health." ] },{ "paper_id": "3424dfd56dfdf957d0fca5e02da73f1352b84ca0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The process of leukocyte adhesion to endothelial cells is the first critical step in neutrophil migration into an area of inflammation.", "C5a-mediated release of histones Histones are essential regulators of genome function in eukaryotic cells. The NS1 protein of influenza A H3N2 subtype possesses a histone-like sequence (histone mimic), and could target the human RNA polymerase-associated factor 1 transcription elongation complex which has a crucial role in the antiviral response. 56 Thus, the virus used NS1 histone mimic to suppress human RNA polymerase-associated factor 1 transcription elongation complex-mediated antiviral response.", "The severe H7N9 patients were in a state of immune paralysis with general leukopenia, low antigen-presenting capacity and impaired T cell response. 90 Those suffering fatal infections with H7N9 have particularly low proportions of peripheral blood T lymphocyte subgroups. 91 Previous studies have demonstrated that C5a induces thymocyte apoptosis, which in turn results in decreased number of T cells in circulation and attendant immunosuppression. 10, 92 This suggests that in a striking contrast to neutrophils, thymocytes apparently receive pro-apoptotic signals from C5a." ] },{ "paper_id": "344b7576e8d591d39fa83b3fe6d6176a61c0ec9a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data pertaining to the characteristics for each epidemiological cluster is presented in Table 1 .", "The present study was performed after approval from the Institutional Review Board (IRB) of the Pusan National University Hospital (IRB No. 1708-030-058). Informed consent was waived by the IRB.", "These results have considerable implications. First, the overall incidence level in the school population needs to be reduced. Since this population has more contact with the family than that of other collective facilities, it is also necessary to manage the family contacts.", "Here, \u00f6 refers to the cumulative distribution function in the normal distribution with a mean of 0 and a variance of 1, where \u00f6 \u22121 (0.75) is the 75th percentile. 30,31 MOR refers to an indicator that quantifies the variation between levels, by comparison between two individuals between different levels (year cluster in the present study); this is the median value of the odds ratios (ORs) in one group with a higher tendency and another with a lower tendency. MOR is a " ] },{ "paper_id": "34a7701ed25e68579ebbc78052c369ba29bc1fae", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Animals: Two hundred and eighty-six calves <21 days. Calves with liquid or semiliquid feces, temperature >39.5\u00b0C, and inappetence were considered as cases, and those that had pasty or firm feces and normal physical examination were designated as controls.", "Conclusions and Clinical Importance: BCoV was more likely to be detected in diarrheic than healthy calves. The PanCoV-RT-PCR assay can be a useful tool to detect CoV samples from diarrheic calves.", "Calves from Southern Ontario Sample Size Calculation A prospective case-control study approach was used, and the sample size was calculated based on an estimated 30% BCoV detection rate in healthy calves. The set parameters to detect an odds ratio of 2, including equal number of cases and controls, with a 95% confidence and a power of 0.8, yielded a total of a 138 calves in each group." ] },{ "paper_id": "34a942268ef93e2776d5074b3fb75879858712b6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The patient and her newborn baby were discharged in stable condition on June 30 with no clinical abnormalities on followup at the outpatient clinic.", "Further studies with a larger sample size will help in understanding of the pathophysiology and perinatal outcome of MERS during pregnancy and the optimal mode of delivery.", "A systematic testing procedure for coronavirus infection, including chest radiograph and serial reverse transcription (RT)-PCR assays with peripheral blood and nasopharyngeal swab, did not demonstrate the presence of MERS-CoV in the newborn. MERS-CoV antibody tests were performed with mother and newborn sera on June 16 and June 28, respectively (5). In the mother's serum, immunoglobulin G (IgG) was detected, albeit weakly, (0.302) via enzyme-linked immunosorbent assay (ELISA; Euroimmun AG, Luebeck, Germany), and via indirect immunofluorescence test (IIFT; Euroimmun AG) with a titer of 1:100. IgM and IgA were not detected through ELISA and the plaque reduction neutralization test (PRNT) result was below the cutoff value. However, MERS antibodies for IgG, IgM, and IgA were not detected in the newborn's blood samples ( Table 1) ." ] },{ "paper_id": "34b3c509de48e972c90694eebad3ff0537f3d10b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Keywords. enterovirus; meningitis; metagenomics; orchitis.", "Schistosoma species a Epididymitis and orchitis typically present." ] },{ "paper_id": "34d485e6c776b7e4e28bab88bdd133aa4d43e4b2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "34dbc74805291ff544a0944fd54d1e4f1a470080", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "34fca1fbc149711e5617126584d1e26f06e94de9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Close relatedness between NiV and these African viruses was also demonstrated by immunofluorescence staining. To this end, Vero cells were infected in a biosafety level 4 laboratory with NiV and incubated with serum from E. helvum before staining with a polyclonal anti-bat antibody. Clear reactivity was seen (Fig. 4c) .", "Next-generation sequencing. Products of random cDNA amplification were loaded on 1.2% agarose gels. Primer dimers and large fragments ( > 700 bp) were removed, and amplicons were extracted from agarose gels. Fragments were endrepaired and a 454 sequencing library was constructed according to the GS Junior Rapid Library Preparation protocol (Roche, Penzberg, Germany). Emulsion PCR and sequencing reaction were performed as recommended by the manufacturer. Primer sequences were trimmed from each read, and all reads were aligned against the NCBI virus database using the tblastx local alignment algorithm in Geneious. All hits were scored and alignments with lengths less than 50 amino acids and a bit-score less than 40 were excluded.", "It was noted that this pattern was very different from that of measles virus in humans 19, 20 .", "We next looked for evidence of continuous virus excretion on population level in bats 7 . A colony of Myotis myotis in Germany known to carry members of the Morbillivirus-related clade was monitored over 3 years for shedding of virus. Shedding rates and concentrations were constant over three observation periods throughout 2008 to 2010 (Fig. 6) . This colony was a maternity colony, and parturition times fell in the middle of observation periods but did not influence excretion, suggesting natural infection with little differences in shedding between young and adult animals. Table 1 . numbers indicate paramyxovirus-positive individuals and individuals tested in total. DRC = Democratic Republic of Congo, RCA = Central African Republic. sampling years and results of individual RT-PCR assays are given in supplementary Table s1 ." ] },{ "paper_id": "35349bb1fc9290338907b7d7f104c9db3951163b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "353852971069ad5794445e5c1ab6077ce23da75d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "357496f6d93f95b8c286882be6bd219ff79f90e1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "357af8bb837fb3521423284fa624316d0965bfa3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cats may live for years with a slowly progressing chronic disease, even without a specific anti-Leishmania treatment. 4, 5, 15 However, in this case, the severity of cutaneous lesions was the clinician's main concern leading her to search for another therapeutic protocol when monotherapy with allopurinol proved to be insufficient.", "Nodular and lymph node aspirates were inoculated in Schneider's Insect Medium (Sigma-Aldrich) supplemented with 0.6% (w/v) of CaCL 2 , 5 mM Hepes, 10% fetal bovine serum, 100 U/ml penicillin and 100 \u00b5g/ml streptomycin. 18 Cultures were maintained at 24\u00baC in a refrigerated incubator (Lovibond) and observed by optical microscopy after 8 days of incubation. Viable promastigotes were observed.", "During and after treatment there were no abnormalities reported by the owner. The cat maintained a normal physical condition 19 and examination apart from the skin lesions." ] },{ "paper_id": "357fe51849c655d37552b3f96c67be8394a9b6e5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "AnS-IC", "LiS-IC*", "AcS-IC*" ] },{ "paper_id": "3588b1ead834ac96e69e3f3e84b422dc3e43c068", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "358ab81c15c1c24b69c02cfa8cf52069a7e2932b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "While critics of blogosphere mining may indicate problems associated with the veracity of the data compiled under this approach, they fail to note that more traditional epidemiological studies also often rely upon limited samples as well. Furthermore, traditional studies are also subject to issues related to response validity. Until empirical evidence demonstrates to the contrary, it must be assumed that blogger posts related to ILI are no more or less accurate than the responses generated by respondents in more traditional surveys.", "The potential benefit of WSM-based flu surveillance far outweighs the potential risk. Before the advent of WSM and blogging, the general public's participation in flu reporting only went as far as calling a public health official (if he or she felt inclined to do so) or visiting a physician who would report ILI to the CDC. Now, if someone has neither the time nor desire to meet directly with a public health official or physician, he or she could, instead, just blog or tweet a statement similar to I'm coming down with the flu. A web-based analytical system such as Subdue will then quickly register the posting." ] },{ "paper_id": "358d351a51c6f7f9ddb86ea3fb468c7fdc601e3d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For construction of pSilencer-siTRAF3, the single-strand oligonucleotides 5= GATCCGCGAGAACTCCTCTTTCCCTCGAGGGAAAGAGG AGTTCTCGCAGA 3= and 5= AGCTTCTGCGAGAACTCCTCTTTCCC TCGAGGGAAAGAGGAGTTCTCGCG 3= were annealed to double strands before being subcloned into the HindIII and BamHI sites of pSilencer 4.1-CMV neo to form the pSilencer-siTRAF3 construct." ] },{ "paper_id": "35ec885b13ad96752433a085e543db81dd1d80df", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "362b77d7f48903a4c2b808cd4edb9013b527e2a3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Lower limit of 95% CI " ] },{ "paper_id": "363b1631ca140d28ca1ba79883e8b339c8a4a68a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Below are several fruitful strategies the author has used herself.", "Research is a long process, and it may take at least a year to complete a research study: Starting from the preparation of a proposal, liaising with clinical partners, going through the ethical approval process, the search for funding support, and carrying out data collection and analysis. Sometimes, it may not be feasible for patients to wait for such a long time before their health needs are met.", "Evaluating and testing an evidence-based intervention involve time, manpower, resources, and effort. Sometimes, nurse clinicians may be reluctant to become involved in research when they are facing a shortage of manpower or are overwhelmed by the workload imposed by existing health services.", "The International Agency for Research on Cancer (IARC) estimated that there were more than 14.1 million new cancer cases reported worldwide in 2012 and 8.2 million deaths from the disease. [1] Moreover, the number of new cases and cancer deaths would increase to 21.6 and 13 million, respectively, in 2030. [2] The cancer burden is not a problem of one single country or region but is a matter for all of us. Although the incidence of cancer may vary from one country to another, people diagnosed with cancer have been reported from all parts of the world. [1] With advances in technology and medical treatment, more people are living longer after cancer treatment. IARC estimated in 2012 that there were about 32.5 million people living with cancer 5 years beyond diagnosis. In fact, 50% of patients survive up to 10 years after diagnosed with cancer. [1] The impact of the disease is not only on people's health but also imposes a heavy financial burden. According to the Global Oncology Trend Report (2015), [3] global spending on cancer medication rose from US$ 75 billion in 2010 to $100 billion in 2014." ] },{ "paper_id": "365b8f727f890a4833a5ab7ca03d443022e7faf2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In order to identify sample-specific variants (say somatic in A when compared with tissue B), LoFreq employs the following approach: (1) variants called in Sample A are then tested in B and (2) variants that are not called in B by LoFreq are further tested to see if this could be because of inadequate read coverage in B (using a binomial test with SNV frequency from A). Variants that pass this test are then reported as being specific to/somatic in A.", "Validation of low-frequency SNVs reported by variant callers is a challenging task and one that has not been attempted before in published methods (21) (22) (23) (24) 27, 29) . The recent availability of micro-fluidic digital PCR systems has made this more accessible but significant cost limitations and technical challenges remain for large-scale validation.", "Supplementary Data are available at NAR Online: Supplementary Figures 1-6 .", "Mitochondrial heteroplasmy Reads mapping against the mitochondrial genome were extracted from the hg18-mapped BAM files and stringently remapped (BWA unique) against the Cambridge reference (37) to allow for easy comparison with Mitomap entries. This was followed by quality recalibration (as was done for the dengue data) and SNV calling using LoFreq.", "In order to enable comparisons with the methods described in these publications-which were chosen as representatives for non-model-based algorithms-we re-implemented them and these are now available as part of the LoFreq package." ] },{ "paper_id": "366057ee7dcf005190e239f45cdb054964e828db", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "366d302151fd854813f4519551c7d8c5381c4fd7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3677789674e47d9e9b35f87c659430e5295370e9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Purified RNA fragments were separated on a nondenaturing 1% aga-", "Coronavirus persists in an infectious state on common surface materials for several days. An inoculum of 10 3 plaque forming units (PFU) persisted on polyfluorotetraethylene (Teflon; PTFE), polyvinyl chloride (PVC), ceramic tiles, glass, and stainless steel for at least 5 days (and 3 days for silicon rubber) at 21\u00b0C and a relative humidity of 30% to 40% (Fig. 1) ." ] },{ "paper_id": "369acb7f90ebcfd6e59ab973c97ab233c5642b1a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "36fd2f3dfeec8932ec6e4553bce33222c4380756", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For all T m and free energy predictions, we used the following Unafold settings: [Na+] = 0.2 M, [Mg+] = 0.0015, annealing temperature = 30 C, and strand concentration of each strand = 10 -7 M, making the total strand concentration of both strands = 2 \u00c2 10 -7 .", "For confirmation of amplicon sequence, 9 ml of amplified PCR product was mixed with 4 ml of ExoSap-it (USB, Cleveland, OH, USA) and incubated at 37 C for 15 min followed by a denaturation step at 80 C for 15 min. Sanger sequencing was then performed with the BigDye V3.1 Terminator Kit (Applied Biosystems, Inc., Foster City, CA, USA). Single reactions contained 4 ml of Ready Reaction Mix, 0.2-mM primer, 2 ml 5\u00c2 Sequencing Buffer, 11.5 ml of nuclease free water (Applied Biosystems, Inc.) and 2 ml of post-Exosap-it PCR product. The sequencing reaction used the following thermocycling profile: 1 cycle of 94 C for 1 min; 25 cycles of 94 C for 15 s, 38 C for 30 s and 60 C for 4 min. Two microliters of sequencing reaction product was combined with 18 ml of Hi-Di Tm Formamide (Applied Biosystems, Inc.) and run on the ABI 3130 (Applied Biosystems, Inc.). The results were analyzed using Sequencing Analysis v5.2 (Applied Biosystems, Inc.).", "coverage of 99% and an e-score of 0 (no data shown)." ] },{ "paper_id": "37012151cf80cbbbc5ed684c0473b06b1f48d50a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "372c5fab99bbe7f7862304f94bfaebd3c02f1e1c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study recruited a cohort of 175 children who underwent HSCT at Seoul National University Children's Hospital from January 2007 to March 2010 and were followed for at least 1 yr after HSCT. Clinical and virological data were extracted from a prospectively compiled, integrated database. ", "All specimens were tested by multiplex reverse transcription PCR (RT-PCR) for 12 respiratory viruses; rhinovirus, adenovirus, respiratory syncytial virus (RSV) types A and B, parainfluenza virus (PIV) types 1, 2, and 3, influenza virus types A and B, human coronavirus (hCoV) 229E/NL63, OC43 and human metapneumovirus (hMPV). The 2009 H1N1 influenza virus A was excluded in this study. Viral RNA was extracted from each specimen using MagNA pure LC (Roche Diagnostics, Seoul, Korea) according to manufacturer's instructions and PCR amplification was performed using Seeplex TM RV12 ACE detection kit (Seegene, Seoul, Korea).", "Differences between categorical variables were tested by the chi-squared test or Fisher's exact test. All data were analyzed using SPSS version 17.0 and results were considered to be statistically significant when the P value was less than 0.05.", "Respiratory specimens were obtained during routine patient care. Respiratory samples were collected from patients who visited the emergency room or were hospitalized when eligible subjects had febrile episodes or respiratory symptoms or radiologic abnormalities. In total, 402 respiratory specimens were collected from 358 clinical episodes that occurred in the 116 children of the 175 consecutive HSCT cohort via nasopharyngeal aspiration, transtracheal aspiration, sputum, and bronchoalveolar lavage." ] },{ "paper_id": "374f83b1cca6c5caba34833d2cd25febd1cc72f1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Involvement of the posterior structures mostly related to HSV and VZV is potentially sight-threatening. Retinal or optic nerve involvement should be suspected in any child, who complains of an acute onset of blurred vision in the absence of anterior segment inflammation or opacities in the ocular media.", "Optic neuropathy may occur as an isolated sign, although it is more often associated with a more generalised involvement of the central nervous system (77, 78) . While specific therapy is not always available, the early diagnosis of ocular viral disease in children should aid in the amelioration of acute symptoms and in the prevention of long-term complications.", "Children and Ebola infection. EV was first discovered in 1976 and has caused three outbreaks, two simultaneously in 1976 and one in 2014 (48) . The exact mode of transmission of EV remains unknown; however, it seems to be transmitted from the biological fluids of wild animals and subsquently through human-to-human contact (49) . According to the WHO, the 2014 west African outbreak claimed a case fatality, which ranged from 25 to 90% and a total number of roughly 10,000 fatalities; the number of children is unknown (49) . This fact makes it a potential lethal tool in bio-warfare. If used in residential areas or within the public transportation system, as a biological agent, EV can easily affect the welfare and life of children.", "Even though a successful vaccine against HBV has been implemented in 184 countries, the eradication of HBV is still not on the horizon (27) . According to the World Health Organization (WHO), there are 240 million chronic carriers of the virus, globally (28) . The risk of developing chronic hepatitis ranges from >90% in newborns of hepatitis B e antigen (HBeAg)-positive mothers, 25-35% in children under the age of 5 and <5% in adults (29) . HBeAg, a non-particulate viral protein, is conventionally considered a marker of HBV replication (30) . This is the only antigen of HBV, which can cross the placenta (31), leading to the specific unresponsiveness of helper T cells to the hepatitis B capsid protein (HBcAg) and HBeAg in newborns of HBeAg-positive mothers (32) . HBeAg is tolerated in utero and acts as a tolerogen after birth (33) . Thus, perinatal transmission is frequent when mothers are HBeAg-positive, whereas it occurs significantly less frequently when mothers are HBeAg-negative (34) (35) (36) ." ] },{ "paper_id": "376a81a940b9cdc1b10609164d5b1a5edac60956", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "sabe que es algo nuevo, pero no se sabe exactamente qu\u00e9 consecuencias puede tener para la salud a una escala global.", "Si bien la mayor\u00eda de las infecciones por arbovirus son asintom\u00e1ticas o no revisten gravedad, la transmisi\u00f3n del ZIKV durante el embarazo puede ocasionar defectos cong\u00e9nitos graves, como la microcefalia." ] },{ "paper_id": "377786fe05588ea782213fcb92f39a6522f113bd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This work was supported by FAPESP -Funda\u00e7\u00e3o Amparo \u00e0 Pesquisa do Estado de S\u00e3o Paulo-FAPESP (Grant number 05/ 51484-1; 07/55932-4). We are indebt to the technical team from SADIA-Unidade Uberl\u00e2ndia, MG, Brazil.", "Sequencing of the amplified products revealed a high homology with TAstV-2 North Carolina Q/34/1990 strain for polymerase gene and to TCoV for the 3'UTR of turkey\\UK\\412\\00 strain (FJ178641 and , respectively) .", "All the RT-PCR products were sequenced directly using the BigDye Terminator v3.1 cycle sequencing kit (Applied Biosystems) using the same set of primers in order to confirm the identity of the amplified products. The sequences were deposited as TCoV/Brazil/2006 accession number FJ188401 and TAstV-2/Brazil/2006 FJ178641, respectively (9, 14) ." ] },{ "paper_id": "377e2c575da8f034d4f9f34d7ad6c4395487f348", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Boehringer Marmheim GmbH (Mannheim, Germany), the other antibodies were gifts from the following sources: B. Burke (Harvard University, Cambridge, MA; cx-mannosidase II), E. Berger (University of Ziirich, Switzerland; \u00a2x-galactosyltransferase), S. Prehn and T. Rapoport (Max-Delbriick Institute, Germany; \u00a2x-ERp34), P. Buck and S. Fuller (EMBL, Germany; c\u00a2-PDI), M. Zerial (EMBL, Heidelberg, Germany; c~-rab2), H. P. Hauri (Biozentrum, Switzerland; , and J. Saraste (University of Bergen, Norway; c~-p58). All secondary antibodies, rhodamine or FITC coupled goat anti-rabbit IgG, goat anti-mouse IgG or goat anti-mouse IgM for immunofluorescence and rabbit anti-mouse IgG, rabbit anti-mouse IgM, or rabbit anti-rat IgG for immuncelectron microscopy, were obtained from Organon Technika/Cappel (West Chester, PA).", "The SLO-permeabilized or broken cells were fixed with 1% glutaraidehyde in 0.2 M cacodylate buffer, pH 7.4, for 1 h and processed for Epon embedding.", "Nuclear and viral DNA were visualized by staining with 5 t-~g/mi bisbenzimide (Hoechst No. 33258 for fixed cells and membrane permeable Hoechst No. 33342 for living cells; Sigma Immunochemicais) for 5 rain. After extensive washing in PBS the coverslips were mounted on glass slides using moviol as mounting medium and examined with an Axiophot fluorescence microscope (Carl Zeiss, Inc., Oberkochen, Germany)." ] },{ "paper_id": "37894de51fed87b7b8b323f9ca56cdabdc164a94", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Notably, 35% of infected patients either were asymptomatic or had a mild illness that did not require any medical intervention." ] },{ "paper_id": "37ab0d36dd92298368b797e0770ebfa03a36eca8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "37afb28ad52f876fd3473878e7990165663f3bd2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "37f31338fc1447eb78c6b17f93e700f77728e25d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Apoptosis is a highly conserved and regulated process for eliminating damaged and surplus cells, such as those generated during normal embryonic development and abnormal cancer. 1 Important regulators of this process are the B cell lymphoma 2 (Bcl-2) family of proteins, which include pro-and anti-apoptotic members. Antiapoptotic (ie, pro-survival) members include Bcl-2, Bcl-xL, Bcl-w, and myeloid cell leukemia-1 (Mcl-1), whereas pro-apoptotic members include Bax-like proteins, such as Bax, Bak, and Bok, and BH3-only proteins, such as Bad, Bim, Bmf, Bik, Hrk, Bid, Puma, and Noxa. 2 The interaction of pro-and anti-apoptotic proteins with regulators is a key element of cell survival and death.", "Zinc05500896 (-6.64) Zinc33257600 (-8.11) Zinc05521275 (-6.73) 8", "Zinc08405446 (-6.61) Zinc08976410 (-8.1) Zinc97327663 (-6.7) 9", "To obtain hierarchal MD clusters, the biomolecular simulation trajectory and data analysis program cpptraj, 32 which is part of the AMBER package, were used. Clustering is a means of partitioning data so that data points inside a cluster are more similar to each other than they are to points outside a cluster. In the context of molecular simulation, this means grouping similar conformations together. Similarity is determined by a distance metric -the smaller the distance, the more similar the structures. One commonly used distance metric is coordinate root mean square deviation (RMSD). Application of this procedure resulted in four main clusters, from which one centroid conformation PDB structure was chosen for subsequent molecular docking." ] },{ "paper_id": "37feea85864da899f6c9b22a7d89c8598fa38a29", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cells from Human Donors. Cord blood (CB) was generously donated from the Cleveland Cord Blood Center, Cleveland, for isolation of CD34 + cells and adult mobilized peripheral blood CD34 + cells were obtained from Fred Hutchinson Cancer Research Center Processing and Procurement Core under the approved institutional protocol of the Scripps Research Institute (no. IRB-13-6173).", "Overall, intricate trafficking of membrane proteins regulates specific cellular activities, such as nutrient uptake and signal transduction, and collectively allows cells to rapidly respond to their surroundings. While providing a means for large molecules to access an otherwise impermeable cell, the endocytic network is also exploited as a portal of entry for pathogens. Many pathogenic enveloped viruses infecting humans, including Influenza A virus (IAV), Dengue virus, and Ebola virus, adhere to a life cycle that relies on endosomal movement and maturation. The progressive acidification that occurs during the transition from early endosomes to late endosomes triggers fusion between viral and endosomal membranes, allowing cytoplasmic access and the initiation of viral replication (7) . Endosomes are thus situated at a crucial cellular threshold, and, as a result, they are equipped with elements of the cell-intrinsic antiviral immune response (8) .", "Flow Cytometry. Cells were fixed/permeabilized with Cytofix/CytoPerm reagent (BD) for 20 min and washed in Perm/Wash buffer (BD). Cells were pelleted and resuspended in primary antibodies diluted in Perm/Wash buffer, incubated at room temperature for 30 min, and washed in Perm/Wash buffer. Cells were pelleted and resuspended in Alexa Fluor-conjugated secondary antibodies diluted in Perm/Wash buffer, incubated at room temperature for 30 min, and washed in Perm/Wash buffer, and cells were acquired and analyzed on a LSRFortessa (BD). The following primary antibodies were used to score virus infections: anti-HIV Gag KC57-FITC (BD), anti-p24 Gag (3537; NIH AIDS Reagent Resource), anti-IAV-NP (AA5H; Abcam), and anti-SeV (PD029; MBL). Endogenous IFITM3 was measured by anti-IFITM3 (EPR5242; Abcam) while exogenous IFITM3 WT and mutants, IFITM2, and IFITM1 expressed from pQCXIP were measured by anti-FLAG M2 (Sigma). Endogenous LAMP1 and EEA1 were measured by anti-LAMP1 (H5G11, sc-18821; Santa Cruz Biotechnology) and anti-EEA1 (clone 14, 610456; BD). The following reagent was obtained through BEI Resources, NIAID, NIH: Human Recombinant IFN Beta, rHuIFN-\u03b2 ser17 (NR-3085)." ] },{ "paper_id": "381d5feb501bd762182e76a3fcb4dd3f64c9a261", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Western blot analysis was performed according to our published protocol. 20 Briefly, 1.5 mg purified (His) 6 -tagged rNPs of MERS-CoV, human CoV (HCoV) 229E and HCoV-OC43 respectively were subjected to 12% SDS-PAGE and were transferred to 0.22 mm nitrocellulose membranes (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The membranes were blocked with 5% skim milk in Trisbuffered saline and then incubated with mouse anti-MERS-CoV-rNP immune sera at 37 6 C for 60 min. Antigen-antibody interaction was detected with 1:4000 diluted horseradish peroxidase (HRP)conjugated goat anti-mouse IgG (Novex, Life Technologies, Grand Island, NY, USA) and visualized by 3,39,5,59-tetramethylbenzidine (TMB) liquid substrates system for membranes (Sigma Aldrich, Saint Louis, MO, USA).", "To establish a capture ELISA for MERS-CoV NP detection, two anti-MERS-CoV-rNP-specific MAbs (1F6 and 7C4) were selected. MAb 1F6 was coated onto the microplate and MAb 7C4 was conjugated with HRP. This ELISA showed a high sensitivity, with detection limit to MERS-CoV-rNP of less than 1 ng/mL; and a high specificity, with no detection for the HCoV-OC43-rNP and HCoV-229E-rNP ( Figure 4A ). The high sensitivity was further confirmed with a detection limit of 10 3 ", "Since its emergence in 2012, Middle East respiratory syndrome (MERS) has affected more than 20 countries globally with a total of more than 900 laboratory-confirmed cases and a fatality rate of over 30%. Similar to severe acute respiratory syndrome (SARS), MERS is also caused by a coronavirus (CoV), named MERS-CoV; 1-4 but unlike the SARS epidemic which has rapidly died off after the intermediate amplification animal hosts were segregated from humans by closure of wild animal markets in southern China, the MERS epidemic has persisted for more than two years with no signs of abatement. The persistence of the epidemic may be partly due to the difficulty to control the contact between the people and dromedary camels, a major zoonotic source of MERS-CoV. [5] [6] [7] [8] [9] Since there is still no effective anti-viral agent for the treatment of MERS-CoV infections, rapid and accurate laboratory diagnosis is essential for commencement of infection control measures." ] },{ "paper_id": "3831c263a7c8d673bd839bb390083c0d79003d14", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "384c7676eb08fb530ec399208932513c0fa0c4e3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Primers targeted specifically the nucleocapsid gene of RSV(6), the Matrix protein gene of hMPV (7), the hemagglutinin and neuraminidase gene of PIV-1,2 (8) and PIV-3 (9) the phosphoprotein gene of PIV-4 (10) hemagglutinin (HA) gene of IFV A and B (11) and hexon gene of AdV (12) ." ] },{ "paper_id": "38550290e3c74a86fb0e56ecd69303ff68de55d9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Where new vaccines are required under emergency conditions to prevent or to curtail disease outbreaks, it is essential for developers and manufacturers to work closely with the regulatory authorities and with the WHO to understand the requirements to bring a candidate vaccine as quickly as possible through the development pipeline and into the clinic. It is evident from this review series that much progress in vaccines for emerging pathogens is being made and will continue to be required to counter these serious infections.", "Understanding the interaction of the host with a viral pathogen to expedite vaccine development is a theme taken up in the review contributed by Sharpe et al. [2] . Specifically, they address the targeting of the human leucocyte antigen (HLA)-E molecule, a major histocompatibility complex (MHC)1b molecule, by viral vectors to induce non-classical CD8 + T cell immunity and to inhibit natural killer (NK) cell activity. However, the authors acknowledge that there remain some questions of safety with this HLA-E targeting approach to vaccination; for example, the existence of self-peptides which are able to up-regulate HLA-E activity. The preclinical data, for", "In this two-part series of reviews, we have invited experts in their fields to contribute articles on the status of vaccine research and development for emerging pathogens. This topic has been brought into sharp focus in recent years following significant outbreaks of viral diseases such as those causing severe acute respiratory syndrome and Middle East respiratory syndrome, as well as devastating outbreaks of diseases caused by the Ebola, Marburg, Zika and Lassa fever viruses, to name only a few examples. Additionally, bacterial infections leading to bubonic and pneumonic plague, most notably in Madagascar in 2018, as well as malaria in many tropical countries, melioidosis in south east Asia and tularaemia in northern Europe and North America, have incurred significant morbidity and mortality. In this review series, the life cycle of these pathogens and the epidemiology of disease have been reviewed in the context of potential points of intervention for the prevention of human infection. Many of the emerging pathogens are zoonoses and, as such, there is scope for intervention at the animal/insect/environmental reservoir. Other pathogens covered in this review series are considered to be re-emerging, such as multi-drug resistant tuberculosis." ] },{ "paper_id": "3897a0019d6f54b8c354f32eca68de8f512af39c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There are no financial or other issues that might lead to conflict of interests. ", "RSV belongs to the family of Paramyxoviridae, and is classified in the genus Pneumovirus. RSV is the most common cause of fatal acute respiratory tract infection in infants and young children. RSV infects virtually everyone by 4 yr of age, and reinfection occurs throughout life, even among the elderly (4-6). Adults infected with RSV tend to have more variable and less distinctive clinical findings than children, and the viral cause of the infection is often unsuspected (7) . This study attempted to verify the seroprevalence of RSV IgG among healthy young adults in their early twenties who had just been admitted to the Korea Air Force basic training camp. Subjects with an RSV IgG seronegative outcome were prospectively observed for vulnerability to respiratory infection, especially during the period of basic training.", "Military recruits admitted to the Air Force boot camp were required to undergo a basic health examination which includes a blood sampling test. In this investigation, RSV IgG immunoassay was added to the basic blood test. All subjects were admitted to the training camp on June 26, 2012. They underwent a blood test on June 27, 2012, which was a day after resting without training on the day of admission. The total number of recruits was 570 and all of them underwent an RSV IgG test. Institutional Review Boards of the Ministry of National Defense (IRB No. AFMC-12-IRB-014). Air Force physicians themselves explained the purpose, method and precautions of this study, and tests were conducted after obtaining an informed consent from each subject." ] },{ "paper_id": "38db3b3d3d82b08a9d95490fd0871d04d7001efe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Competing interests None declared.", "Provenance and peer review Not commissioned; externally peer reviewed.", "Data sharing statement No additional data are available." ] },{ "paper_id": "390dc3c6b8a82c69dddf3395e72846d49f5c4a72", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3920596af370a9e2e4c31d89444c980ceadbc4f8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "RNAs encoding the \u2423-domain gene were mixed with the highly purified reconstituted translation system (30) containing protein (EA reagent, Clontech) and a fluorescent substrate (50 M Tokyo Green R -\u2424Gal, Sekisui Medical, Japan) according to a previous study (31) . The fluorescence at 37 \u2022 C was detected using an Mx3005P QPCR system (Agilent Technologies, USA).", "Supplementary Data are available at NAR Online.", "Funding for open access charge: Exploratory Research for Advanced Technology, Japan Science and Technology Agency. Conflict of interest statement. None declared." ] },{ "paper_id": "39244c86324ed37f0b32222540efeefd2144d458", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All analyzes were performed using SPSS V13.0 software; P<0.01 and P<0.05 were defined as statistically very significant and significant, respectively. One-way analysis of variance (ANOVA) and multiple comparison statistical test were also used.", "TGEV is a coronavirus and contains a positive-sense single-stranded RNA genome [28] , which encodes four structural proteins and three non-structural proteins. Spike (S) protein is the major component of the virion surface and possesses four antigen sites," ] },{ "paper_id": "39708f10658e8e33983d0b2ebb570bdd00c5df46", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "KM is a co-founder of Inserogen, Inc., a plant-based biotechnology company with a focus on the development of orphan drugs for replacement therapy.", "We performed a sensitivity analysis to understand how critical process cost variables impact COGS. The results of a relative sensitivity analysis for the facility are shown in ", "Chinese hamster ovary (CHO) and Escherichia coli (E. coli) cells are the most common type of cells used for therapeutic protein production. The time needed for CHO cell line development has decreased in the past decades, but remains a relatively long and costly process. CHO cell cultures require expensive media and multi-step bioreactor seed trains, and are vulnerable to infection with mammalian viruses and pathogens that can result in shutdown of manufacturing operations. With over 20 years of commercial development and use, the CHO platform only offers shrinking intellectual property opportunities; patent protection for major innovations are held by a relatively small number of consolidated pharmaceutical companies." ] },{ "paper_id": "39988cf0ce9b1ea1e63e9c3c15de51a9c87fc376", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "39a01111cbf00eb9bf55c7713c1edec443d3e97e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study was funded by Vice Chancellor Fellowship, the University of New South Wales, 2010-2012.", "By the year 2009, 8563 laboratories (8273 screening laboratories, 254 confirmatory laboratories, 35 confirmatory central laboratories and 1 National AIDS Reference Laboratory) and 84 laboratories hospitals are capable of carrying out CD4 and HIV viral load testing in China [22] . Confirmed diagnosed HIV cases were reported back to referring clinical sites then further integrated into the central database through CISDCP. The hospital-based surveillance in China has cumulatively diagnosed 326,000 people living AIDS and a total of 65,481 people are currently receiving ART in 2009 [23] , which accounted for 62.4% of the AIDS cases [2] .", "Prior to 2004, newly diagnosed HIV/AIDS cases were reported through the National Disease Reporting System (NDRS) (see Table 1 for a list of reportable items in China). The system consists of multiple level of reporting. Villages, being the lowest level of administrative, collected HIV epidemiological data in their allocated areas and reported to prevention units in township hospitals. From the prevention units, HIV data were further sent through county health and epidemic-prevention stations (EPS) to provincial centers and forwarded to the Chinese Academy of Preventive Medicine. With the support from the Ministry of Health and cooperation of provincial centers of health and epidemic prevention, a computerized system had worked effectively to network the monitoring of HIV epidemics at various levels in China and information transfer experienced no substantial changes for about 25 years. However, all communicable disease surveillance systems in China underwent significant upgrade in 2004." ] },{ "paper_id": "39a7144b3eb9ddf5b9076163aa61099d8b58f977", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Our results highlight the importance of carrying out these separate analyses." ] },{ "paper_id": "3ac5e3619d6decbe8deedc18bb939bbfbf0c707c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Our goal was to identify a structural feature of E1 that might be responsible for intracellular accumulation of the protein.", "The process of intracellular transport to the plasma membrane could be governed by positive sorting signals; i.e. pro-C. E. Machamer's present address is Department of Pathology, Yale University School of Medicine, New Haven, Connecticut 06510. J. K. Rose's present address is Departments of Pathology and Cell Biology, at the same institute.", "Both COS-1 and HeLa cells were maintained in Dulbecco-Vogt's modified Eagle's medium with 5% FCS. The IBV used in these experiments was adapted to growth in monkey cells by nine consecutive passages of egggrown virus at low multiplicity of infection in Vero cells, and was obtained from B. Sefton (The Salk Institute). Tissue culture supernatant from infected Vero cells was used as the inoculum to infect COS-I cells for radiolabeling and inununofluorescence. The multiplicity of infection was approximately 0.1, and infected cells were assayed for IBV-speciflc polypeptides at 29 and 48 h postinfection." ] },{ "paper_id": "3b09cf3b8cc59b5d16c4717c50ffa70edb467046", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Major clinical criteria for PCD diagnosis \u00c3 1) Unexplained neonatal respiratory distress (at term birth) with lobar collapse and/or need for respiratory support with CPAP and/or oxygen for >24 hr.", "Various diseases caused by genetic disorders of nonmotile cilia can result in cystic kidneys, cystic or cholestatic liver, skeletal malformations, developmental delay, hydrocephalus, blindness, or deafness. These include Joubert Syndrome, Bardet-Biedl syndrome, Usher Syndrome, Jeune Syndrome, polycystic kidney disease, and others. The overlap of these non-motile ciliopathies with respiratory cilia dysfunction is unusual, and poorly understood at present, 90,92,93 but increased rates of bronchiectasis are found in polycystic kidney disease. 94 Therefore, consultation with a geneticist or other subspecialists is recommended when patients with possible PCD have features of non-motile ciliary dysfunction.", "Finally, PCD patients should receive recommended vaccinations per local schedules. Annual influenza 127 and pneumococcal vaccinations (per the Advisory Committee on Immunization Practices) 128, 129 are recommended in PCD. In the first year of life, monthly (seasonal) immunoprophylaxis against respiratory synctial virus can be considered for infants with PCD, and more specifically for infants with complicated respiratory courses requiring prolonged oxygen supplementation." ] },{ "paper_id": "3b19c08ee471af50e75d3d2071699e88990cbe68", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplementary materials are available at Open Forum Infectious Diseases online (ofid.oxfordjournals.org). Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.", "In conclusion, this report raises a potential opportunity to widen the diagnostic window for JEV infection. Given the challenges inherent in flavivirus serological diagnosis, especially in the context of lifetime exposures to multiple flaviviruses, a greater capacity for direct virus detection by PCR could be very attractive. Further studies are needed to determine the reproducibility of these findings.", "Electromyogram and nerve conduction studies performed on day 22 were consistent with an acute motor-axonal neuropathy or anterior horn cell pathology. No clinical improvement was evident after 4 days of intravenous immunoglobulin (IVIG) administered at a dose of 1 g/kg daily, and the patient died 30 days after the onset of symptoms.", "Shortly after admission, on day 7 of his illness, he became confused. Cerebrospinal fluid (CSF) obtained by lumbar puncture demonstrated a glucose of 3.5 mmol/L (reference interval, 2.2-3.9 mmol/L), protein of 1.3 g/L (reference interval < 0.45), polymorphs of 280 \u00d7 10^6/L, lymphocytes of 90 \u00d7 10^6/L, and red blood cells of 54 \u00d7 10^6/L. He was commenced on empiric broad-spectrum antibiotics with vancomycin, meropenem, benzyl penicillin, and acyclovir. Due to a deteriorating conscious state, he was intubated the following day and transferred to a tertiary center. Neurological examination upon arrival revealed a generalized flaccid paralysis. A magnetic resonance image of the brain demonstrated no abnormalities. Seizure activity developed on day 10 of his illness, for which anticonvulsant medication was commenced." ] },{ "paper_id": "3b299c75b42f7b4119456256518d2d8753d74838", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3b4bdc3dce8169c30fd1f151713b1f801059c694", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Clearly, m Z g1 gives greater weights to outer vertices/edges than to inner ones in a graph.", ", , , ." ] },{ "paper_id": "3b5c43f1068e79db27adaca5df0bd717851c37cc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "URLs EHCO [132] http://ehco.iis.sinica.edu.tw/ Onco.HCC [133] http://oncodb.hcc.ibms.sinica.edu.tw/index.htm HCVpro [134] http://cbrc.kaust.edu.sa/hcvpro/ HCVdb [135] http://euhcvdb.ibcp.fr/euHCVdb/ Hepatitis Virus Database (HVDB) [136] http://s2as02.genes.nig.ac.jp Los Alamos National Laboratory in the United States [137] http://hcv.lanl.gov LiverAtlas [138] http://liveratlas.hupo.org.cn dbHCCvar [139] http://GenetMed.fudan.edu.cn/dbHCCvar", "J Jo ou ur rn na al l o of f C Ca an nc ce er r 2015; 6(1): 54-65." ] },{ "paper_id": "3b69d402abfb10509e1518f2f2b38e8d8840f34e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Emerging disease is a term used with increasing frequency to describe the appearance of an as yet unrecognized infection, or a previously recognized infection that has expanded into a new ecological niche or geographical zone and often accompanied by a significant change in pathogenicity. 1 The key message is that these are representative of constantly evolving infections responding to rapid changes in the relationship between pathogen and host.", "Considerable international effort is now being made to collect and record samples of viruses and microorganisms from wild animal populations and potential arthropod vectors in order to expand the current molecular databases. By making available extensive catalogues of genome sequences, it is expected that newly emerging agents would in future be more readily identified and thus control measures put in place much more rapidly.", "Viruses must bind to one or more receptors on the surface of the target cell in order to enter and infect cells. New diseases can emerge when viruses evolve the ability to bind to either a new receptor in a novel target host species, or use the homologue of an existing receptor in a new species.", "It is imperative that veterinary scientists are involved in any suspected zoonotic outbreak. Valuable time was lost in 1999 when the first cases of West Nile virus occurred in New York City among both humans and birds. 68 Historically, there has been little integration of animal and human public health, yet the techniques and methods for diagnosing and controlling infectious disease are similar regardless of affected species.", "The preeminent property of the arenaviruses is the establishment of a long-term, chronic infection in their principle murine reservoir. Although rodents are divided into over 30 families worldwide, arenaviruses are found mainly within two rodent families, the Muridae and Cricetidae (e.g. field voles, lemmings, gerbils). Each arenavirus is not necessarily found distributed throughout the populations of any particular host reservoir, however." ] },{ "paper_id": "3b6d953fa2770589cb1f699047f2d94990cfa4ad", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Nil.", "There are no conflicts of interest." ] },{ "paper_id": "3b8b2a835cfa770c6cef711d52e1f1e869d8aca8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Reactive oxygen species (ROS) levels in macrophages were monitored using the fluorescent ROS indicator C2 0 ,7 0 -dichlorodihydrofluorescein diacetate (5 mmol/L; Molecular Probes, Eugene, Oregon). Cell-associated fluorescence was detected by fluorescence-activated cell signaling (FACS) using a FACS-Calibur flow cytometer (BD Biosciences, San Diego, California) with FlowJo software V 7.2.5 (Tree Star Inc, Ashland, Orogen). Images of fluorescent cells were acquired under a 710 confocal microscope (Carl-Zeiss, Germany).", "The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.", "Eun Ho Kim, PhD https://orcid.org/0000-0002-6476-163X" ] },{ "paper_id": "3b8d650d6325394ab80ca6c41330f625134680eb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3b8d7417f616e8ba9912423e9b764870d8e2e047", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Live Varroa mites were fixed in 4% paraformaldehyde in 100 mM PBS (pH 7.0) overnight at 4\u00b0C, rinsed in nuclease-free water three times, and then stored in 70% ethanol (200 proof) at 4\u00b0C until used. Tissue dehydration was carried out by successive incubations in ethanol (70%, 95%, and 100%) and xylol (twice for 5 min each) and embedded in paraffin. Paraffin sections were cut 2 to 5 micrometers thick and mounted on poly-Llysinated slides and stored at 4\u00b0C overnight. The sections were then rehydrated through a descending concentration of ethanol (100%, 95%, and 70%), dewaxed in xylol, treated with proteinase K (10 g/ml) for 30 min, and acetylated with 0.33% (vol/vol) acetic anhydride in 0.1 M triethanolamine-HCl (pH 8.0) for 10 min prior to hybridization.", "Virus particles were negatively stained with 2% uranyl acetate on a Formvar-coated Ni grid and viewed in a Hitachi H-7000 electron microscope at magnifications between \u03eb33,000 and \u03eb100,000.", "Nucleotide sequence accession numbers. The cDNA sequence data have been submitted to the GenBank sequence database and assigned the accession numbers JQ710729 and JQ710730 for the helicase and capsid protein coding regions, respectively." ] },{ "paper_id": "3b8ec6abf589bfc9738475e02cb3a6d18eaba5b7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Complement activation plays a critical role in innate recognition and neutralization of pathogens in vivo (3, 4, 58) .", "For survival analysis, Kaplan-Meier survival curves were plotted using Prism software (GraphPad) and analyzed by the log rank test. Statistical signifi cance of complement levels, survival time, viral burdens, antiviral antibody titers, and total number of activated T cells were analyzed by an unpaired t test or Mann-Whitney test." ] },{ "paper_id": "3ba6e62e7ed8c087b34db8520cb1a203a062ded9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In the past, the central Taiwan government has primarily focused on social relief and support efforts during disasters. During the catastrophic earthquake on September 21, 1999, inadequate integrated information and an incomplete response framework resulted in a delayed government response. Thus, it became apparent that the disaster response framework required revision.", "Taiwan is well-versed in responding to natural disasters and has already established relevant, detailed standard operating procedures (SOPs). However, during public health emergencies, such as a dengue fever or rabies outbreak, Taiwan uses a flexible command center structure, and SOPs are not well-established for these types of responses. This is a potential area for future improvement.", "In an emergency, depending on the disaster severity, type, affected area, and other aspects, the CEOC may be activated. When the CEOC is activated, its command structure consists of at least 4 sections, including staff, information, operations, and administration sections as well as 1 on-scene incident office (see Figure 2 ). 17 ", "L ocated on the earthquake-prone circum-Pacific belt and seasonal typhoon impact zone, Taiwan has historically been threatened by natural disasters. Taiwan is a small island with high population and urban density. Disasters in Taiwan can grow into complicated events, causing large impacts on the country's economy, environment, and public health. In 2005, the World Bank report Natural Disaster Hotspots: A Global Risk Analysis indicated that 73% of Taiwan's land and population are exposed to 3 or more hazards, such as earthquake, landslide, or flood, and almost 99% of its land and population are exposed to 2 or more hazards. 1 In fact, Taiwan may be considered one of the most vulnerable areas to natural hazards on Earth. 2 In addition, as climate change con-tinues to affect the world, extreme weather affecting Taiwan may grow worse." ] },{ "paper_id": "3bb1bf62e09f90f586662be381ca7660090400a8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The mammalian Vero, HeLa, and BHK-21 cell lines were maintained in Dulbecco modified Eagle medium (DMEM; Gibco) supplemented with 10% newborn calf serum (Gibco) and 1% penicillinstreptomycin (Sigma) at 37\u00b0C with 5% CO 2 .", "The continuous protease assays were performed using fluorescence resonance energy transfer (FRET)-based substrate representing the CHIKV nsP3/4 cleavage site (34) (Fig. 4D ). Briefly, a peptide substrate with an excitation wavelength of 340 nm and an emission wavelength of 490 nm at an interval of 5 min for a total period of more than 2 h. Finally, the data were normalized to a no-enzyme control and are expressed as relative fluorescence units (RFU)." ] },{ "paper_id": "3bbbbc7190599b47616269323cfbd3659d9dc420", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Step 1, linearization of the fulllength SA 14 -14-2 cDNA at the 3'-end of the viral genome ( Figure 4A) ;", "Step 1, purification of viral RNA from the cell culture supernatant of JEV-infected BHK-21 cells (Figure 1A) ; Step 2, synthesis of four overlapping cDNA amplicons (F1 to F4) spanning the whole viral genome ( Figure 1B); Step 3, subcloning of each of the four contiguous cDNA fragments into a BAC vector, creating pBAC/F1 to pBAC/F4 ( Figure 1C) ;", "The authors have declared that they have no competing financial interests." ] },{ "paper_id": "3be2b917c48e3dc25a4e6bb3028fd5d32e4f2d9d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3bed29e225d41a6617ee40c5bc70c0574388079a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "As viral diseases vary greatly in duration and severity, the safety threshold of an antiviral nucleoside/tide needs to be considered in the context of its efficacy and treatment duration. For example, compounds to treat acute and deadly viral infections such as Ebola would likely have different safety criteria than drugs used to control chronic infections such as HIV-1 and HBV. Existing nucleoside/tides are routinely screened against emerging viruses, and it is possible that a compound that failed to achieve an adequate therapeutic window against one virus may be suitable for treating other viral infections.", "Nucleoside and nucleotide analogs have played significant roles in antiviral therapies and are valued for their impressive potency and high barrier to resistance. They have been approved for treatment of herpes simplex virus-1, HIV, HBV, HCV, and influenza, and new drugs are being developed for the treatment of RSV, Ebola, coronavirus MERS, and other emerging viruses. However, this class of compounds has also experienced a high attrition rate in clinical trials due to toxicity. In this review, we discuss the utility of different biochemical and cell-based assays and provide recommendations for assessing toxicity liability before entering animal toxicity studies.", "In certain cases, testing in a specific cell assay is warranted. For example, a number of the first-generation HIV nucleoside analogs showed myelosuppressive effects. As a result, the FDA recommended evaluating this toxicity on the growth of human bone marrow progenitor cells in colony formation assays. 37 The importance of measuring cellular TP levels A nucleoside/tide analog's cytotoxicity is often directly related to its cellular level of the active TP metabolite. BMS-986094 and IDX184 are both 2 0 CMe guanosine nucleotide prodrugs, but the former formed >37-fold higher TP, and this correlated with its significantly higher toxicity. 18 Some nucleoside analogs are poorly phosphorylated in cells, such as balapiravir. Even though it is a specific inhibitor of POLRMT, balapiravir showed little or no toxicity in a large panel of cell lines and primary cells tested, but development of this compound was stopped at Phase II due to toxicity." ] },{ "paper_id": "3c0c493a037dacafd2eda2e37518e0f0dff7955f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Rarely, we used vasopressor support on day 1 following ICU admission (3.2%). Broad-spectrum antibacterial agents were initiated in almost all.", "Chest radiographs demonstrating bilateral mixed interstitial or alveolar infiltrates were found in 90% of patients.", "On admission, 11 of 61 (18 %) patients who were tested had leukopenia, 27 of 61 (42.2 %) had anemia, and 18 of 61 (29.5 %) had thrombocytopenia. Twelve of 61 patients had positive blood and bronchoalveolar lavage cultures.", "The clinical picture in severe cases of pandemic (H1N1) 2009 influenza is markedly different from the disease pattern seen during epidemics of seasonal influenza, in that many of those affected were previously healthy young people. Current predictions estimate that, during a pandemic wave, 12-30 % of the population will develop clinical influenza (compared with 5-15% for seasonal influenza) with 4% of those patients requiring hospital admissions and one in five requiring critical care (6) ." ] },{ "paper_id": "3c39d9aa9e05723ab781cc800c89c69869fd0eeb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3c3a1e707eaf3efae5ae22cced7d4850ffc1f587", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "creased understanding of vaccine-mediated immunity can help scientists be better positioned to identify correlates of vaccine immunogenicity and make progress towards developing new and enhanced vaccines and therapeutics.", "Recent global outbreaks of EIDs, such as Ebola or Zika virus (ZIKV) diseases, reminded the world of the imminent threat of unexpected pathogens. EIDs can result from infectious agents that have recently appeared or have existed, but are rapidly increasing in incidence. 14, 15 Major pathogens include highly pathogenic avian influenza (HPAI) virus, severe fever with thrombocytopenia syndrome (SFTS) virus (SFTSV), ZIKV, dengue virus (DENV), and Middle East respiratory syndrome coronavirus (MERS-CoV).", "Emerging infectious diseases (EIDs) are defined as newly appearing infections in a population or diseases that have previously existed, but are rapidly emerging in incidence or geographic range. 1, 2 EIDs are often initiated by pathogens with a change in pathogenicity, and these emerging pathogens are highly likely to be zoonotic, with a broad range of hosts or vector-borne. [3] [4] [5] New human pathogens are especially likely to continue emerging, mainly from mammals and birds, for the foreseeable future. For these reasons, an effective global surveillance system for novel pathogens is needed. Due to the diverse nature of antigenic variation of emerging pathogens and their various strategies to evade the immune system, EIDs continue to pose difficult challenges to clinicians, public health profes-sionals, and researchers globally.", "As summarized above, in addition to virus genetic variation, complex environmental factors, including ecological and behavioral influences, can be important contributing components of the recent emergence of viral diseases. Recent Ebola and Zika outbreaks have shown that the world is unprepared to detect local outbreaks and respond quickly enough to prevent them from becoming global pandemics. Given the great concern for public health owing to the speed and increased volume of global transportation, the ability to rapidly develop and deliver vaccines when new 'unknown' diseases emerge offers our best hope to outpace EID outbreaks, save lives, and avert disastrous economic consequences." ] },{ "paper_id": "3c3ab717ef79befde82029b1362348708998d17e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3c47eea51db8f16e9de1d4303cfe054cc39416cc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3c4f6a15937affaf17af8ba34d069cc71968db53", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The following reference compounds were included: tenofovir (PMPA), AMD3100, ganciclovir, cidofovir, acyclovir, brivudin, the lectins Hippeastrum hybrid agglutinin (HHA) and Urtica dioica agglutinin (UDA), dextran sulfate (molecular weight 10000, DS-10000), ribavirin, oseltamivir carboxylate, amantadine and rimantadine, zalcitabine and alovudine.", "The last step involves the removal of the benzoyl protecting groups from O2 0 , O3 0 , and O5 0 positions of D-ribose 4a-j using sodium methoxide (NaOMe) in methanol [30] to afford the desired 1,2,3-triazole nucleosides 5a-j (Table 1 ). ", "influenza A H1N1 subtype, influenza A H3N2 subtype, and influenza B virus in MDCK (Madin-Darby canine kidney) cells." ] },{ "paper_id": "3c6601ba74b263d57b6b7fc0fbb7868d6ad2b107", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In the present study, we described the clinical and histological findings of a feline case of fibrinous pericarditis presumably caused by Moraxella osloensis.", "In conclusion, fibrinous pericarditis is a rare in cats, and empirical administration of antibiotics without surgical management could be insufficient for the treatment of the fibrinous pericarditis. This report described a rarely case of fibrinous pericarditis in a cat secondary to bacterial infection. Based on the morphological characteristics of the bacteria, Moraxella osloensis was suspected ", "A three-year-old spayed domestic short-haired cat, weighing 3.3 kg, presented to a primary care veterinarian with a one-week history of lethargy, anorexia, dyspnea and weight loss. The cat was group fed, liver indoors, and had no history of trauma. Thoracic radiography revealed cardiomegaly and pleural effusion. Due to lack of response to antibiotics, the cat was referred to the Veterinary Medical Center, Obihiro University of Agriculture and Veterinary Medicine (VMC-OUAVM)." ] },{ "paper_id": "3c6ed103b79757989428ac0f837b7a69f0d62b86", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All procedures were done at room temperature. Proteins were separated on 8.5 % polyacrylamide gels (20) and electrophoretically transferred to a dora-pore membrane according to the method of Burnette (8) using a semidry transfer blotter for 2.5 h at 36 V. After blocking with 3% skim milk in TBS for 1.5 h, blots were incubated with primary antibody in 3 % skim milk/ TBS for 1.5 h, and washed four times (5 rain each) with 0.05% Tween-20 in TBS. They were then incubated with secondary antibody (pemxidaseconjugated goat anti-rabbit IgG or anti-mouse IgG) in 0.05 % Tween-20/ TBS for 1.5 h, followed by four washes (5 rain each) with 0.05% Tween-20/TBS. Blots were stained using the enhanced chemiluminescence Western blotting detection system (Amersham Corp., Arlington Heights, IL). Protein bands were quantitated using an enhanced laser densitometer (LKB Instruments Inc., Bromma, Sweden) to evaluate the relative level of proteins in each subcellular fraction. The densitometric scan value was then estimated by multiplying the relative level by the protein yield (milligrams of protein) in corresponding subcellular fraction. In calculating the percent distribution of each immunodetectable protein, the densitometric scan value of the homogenate was defined as 100%.", "All procedures, except for the incubation with antibodies or FITCconjugated lectin at 37\u00b0C, were carried out at room temperature. Cells grown on coverslips were washed gently three times (5 rain each) with PBS, fixed with 4% paraformaldehyde in PBS containing 1 mM CaC12 and 0.5 mM MgCI2 [PBS(+)] for 20 rain, and permeabilized with 0.1% Triton X-100 in PBS(+) for 1 h. They were then rinsed twice with PBS(+), and incubated with 2 % FBS in PBS(+) to block nonspecific binding of primary antibodies for 1 h followed by 45 rain incubation with primary antibody in 2 % FBS/PBS(+). After washing four times (5 rain each) with PBS(+), cells were incubated with secondary antibody in 2% FBS/PBS(+) for 45 min. For localization of the Golgi complex, cells were incubated with FITCconjugated wheat germ agglutinin in 2% FBS/PBS(+) for 45 rain. After washing with PBS(+), they were then mounted on glass slides with 90% glycerol in PBS containing 1 m~/ml paraphenylenediamine, examined, and photographed on a microscope (BH-2; Olympus Corp., Tokyo, Japan) with Ektachrome 400 film (Kodak, Rochester, NY).", "Rat microsomal aldehyde dehydrogenase (msALDH) has no amino-terminal signal sequence, but instead it has a characteristic hydrophobic domain at the carboxyl terminus (Miyauehi, K., R. Masaki, S. Taketani, A. Yamamoto, A. Akayama, and Y. Tashiro. 1991. J. Biol. Chem. 266:19536-19542). This membrane-bound enzyme is a useful model protein for studying posttranslational localization to its final destination. When expressed from eDNA in COS-1 cells, wild-type msALDH is localized exclusively in the well-developed ER. The removal of the hydrophobic", "Frozen ultramicrotomy was performed as described by Tokuyasu (46) . Transfected cells were harvested by centrifugation at 1,000 g for 3 rain, and the pellet was fixed with 4% paraformaldehyde and 0.1% glutaraldehyde dis- Cell fractionation was performed as described in Materials and Methods. In calculating the percent distribution, each value of the homogenate was defined as 100%. The distribution of FP2 and succinate-cytochrome c reductase(SCR) is determined from the specific activities measured. The specific activities of the homogenate fractions are 52.3 + 11.0 nmol cytechrome c reduced/rain per mg protein (the mean + SD n = 4) and 26.9 + 2.8 nmol cytoehrome c reduced/min per mg protein for FP2 and succinate-cytochrome c reductase, respectively." ] },{ "paper_id": "3c919c2857ddedf0a444aa214761e16e4676d50b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Note that Step 4, performed to predict successful outcome, is an optional step. If", ". LCL have been used to present antigens in a variety of immunologic assays 2, 3 . In addition, LCL can be used to generate human monoclonal antibodies 4, 5 and provide a potentially unlimited source when access to primary biologic materials is limited 6, 7 ." ] },{ "paper_id": "3ca41eba26adc5422815f1d8043e76b406e747bd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3cb43b6223f2860048cc7bce8cb0ed0e490ddbda", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "At killing, blood was taken for clinical biochemistry (albumin, globulin, bilirubin, cholesterol, triglycerides, creatinine, glucose, protein, urea, calcium, alanine aminotransferase, alkaline phosphatase, \u03b1-amylase, aspartate aminotransferase, creatine kinase, glutamate-dehydrogenase, \u03b3-glutamyl-transferase, lactate dehydrogenase) and hematology (hemoglobin content, erythrocytes, leukocytes, differential blood count, reticulocytes, platelets, mean platelet volume, red cell distribution width, hematocrit, mean corpuscular volume, mean corpuscular hemoglobin, mean corpuscular hemoglobin concentration).", "IgG levels were statistically analyzed using GraphPad Prism 5 (GraphPad Software Inc., La Jolla, USA). Normality of data was tested with Shapiro-Wilk test prior to applying either two-tailed Student's t-test or Mann-Whitney test to analyze differences between means of two groups (P \u2a7d 0.05).", "OR, DO, AE and CJ are employees and MS is Chairman of the Executive Board of Mologen AG. CH is employee of IMGM Laboratories GmbH. AW is employee of LPT GmbH & Co. KG. MOLOGEN AG owns a patent for the MIDGE-Th1 vector (PCT/ DE02/03798P74). These affiliations do not alter the authors' adherence to Gene Therapy policies on sharing data and materials. FJS declares no conflict of interest." ] },{ "paper_id": "3ced31e65e14cbd45628ea410b50d4e4841c9f50", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "BMJ Open publishes all reviews undertaken for accepted manuscripts. Reviewers are asked to complete a checklist review form (http://bmjopen.bmj.com/site/about/resources/checklist.pdf) and are provided with free text boxes to elaborate on their assessment. These free text comments are reproduced below.", "3-would it be helpful to add a model consent form and other related documentation given to participants (including instructions on how to use the devices)?", "Answer:" ] },{ "paper_id": "3cf33ae7aecff3052d051eefe7f4d26287c0217d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "How might it impact on clinical practice in the foreseeable future?", "What are the new findings?" ] },{ "paper_id": "3d4c571fcd1ba20b5c25488e82ced70014652cd4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3d5f2ea9eca2aa8acb508626fef27e7b1c087312", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3d6462be232a3f4b4aab41386a74bb8e6a118b44", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3d86ddb1f87053b373d42baadaba6a449fb22fa4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis was performed using the SPSS software (version 10, SPSS Inc., Chicago, IL, USA), and graphs were prepared using Prism software (version 4.0, GraPad Software, Inc., San Diego, CA, USA). Mann-Whitney U test, Chi-squared or Fisher's exact test were performed to assess the significance. A P value < 0.05 was considered statistically significant for all the tests.", "To obtain standard curves for absolute quantification, the PCR product of HBoV was cloned into a plasmid vector pGEM\u00ae-T Easy Vector (Promega, Madison, WI, USA), purified using a QIAprep mini prep kit (Qiagen Inc., Valencia, CA, USA), and quantified using UV spectroscopy (1 genomic copy = 5 \u00d7 10 -12 \u00b5g). Serial 10-fold dilutions of the cloned plasmid were prepared to generate the standard curves.", "Ninety-three (4.8%) of the 1,926 nasopharyngeal aspirates obtained from patients of all age-groups were positive for HBoV. Our detection rate is similar to that stated in other reports [2, 3, 8] . Generally, HBoV is detected in fewer than 8% of respiratory specimens [1, [8] [9] [10] [11] [12] [13] ; however, higher detection rates ranging from 10.3% to 19% have been reported [5, 14, 15] .", "Human bocavirus (HBoV) was newly discovered by Allander et al. [1] and was stated to be the possible causative agent of respiratory illness. Phylogenetic analysis of the complete genome of HBoV revealed that the virus is most closely related to canine minute virus and bovine parvovirus, which are members of the Bocavirus genus of the Parvoviridae family [1] ." ] },{ "paper_id": "3dc1b1e197ec2bdd5ee03a588505a7a7c127c79d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All study-related activities were conducted according to good clinical practice, which includes the provisions of the Declaration of Helsinki.", "A fast, automated POCT, the Cepheid Xpert Influenza+RSV Xpress Assay, was used according to the manufacturer's instructions. 16 A nasal swab was suspended into 3 mL of universal transport medium (UTM, Copan Italia, Brescia, Italy) and 300 \u00b5L of suspension was added into the assay cartridge, which was then loaded into the Cepheid GeneXpert II instrument. After a processing time of 30 min, the test reading was recorded.", "The difference between proportions was tested with a binomial standard normal deviation (SND) test and 95% CIs were calculated accordingly." ] },{ "paper_id": "3dd8351aa51cbbf5dbfbd90a569efbad88b57b36", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "shown in Table 1 . ", "describing adults was realized by Bellei and colleagues (2007) detecting 37.7%.", "Many studies have investigated the occurrence of rhinovirus among community cases but there is a lack of information about the frequency of rhinovirus asymptomatic cases. We investigated HRV infections rates on selected populations of a pair of one child and one family member, health care workers (HCW), and immunocompromised patients with and without respiratory symptoms from June to September." ] },{ "paper_id": "3de90c8c18dbed90408c4a5cc5cb94f856c9f637", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cystoisospora canis, C. ohioensis, and C. burrowsi cause diarrhea in puppies < 6 months of age and immunocompromised dogs [3] . Although C. canis is the prevalent Cystoisospora species in dogs, C. ohioensis is frequently detected in Chinese dogs [4] .", "Recently, Japanese raccoon dogs were identified as the reservoir host of C. ohioensis [5] . However, no clinical cases of canine cystoisosporiasis have been reported to date in Korea although experimental infection and sporulation of C. ohioensis isolates have been performed in Korean puppies [6] .", "It is difficult for veterinary clinicians to diagnose cyclosporiasis and cystoisosporiasis based on clinical signs alone. The morphological similarity of Cyclospora and Cystoisospora oocyst hinders microscopic diagnosis using stools. Thus, both microscopic examination and molecular techniques for differential diagnosis are used [4, 5] . The present study aimed to describe a clinical case in which the protozoan pathogen C. ohioensis was identified in a Korean dog, using microscopy of diarrheal stools and confirmed using phylogenetic analysis of 18S ribosomal RNA (rRNA)." ] },{ "paper_id": "3e039d09e97b28724f19438f21fcebab6c15c986", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3e107cc95d4428962d4fc859f24b87bf0b8433e5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3e1874b3a7b354af8cb25bfcd127ba887afe92c2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org/ lookup/suppl/doi:10.1128/mBio.01461-15/-/DCSupplemental. Figure S1 , TIF file, 2.8 MB. Figure S2 , TIF file, 2.8 MB. Figure S3 , TIF file, 2.8 MB. ", "DENV type-specific PCR and RFLP analysis. Total RNA was isolated from viral supernatants and used as the template for cDNA synthesis using standard molecular techniques. Serotype-specific PCR and restriction fragment length polymorphism (RFLP) restriction endonuclease analyses were performed on cDNA samples in order to validate the purity of the recombinant viral preparations (see Fig. S2A , B, and C in the supplemental material).", "Virus construction. Recombinant viruses were constructed using a four-cDNA cloning strategy, the same strategy used to create wt DENV infectious clones (see Fig. S1 in the supplemental material). Patterned after coronavirus cDNA clones (28, 29) , the DENV-4 genome was subcloned into four separate cDNA plasmids. A T7 promoter was introduced into the 5= end of the A fragment, and unique type IIS restriction endonuclease cleavage sites are introduced into the 5= and 3= ends of each fragment to allow for systematic assembly into a genome-length cDNA from which full-length transcripts can be derived (28) (29) (30) ." ] },{ "paper_id": "3e213ce275307f241723cf26bcb756dcba2a6b5b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The Evolutionary History of Bacterial tRNA Modifications Is Highly Dynamic", "The cmo 5 U modification exists in tRNA molecules for four box codons (Leucine, Valine, Serine, Proline, Threonine, and Alanine) and therefore there were three possible nontarget tRNA in each case. However, tRNA with GNN anticodons (where N is any nucleotide) in each of these codon boxes can also recognize NNU codons via GU wobble pairing. Thus, we only focused on the nontarget tRNA that have CNN anticodons (indicated in fig. 1C ).", "Supplementary data are available at Molecular Biology and Evolution online." ] },{ "paper_id": "3e2e2a0b86f45e26fbd4724a26d74b62a5f7b0e3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Samples of 10-20 ~1 of extracts from whole cells, spheroplasts, or spheroplast supernatants were resolved by SDS-PAGE (Laemmli, 1970) on 8% polyacrylamide gels and then electro-blotted to nitrocellulose filters. For Western blot detection, the following antibodies were used: rabbit antiinvertase at 1:1,000 dilution, mouse anti-M2 (Eastman Kodak Co., Rochester, NY) at 1:10,000 dilution, HRP-coupled protein A (Organon Teknika-Cappel, Durham, NC), at 1:10,000 dilution, and HRP-coupled sheep anti-mouse Ig (Amersham Corp., Arlington Heights, IL) at 1: 10,000. Blots were developed using the ECL detection system (Amersham Corp.).", "For Endo H digestions, 5 vd of boiled protein extract was diluted with 2-3 vol of 50 mM sodium citrate, pH 5.1, containing 100-250 U of Endo Hf (New England Biolabs) and incubated at 37\u00b0C for 2-16 h. Samples were boiled before gel electrophoresis.", "To spheroplast cells, induced cultures of 6 x 107 cells were washed in distilled water, incubated in 0.3 ml of 100 mM Tris-SO4, pH 9.4, 50 mM 13-merceptoethanol for 10 min, washed in 1.2 M sorbitol, resuspended in 60 txl of spheroplasting buffer (1.2 M sorbitol, 10 mM Tris-HCl, pH 7.5) containing 60 U of recombinant lyticase, and incubated for 30 min at 30\u00b0C. The endpoint for complete spheroplasting was determined by >85% cell lysis upon dilution into 1% Triton X-100. Centrifugation at 500 g for 5 min yielded a supernatant fraction containing extracellular enzyme and a spheroplast pellet. Pellets were washed in spheroplasting buffer and lysed by vigorous agitation with acid-washed glass beads. Both supernatant and pellet fractions were boiled in sample buffer. In spheroplasting experiments where protease inhibitors were used, 1 mM PMSF and 0.5 Ixg/ml leupeptin (both Boehringer Mannheim Corp., Indianapolis, IN) were added to the YEP containing 0.1% glucose induction medium, spheroplasting buffer, and lyticase." ] },{ "paper_id": "3e3f1f1b1f7f02523bc38fc9a0c321d1ccc9e1b8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Laboratory variables were determined as previously described. 9 In brief, serum chemistry variables and enzyme activities were determined with an automated analyzer system a and a complete blood cell count was performed with a hematology analyzer (pocH-100iV DIFF, Sysmex).", "Objectives: To describe clinical signs, laboratory variables, and pathological findings of ZDL syndrome and their utility to differentiate ZDL from BHZD and infectious diseases with similar phenotype.", "Histologically, the mucosa of the oral cavity and muzzle was multifocally eroded or ulcerated with many infiltrating neutrophils and many suprabasilar apoptotic keratinocytes in the deep epithelial papillae (Fig 2d) ." ] },{ "paper_id": "3e40cb7055fe5ef148eced8994ff059a0e98aef1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Nucleic Acids Research, 2010, Vol. 38, Web Server issue W93", "Description of the i-GSAE4GWAS web server System development, configuration and system overview. i-GSEA4GWAS is written in Java and JSP. The program is running in a high-end computing cluster with six dedicated Intel XEON Quad-Core CPUs at 2.0 GHz and two dedicated Intel XEON Quad-Core CPUs at 3.0 GHz (representing a total of 32 cores) with a total of 96 GB of memory.", "Input data. The input data of i-GWAS are SNP data, mainly P-values. The server will transform the P-value to \u00c0log(P-value). Some other values of association test like odds ratio and statistics are also accepted. Here, we define all these input values as 'association value'. The detailed format of input is a SNP list with two columns, namely SNP identifier and its corresponding association value. A gene list with gene HUGO symbol (http://www .genenames.org/) (18) and along with corresponding association value is also accepted but not recommended due to the limitation of gene variation as described above." ] },{ "paper_id": "3e43db4bbfa0307b42810ceb2b3cd07e2c321e2b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3e5edc4ff36064478e209800a15365cd5f710756", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3e66fa6e5fa282546d206b4d2c55ad15f38f7563", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "other findings when there is extensive involvement by the disease.", "Objetivo: Descrever os aspectos encontrados em TCAR do t\u00f3rax de pacientes infectados pelo v\u00edrus influenza A (H1N1). M\u00e9todos: Foram analisadas retrospectivamente as TCAR de 71 pacientes (38 femininos e 33 masculinos) com diagn\u00f3stico confirmado de influenza A (H1N1) atrav\u00e9s da identifica\u00e7\u00e3o laboratorial do v\u00edrus, estudados no per\u00edodo entre julho e setembro de 2009. A interpreta\u00e7\u00e3o das TCAR foi realizada por dois radiologistas tor\u00e1cicos de forma independente, e, em caso de discord\u00e2ncia, as decis\u00f5es foram tomadas por consenso. Resultados: Os achados de TCAR mais comuns foram opacidades em vidro fosco (85%), consolida\u00e7\u00e3o (64%) ou a combina\u00e7\u00e3o de opacidades em vidro fosco e consolida\u00e7\u00e3o (58%). Outros achados foram n\u00f3dulos do espa\u00e7o a\u00e9reo (25%), espessamento das paredes br\u00f4nquicas (25%), espessamento de septos interlobulares (21%), padr\u00e3o de pavimenta\u00e7\u00e3o em mosaico (15%), espessamento perilobular (3%) e aprisionamento a\u00e9reo (3%). As altera\u00e7\u00f5es foram frequentemente bilaterais (89%), com distribui\u00e7\u00e3o n\u00e3o espec\u00edfica (68%). Derrame pleural, quando observado, foi, em geral, de pequena monta. N\u00e3o foram observadas linfonodomegalias. Conclus\u00f5es: As altera\u00e7\u00f5es predominantes foram opacidades em vidro fosco, consolida\u00e7\u00f5es ou a combina\u00e7\u00e3o de ambas. O acometimento foi frequentemente bilateral e n\u00e3o houve predom\u00ednio quanto \u00e0 distribui\u00e7\u00e3o (axial ou craniocaudal). Apesar de inespec\u00edficos, \u00e9 importante reconhecer os principais aspectos tomogr\u00e1ficos da infec\u00e7\u00e3o por influenza A (H1N1) a fim de incluir essa possibilidade no diagn\u00f3stico diferencial de sintomas respirat\u00f3rios. Descritores: Pneumonia viral; Tomografia computadorizada por raios X; V\u00edrus da influenza A subtipo H1N1.", "features of the disease becomes important in clinical practice." ] },{ "paper_id": "3e880727d0c88f982bad7fa677c2a8dc1d837dc7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In-depth literature review was conducted using Cochrane engine and google scholar. The questionnaire Disclosure. Authors have no conflict of interests, and the work was not supported or funded by any drug company." ] },{ "paper_id": "3ef8cc40a38577b24aab94171acf6959598b32c7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Dogs were client owned or protection dogs brought to the Kagoshima University Veterinary Teaching Hospital for veterinary care. Residues of heparinized blood samples applied for biochemical tests were used in this study. Information including the patient's signalment, body condition score (5 points scale), diagnosis and undergoing treatment was obtained from the veterinary medical record or from the veterinarians in charge.", "Previous studies have characterized Sir2 protein as a pro-longevity factor for replicative lifespan in yeast [15, 20, 26, 46, 53] . Sir2 orthologs also extended lifespan in other organism species including Caenorhabditis elegans and flies [43, 50] . Because it has been suggested that the beneficial effects of caloric restriction on lifespan are mediated by Sir2 orthologs in higher eukaryotes [4, 7, 8, 44] , sirtuins received significant public interest. Sirtuins are a family of highly conserved nicotinamide adenine dinucleotide (NAD + )-dependent protein deacylases found in eukaryotes. In humans, there are seven sirtuin homologs (SIRT1-7). All sirtuins require NAD + as a cofactor, making them prone to regulation by fluctuations in NAD+ conditions, thus linking them to cellular metabolism in response to nutritional and environmental perturbations such as caloric restriction. Of all the sirtuins, SIRT1 has received the most attention in relation to longevity. It deacetylates key histone residues involved in transcription regulation, and multiple non-histone proteins including p53, FOXO1/3, PGC-1\u03b1 and NF-\u03baB [11, 37, 51] . By targeting these proteins, SIRT1 is able to regulate numerous vital signaling pathways, including DNA repair, apoptosis, muscle and fat differentiation, neurogenesis, mitochondrial biogenesis, hormone secretion, cell stress responses and circadian rhythms [3, 37, 42] . In general, SIRT1 activation triggers nuclear transcription programs that enhance metabolic efficiency and up-regulate mitochondrial oxidative metabolism accompanying resistance to oxidative stress [13, 16] .", "To our knowledge, there are few published studies measuring SIRT1 level in companion animals [17, 18, 30, 31] . In dogs, there are two reports: one is in association with the p53 mutations status in a dog with multiple tumors [31] , and the other evaluated SIRT1 gene expression in a cell line in relation to coronavirus infection [30] . The reason for the low number of studies is, at least in part by, the lack of antibodies to detect canine SIRT1." ] },{ "paper_id": "3f1cfb6b5432c28ba97e2c1fbb8ca341c35f6b4e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3f50d334193fa8cd216e4c4166e43fb0c8109709", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Values are presented as means and standard deviations (s.d.). Statistical significance among different vaccination groups was calculated by Student's t-test using GraphPad Prism statistical software. P values less than 0.05 were considered statistically significant.", "Cellular & Molecular Immunology" ] },{ "paper_id": "3f5d545fbca8b7c83ff7b10f827d772cb0011aa4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3f65b990d1f24de2bf3cd52d8559e8ccba9961af", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3f704d2ac81e0dc4e9e74ffd7d25f790baa6ebe1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Protein structure accession number. Coordinates and structure factors have been deposited into the Protein Data Bank under accession number 5HJ3." ] },{ "paper_id": "3f9572ae671d876279b4d2cd6b6544b24fb3e52d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "3f95cd9324e4e68dfac149200521e09981091feb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Overall, evidence justifying the use of E. faecium under these conditions is limited.", "To date, four bacterial strains/products have been examined by the European Food Safety Authority (EFSA) for their safety and efficacy as probiotics or feed additives in dogs. This includes two Enterococcus faecium strains (E. faecium NCIMB 10415 E1705, E. faecium NCIMB 10415 E1707), Lactobacillus acidophilus DSM 13241 25 and Bifidobacterium sp. animalis.", "Infectious and non-infectious acute diarrhoea", "Overall data on improving gut health or immunological status in dogs using lactobacilli or bifidobacteria are not compelling, especially in the light of the fact that it is not known if increasing certain bacterial phyla is correlated with improved GI function or a lower incidence of diarrhoeic diseases." ] },{ "paper_id": "3fa8abac6ce337d7597f4c0d4adac979c4e0b9b7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Coronaviruses are a diverse group of large, enveloped positivestranded RNA viruses in the order Nilovirales, family Coronaviridae, and genus Coronavirus. Typically, they cause respiratory and enteric diseases in humans and animals. Using the open reading frame (ORF) 1a sequences, SARS-CoV was categorized as a subgroup of the group II coronaviruses. 9 The 30 kb poly-adenylated positive-stranded RNA genome 10, 11 has an genomic organization typical of a coronavirus where the first two ORFs (1a and 1b) encode the viral replicase that requires processing by the viral cysteine proteinases to yield the functional membrane-bound replicase complex and a group of 16 non-structural proteins (NSP). 12 Although some functions of these NSPs have been investigated and known, there are many others that still require further characterization (reviewed by Cheng et al. 13 ).", "Although T cell response could be observed for the M protein, current studies seem to suggest that the 3a protein is more immunogenic in comparison, and T cell epitopes identified in it may play an important role in recovery from a primary SARS-CoV infection and in vaccine development.", "Finally, it is important to note that T cells can play a protective and/ or pathological role during an infection. In the case of mouse-hepatitis virus (MHV), an increase of morbidity and mortality in infected mice has been associated with memory T cells. 76 Although no direct evidence have shown that SARS-CoV-specific T cell responses contribute to immunopathology in SARS, it is a question that needs to be further addressed. T cell immune response in SARS coronavirus infection HLJ Oh et al 5" ] },{ "paper_id": "3fad6dea4f2f9afda7699aa3b79d11b4ddfb57fd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Several studies revealed a higher postoperative morbidity, delayed healing, and more frequent secondary infections in malnourished patients with amputations than in non-malnourished patients. Malnutrition encourages dropping sutures. An earlier acute or chronic malnutrition trauma slows healing. Zinc as a trace element is quantitatively the most important one and is involved in the construction of over 200 enzymes with effects as follow: improving cell growth and differentiation, fibroblast proliferation, collagen synthesis, strengthening the immune system and increasing steroid receptors [21, 22] ." ] },{ "paper_id": "3ffe5f150d7f8fe18d126f3c5035ed9425f9f4b6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "where \u03bb is a shrinkage parameter for the L 2 -norm penalty.", "where r k is the 1 \u00d7 m vector of residuals for m samples." ] },{ "paper_id": "40470023462dcfcc8ed653d73a5dd255699abcad", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "404f219ad630336f512bb52d5e6b357adf10e130", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Methods: In total, 44 children aged 0 to 24 months with febrile UTI and 35 age-and sexmatched controls with fever from other causes were enrolled in the study. ELISA was performed to determine the level of YKL-40 in urine collected from each child.", "Background: Given that YKL-40 is a known marker of inflammation, we sought to determine its association with urinary tract infection (UTI) in febrile children.", "ROC curves were analyzed to compare the diagnostic value of urinary YKL-40/Cr with abnormal urinalysis findings (pyuria and positive nitrite) for detecting UTI ( ", "Determining the levels of urinary YKL-40/Cr may help identify true cases of UTI in febrile young children, especially when they have pyuria but not nitrite, or have neither pyuria nor nitrite in the urine. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited." ] },{ "paper_id": "4090c4a0e8cead64dd9e44a1610fb4f557fefdcf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors have nothing to declare." ] },{ "paper_id": "40b2b0e3d2cf519723d858a138e77a26a70f460f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "40c0532640a8bb9d9a0aac07d017d5982af33fdb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "same owner and referred to a veterinary hospital. The analyzed tissues included kidneys, mesenteric lymph nodes, a spleen, and an eye and its vitreous humor. Whole blood samples were treated with ethylenediaminetetraacetic acid as an anticoagulant.", "MATERIALS AND METHODS", "The lengths of truncated 3c proteins expressed by FCoVs were predicted to range from 3 to 235 aa, corresponding to 1.3-99.2% of the length of the wild-type protein." ] },{ "paper_id": "40f79b91682886f0f531b6bb876482a23cd6e400", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In conclusion, our study suggests that initial laboratory findings of patients with acute febrile illness could be potential predictors for MERS-CoV infection during the nosocomial outbreak. Monocytosis with normal WBC count and low CRP level may be useful markers for the prediction of MERS and triage at the initial presentation of acute febrile patients.", "A case-control study was performed to identify clinical predictors for Middle East respiratory syndrome coronavirus (MERS-CoV) infection among patients with acute febrile illness during the nosocomial outbreak. Patients with MERS-CoV were more likely to have monocytosis with normal white blood cell (WBC) count and lower C-reactive protein (CRP) level. Simple laboratory data such as complete blood counts (CBC) with differential count could be a useful marker for the prediction of MERS and triage at the initial presentation of acute febrile patients in outbreak setting.", "In the current study, we found that simple laboratory data such as CBC with differential count could be a useful marker for the prediction of MERS-CoV infection during the nosocomial outbreak. During the nosocomial outbreak of MERS-CoV infection, an unexpected exposure of patients and health care workers can occur, and strict infection control measures are important for the prevention of MERS-CoV spread. Identification of clinical predictors for MERS-CoV infection would be useful in triaging patients into risk categories to determine the likelihood of MERS-CoV infection (7) ." ] },{ "paper_id": "41199e837e1c706b7a8a1a8a0970856974235566", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study investigated the role and mechanism of alprostadil in acute respiratory distress syndrome (ARDS) induced by oleic acid (OA) in rats.", "Thirty male Sprague-Dawley rats (200-300 g weight and 7-8 weeks of age) were purchased from the Animal Center of Yanbian University, Jilin, China (License No.: SCXK" ] },{ "paper_id": "4135ace30ea08a669730959e0f98a4af06537d07", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ethics approval was granted by the Hunter New England Human Research Ethics Committee (HREC), Australia (Ref: HREC/13/HNE/265). To verify the vaccination records of pilgrims, data were cross-checked with another ongoing trial by our team with a separate ethics approval from the Hunter New England HREC (Ref13/05/15/3.05). ", "Twenty-six (14.2%) participants had S. pneumoniae detected by NAT ( " ] },{ "paper_id": "4178b81e61b88d5cc07ca0253875007e93e9a7f5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Nanomicelles stabilize peptides in active biological form (\u03b1-helix), which is preferred for ligand-receptor interactions, and prevents rapid peptide degradation in vivo, thereby prolonging bioactivity [25, 26] . Unlike surfactant micelles, a low critical micellar concentration (\u223c1 \u00b5M) of these nanoparticles prevents their disintegration upon dilution in biological fluids. Importantly, the PEG 2000 moiety of SSM confers steric hindrance in the circulation, while their nanosize mitigates renal clearance and extravasation from intact microvessels. This, in turn, prolongs the circulation time of drug-loaded nanomicelles and promotes preferential extravasation from hyperpermeable lung microcirculation, the hallmark of ALI, into the injured lung.", "To effectively block the expression of TREM1, we developed LP17 peptide nanomedicine, LP17-SSM. LP17 is the soluble TREM1 or extracellular component which binds and inhibits signaling through TREM1 [5] . Control SSMs were prepared by using scrambled peptide. For the TREM1 blocking peptide, LP17, circular dichroism confirmed that there was a significant increase in \u03b1-helicity in the presence of SSM compared to the free peptides in normal saline. This indicated the presence of peptide-micelle interaction where the peptides changed from a random conformation in saline to a more ordered helical structure when associated with SSM. To determine in vivo anti-inflammatory efficacy and the dose-response effect of LP17-SSM, we established the dose and time-dependent effects as with GLP-1-SSM [16] . Mice were given one dose of LP17 nanomedicine, nanoscrambled peptide, PBS, or LP17 subcutaneously in a single dose prior to LPS challenge. The ALI animal model used was based on previous publications [16, 37] . Mice were challenged with aerosolized LPS by nebulization (8 mg LPS dissolved in phosphate-buffered saline at the concentration of 1 mg/mL) administered via DeVilbiss disposable nebulizer (at the continuous air flow rate of 10 ft 3 /h) over 1 h to induce ALI. The animals were sacrificed 12 h after LPS nebulization.", "Studies with other nanomicellar preparations such as 17-AAG, curcumin, and PPAR\u03b3 agonists for treatment of ALI/ARDS are currently ongoing in our laboratory [8] . Together, our studies demonstrate the feasibility of translating the use of these nanomicellar preparations for translational human studies to the clinics to treat this devastating disease. We hypothesize that combinatorial administration of nanomicelles or use of more pleiotropic agents that modulate multiple signaling pathways will prove to be more potent; however, further studies are needed to optimize the administration of the nanopreparations. ", "We have also tested the efficacy of TREM1 nanomicellar peptides in a model of LPSinduced sepsis and lung injury. TREM proteins are a family of immunoglobulin cell surface receptors expressed on myeloid cells. TREM1 was the first TREM identified, and blockade of TREM1 has been shown to improve survival in animal models of sepsis [33] . We have extensively studied the mechanisms by which TREM1 amplifies inflammation [30] [31] [32] [33] [34] . Previous studies where TREM1 blockade was used therapeutically in models of sepsis and infection employed fusion proteins (soluble or extracellular components of TREM1) [23, 33] . These peptides are limited by their short half-life and therefore may not be practical for therapeutic purposes." ] },{ "paper_id": "417cbe38a2f8a93d0827cd67f4c42076921d6050", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Primary cells are cells isolated directly from tissues or blood using enzymatic or mechanical methods. The cells are characterized by their high degrees of specialization, are often fully differentiated and thus require defined culture conditions (serum-free media) in order to preserve their original phenotype.", "J o u r n a l P r e -p r o o f", "Fifty BSAAs possess not only antiviral but also antibacterial activity ( Figure 4 ; Table S1 ) (Schor and Einav, 2018) . Moreover, 13 of the 50 agents are approved as antibiotics (2 withdrawn " ] },{ "paper_id": "418d9334932cd1b03e23fd6e03c01e660fff4bd4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Test strains were grown in 100 ml LB medium containing 100 mg/ml ampicillin in 500 ml flasks at 250 rpm and 37 C. After 24 h, 200 OD 600 units of cells were collected by centrifugation at 4000g and 4 C for 20 min. Cells were lysed and purified by Ni-NTA under native conditions according to the manufacturer's protocol (Qiagen). Purified protein samples were resolved by SDS-PAGE (10% w/v polyacrylamide). Gel band excision and in-gel trypsin digestion were performed using a previously described standard method (33) .", "Fraction of FS m \u00f0%\u00de observed by MS", "where A FSm is the sum of peak areas at different charge states for an FS m target peptide and A FSz is the same for an FS z target peptide in MS.", "Escherichia coli XL1 blue MRF 0 (Stratagene, La Jolla, CA, USA) was used in all experimental studies. All constructs were verified by DNA sequencing at the Cornell Bioresource Center. Construction of the dual fluorescence reporter was described earlier (27, 30) , except that different linker sequences were incorporated into the reporter plasmid ( " ] },{ "paper_id": "41a94f21d4dc3946e1377439a2a3880fb9d33776", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "with four consecutive SNPs spanning the region from 68-91 megabase pairs (Mbp, Fig. 2 Fig. 2 F) , including refined border regions for mice #14 and #28. Mice having apparently discordant levels ( Fig. 2 B , bottom dot plots), which correlated directly with increased or normal CD5 expression, respectively. These results confirmed the existence of a genetic modifier locus/ loci that regulates BCR-induced AICD and CD5 expression.", "phenotypes under low resolution mapping (viable, #2 and 19; nonviable, #44, Fig. 2 ", "Fluorescently labeled HEL protein (Sigma-Aldrich) was made using Pacific blue succinimidyl ester (Invitrogen) according to the manufacturer's instructions, and dialyzed 4\u00d7 against a large volume of room temperature PBS." ] },{ "paper_id": "41d42af9e99779958c80165b6958a1cbeba023a9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "41deae1169912161f5195d978626aa2ca1898994", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All values in the study were presented as the means \u00b1 SD. Statistical significance among groups was determined using a student's-two-tailed t test. A p \uff1c 0.05 was considered to be statistically significant.", "Infectious bronchitis virus (IBV), a member of the coronavirus family, is prevalent in all countries with an intensive poultry industry [8] . IBV is highly infectious and spreads rapidly in unprotected birds [32] . IBV replicates in the epithelium of respiratory tract tissues, as well as in many non-respiratory tissues, such as those from kidneys and gonads [5, 29] . There are a large number of IBV variants worldwide, and they cause great economic losses to the poultry industry.", "Spodoptera frugiperda Sf-9 cells were maintained in Grace's insect cell culture medium (Gibco, USA) supplemented with 10% heated-inactivated fetal bovine serum (FBS), 100 \u03bcg/mL streptomycin and 100 IU/mL penicillin in a 27 o C humidified incubator. IBV strain H120 (accession number M21970) was propagated in 9-day-old specific pathogen free (SPF) embryonated chicken eggs." ] },{ "paper_id": "41df61dc89201d699b23532cbd09da787afa7e84", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The excitatory amino acid glutamate serves as a fast excitatory neurotransmitter in the central nervous system (1) , and excitotoxicity and oxidative toxicity are considered to be two major pathways responsible for glutamateinduced toxicity (2, 3) . Excessive release of glutamate leading to excitotoxicity is responsible for neuronal injury associated with many acute and chronic brain diseases, such as brain ischemia, traumatic brain injury, and neurodegenerative disorders (4, 5) .", "In conclusion, GA protects DPC12 cells against glutamate-induced neurotoxicity mainly through ERK and mitochondria-related pathways. Our findings provide experimental evidence that GA may be a candidate for treating or preventing neurodegenerative diseases.", "One-way analysis of variance followed by post hoc multiple comparisons (Dunn's test) were performed to detect statistically significant differences (P,0.05). Data are reported as means\u00b1SD." ] },{ "paper_id": "41e98d93f0f9f490c34dc4e8f96340cf477e7355", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was approved by the ethics committee of the Armed Forces Medical Command, which waived the requirement of informed patients consent for this retrospective study.", "A malaria smear and triple antibody tests of Hantann, leptospirosis, and Tsutsugamushi virus were also performed to rule out other potential causes of fever, and revealed no remarkable abnormalities." ] },{ "paper_id": "425e0ee111062385cb630f0ea0659608d5fbec5c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "426da8c3fb9c6792b5d26214d55471099877e337", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data analysis. Data from the genome quantification and TCID 50 assays was analyzed in Prism (GraphPad Software) and CompuSyn (combosyn.com)." ] },{ "paper_id": "426eeb6c4a3047760cd5402f4f4771a317026f95", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The genus Ebolavirus of the family Filoviridae (Order: Mononegavirales) is comprised of five recognized species, with Zaire ebolavirus (ZEBOV) representing the prototype species. ZEBOV is a significant human pathogen with case fatality rates often reaching 90%. To date there have been numerous outbreaks of ZEBOV, 1 the largest of which occurred in West Africa in 2014 and resulted in >28,000 human cases and >11,000 deaths. 2, 3 The high case fatality rate and magnitude of the 2014 outbreak in West Africa illustrates the pressing need for the development of a safe and efficacious vaccine to prevent future ZEBOV outbreaks.", "At 14 days post exposure, to allow plenty of time for dissemination to occur, 48 mosquitoes from each group were anesthetized by cold treatment at 4 C. Legs & wings were removed and transferred into a 2 mL Eppendorf Safe-Lock tube containing 250 mL mosquito diluent, and a stainless steel bead for homogenization. Bodies were placed in a separate 2 ml Eppendorf Safe-Lock tube prepared similarly. Mosquito tissues were prepped and titrated as described above.", "Disclosure of potential conflicts of interest T.P.M. is an employee of New Link Genetics." ] },{ "paper_id": "427e9059167b857c57f420d2fd243be87f6b8a33", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ab 5 antibody; Ag 5 antigen; ALT 5alanine aminotransferase; AST 5aspartate aminotransferase; CFT 5 complement fixation test; EIA 5 enzyme-linked immunosorbent assay; GGT 5 gamma-glutamyl transferase; IFA 5 indirect fluorescent antibody; IgM 5 immunoglobulin M; WBC 5 white blood cell count.", "A brain biopsy of the right frontal lobe revealed features of meningoencephalitis, with inflamed fibrous leptomeninges, scattered microglial nodules, and a perivascular as well as interstitial lymphocytic infiltrate in the cortex (Fig 3) . The white matter also contained a few microglial nodules and small number of perivascular lymphocytes (not shown). The perivascular and interstitial lymphocytic infiltrate was composed predominantly of CD8 1 T lymphocytes. No viral cytopathic changes were seen. Conventional CSF and brain biopsy studies failed to identify a causative organism ( Table 2) .", "The patient is a 34-year-old man from Australia with a history of hypochondroplasia and X-linked agammaglobulinemia (confirmed germline mutations in fibroblast growth factor receptor 3 [FGFR3] and Bruton tyrosine kinase [BTK], respectively). The antibody deficiency was diagnosed in infancy, and the patient commenced lifelong intravenous immunoglobulin (IVIg) therapy. The patient suffered from chronic sinusitis despite IVIg therapy and was treated with clarithromycin prophylaxis. Despite mild developmental delay and associated learning difficulties, he completed school and vocational training and went on to full-time employment as a retail store manager." ] },{ "paper_id": "42d6a33f03497257ad765977dd53d0c4709e5e77", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "433c16daf21bb7f5f0d6379d67fe0917c2aa0281", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "but chest radiography revealed ill-defined opacities in both of his lower lungs.", "Background and Purpose Middle East respiratory syndrome (MERS) has a high mortality rate and pandemic potential. However, the neurological manifestations of MERS have rarely been reported since it first emerged in 2012." ] },{ "paper_id": "43ac139b156b7a9397d9da995694319fdeeba0f4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(2) intervention for difficulty in adaptation, mainly by social psychologists. Among them serious mental problems (e.g. violence, suicide behaviors) must be managed by psychiatrists. Such emotion hypothetical model of psychological crisis intervention is shown in Fig. 1 .", "We propose that the psychological crisis intervention should be dynamic, adapted to suit different stages of the epidemic, i.e., during and after the outbreak. During the outbreak, mental health professionals should actively participate in the overall intervention process for the disease, so that the mental health and psychosocial response can be mobilized in a timely fashion. 12 Specifically, psychological crisis interventions should be integrated into the treatment of pneumonia and blocking of the transmission routes. In this stage, psychological crisis intervention should include two simultaneous activities: (1) intervention for fear of disease, carried out mainly by physicians and assisted by psychologists;", "Based on our experience about the model of psychological intervention practicability and effectiveness, West China Hospital developed and is carrying out the psychological rehabilitation plan, namely the two-stage psychological intervention model (Fig. 6) . The central idea is to integrate Internet technology to the whole process of intervention, and to combine early intervention with later rehabilitation. In order to help patients and general population in the COVID-19 epidemic, we are trying to share it with all mental health hospitals in Sichuan Province to help relieve psychological aftershock of the public emergency. However, there are still many problems with the current psychological interventions, including effective utilization of Internet resources/tools, and efficient cooperation between medical staffs and psychologists." ] },{ "paper_id": "43aeebc83e75673430343bc8f01df5a96793b217", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "43eb920135bc1acb5cb4f1d91b5d06079c53765b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "These results indicate that ABT-263 sensitises cells to death at multiple stages of IAV infection following virus endocytic uptake.", "In conclusion, anticancer therapeutics may accelerate or attenuate microbial infection in cancer patients by targeting host functions essential for host-microbe interplay. However, anticancer programs have neglected the possibility of evaluating the effects of investigational small molecules on this interplay. Preclinical trials are typically performed on pathogen-free mice with xenotransplanted human tumour cells, and early stages of clinical trials focus on tumour regression and long-term survival without taking into account the potential impact of the chemotherapeutic agent in conjunction with underlying or overt viral infection of the patients. Our study sets an example for addressing the impact of anticancer molecules on the microbe-host interplay and the therapeutic outcome in a background of microbial infection. I L 2 IL3 IL4 IL5 IL6 IL7 IL10 IL13IL12 IL16 IL17 IL23 IL27 IP10ITAC KC MCSF T A R C ? IL4 IL5 IL6 IL7 IL10 IL13IL12 IL16 IL17 IL23 IL27 IP10ITAC ", "The infection of macrophages, RPE, MDCK, A549, BHK-21 and Vero-E6 cells with influenza A/WSN/33 (WSN; H1N1) , A/PR/8/34 (PR8; H1N1), A/Sydney/5/1997 (Syd97; H3N2) , B/Shandong/7/97 (InfB), human echovirus 6 (Echo6), sindbis (SINV), semliki forest (SFV), bunyamwera (BUNV), measles (MeV), herpes simplex 1 and 2 (HSV-1, HSV-2), tick born encephalitis (TBEV), dengue (DENV) and vaccinia (VACV) viruses was done as described previously. 31,32 KSHV production was induced in iSLK.219 cells with 0.2 mg/ml doxycycline and 1.35 mM sodium butyrate. 33 Titres of infectious viruses were determined as described. 26, 31 Compound efficacy testing in vitro. The compound efficacy testing was performed in 96-well plates in human macrophages, RPE, A549, MDCK, Vero-E6 and iSLK.219 cells. Typically, cells were seeded in 100 ml of an appropriate cell growth medium and grown for 24 h. The growth medium was changed to an appropriate virus inoculum 31 and the studied compounds were added into the medium; DMSO was added to the control wells. The cells were infected with viruses at a multiplicity of infection (moi) of 0.1-10 or non-infected (mock). Cell viability was measured using a Cell Titre Glo assay (CTG; Promega, Southampton, UK). Luminescence was read with PHERAstar FS plate reader (BMG Labtech, Ortenberg, Germany).", "For a genomic viral RNA (vRNA) transfection experiment, A/WSN/33 virus was grown in MDCK cells. Supernatants were collected at 24 hpi, and the virus was pelleted using ultracentrifugation at 285 000 g for 4 h. Viral RNA was purified using the RNA extraction kit (Qiagen, Hilden, Germany). The RNA was transfected into RPE cells using Lipofectamine 2000 (Life Technologies, Carlsbad, CA, USA) according to the manufacturer's instructions. Six hours after transfection, the Opti-MEM media were replaced with growth media with or without 0.4 mM ABT-263. After 18 h, the cell viability or caspase activity was measured." ] },{ "paper_id": "43fa3923d6ba1d04fb5b0419f617b8c2fbc2f268", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "43fb44b6c809c497fa4e6e7a52e7a3dbbebe4155", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Continuous variables were presented as medians with interquartile range. Categorical variables were presented as frequencies and percentages of the specified group. Comparisons between groups were made with the Fisher exact test or the Kruskal-Wallis test, as appropriate. A two-sided p-value of <0.05 was considered statistically significant. Statistical analyses were performed using SPSS Statistics, version 24, software (IBM, Armonk, NY, USA).", "Secondly, our study showed the existence of a strong association between pneumonia severity and performance of diagnostic testing, in accordance with IDSA/ATS and ERS recommendations. As a consequence, pneumonia severity was also associated with an increased probability of pathogen detection. Exploring the true determinants of pathogen detection would have required a systematic and universal testing strategy and, for this reason, it was out of the scope of this study.", "Community-acquired pneumonia (CAP) is a leading cause of hospitalisation worldwide. Mortality rates for patients hospitalised with CAP approach 30%, especially in those admitted to an intensive care unit (ICU) [1] [2] [3] [4] . Diagnostic testing in CAP has the potential to improve individual patient management, reducing the risk of clinical failure and death, and to generate epidemiological data, informing the selection of appropriate empirical antibiotic therapy. Unfortunately, these advantages are counterbalanced by high healthcare costs associated with diagnostic testing and low sensitivity of these tests to identify pathogens causing CAP [5, 6] .", "We performed a secondary analysis of an international, multicentre, observational, prospective cohort study using the Global Initiative for Methicillin-resistant Staphylococcus aureus Pneumonia (GLIMP) database [13] . GLIMP was conducted among 222 hospitals in 54 countries over 4 days, with 1 day per month randomly selected during March, April, May and June 2015. All adult patients (aged >18 years) hospitalised for CAP at the participating centres during the four study days were screened by GLIMP investigators and included in this secondary analysis. Patients hospitalised with a diagnosis of hospital-acquired or ventilator-associated pneumonia were excluded. The GLIMP coordinating centre was located at the University of Texas Health San Antonio (San Antonio, TX, USA). The coordinating centre received expedited project approval by the institutional review board (number HSC20150184E). The review board waived the need for receipt of informed consent due to the nature of the study. Institutional review board approval was obtained by the site investigators at each individual centre. A detailed description of the GLIMP organisation and methodologies has been previously published [13] .", "In conclusion, our understanding of the aetiologies of CAP among hospitalised adults is scarce, limiting the accuracy of empirical antimicrobial regimens. Disease severity and geography are associated with differences in testing approaches. The wide discordance between IDSA/ATS/ERS recommendations and real-life testing strategies should prompt future studies to evaluate the clinical and economic implications of different testing approaches and investigate the reasons for these differences." ] },{ "paper_id": "4476687d4a23df5d5428626f81d9621abf94e679", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Swine kidney cells (IBRS-2) were cultured for 1 day in a 37 o C, 5% CO2 incubator with 10% fetal bovine serum (FBS; pH 7.4) and 1% antibiotics added to minimum essential medium-alpha. Virus titers were determined in IBRS-2 for FMDV. Three days later, the 50% tissue culture infective dose (TCID50) was calculated using the Reed and Muench method. FMDV O/Andong/SKR/2010 (GenBank accession No. KC503937) was used for challenging the pigs.", "Importantly, there are side effects to be considered before undertaking clinical application of ribavirin. It has been reported that all ribavirin-treated pigs show significant decreases in body weight and red-blood-cell counts until 8 dpi [17] . Moreover, in ribavirin-treated FMDV-uninfected pigs, clinical signs of dyspnea, anorexia, weakness, and depression were present until 5 days [17] .", "Pigs that were administered ribavirin with oil adjuvant (water in oil in water) were observed to have the highest clinical score (5 points) within 3 dpc (Table 2 ). Another group that was injected with ribavirin with oil and commercial vaccine did not exhibit any clinical signs during all experimental days, even though the pigs were exposed to approximately 10 2-4 RNA copy numbers from 2 to 3 dpc. The negative control was found to have high RNA copy numbers of viremia (Table 2 ).", "The growth inhibitory effects of the various antiviral agents against FMDVs were measured in IBRS-2 cells. The selectivity index of ribavirin had the highest value (Table 1) . Regarding cell toxicity (CC 50 ), ribavirin and azauridine had similar values but T1105 produced the lowest reaction by the cells. For the degree of resistance (EC50) against FMDV, ribavirin was able to provide an antiviral effect at the lowest concentration.", "Foot-and-mouth disease (FMD) occurs in animals with cloven hooves. FMD viruses (FMDVs) are a positive-sense single-stranded RNA virus [16] and belong to the genus Aphthovirus, family Picornaviridae [4] ; the size of the virus genome is approximately 8.5 kb. These viruses are classified into seven serotypes-A, O, Asia1, C, SAT1, SAT2, and SAT3and more than 60 subtypes [16] . FMD outbreaks cause a reduction in the productivity of infected animals (e.g., pigs, cows, lambs, and goats) [2, 3] . The culling of infected animals and events such as environmental contamination and loss of revenue from the livestock have emerged as important socioeconomic issues [21, 23] ." ] },{ "paper_id": "44ca0c52f79a893a551da92dd78e599fbc74b060", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The values of Dlat typically are not a normal distribution. Accordingly, geometric mean Dlat were calculated from normally distributed laD. Signifieances of differences between mean InDRit were compared in Student's t test. p < 0.05 was considered significant.", "In experiments with MI2.C3-10-D2, the transfectant that expresses the lowest level of I-A k, recovery of fluorescence was reduced if cells were incubated with goat anti-mouse IgG before measurement (data not shown). This demonstrates that the fluorescence measured is from mAb bound to surface I-A k and is not cell autofluorescence.", "Class II MHC molecules, Ia antigens in the mouse, are heterodimeric transmembrane proteins expressed on B lymphocytes, macrophages, and other antigen-presenting cells. There are two isotypes of Ia antigens in the mouse, I-A and I-E; each consists of a 34-36-kD ct chain and a 27-29-kD/~ chain. Each chain is composed of two external domains (ot~/ot2 or/3,/~2) and a connecting peptide that joins the ex-ternal domains to the transmembmne and cytoplasmic domains. There are two asparagine-linked oligosaccharide units on each c+ chain and one on the B chain.", "mAbs were purified from tissue culture supernatants by affinity chromatogk raphy on protein A-Sepharose. The anti-l-A mAb, 39], is specific for the c~ chain (21) . The anti-I-A k mAb, 10-3.6, is specific for the fl chain (19) . The anti-L d mAb, 28-14-8, was used as a control to assess for nonspecific effect on plasma membrane protein Dl,, values (20),2-8 mg of mAb was digested with 1:100 (wt/wt) papain (Sigma Chemical Co., St. Louis, MO) at pH 5.2 for 10 min. The digest was fractionated on Sephadex G-100, and the first included peak was refractionated on protein A-sepharose to remove traces of IgG. The purified Fab was concentrated to 5-10 mg/mi protein, dialyzed into 0.2 M Na2CO3 buffer, pH 9.5, and reacted with 15 #g FITC/ mg protein at 0oc for I h. The reaction mixture was purified by passage c~er Sephadex G-25. All conjugates had 3-4 tool fluoresccin coupled/mol Fab.", "The pSV2-Neo construct (27) was a gift from Dr. Ed Palmer (National Jewish Center for Immunology and Respiratory Medicine, Denver, CO). The origin and generation of the a and fl I-A k genomic DNA constructs have been described (28) . In brief, site-directed mutagenesis in vitro was used to introduce double-stop codons that v~uld result in truncated a or fl chains lacking 6 and 12 or 12 and 18 amino acids, respectively. Uamb+nne I RHRsQK Transfectants were generated by introducing pSV2-Neo DNA and ~ and genomic DNA into the Ia-negative B cell iymphoma M12.C3 by electroporation. The transfecled cells were selected and maintained using (3418 (neomycin) at a final concentration of 300 t~g/ml. Transfectants expressing memk k brahe I-A were chosen based on flow cytometry using anti-l-A -specific mAb (Fig. 2) ." ] },{ "paper_id": "44f01ea111fa2b4bd8ce34739f64b17930bb0ea8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The factors which determine probability of transmission from an infectious individual (Ii) to a susceptible individual (Is) are the basic virus transmissibility (\u03b2v), the age-based susceptibility of Is the current level of infectiousness of Ii, and, if the contact between Ii and Is occurs in a household, the household size Household(Ii, Is). These factors are explained below.", "Design A modelling study.", "Setting The towns of Madang in Papua New Guinea (population ~35,000) and Albany (population ~30,000) in Australia." ] },{ "paper_id": "4564dfbcb341f91caefc5a880a127a629416c1c6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Results are reported as means \u00b1 SD. The significance of differences between results for different groups were evaluated using one-way ANOVA with a p-value threshold of 0.05.", "After two weeks, none of the animals in the experimental group exhibited symptoms of FMDV whereas 155 control group cows belonging to 4 different farmers did. Animals in the experimental group were thus completely protected by spraying with Chinese herbal kombucha. These field results clearly demonstrate the potential of Chinese herbal kombucha as a probiotic treatment for the prevention and containment of FMD outbreaks.", "Foot-and-mouth disease virus (FMDV) infects cloven-hoofed animals and has had devastating consequences in many countries (Gibbens et al., 2001; Grubman et al., 2004; Knowles et al., 2001) . Two strategies for its prevention and eradication have been widely adopted. Mass slaughter of animals at risk of infection has been used extensively in developed countries but economic factors have made vaccination more popular in developing countries where the prevalence of FMD is high (Li et al., 2010) . Most countries in the European Union and North America have controlled the disease by slaughtering infected animals and those that may have been exposed, but it remains endemic in many African, Asian, and South American countries (Bayry et al., 2001) . Although the slaughter policy has been highly successful in limiting the extent of outbreaks and eliminating the infection, it has important negative aspects." ] },{ "paper_id": "459c780b398aa89f292490a6b455845448b7d537", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All data were processed using the statistical language R (3.6.2), unless otherwise specified.", "Step 2", "Step 3" ] },{ "paper_id": "459f95218942f624446533e21c9ab2775b8efce3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "45ab08a84c5a80e9ba6a6d21eb814d0ab04a473c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Proteins were separated on 5-10% gradient or 10% polyacrylamide gels (27) . Gels were fixed in isopropanol/water/acetic acid (25:65:10) and soaked in Amplify (Amersham Corp.) before drying and exposure to Kodak XAR film (Eastman Kodak Co., Rochester, NY) at -80~ Protein bands were quantitated using a BioRad densitometer.", "Reagents and supplies were from the following sources: MEM alpha and dialyzed fetal bovine serum (DFBS) were purchased from Irvine Scientific (Santa Ana, CA). Brefeldin A (BFA) was from Epicenter Technologies (Madison, WI). Fibronectin, calcium ionopbores A23187 and ionomycin, SDS, hypoxanthine-thymidine supplement, chloroquine, nocodazole, and BSA were purchased from Sigma Chemical Co. (St. Louis, MO). [3SS]cysteine (800 Ci/mM) was from ICN Biomedicals, Inc. grvine, CA) and 3H- [9, 10] palmitate (30-60 Ci/mM) was from New England Nuclear (Boston, MA). t4C-labeled protein standards and goat anti-rabbit IgGgold conjugate ( ", "CHODG44 ceils which are deficient in dihydrofolate reductase (dhfr) (64) were grown in MEM alpha supplemented with 10% FBS, 0.5x hypoxanthine-thymidine supplement, 100 U/ml penicillin, 100 ~g/ml streptomycin, and 2 mM glutarnine at 37\"C in a 5% CO2 incubator." ] },{ "paper_id": "45cf4bcdf80e9ed9e3048485b0c57926028451d3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "45d421f19615b936de0527809bb71e12be89fa7c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To rapidly distinguish Canine distemper virus (CDV), canine parvovirus (CPV), and canine kobuvirus (CaKoV) in practice, a one-step multiplex PCR/RT-PCR assay was developed, with detection limits of 10 2.1 TCID 50 for CDV, 10 1.9 TCID 50 for CPV and 10 3 copies for CaKoV. This method did not amplify nonspecific DNA or RNA from other canine viruses. Therefore, the assay provides a sensitive tool for the rapid clinical detection and epidemiological surveillance of CDV, CPV and CaKoV in dogs.", "doi: 10 .1292/jvms. The one-step multiplex PCR/RT-PCR was performed in a 25 \u00b5l reaction mix with the PrimeScript\u2122 One Step RT-PCR Kit Ver. 2 (Takara, Dalian, China), according to the manufacturer's instructions. The components of the reaction were: 0.75 \u00b5l of CDV, 1 \u00b5l of CPV or 2.5 \u00b5l of CaKoV RNA; 2.5 pmol each of primers CDV-F, CDV-R, and CPV-F, and 10 pmol each of primers CPV-R, CaKoV-F, and CaKoV-R; 12.5 \u00b5l of 2 \u00d7 1 Step Buffer; 0.5 \u00b5l of PrimeScript 1 Step Enzyme Mix (Takara); and 4.75 \u00b5l of RNase-free dH 2 O. The cycling parameters were: 50\u00b0C for 30 min; predenaturation at 94\u00b0C for 5 min; 30 cycles of denaturation at 94\u00b0C for 30 sec, annealing at 55\u00b0C for 30 sec, and extension at 72\u00b0C for 30 sec; and a final extension step at 72\u00b0C for 10 min. The specificity of the one-step multiplex PCR/RT-PCR was assessed against other major canine viruses: CAdV-1, CAdV-2, CPIV and CCoV. To evaluate the sensitivity of this method, 10-fold serially diluted DNA/RNAs (the original concentrations were 10 7 copies for CaKoV (RNA copies for CaKoV were determined by one step SYBR Green Real-time RT-PCR assay (data not shown)), 10 6.1 TCID 50 for CDV and 10 5.9 TCID 50 for CPV) were used as the templates in the multiplex PCR/RT-PCR. The assay detected CDV, CPV and CaKoV, evident as bands of different sizes on agarose gel electrophoresis (Fig. 1) . No PCR products were amplified from CAdV-1, CAdV-2, CPIV and CCoV. The limits of detection were 10 3 copies for CaKoV (Fig. 2) , 10 2.1 TCID 50 for CDV and 10 1.9 TCID 50 for CPV.", "The viral DNA/RNA of fecal samples collected from dogs with clinical symptoms of diarrhea were extracted and tested in parallel with both the one-step multiplex PCR/RT-PCR and the commercial Rapid CDV/CPV Ag Test Kit (Bionote, Gyeonggi, Republic of Korea) for CDV or CPV, according to the manufacturer's instruction, and a traditional simplex RT-PCR for CaKoV, as described previously with minor modification [4] . Of the 66 fecal samples tested, four (6.06%) were positive for CDV, eight (12.12%) were positive for CPV, and four (6.06%) were positive for CaKoV. Among these, two were mixed infections of CDV and CPV and one was a mixed infection of CPV and CaKoV, detected with the one-step multiplex PCR/RT-PCR. The results for the commercial CDV/CPV Ag Test Kit and the traditional simplex RT-PCR were three (4.55%) samples positive for CDV, seven (10.61%) positive for CPV, and four (6.06%) positive for CaKoV; among these positive samples, one was a mixed infection of CPV and CaKoV. For the CDV and CPV, the positive rate of clinical samples tested by one-step multiplex PCR/RT-PCR was higher than the commercial CDV/CPV Ag Test Kit. The main reason may be that the nucleic acid detection methods are more sensitive than the antigen detection methods, But statistically, we cannot conclude that the multiplex PCR/RT-PCR established in present study is more sensitive than the commercial CDV/CPV Ag Test Kit or the traditional simplex RT-PCR. The more clinical tests need further to be done to evaluate it. For one sample, the CPV was positive tested by CPV Ag Test Kit, but negative by the " ] },{ "paper_id": "4615c0a2b164f98ac850d2c16f24cfe5a33db75d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "that imaging ellipsometer enables quantitative, label-free, rapid, high-throughput and low-cost analysis of biological interactions.", "Detection of interactions between SNAREs with imaging ellipsometer. The cytosolic regions (without the transmembrane domain) of Sso2p, Sec22p and Ykt6p were expressed in E. Coli and purified to high quality (Fig. 1 ). To detect their interactions, we designed the microfluidic array as illustrated in Fig. 2a and Fig. 2b .", "The agreement between the SPR and imaging ellipsometer results demonstrated the interactions between the three SNARE proteins. The interactions at protein level were also consistent with Y2H result at domain level 7 . Previous study also showed that the R-SNAREs Sec22p and Ykt6p can substitute for each other in the fusion of ER-derived transport vesicles with the cis-Golgi 25 .Their similar interaction pattern with the Q-SNARE Sso2p observed in our study reinforces that the two R-SNAREs are functionally identical." ] },{ "paper_id": "461bd946be4c4280c46eb9a7b163e9f3da0a734a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Male C57BL/6 mice weighing 20-25 g were procured from Biological Resource Centre (Singapore) and housed in groups of five, in cages with Corncob bedding Experiments were conducted in animal biosafety level 3 rooms. Cages were placed in an isolator maintained at -100 Pa pressure with a supply of high-efficiency particulate air-filtered air. Mice were provided with commercial rodent diet (Harlan-Teklad, Bicester, UK) and drinking water ad libitum. All animals were handled in strict accordance with good animal practice and all animal work was approved by the Institutional Animal Care and Use Committee, Biological Resource Centre (Institutional Animal Care and Use Committee #070236).", "Rolipram and oseltamivir were obtained from Kemprotec Ltd (Middlesbrough, UK). Sertraline was obtained from Atomax Chemicals Co. Ltd (Shenzen, China) and enzyme-linked immunosorbent assay reagents were from R&D Systems (Minneapolis, USA). Minimum essential medium and bovine serum albumin was obtained from Gibco (Life Technologies, Singapore) and L-(tosylamido-2-phenyl) ethyl chloromethyl ketone-treated trypsin, penicillin and streptomycin were from Sigma.", "Thus, the interactions mediated by competition for these enzymes are unlikely to rule out an essential problem of drug-drug interactions." ] },{ "paper_id": "464e444443d007ddd7b577c9e878c12eeaf7829e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "46768e7c839a7f4de0d5a73d25897f948b4eac30", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "46bf124930f3ef18bc9dd2d4ae356a45d3bae461", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All patients underwent a baseline digital anteroposterior chest radiography at full inspiration using a mobile chest radiograph machine (FLUOROSPOT Compact FD, Siemens Healthineers; DRX-Revolution Mobile X-ray System, Carestream Health, Rochester, NY, USA; or Optima XR220, GE Healthcare, Milwaukee, WI, USA).", "This retrospective study was approved by the Institutional Review Board of the participating hospitals, and the requirement for informed consent was waived.", "The authors have no potential conflicts of interest to disclose." ] },{ "paper_id": "46c2b3f4e85af8b1e30ac3c5be7b72a1412eec46", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "46c58d9482fd8d00108402c45033131561eb8921", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The \u2423 2,3 sialyltransferase, \u2423 2,3 SAT (O),", "Reactivity of Peanut Lectin with Live Cells. Cells were incubated with or without neuraminidase and analyzed by FACS \u00ae can for Arachis hypogaea peanut agglutinin (PNA) (Sigma Chemical Co.) lectin binding as described previously (Burchell and Taylor-Papadimitriou, 1993) .", "Detection of the Tagged Sialyltransferase in Permeabilized Cells. Cells were stained with 9E10 mAb after incubating the cells with 0.3% saponin for 20 min. Subsequent steps were as previously described (Burchell and Taylor-Papadimitriou, 1993) with the exception that 0.1% saponin was included in all incubations and washes, which were carried out at room temperature. The reactivity of an mAb (LE61) to keratin 18 (Lane, 1982) was included as a positive control for staining the permeabilized cells." ] },{ "paper_id": "46e88010c4a926b35d981984c673bb834c17f7d2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Recommendations regarding the optimal duration of antibiotic therapy have changed over time, and there are discrepancies on this issue across guidelines (Table 1) .", "Community-acquired pneumonia (CAP) is the leading cause of death worldwide." ] },{ "paper_id": "46eecf9daff1ef854fd51a8e6963d58126d35a2b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The mean fluorescence (MF) value obtained in the wells without competitor peptide was regarded as maximal binding and equated to 0% inhibition; the MF obtained from the wells without reference peptide was equated to 100% inhibition. Percentage of inhibition of binding was calculated using the formula: [1 \u03ea (MF 150 nM reference and competitor peptide \u03ea MF no reference peptide) / (MF 150 nM reference peptide \u03ea MF no reference peptide)] \u03eb 100%.", "Our findings demonstrate the potential of HCV to induce autoreactive CD8 \u03e9 CTLs by a molecular mimicry of CYP2A6/2A7 by the core protein and therefore show a possible mechanism by which HCV may trigger AIH. Further studies analyzing the cross-reactivity pattern of HCV core-specific CTLs derived from untreated patients with active HCV-associated autoimmune hepatitis are required in order to establish this mechanism.", "Competition-based MHC Class I Peptide Binding Assay. Peptides were tested for their binding affinity using the previously described peptide binding assay (26) . In brief, cells were stripped (see above) and resuspended at 7 \u03eb 10 5 cells/ml in IMDM plus 1.5 g/ml \u2424 2 -microglobulin. A fluorescein (FL)-labeled reference peptide (FLPSDC(FL) FPSV), 25 l (end concentration, 150 nM), was incubated with 25 l of competitor peptide (different end concentrations) in a 96-well V-bottomed plate. 100 l of mild acid-treated JY cells was added to these wells. The mixture was incubated for 24 h at 4 \u040a C, washed twice with PBS containing 1% BSA (PBA1%), resuspended in PBA1% containing 0.5% paraformaldehyde, and analyzed by FACScan \u00ae (Becton Dickinson)." ] },{ "paper_id": "46ef984b54bda15d5f23858a2d0a0eb64f39f5d8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "471aa6c890ce013986b2f55f65bde5b06615f456", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We now report a dominantly inherited variant that affects LMAN2L's ER retention, in a second similarly affected family (Fig. 1A ).", "Additional supporting information may be found online in the Supporting Information section at the end of the article. Table S1 . Current neuropsychological testing data. Table S2 . Summary of shared heterozygous, protein coding variants with high confidence in the linked region amongst affected patients.", "Whole exome sequencing (WES) was as previously described. 5 The human LMAN2L NM_001142292.1 cDNA was cloned into pcDNA3.1. The EQKLISEEDLA myc epitope was introduced downstream of the signal sequence cleavage site between codons for amino acids 44 and 45 ( Fig. 2A) . Site-directed mutagenesis on this wild-type (wt) construct generated the mutated version. Following sequence verification, the constructs were transfected into HeLa cells. Lysates were fractionated for cytosolic and light and plasma membrane proteins as previously described. 6 For microscopy, 24 h post-transfection cells were treated with 10 mg/mL cycloheximide for 2 h, fixed in 4% paraformaldehyde, and incubated with anti-myc antibody followed by Alexa 488-coupled anti-mouse IgG." ] },{ "paper_id": "477645a85a65fb72adc9d17a09bf6d53ca3f24fd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4776a30b2dc8da97b0c419d7577dd959231bbd61", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "47772f3e98d8c61bb9782531a0338ba85f27bf3f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "An epidemic of a novel coronavirus emerged from Wuhan, China, in late December 2019 and has since spread to several large Chinese cities. Should a scenario arise where this coronavirus spreads more broadly across China, we evaluate how patterns of international disease transmission could change.", "A novel coronavirus emerging from Wuhan, China in late December 2019 is currently spreading to other provinces in mainland China and international destinations across East Asia. At the time of writing, cases have been confirmed in Beijing, Shanghai, Hong Kong, Macau and multiple cities in Guangdong province, with more than 500 cases confirmed across China. 1 Furthermore, several cases have spread internationally via air travel 2 to Japan, South Korea, Taiwan, Thailand and the USA. A recent modelling study concluded that for these international exportations to be observed, the outbreak in China should be substantially larger than is reflected by confirmed case counts. 3 Currently, many public health interventions are based on scenarios where Wuhan is the primary source of new cases. 4 While there are currently no documented transmission chains outside of the Wuhan region, should a scenario arise where this novel coronavirus spreads more broadly to and within other Chinese cities, we evaluated how global patterns of disease dispersion might change.", "We analyzed international airline passenger trips from the following 10 cities: Wuhan, Beijing, Shanghai, Kunming, Chengdu, Xiamen, Haikou, Guangzhou, Shenzhen and Hong There currently are numerous unknowns including the presumed animal origins of the virus, the efficiency of humanto-human transmission, an understanding of the full spectrum of clinical illness and an incomplete epidemiological picture of disease activity in China. While our analysis does not account for the potential effects of the epidemic on changing travel behaviours, it reflects worldwide flows of airline travellers at the same time of year in 2019, including the Lunar New Year in February 2019. At the time of writing, flights and land transportation in and out of Wuhan have been suspended, and it is uncertain how this will impact disease transmission in China. Our findings could support public health planning and readiness for different scenarios should the current epidemic spread more widely across mainland China and neighbouring cities." ] },{ "paper_id": "4790e3eb0374a7f159014ef77ec42a6b9de91c29", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "47bd7df352db2b1b093566b04fc328d6f0292c1b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "participants (large and medium) wore model 1860, and 7 (small size) wore model 1860S." ] },{ "paper_id": "47ceb56d266552a6cc6c3c0eb153bab3b99a1e98", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Financial support. ", "Disclaimer. The findings and conclusions are those of the authors and do not necessarily represent the views of the US Centers for Disease Control and Prevention." ] },{ "paper_id": "480e5240848f603d3c04a1e21cecfe502a13cd89", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "well as in important, prespecified subgroups. ALIC 4 E is likely therefore to enhance the evidence base supporting and important and common area of clinical practice.", "There is no requirement for participants to attend a faceto-face follow-up visit as part of their study participation, as all subsequent measurements will be ascertained by self-completed diary-based questionnaires and through telephone calls from the local trial team.", "Participants who have visited the hospital with complications possibly related to ILI and who have had a chest X-ray will have their primary care clinical records examined by the trial team for confirmation of relevant diagnoses of complications, including pneumonia.", "A manuscript with the results of the primary outcome will be published in a peer-reviewed journal. Additional manuscripts will report secondary outcomes and be submitted for publication in peer-reviewed journals.", "The local implementation of the trial has built-in flexibility, and local network recruitment processes vary. For example, medical students may assist with recruitment tasks in certain practices, whereas others will incorporate triage systems or additional trial-specific clinics and/or research support staff in their recruitment processes." ] },{ "paper_id": "485169c3d48f25be33434505f0e9b5ea5c1256f9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A chymotrypsin-like cysteine proteinase, 3C pro , is the main cleavage protein found in all picornaviruses and contains a conserved cleavage site aiding in the identification of cleavage sites of newly discovered viruses (Lendeckel and Hooper 2009) . The 2A pro is another protease encoded by entero-and rhinoviruses, that folds spontaneously into an active form, performing a primary cleavage (Ehrenfeld et al. 2004; Lendeckel and Hooper 2009) .", "Picornavirus evolution is determined by their high mutation rate, which is predicted to range between 10 \u00c03 and 10 \u00c05 mutations per nucleotide, per genomic replication (Domingo and Holland 1997) . In addition, the often reported recombination events are crucial to shape their genomic architecture (Simmonds 2006) .", "Supplementary data are available at Virus Evolution online.", "First-and second-strand synthesis and random PCR amplification were performed for 17 cycles using a modified Whole Transcriptome Amplification (WTA2) kit procedure (Sigma-Aldrich). Denaturation temperature was increased to 95 C to allow for the denaturation of dsDNA and dsRNA. WTA2 products were purified with MSB Spin PCRapace spin columns (Stratec) and were prepared for Illumina sequencing using the Nextera XT library preparation kit (Illumina). Libraries were quantified with the KAPA Library Quantification kit (Kapa Biosystems) and sequencing of the samples was performed on a HiSeq TM 2500 platform (Illumina) for 300 cycles (150 bp paired ends), generating 67,251,870 reads." ] },{ "paper_id": "48545476b719bbb0efc851c4bb4da881b8244cc2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "[22]", "A sample size of 30 was chosen to:", "[2] The severity of symptoms 77 typically peaks two to three days after symptom onset." ] },{ "paper_id": "485f987d1d6344a2982cd356cc2116b4221ad3fe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The patient was later diagnosed as Vici syndrome, which consists of agenesis of the corpus callosum, cataracts, oculocutaneous hypopigmentation, cardiomyopathy, and a combined immunodeficiency (molecular testing revealed biallelic mutations in the EPG5 gene).", "Angiotensin converting enzyme inhibitor therapy was initiated, and his urine protein/Cr ratio decreased to 0.6 on a follow-up nephrology visit. He continued to have intermittent episodes of proteinuria and acute kidney injury during subsequent hospitalizations. The patient expired following a hospitalization for respiratory failure due to severe pneumonia, and acute respiratory distress syndrome (ARDS) which was associated with a disseminated fungal infection.", "In this article, we report 3 pediatric patients with renal biopsy showing TRIs. Evaluation of these patients did not reveal HIV, SLE, or any other viral illness that has been reported in association with TRIs." ] },{ "paper_id": "488c028f6d7b11c0eda9224a28685fcc192e151e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "496bfe6fe82dca285afe74c0202ad9498b41370c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ ".", ", 10% , [2, 3] . , ,", "( )." ] },{ "paper_id": "497065a88412aca3ce4d3de9ebad13ce175e5f18", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The data were analyzed using the PASW Statistics software program for Windows, version 18.0.", "Suicide is a grave public health issue with a global mortality rate of 16 per 100,000 individuals. 1 Suicide is one of the top three leading causes of death, particularly among individuals aged 15-44 years, which is a productive age group. 1 Suicide is a complex event that is influenced by biological, cultural, psychological, and socioeconomic factors." ] },{ "paper_id": "49a7701b214e24e40679127c598881fa579f97dd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The abstracts of the identified studies were independently reviewed by two readers (AB and SJ). Differences were resolved through discussions for a consensus to be reached. Percentage agreement and Cohen's Kappa (k) statistic 45 were calculated and interpreted in accordance with Landis and Koch's benchmarks 46 for assessing the agreement between reviewers as poor (<0), slight (0.0-0.20), fair (0.21-0.40), moderate (0.41-0.60), substantial (0.61-0.80), and excellent (0.81-1.0). The agreement on the inclusion between the two reviewers was 86%, with k=0.72 (95% CI 0.58-0.85).", "The methodological quality of each study was evaluated as previously described 47 with some modification. Quality of the study was based on four criteria: (a) the number of study subjects (n; at least the median of 157 for H1N1 and 17 for MERS-CoV), (b) comprehensive reporting of patients' demographic information, (c) describing a minimum of 3 disease-associated symptoms and (d) reporting at least 2 comorbidities (in addition to diabetes). For each criterion, each study was given a score (0 or 1, with 1 fulfilling the criteria). The total score was calculated for each study (score range 0-4). Quality scores of 1, 2, 3, and 4 were considered poor, fair, good and very good, respectively.", "A search was conducted in PubMed, Ovid MEDLINE, Embase and Embase Classic databases to the last week of July 2015 using the search terms (MeSH) H1N1 or MERS-CoV (Middle East respiratory syndrome coronavirus) and Diabetes. The search resulted in 123 articles selected for title and abstract review as they satisfied our selection criteria (see below). We limited the studies into those in humans and excluded reports published as review articles, letters, case studies, editorials, conference abstracts, vaccination trials or family-based studies. After eliminating duplicate listings and only considering articles in full text, a total of 44 peer-reviewed original studies were selected for full text review. Full article review resulted in the further exclusion of 8 reports that were not documenting the prevalence of diabetes in H1N1 or MERS-CoV (i.e., no association studies), examining only a small number of travellers as a case report (n=2 subjects), reporting seasonal influenza alone, reviewing already reported cases (MERS-CoV), or simply documenting national surveys. A bibliography search of the remaining articles identified two additional studies. A total of 38 peerreviewed articles (29 studies for H1N1 3-5,14-39 and 9 for MERS-CoV 6-9,40-44 ) were identified for this article (Figure 1 )." ] },{ "paper_id": "49c8f45d390502809816b630ee23375427ea0fb6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Intestinal tumors are generally rare in cats. Lymphomas account for nearly 30% of all feline tumors and are the most common intestinal tumors [20] . Adenocarcinomas are the second most frequent tumors in cats, followed by mast cell tumors. Gastrointestinal stromal tumors (GISTs) are thought to originate from the interstitial cells of Cajal (ICCs), which form a network that coordinates peristalsis in the gastrointestinal tract [11] . Many of the smooth muscle tumors in human and canine patients have now been reclassified as GISTs, which by definition express CD117 (KIT) [13, 15] . GISTs have been described in humans, dogs, horses, Spanish ibex, a ferret, a rat, and nonhuman primates [5, 18, 19] . These occur most frequently in the jejunum, cecum and colon [16] . To the authors' knowledge, only one report has described \"a feline GIST\" in the stomach [17] .", "(approximately 5.0 mm) (Fig. 2B ) and performed cytological examination of a fine-needle aspirate. It revealed the lymph node had reactive hyperplasia. Biopsy examination of a hepatic nodule was not performed, because the owner declined it. After surgery, the cat was administered total parenteral nutrition through a central venous catheter." ] },{ "paper_id": "49d10e98d15b16cd6d0b522b21714401d767dcc2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "described (6) (7) (8) (9) . These cases have raised concerns about adenovirus infection in the general population, but there is still limited information on the condition.", "The institutional review board approved our retrospective study, and written informed consent was waived for the use of patients' medical and imaging data. All of the patients' information was anonymized prior to the analysis.", "Diagnosis was confirmed in five patients based on positive viral culture for adenovirus in BAL fluid. Diagnosis via lung biopsy specimens obtained by video-assisted thoracoscopic surgery (n = 4) or transbronchial lung biopsy (n = 1) was made in another five patients. The specimens were evaluated using hematoxylin and eosin immunohistochemical staining (10, 12) . In nine patients, BAL fluid was analyzed using the one-step multiplex realtime AdvanSure RV real-time PCR kit (LG Life Sciences, Seoul, Korea) or conventional multiplex reverse transcription PCR (RT-PCR) assay (Seeplex RV12 Detection Kit; Seegene, Seoul, Korea) (13, 14) ." ] },{ "paper_id": "49fb495cd0efde647aa99ec56606432699b1e88e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Disclosure. Authors have no conflict of interests, and the work was not supported or funded by any drug company.", "Echocardiography showed mild tricuspid regurgitation with normal cardiac function. He was switched to highfrequency oscillatory ventilation. He was afebrile, and laboratory investigations showed a C-reactive protein of 24 mg/L (normal value [NV] -0-6 mg/L), white blood cell count of 9.600/mm 3 (NV -5-14.5/mm 3 ), hemoglobin of 10.9 g/dL (NV -11.5-15.5 g/dl), and platelet of 32000/mm 3 (NV -150-450/mm 3 ). His coagulation profile was initially within the normal range but later become prolonged ", "Discussion. Since the emergence of MERS-CoV, the Prince Sultan Military Medical City in Riyadh has taken extensive measures (the \"no risk\" policy) to prevent further spread of the disease. Apart from extensive infection control measures, a vast education campaign for the staff and the community including parents and their children was initiated." ] },{ "paper_id": "49fbca70a4e7e3018cab7eb445683c58fd06bce2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Background. Beginning in December 2013, an epidemic of chikungunya virus (CHIKV) infection spread across the Caribbean and into virtually all countries in the Western hemisphere, with >2.4 million cases reported through the end of 2017.", "Supplementary materials are available at Clinical Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.", "Methods. We monitored a cohort of school children in rural Haiti from May 2014, through February 2015, for occurrence of acute undifferentiated febrile illness, with clinical and laboratory data available for 252 illness episodes." ] },{ "paper_id": "4a17794fa919d411ae351c9d671d4d1a6d64cc99", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We thank Roselyn J. Eisenberg and Gary H. Cohen for generous donation of the recombinant gB-1 protein. This work has in part been funded by the Bundesministerium f\u00fcr Bildung und Forschung (BMBF; 01EZ0934), and the Klaus Tschira Stiftung (KTS, 00.150.2009).", "Neutralizing activity of LYNDAL antibodies was determined in a plaque reduction assay as described previously. 49 The humanized version of a highly potent HSV-neutralizing antibody was used as positive control. 49", "No potential conflicts of interest were disclosed." ] },{ "paper_id": "4a32929dbc801a7e96e900f42f242f93057211ab", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The application of FISH is growing rapidly in genomics, cytogenetics, prenatal research, tumor biology, radiation labels, gene mapping, gene amplification, and basic biomedical research, as well as clinical applications, for diagnostic purposes. As a gene expression assay, FISH is used for localization and detection of specific RNA targets (mRNA, lncRNA and miRNA) in tumor cells and tissues.", "With a sample processing fee of as little as $0.50 for a single gene, an experimental time of about 5 hours that includes RNA isolation and purification, as well as PCR and data analysis, qRT-PCR offers the cheapest and quickest assay for processing an individual clinical sample for 1-50 genes. Small laboratories such as a hospital lab or a clinic lab suited to a clinical processing environment can purchase a thermal cycler for as little as $25 000 to process and analyze their sample.", "The quantitation of results generally requires the study of the output dissociation curve, which allows a graph of known RNA concentration to be used as a reference for a curve constructed from the unknown RNA quantity. This approach is known as the standard curve method. The comparative Ct method involves comparing the Ct values of interest with a control, such as a non-treated or normal sample, which are both then normalized to a housekeeping gene. 9, 11 A biostatistical analysis can also be done where the final gene expression values are log-transformed for a normalized or symmetrical data distribution." ] },{ "paper_id": "4a3701d8545be96ceb7d7b0625ca1702b3de2634", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Although, the epidemiological studies for the association between air pollution and the incidence of respiratory infection in this geographical area are relatively few, virus types identification and their molecular characterization is fundamental not only for surveillance, for diagnostic and therapeutic purposes, but also for highlight the relationships between respiratory diseases in children and concentrations of environment pollutions (9) .", "From patient electronic medical records the following information was obtained: Demographics (age and sex), month of hospitalization, and geographical origin.", "FilmArray testing. NPSs were collected according to a standard procedure, kept in viral transport medium, and stored at -20\u02daC prior to analysis." ] },{ "paper_id": "4a8852f2970eadd44d677311548ca6eea1c5079f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4a9469fd152806179cbbf936e6ec7df22930efce", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4aa30aa1b955b36fda673d75c1a37f386f5823c4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4aa64b68fec8e053f6abcc1594eee14507853618", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4af614b04d5df393575c749cd953aa3855fa8b44", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4af62711ee4cca0c90baf73be3e83ea95e68c045", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No conflict of interest to declare.", "None.", "Approval was not required." ] },{ "paper_id": "4b1b2e95b29b2fb4926c6c0191689f86537985bb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "15-#1 translation mixtures were adjusted to pH 11-11.5 by adding an appropriate volume (pretitrated) of 0.1 N NaOH. After a 10-rain incubation on ice the samples were separated into a pellet fraction and a supernatant fraction by centrifugation through a 100-#1 alkaline socmse cushion (Gilmore and Blobel, 1985) for 10 rain at 30 psi in an airfuge (Beckman Instruments, Inc., Palo Alto, CA) using the A-100/30 rotor and cellulose propionate tubes precoated with BSA (1% solution). The entire supernatant was removed, neutralized with 1 N HCI, diluted 2.5 times with water, and then precipitated by adding 3.5 vol of acetone. These precipitated proteins and pelleted membranes (obtained from the airfuge tube) were taken up in 4% SDS by incubating at 56\u00b0C for 15 min and then processed for immunoprecipitation reactions as described below.", "(1987a) have suggested a translocator protein model in which the signal sequence helps to keep the machinery open for chain transfer.", "Total translation mixtures were adjusted to 4% SDS, then boiled for 4 rain and diluted 1:2 with water. 4 vol of immunoprecipitation buffer (2.5 % Triton X-100, 190 mM NaC1, 60 mM Tris-HC1, pH 7.4, 6 mM EDTA, and 20/~g PMSF/rni) and 2 #1 of antibody were added for 16 h at 40C. The mixture was briefly centrifuged (2-3 min in an Eppendorf minifuge) and to the supernatant one fifth volume of a 1:1 slurry of protein A beads were added and incubated at 24\"C for 2 h under constant agitation. The beads were collected and washed four times with 1 ml RIPA buffer (Gielkens et al., 1976) by centrifugation, followed by a single wash with a buffer containing 150 mM NaCI, 10 mM Tris-HCl pH 7.4, and 20 t~g PMSF/ml. The beads were then taken up in excess gel loading buffer (Cutler and Garoff, 1986) , heated at 95\u00b0C for 5 min, and cleared by centrifugation before loading the immunoprecipitate on the gel." ] },{ "paper_id": "4b34166a75b4835a2743fabba60bf7ff23cf0087", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Being a case report, our institution does not require formal ethical approval. Informed written consent was obtained from the patient for publication of this case report and accompanying image." ] },{ "paper_id": "4b36607cdbc54f8006161a9a1839489dd0a51269", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "-'Two bats flew into our room, so we caught them to eat' (female peasant farmer, 60-y-old, Guangxi).", "I am on the way to interview a potential participant, currently going through a small local market, here they sell fresh vegetables, fruits, pork and live poultry on both sides of the street. Live chickens, ducks and geese are mixed and kept in cages, I can smell the faeces. A vendor (female) is slaughtering a chicken for her customer who just selected one from the cage, she seems very proficient, only wears an apron but no gloves, the ground is covered by blood and feathers. Not far away, there is a woman wearing an orange uniform who is cleaning the street. " ] },{ "paper_id": "4b3d6bca8bfe315d03331cba07299570e2ce7fad", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Autophagy has inexorably been linked to the host cellular response to diverse intracellular pathogens. Indeed, autophagy frequently serves as an innate mechanism that sequesters or clears offending pathogens from the host cell, termed xenophagy. In response to infection, pathogen-and damage-associated molecular patterns stimulate pattern recognition receptors, which then activate ATG proteins to induce autophagy or promote recognition of the microbe by the LC3-positive autophagosome (Deretic et al., 2015) . Nevertheless, the autophagy trafficking process can be subverted by pathogens that have adapted to avoid or use autophagy to their own benefit (Deretic and Levine, 2009 ). One example is poliovirus, which utilizes LC3 to promote its nonlytic viral release, potentially by the fusion of LC3-positive vesicles containing poliovirus with the plasma membrane (Bird et al., 2014) .", "During Brucella abortus infection, multiple ATG proteins implicated in the early steps of autophagosome initiation, such as ULK1 and Beclin 1, are involved in the formation of a B. abortus-containing vacuole (BCV) with autophagic features (aBCV), which promotes bacterial proliferation. Double-membrane crescents reminiscent of the autophagosome engulf BCVs late in infection but do not degrade or clear the bacteria. Instead, ULK1, Beclin 1, and class III phosphatidylinositol 3-kinase activity are all required for the conversion of BCVs into aBCVs. However, the ATG conjugation pathways involved in autophagosome elongation play no role in aBCV formation. Furthermore, these aBCVs facilitate bacterial release and infection of neighboring cells, demonstrating that very specific components of autophagosome initiation promote B. abortus infection (Starr et al., 2012) ." ] },{ "paper_id": "4b55b2415bd2adff96e6013f792d281693bf4587", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Human embryonic kidney 293T cells were maintained in Dulbecco's minimal essential medium, supplemented with 10% fetal bovine serum (PAA), 100 U/mL penicillin, and 100 \u00b5g/ mL streptomycin (Cytogen). RD cells stably expressing a C-terminal fragment of Gaussia luciferase (GLuc) were generated by selection of transfected cells in Dulbecco's minimal essential medium containing G418 at 1 mg/mL. Monocyte-derived macrophages (MDMs) were cultured in X-Vivo 10 medium (Lonza).", "Supplementary materials are available at The Journal of Infectious Diseases online (http://jid.oxfordjournals.org). Supplementary materials consist of data provided by the author that are published to benefit the reader. The posted materials are not copyedited. The contents of all supplementary data are the sole responsibility of the authors. Questions or messages regarding errors should be addressed to the author.", "For the production of human MDMs, monocyte-enriched cells were isolated from thrombapheresis rings by Ficoll density gradient centrifugation. The amount of platelets in the preparations was reduced by centrifugation, and monocytes were collected by adhesion-mediated enrichment on plastic dishes followed by culture in monocyte adhesion medium (Roswell Park Memorial Institute 1640 medium supplemented with 7.5% human fibrindepleted plasma and antibiotics). The next day, the cultures were washed with phosphate-buffered saline, and cells were detached and seeded in monocyte differentiation medium (X-Vivo 10 supplemented with 1% human fibrin-depleted plasma and antibiotics) and cultured for 6 days. Differentiation into MDMs was controlled by flow cytometric analysis of CD14 expression.", "responsible for outbreaks of severe disease in sub-Saharan Africa, which are associated with high case fatality rates [2, 3] . In addition, an EBOV disease is currently ongoing in Western Africa [4] and is associated with 25 791 cases and 10 689 deaths (as of 15 April 2015) [5] . In contrast, RESTV is an Asian ebolavirus, which might be apathogenic in immunocompetent humans [6] . African [7] and Asian ebolaviruses [8] infect bats, which serve as a natural reservoir, and a related filovirus, Lloviu virus (LLOV; genus Cuevavirus), was identified in a European bat [9] . Thus, zoonotic transmission of ebolaviruses to humans can pose a significant threat to public health, and understanding virus-host cell interactions might yield insights into viral spread and pathogenesis and provide a basis for developing antiviral strategies." ] },{ "paper_id": "4b938c2f60ce863541ac9ca19fe0a98cd9a8730e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Depending on the type of experiment, recombinant trapping mutant was applied to cytosolic preparations, human serum ultrafiltrate or intact cells. A detailed description of the different substrate trapping protocols is provided as Supplementary information.", "Cell culture BL-41, CCRF-CEM, HDLM-2, Jurkat, RMA and U937 cells were cultured in RPMI 1640 (Gibco) supplemented with 10% heatinactivated fetal bovine serum, 2 mM L-glutamine, 100 U/ml penicillin and 100 mg/ml streptomycin (Gibco). LCL-721.220 and YT cells were cultured in IMDM (Gibco), HeLa and A431 cells in DMEM (Gibco) with the same supplements.", "Supplementary data are available at The EMBO Journal Online (http://www.embojournal.org)." ] },{ "paper_id": "4b9e5d0ffdac80fba0ea840f8f14e359ad4c43f1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4bae83e2441c3738d96e49c21c9be0a4c85b4a92", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis was performed with SPSS (ver. 17.0; IBM, USA). Differences between the groups were analyzed with a one-way repeated measurement ANOVA and least significance difference test.", "In the present study, we evaluated the protective effect of three plasmids expressing the S1, N, and M proteins of the virulent IBVSX16 strain that we previously constructed [22] . Chickens were immunized monovalently with each individual plasmid (pVAX1-16S1, pVAX1-16M, and ", "A T cell proliferation assay was performed as previously described [1] with some modification. Peripheral blood mononuclear cells (PBMCs) were isolated by Lympholyte-Mammal (Cedarlane, Canada). Briefly, 2 mL freshly heparinized whole blood was diluted with Hanks' balanced salt solution in a ratio of 1\uff1a1 and carefully add on top of 2 mL lympholyte-mammal separation medium, centrifuge at 400 \u00d7 g/min for 20 min, aspirate coat of leukocyte, add 4 mL KPMI 1640 (Invitrogen, USA), centrifuge at 400 \u00d7 g/min for 20 min, discard supernatant and wash precipitation cell twice by the same method. The cells were resuspended in RPMI 1640 medium (Invitrogen, USA) supplemented with 5% fetal bovine serum (Invitrogen, USA), 100 \u03bcg/mL penicillin (Invitrogen, USA), and 100 \u03bcg/mL streptomycin (Invitrogen, USA) at a concentration of 1 \u00d7 10 7 cells/mL. The freshly isolated PBMCs (10 " ] },{ "paper_id": "4bbb0c59babc718f67953fae032dad6ae0d7aeb1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In conclusion, the Genome Detective Coronavirus Typing Tool is a webbased and user-friendly software application that allows the identification and characterization of novel coronavirus genomes.", "The tool uses a novel and dynamic aligner, AGA, to allow submitted sequences to be queried against reference genomes, using both nucleotide and amino acid similarity scores. This allows accurate identification of other coronavirus species and the tracking of new viral mutations as the outbreak expands globally. It also performs detailed analysis of the coding regions and proteins. Moreover, it can easily be updated to add new phylogenetic clusters if new outbreaks arise or if the classification nomenclature changes. The tool has been able to correctly classify all the recently released SARS-CoV-2 genomes, as well as all the 2002-2003 SARS outbreak sequences", "We developed and released the Genome Detective Coronavirus Typing tool as a free-of-charge resource in the third week of January 2020 in order to help the rapid characterization of COVID-19 infections. This tool allows the analysis of whole or partial viral genomes within minutes. It accepts assembled genomes in FASTA format or raw NGS data in FASTQ format from Illumina, Ion Torrent, PACBIO or Oxford Nanopore Technologies (ONT) can be submitted to the Genome Detective Virus Tool (Vilsker et al., 2019) to automatically assemble the consensus genome prior to executing the Coronavirus Typing Tool. User effort is minimal, and a user can submit multiple FASTA sequences at once." ] },{ "paper_id": "4be09649912765a96eb17e54d40b4b777b3413c6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4bf7428a3d7bd1625f0e945398eb8ff045ea4b71", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The proteins found in plaques or neurofibrillary tangles are from two proteomics studies yielding 488 proteins in plaques [85] and 90 in tangles [86] .", "Viruses are transported via the microtubule network [128] , which is also exploited by C. pneumoniae, T. cruzi, and T. gondii to reorganize cellular organelles to the pathogens' advantage [129, 130] . Phosphorylated tau is a hallmark of neurofibrillary tangles and is induced by many pathogens. Tau inhibits the motility of the kinesin-1 motor protein that transports cellular organelles (or viruses) along the microtubules and tau phosphorylation counteracts this inhibition [131] , but it is not clear whether this benefits or deleteriously affects the pathogens.", "Two separate case reports have shown remission from an initial diagnosis of dementia or AD in patients subsequently diagnosed with and treated for C. neoformans infection [278, 279] ." ] },{ "paper_id": "4c13be11a41de81fb7066f7993da218c463cfa1e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "www.nature.com/scientificreports SCIENTIFIC REPORTS | 3 : 3311 | DOI: 10.1038/srep03311 both genders and found no such differences in our results for MDS patients.", "ELISAs. Utilizing ELISA kits we measured plasma levels of AKT3 (dilution 1:5, PathScanH Catalog No. #7934, Cell Signaling), FCGR3A (dilution 1:10, Catalog No. E91278Hu, Uscn Life Science Inc.) and ARL8B (dilution 1:10, MyBioSource Catalog No. MBS946943), using samples from 20 subjects (80 total) for each of s-MDS, t-MDS, L and healthy subjects tested in triplicate, following each manufacturer's instructions (Fig. 3c) .", "M yelodysplastic syndromes (MDS) encompass a diverse range of hematological disorders, with variable clinical outcomes resulting from individual patients' clinical and biological features 1, 2 . MDS pathogenesis involves multifaceted factors, related to intrinsic hematopoietic precursor cell abnormalities. The prevalent shared pathogenesis causing the ineffective hematopoiesis in MDS involves varying degrees of apoptosis of the hematopoietic cell linage [3] [4] [5] . Recent genomic approaches have concentrated on the effects of specific gene mutations and their associated signaling pathways, and their role in MDS development and outcome, including the tendency of transitioning to more aggressive disease stages 6, 7 . Currently, the prognosis of patient outcomes is greatly facilitated by the establishment of the International Prognostic Scoring System (IPSS 8 , recently revised as IPSS-R 9 ). The IPSS takes into account multiple clinical markers to classify lower risk patients (Low, Intermediate 1) as having improved prognoses compared to those with higher risk features (Intermediate 2 and High)." ] },{ "paper_id": "4c565559fff97813a77571986c4c0b34fa3f4d46", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u2022 Optimization and preclinical analysis of a bacterial natural product.", "Stocks of NL4-3 (X4 virus) were prepared by transfection of 293T cells and collection of supernatants on day 2. Supernatants were filtered, aliquoted and frozen at \u221280 \u00b0C until use. Amounts of virus were quantified by p24 ELISA and infectivity of viral stocks verified using CD4+ HeLa-betagalactosidase reporter cells.", "Refer to Web version on PubMed Central for supplementary material.", "From the 1940s to 2007, 73% of the 155 small molecules approved as anticancer drugs were of natural origin, either directly or derived 1 . As opposed to this, few natural products had been approved for use in antiviral therapy, although they were the inspiration for antiviral nucleoside analogues 2 .", "Anti-HCV assay in Huh 5-2 cells was performed by seeding 6.5\u00d710 3 cells per well in a tissue culture treated white 96-well view plate (Packard, Canberra, Canada) in Dulbecco's modified essential media (DMEM) supplemented with 250 \u00b5g/ml G418. Following incubation for 24 h at 37 \u00b0C (5 % CO 2 ) medium was removed and 3-fold serial dilutions in complete DMEM (without G418) of the test compounds were added in a total volume of 100 \u00b5l. After 4 days of incubation at 37\u00b0C, cell culture medium was removed and luciferase activity was determined using the luciferase assay system (Promega, Leiden, The Netherlands); the luciferase signal was measured using a Safire2 (Tecan, Switzerland). Relative luminescence units were converted to percentage of untreated controls. The 50 % effective concentration (EC 50 ) was defined as the concentration of compound that reduced the luciferase signal by 50%." ] },{ "paper_id": "4c5c841e4ad3fbf9b31d6c0c282dfec035f716bb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4c819d4002a693bae0a39b5d0a282c4feac3f184", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4c8bac1e65d1fd2effec0b45c143a97cef99aebd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4ca26be0493fc360519e7586ec0392760846d662", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ISDS Annual Conference Proceedings 2017. This is an Open Access article distributed under the terms of the Creative Commons Attribution-Noncommercial 3.0 Unported License (http://creativecommons.org/licenses/by-nc/3.0/), permitting all non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.", "Phylogenetics; Transmission Graph; MERS-CoV; Syndromic; Genetic", "Here we use novel methods of phylogenetic transmission graph analysis to reconstruct the geographic spread of MERS-CoV. We compare these results to those derived from text mining and visualization of the World Health Organization's (WHO) Disease Outbreak News." ] },{ "paper_id": "4d186611ecffce20666431e3e9988308833c0236", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Considering a dropout rate of 30%, the sample size increased to 77 individuals, which was then further rounded up to 80 (per group) to enhance the accuracy. According to our CONSORT diagram (Fig. 1) , after the dropout, each group ended up to contain 60 samples.", "The use of positive end-expiratory pressure is one of the ways to treat atelectasis after cardiac surgery. It is not as a preventive method for the atelectasis. It's also a controversy about its beneficial level." ] },{ "paper_id": "4d9b7d6b31a252255d427fd463344c162ae7c690", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4db442dee5f7675795f576b1f6b7be277decf03b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Since all continuous variables were skewed, medians and ranges were calculated to describe the data. Numbers and percentages " ] },{ "paper_id": "4de882602b82e20b2b7d9c7cb136de860a4f8634", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "HEK293T (human embryonic kidney epithelial cell line) and Raw264.7 (murine macrophage cell line) cell lines were cultured in Dulbecco's modified minimal essential medium (DMEM) supplemented with 100 U penicillin-streptomycin and 10% fetal bovine serum at 37 o C in a humidified atmosphere containing 5% CO 2 .", "Group comparisons were performed by a paired Student's t-test in Prism 7 (GraphPad Software, USA). Differences were considered significant when P values were less than 0.05." ] },{ "paper_id": "4e0773d0ae56a69211b358144a99bbecbad56bac", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. Statistical analysis was performed using SPSS version 17.0 (SPSS, Inc., Chicago, IL, USA). Continuous variables were compared using analysis of variance (ANOVA) and one-way ANOVA was used to evaluate the differences among groups. Non-continuous variables were compared using a Mann-Whitney U test between two groups and Kruskal-Wallis H non-parametric test among groups. Correlation was evaluated using Pearson's or Spearman's correlation analysis. P<0.05 was considered to indicate a statistically significant difference.", "Determination and image capture. The specimens were evaluated semi-quantitatively by two pathologists in a blinded-manner (22) . The frequencies of positive cells to total cells at x200 magnification were scored as follows: 1, \u226425%; 2, 26-50%; 3, >51%. The staining intensity above the background level was scored as follows: 0, no staining; 1, light yellow; 2, yellow-brown; 3, brown. These scores served as measures of target protein expression. The final score was the product of the above two scores: 0, negative (-); 1-2, weakly positive (+); 3-4, positive (++); 6-9, strongly positive (+++). Slides were mounted with gum for examination and captured using an Olympus BX51 microscope (Olympus Corp., Tokyo, Japan) and a Nikon Digital Camera System (80i; Nikon Corp., Tokyo, Japan) for study comparison. For this evaluation, five fields were randomly selected per section (magnification, x200).", "Detection of viral load. Blood was processed within 2-4 h post-collection by centrifugation for 10 min at 1,100 x g for plasma separation, followed by HIV RNA extraction by using a Roche Cobas AmpliPrep/Cobas TaqMan automatic analysis system (Roche Diagnostics; Basel, Switzerland, USA). The viral load was quantitatively measured using a Roche Cobas AmpliPrep/Cobas TaqMan HIV-1 test kit (version 2.0; Roche Diagnostics) according to the manufacturer's instruction." ] },{ "paper_id": "4e14a0bdb3702f1c98145da4335c327a99b7275c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The institutional review board at Seoul National University Hospital reviewed the study protocol and provided study approval. The board waived the requirement for written consent (IRB re- " ] },{ "paper_id": "4e2387a88720584e25e0f6418be2491523e288af", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4e5e41c6bee286394aab9998f7c4b2401a80333b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4e9acd476a5b8224baf48582bd4f4c095feafe27", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4ea10ee40e0ecf02db0667f87ed9ee4e2bd6aa9c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data are expressed as mean \u00b1 SD (number of mice). Statistical difference between groups was determined using the unpaired two-tailed t test. When there were more than two groups, differences were analyzed using analysis of variance if the variances were equal, and the Mann-Whitney nonparametric test if variances were unequal [16] . Linear regressions were calculated using a statistical computer package, Number Cruncher Statistical Systems [16] . A value of P < 0.05 was considered statistically significant.", "HEK-293 T cells were cultured in DMEM medium containing 10% fetal bovine serum (FBS) in air and 5% CO 2 atmosphere at 37\u00b0C. CaCo-2 cells were cultured in DMEM medium containing 10% FBS, 4.5 g/l glucose, 2.292 mg/ml glutamine, 10 nmol/l pyruvic acid sodium, = and 1% unsaturated amino acid in air and 5% CO 2 atmosphere at 37\u00b0C.", "In conclusion, polyethylenimine is a new human TLR5 agonist with potential application in radiation protection, including, but not limited to, offering protection for cancer patients who receive radiotherapy or radiosurgery, and could serve as a new compound for protecting the health and safety of people in radiation-related accidents." ] },{ "paper_id": "4eb6e165ee705e2ae2a24ed2d4e67da42831ff4a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The program can be obtained free of charge for research purposes by contacting the authors.", "A resequencing microarray (RPM v.1) was designed previously for detection and sequence typing of 20 common respiratory and 6 CDC category A biothreat pathogens known to cause febrile respiratory illness based on ProSeqs without relying on predetermined hybridization patterns (15, 16, 18 ", "In this paper, target pathogens are the organisms the assay was specifically designed to detect. The sets of probes that represent reference sequence selected from target pathogen genomes are referred to as a Prototype Sequence or 'ProSeq' for brevity. The set of resolved bases that result from hybridization of genomic material to a ProSeq is referred to as the hybridized sequence or 'HybSeq'. The HybSeq is split into possible subsequences or 'SubSeqs'.", "image of the database obtained on this date.) The default gap penalty and nucleotide match score were used. The nucleotide mismatch penalty, -q, parameter was set to \u00c01 rather than the default. The results of any BLAST query with an expect value <0.0001 were returned in tabular format from the blastall program. The information about each return (bit score, expect value, mismatches, length of match) was placed in the Return{hash key}{info} hash using the SubSeq identity as the hash key for further analysis." ] },{ "paper_id": "4ebe630a2d802a7d6f2402a88c3dc88e7497dcfd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "F.J. and C.C. designed the research, performed the experiments, and analyzed the data. F.J. wrote the paper. M.H. supervised the study and edited the paper.", "(B) A simplified diagram of the pyrimidine metabolism pathway and related genes in C.", "(C) A picture of the disorganized germline of a cddko worm when fed diluted control RNAi food. This phenotype was suppressed when control RNAi was replaced with endu-2 or ctps-1" ] },{ "paper_id": "4ec7c4ec545371f4b8c4a40db7d28fc534674c39", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study was approved by the institutional review board of Sunchon National University (104173-201705-HR-013-02, 104173-201709-HR-023-02). Prior to participating, written informed consent was obtained from each participant; participants were also informed that their consent could be withdrawn at any time during the study.", "The structured questionnaire was adapted from the World Health Organization's survey. Data were collected between June 26 and July 14, 2017." ] },{ "paper_id": "4ecbacf61daab591e76f7471eb6e7fc1a4e0ed70", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4edda548e89522b4df20e723e29c63f309857b10", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Microarray data accession numbers. Raw microarray data have been deposited in NCBI's Gene Expression Omnibus under accession number GSE45042." ] },{ "paper_id": "4ee0f8eb93dda0ff3512556fbb784c3859cc156f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Leishmaniasis is present in countries around the Mediterranean Sea where the insect vector is present. The ", "Numerous studies have suggested the importance of companion (pet) animals to the physical and mental well-being of their owners. 74 This includes the need to travel with ", "Publish your work in this journal Submit your manuscript here: http://www.dovepress.com/veterinary-medicine-research-and-reports-journal Veterinary Medicine: Research and Reports is an international, peer-reviewed, open access journal publishing original research, case reports, editorials, reviews and commentaries on all areas of veterinary medicine. The manuscript management system is completely online and includes a very quick and fair peer-review system. ", "Companion animals are susceptible to a range of infectious diseases, many of which are zoonotic. Table 2 provides a short list of common vector-borne diseases associated with dogs. " ] },{ "paper_id": "4ef096e83734058dd9385a5d65b0c63c080df563", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Is RlmM dependent on rRNA substrate for closing the AdoMet pocket?", "Prior to methylation reactions, 200 nM rRNA (23S in vitro transcript or transcribed domain V) was suspended in 40 mM HEPES pH 7.6, 100 mM NH 4 Cl, 10 mM MgCl 2 , 12 mM b-mercaptoethanol, 20% glycerol and 0.1% Triton X-100 and warmed for 10 min at 50 C followed by 15 min at 37 C (9). A final concentration of 1 mM AdoMet was then added as the methyl donor followed by addition of Ni-purified RlmM to a final concentration of 100 nM. The reaction was carried out at 37 C for 90 min or as noted otherwise. Reactions were quenched in 50:50 phenol:chloroform followed by ethanol precipitation. Precipitated RNA was dissolved in H 2 O prior to primer extension. For time course analysis, 10 ml aliquots were quenched in 50:50 phenol:chloroform at 0 s (before enzyme addition), 30 s, 1, 2, 4, 8, 20, 45 and 90 min. Primer extension analysis was used to detect the modification.", "Pdb entries 4auk, 4atn, 4b17.", "Of the other similar structures, archaebacterial fibrillarins take part in guide-mediated ribose methylation in rRNA and tRNA, RrmJ is a bacterial 23S rRNA 2 0 Oribose MTase and Nsp5 is involved in capping of viral mRNAs. Thus, similar structures are used for ribose methylation of a variety of substrates in viruses, bacteria and archaea using different mechanisms of substrate recognition." ] },{ "paper_id": "4f03e55d6a48282637116273820d4114459abfb0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4f3e689f3806b2047b5f5a70df6ce9d3581dcc97", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Details and examples further describing the three disease emergence categories are provided in subsequent sections.", "Distinctly different from the above three disease emergence categories is the disease behavior that that normally plays at the population level. All diseases feature a certain degree of plasticity in terms of their behavior in time and space, responding to host demographic cycles, host immune status, spatial population structure, seasonality or health protection measures ( Figure 1 , numbers 1, 2 and 3).", "The drivers of disease emergence in a novel landscape facilitate access by existing pathogens to host resources elsewhere distributed. More complex scenarios involve introduction of infected host populations or infected vectors becoming newly established upon arrival." ] },{ "paper_id": "4f7e3be54c93d119c3a1ddb753aa5394878a2bbe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Besides performing clinical clerkships, students attended lectures held in classrooms located at the main teaching hospital (SMC). Thus, SKKUSOM students faced a greater risk than those of other medical schools with a school building separate from their teaching hospital.", "(1) ensuring student safety, (2) minimizing loss of student learning, and (3) reducing anxiety and concern on the part of staff and students. Details of SKKUSOM's actions are discussed below.", "At the end of May 2015, the first Korean patient with MERS was reported at the SMC, and several nearby patients were subsequently identified as having MERS." ] },{ "paper_id": "4f8881d84a2dc68828437d1778e841a3fbf6e2b4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4f8d0dce755f89c22c48c301fe55a457c8ed715b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The ", "who were active in notifying cases to FLU-CIN. S.J. Brett and P.J. Openshaw wish to acknowledge the support of the UK NIHR Biomedical Research Centre scheme." ] },{ "paper_id": "4fab9d6fcfd7daca9ed2e0f89c2433955d34e553", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "4fd25cc19b106e5c8a69f89162ca37719192330d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Pneumocystis pneumonia highly unlikely The following findings 'do not' represent pathogens causative for lung infiltrates:", "Previous exposure to antifungal therapy may reduce the sensitivity of the galactomannan as well as quantitative PCR assays [103, 104] ." ] },{ "paper_id": "50005544cba05adf4b743e0ec11f39bd8d903cbd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No potential conflicts of interest were disclosed.", "This work was supported by NIH grants AI089716 to CG and GM053396 to DJK.", "ADP ribosylation factor 1 ATG autophagy related BECN1 Beclin 1 BFA brefeldin A ER endoplasmic reticulum GTP guanosine triphosphate LC3 microtubule-associated protein 1 light chain 3 MEF mouse embryo fibroblast" ] },{ "paper_id": "500e585afac01e4b3847aa138db86b04352484c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5036d9acb850bbb3705be78b3ab64dec35d68b27", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "History, signalment, and physical examination findings were recorded for all 78 cats examined. Laboratory analysis (<3 days before laparotomy) for all 78 cats included fecal parasitological examination, CBC, a serum biochemistry profile: albumin (ALB), b blood urea nitrogen (BUN), b creatinine (Crea), b alkaline phosphatase activity (ALP), b alanine amino transferase activity (ALT), b c-glutamyl transferase activity (cGT), b aspartate transaminase activity (AST), b total bilirubin (TBIL), b lipase activity (LIPA), b calcium (Ca), b phosphorus (P), b potassium (K), c sodium (Na), c blood coagulation profile including prothrombin time (PT) d (76/78) and partial thromboplastine time (PTT) d (76/78), serum total thyroxine (T 4 ) concentration, e free thyroxine (fT 4 ) concentration, e serum feline pancreatic lipase immunoreactivity (fPLI measured by Spec fPL \u00d2f ) [32] [33] [34] [35] (76/78), trypsin-like immunoreactivity (fTLI g ; 77/78), and FIV, h FeLV, h and feline coronavirus i testing.", "Diagnostic imaging included thoracic and abdominal radiographs g (69/78) and abdominal ultrasonography k (76/78).", "Cholangitis Score Pancreatitis Score n Median (Range) Median (Range) Median (Range) " ] },{ "paper_id": "50641a70bd884557e33cd969cd77a0f724f4dda6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A cross-sectional survey was conducted of qualified nurses between 18 April and 18 October, 2010. Qualified nurses attending continuing professional education courses at a large university in central London were invited to participate in the study. Potential respondents were given a study information sheet and a questionnaire by the investigator. Completed questionnaires were collected immediately by the investigator or returned by mail to the research team using Freepost addressed envelopes. Questionnaire completion was anonymous so that it was not possible to follow up non-response. Ethical approval was obtained from the University Ethics Committee.", "Further comparisons were performed to explore whether there were differences across the different items of knowledge and risk perception in the clusters.", "For the above reasons, the World Health Organization (WHO), United Kingdom Department of Health (DoH) [8] , United States Centers for Disease Control and Prevention (CDC), other healthcare professional organizations and many countries' government agencies [1, 9, 10] strongly recommend the annual seasonal influenza vaccination of HCWs. However, studies suggest that influenza vaccine uptake in HCWs is often low worldwide [11] [12] [13] [14] . For example, the overall seasonal vaccination rate in England for HCWs was 26 . 4% for the 2009/2010 season [15] . Nurses, as the group having the most patient contact, are more reluctant to be vaccinated than other HCWs [16] [17] [18] [19] [20] [21] [22] [23] ." ] },{ "paper_id": "509eaf8fb436b60e6d84da002b3630d62b39309e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Lipkin WI. 2015. Middle East respiratory syndrome coronavirus recombination and the evolution of science and public health in China. mBio 6(5):e01381-15.", "The paper is important in two respects. First, the recombination event may have resulted in the evolution of a new lineage of MERS-CoV with different transmission properties. Additional field work in epidemiology and studies of recombinant viruses in culture and in animal models will be required to determine whether this proves true. However, the paper itself is evidence of an evolutionary advance in scientific expertise and transparency that is at least as important for microbiology and public health. China has come a long way since the emergence of SARS-CoV in 2002/2003.", "Recombination is common in coronaviruses and has been implicated in the emergence of pathogenic coronaviruses in poultry, cats, and pigs (2, 3). It would not be surprising, therefore, if recombination were to occur in MERS-CoV and to result in enhanced transmission or virulence. Wang et al. clearly demonstrate through bootstrap scanning and single-nucleotide polymorphism analyses that the viruses found in South Korea and China represent a recombinant virus that contains a clade B group 3 coronavirus sequence in the 5= portion of the genome and a clade B group 5 coronavirus sequence in the 3= end of the genome, with a site of recombination between nucleotide positions 17206 and 17311, a region that spans the junction between the ORF1a and S genes. They note that the recombination is evident in recent strains identified in human cases of MERS in Saudi Arabia and estimate that the recombination occurred in Saudi Arabia in the later months of 2014." ] },{ "paper_id": "50a6717377c416aadc6204e0e92f96d12ab4b0e7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This review will focus on the therapeutics currently available for treating viral hepatitis of all forms. In addition, the potential of new therapeutics and targeted inhibitor-based therapies against viral membrane-penetrating peptides and viroporins, a group of virally encoded proteins involved in facilitating replication and other specific steps in the viral life cycle, are also discussed.", "We further investigated the non-structural 2B protein of HAV, which was found to contain a stretch of 60 residues in its C-terminus, and which has viroporin-like activity. 97 A combination of crosslinking studies, biophysical assays and simulation was employed to determine that 2B probably forms dimers and generates ;3 nm pores in membranes. The resulting alteration of membrane permeability is thought to be essential for HAV replication. It is probable that inhibition of the membrane activity of 2B would negatively impact the viral replication process. Thus, a treatment regimen against HAV, which includes a combination therapy targeting VP4 and 2B, could be a very promising and effective approach.", "Given the essential roles played by viroporins and viral membrane penetrating peptides in enhancing several aspects of the virus life cycle, targeted inhibitor therapy holds promise for development of virus-specific drugs. Establishing the commonalities between the structures and functions of these membrane active components might make it easier to design small molecule inhibitors. Finally, given the promise of p7-based therapy against HCV, it is essential to pinpoint such potential candidates in other hepatotropic viruses, in order to expand therapy options against chronic and acute viral hepatitis. " ] },{ "paper_id": "511cd67bbeb3835b5feb25ace6582b7d758debe4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Vitamin D is known for its positive effects on bone mineralization and calcium metabolism, and severe deficiency has classically been linked to rickets. Mounting evidence now points to a key immunomodulatory role for vitamin D and to a link between vitamin D deficiency and increased susceptibility to acute viral infections [90] . Furthermore, despite conflicting reports and heterogeneity within studies, a recent systematic review encompassing 10933 participants in 25 randomized controlled trials concluded that vitamin D supplementation reduced the risk of acute respiratory infection, with stronger protective effects in patients with baseline 25-hydroxyvitamin D levels <25 nmol/l [91] .", "Human rhinoviruses \u2022 Human rhinoviruses (RVs) are the primary etiological agents of the common cold, but can cause serious illness and increased hospital admissions in immunocompromised individuals or those with pre-existing respiratory conditions.", "This work was supported by a funding award from the Chief Scientist Office (ETM/389) awarded to PG Barlow and C Stevens. FH Sousa is supported by a 50th Anniversary PhD studentship from Edinburgh Napier University. The authors have no other relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclosed." ] },{ "paper_id": "51485c1b5e3ce7050422a81c6a16ed00faa768fd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Moreover, lower respiratory infections (LRIs), including acute lower respiratory tract infections, pneumonia, atypical pneumonia, bronchitis, bronchiolitis, and severe acute respiratory syndrome (SARS), continue to threaten the health of children worldwide and especially in developing countries, where poor nutrition prevails and access to health care is scarce [11] .", "Student's t-test or one-way analysis of variance (ANOVA) was used for normally distributed variables, while the Mann-Whitney test was used for variables not normally distributed. Values of p < 0.05 were considered as significant.", "Re f e r e n c e s" ] },{ "paper_id": "5157ee00e0ee6c807ca321c405baf2d8b9bd8a4f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Barral-Netto, M., Barral, A., Brodskyn, C., Carvalho, E. M., and Reed, S. G. (1995) . Cytotoxicity in human mucosal and cutaneous leishmaniasis. Parasite Immunol. 17, 21-28. Basu, R., Roy, S., and Walden, P.", "Interestingly, CD8 + T cells do not only participate in primary responses to L. donovani, but are also the major mediators of resistance upon reinfection (Stern et al., 1988) . Indeed, protection was abrogated following CD8 + T cell but not CD4 + T cell depletion.", "www.frontiersin.org" ] },{ "paper_id": "517698251b94fac6d80edcc4644e2448a4efd4ef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "and recursions for the p-variables reduce to:", "Supplementary data are available at Molecular Biology and Evolution online. ", "By separating out the first and last term in the sum above, and using the y-variable recursions, a nearly direct recursion can be written for the x-variables:" ] },{ "paper_id": "51a24b884e01df122d889f1133e7727e2478be24", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The exchange of genetic material generates variations among natural populations and demonstrates their role in evolution and adaptation (Awadalla 2003) . Populations of RNA viruses usually harbor genetic diversity due to high mutation rates, recombination, turnover rates, and large variability (Simon-Loriere and Holmes 2011). Genetic RNA recombination contributes to viral evolution and biogenesis (Koonin, Dolja, and Krupovic 2015) , evident in many groups of plus-sense RNA viruses in animals (Weiss and Schlesinger 1991; Graham and Baric 2010; Lukashev 2010) , plants (reviewed in Bujarski 2013) , and bacteria (Palasingam and Shaklee 1992) , in negativesense (Han and Worobey 2011) , double-stranded (Krupovic, Dolja, and Koonin 2015) , and retroviruses (Delviks-Frankenberry et al. 2011) , and in defective-interfering RNAs (Sandoval et al. 2008) .", "The PCR-generated cDNA products were cloned into the pGEM-T Easy vector (Promega). Digestions with strain-specific restriction enzymes were used to select the insert-carrying cDNA clones and to confirm the ratio of F to R strains in the coinoculated plants. The insert-carrying clones were sequenced using the Sanger protocol at The University of Chicago DNA Sequencing and Genotyping Facility (http://cancer-seqbase.uchi cago.edu/).", "Supplementary data are available at Virus Evolution online.", "Column four presents the corresponding P values that reflect the reliability of the Pearson correlation coefficient. A P value of 0.05 and lower means a 95 per cent chance the stated correlation being correct. The fifth column displays the degrees of freedom, which was used to calculate the correlations; they simply represent the number of fragments being analyzed minus 2." ] },{ "paper_id": "51a25686ff156fa8b99d72204eb04a10079a0a74", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "51d37c55030f7c7570f83c8a75f5e6a97209a6c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was conducted in accordance with the amended Declaration of Helsinki and was approved by the Institutional Review Board of Seoul National University Hospital (protocol no. H-1705-019-851). The requirement for informed consent was waived because of the retrospective study design and because all patients records and information were anonymized prior to analysis.", "Isolation beds were isolated with walls and a door, whereas open beds were divided by curtains. The patient to nurse ratio was 2:1 during the day and evening and 3:1 at night. Routine cleaning of the floors was performed every day with 4% sodium hypochlorite and was done more frequently when visual contamination was observed. When a patient left the ICU bed, every surface of the patient's medical equipment was cleaned with 50% benzalkonium chloride.", "Categorical variables are described as numbers and percentages and compared using either the chi-square test or Fisher exact test. Numerical variables are described using the median and interquartile range (IQR) and compared using the Mann-Whitney U-test. IRs are described as numbers per 1,000 patient-days with 95% confidence intervals (CIs) and compared using Poisson regression analyses or negative binomial regression analyses. All statistical analyses were performed using STATA version 13.0 (Stata Corp., College Station, TX, USA). The P-values of less than 0.05 were considered statistically significant." ] },{ "paper_id": "51fff92f21f050e40ae7214b2b0b3a51e9079918", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data were described using percentages and means (SD). The differences between the proportions were compared using chi-square test. Data were analyzed using IPM-SPSS version 23. A P value of less than .05 was considered as statistically significant.", "A cross-sectional study was conducted among resident doctors who were working in MOH and university teaching hospitals in Jordan during the period September 2017 to January 2018. The 4 main MOH hospitals out of 32 hospitals and 2 teaching hospitals that have residency programs were selected. All residents in the selected hospitals from all specialties including emergency medicine, internal medicine, pediatric, and family medicine were visited by the researcher and invited to participate in this study." ] },{ "paper_id": "52069d14f038d493dce5d6cc1fdcdc7c1f0823f9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "52566dccb4bd8044edc87b1a0aa268320a6ea3d4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Full characterization for all the compounds described below can be found in the Supplementary Data.", "A total of 102 unrelated Centre Etude Polymorphism Humaine DNA samples were obtained from the Coriell Institute of Medical Research (http://locus.umdnj.edu/) after specifying that the DNA samples should be used for research purpose only. The list of templates used is available at http:// snp500cancer.nci.nih.gov.", "I FL1 R 1 -R 7 \u00bc H; n \u00bc 0 0.97 0.0031 313 II FL2 R 1 \u00bc R 3 \u00bc R 4 \u00bc R 5 \u00bc R 6 \u00bc R 7 \u00bc Cl; R 2 \u00bc H; n \u00bc 0 0.93 0.0012 775 III FL3 R 1 \u00bc R 3 \u00bc R 5 \u00bc R 6 \u00bc Cl; R 4 \u00bc R 7 \u00bc H; R 2 \u00bc CH 3 ; n \u00bc 0 1.04 0.0010 1040 IV FL4 R 1 \u00bc R 3 \u00bc R 5 \u00bc R 6 \u00bc Cl; R 4 \u00bc R 7 \u00bc H; R 2 \u00bc CH 3 ; n \u00bc 1 1.90 0.0260 73 - - - - - - - - - - - - - - - - -4 - - - - - - - - - - - - - - - -2 - - - - - - -3 - -5 3'-GCTGAGCCGGGAACGGGCGGTGTAACCGTGGCTGACACTGA -5' |||||||||| 5'-Q-CTCGGCCCTT Dye", "Apurinic/apyrimidinic (AP) sites in DNA arise via spontaneous or mutagen-induced hydrolysis of the N-glycosylic bond, or through the repair activity of DNA glycosylases (10) . If left unrepaired, AP sites are potentially lethal or mutagenic (11). To cope with the deleterious consequences of AP sites, organisms possess AP endonucleases that initiate the repair of these DNA lesions (10) . Class II AP endonucleases initiate repair by catalyzing the hydrolysis of the 5 0 -phosphodiester of an abasic site to generate a 3 0 -OH group and a 5 0 -abasic phosphate residue (10) . The substrate specificity of human apurinic endonuclease on synthetic substrate analogs has been reported previously (12) ." ] },{ "paper_id": "528411eebd9d3c1b16ab5ec425724551e7837c5d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Venous blood gas analysis revealed a mixed acid-base disorder with pH 7. 43 An abdominal focused assessment with sonography for trauma scan revealed a moderate amount of echogenic fluid with small suspended particles, diagnosed as a septic exudate on cytology and later confirmed with bacteriologic culture to contain E. coli.", "One day after surgery, the cat developed mild dyspnea. A thoracic ultrasound revealed minimal pleural and pericardial effusions. Echocardiography revealed mild inhomogeneity of the ventricular wall, suggestive of possible myocarditis, and minimal pericardial effusion. Pleural fluid real-time PCR for feline Corona virus was negative. Cytology revealed a septic exudate, confirmed to be hemolytic E. coli on bacterial culture. Blood cultures were negative. The pyothorax was treated with intermittent thoracocentesis followed by placement of bilateral chest drains and intermittent lavage during 4 days. Bacterial culture and sensitivity revealed that E. coli cultured from both body cavities was sensitive to marbofloxacin but E.coli cultured from the peritoneal cavity was resistant to ampicillin and rifampicin, and E.coli cultured from the pleural cavity was resistant to all penicillins and 1st-and 3rd-generation cephalosporins. Monotherapy with marbofloxacin was, therefore, continued.", "Necropsy, performed with the owner's consent, revealed mild myocardial arteriosclerosis, and bilateral diffuse adrenocortical hyperplasia and hypertrophy with moderate cytoplasmic vacuolization, but no lesions explaining the cause of death were identified." ] },{ "paper_id": "52cc80efbb69d917fa6d4ad3f34f73124ea27ee8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Records from subsequent visits were then examined to determine if any follow-up testing was performed to confirm the positive FeLV results. For cats that were euthanased or known to have died, the date of death was recorded. For all other cats, the most recent date the cat was known to be alive (either through a clinic consultation or other forms of client communication) was recorded.", "Separate multivariable logistic regression models were then constructed for FeLV and FIV to identify risk factors associated with test positivity. Univariable analyses were performed using a \u03c7 2 test (for variables with more than five observations in all cells) and Fisher's exact test (for variables with fewer than five observations in at least one cell) to identify risk factors associated with the outcome of interest at a P value <0.2 for inclusion in the multivariable analysis.", "Most veterinary practices never (70/112; 62.5%) or rarely (29/112 or 25.9%) vaccinated against FeLV. Only an estimated 0.2% of cats were vaccinated during the 2015 calendar year with the most common reasons being requested by the owner (29.7%), exposure to infected cats (25.3%), routine vaccination (25.3%), cat at risk being outdoors (5.4%) and other reasons (21.3%). The low perceived prevalence of disease was highlighted as the main reason for not vaccinating against FeLV in the Likert-rating questions (Table 1) and free-text survey comments." ] },{ "paper_id": "52e323d1ed2d4a0dfbe4f68d15d20430a33de8bf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Raw and summarized microarray have been deposited to the NCBI GEO and are available under accession numbers GEO:GSE65075. H K / H K 6 : 2 P a n / P a n 6 : 2 H K / P a n 6 : 2 P a n / H represented as mean with SD. An asterisk (*) indicates statistically significant differences (P < 0.05) between HK wt and HK +II virus.", "The quantitative real-time PCR-based cytokine/chemokine analysis (RT 2 Profiler PCR Array; human NFkB signaling targets [PAHS-225Z]; QIAGEN) was conducted according to manufacturer's protocol. Data analysis was conducted by RT 2 Profiler PCR Array Data Analysis software on QIAGEN webpage.", "For determination of virus titers and cytokine/chemokine protein levels, mouse lungs were collected in PBS, homogenized using a FastPrep-24 homogenizer with Lysing Matrix D (both from MP Biomedical), and adjusted with PBS to obtain a 10% tissue homogenate. The samples were cleared of debris, and supernatants were used for virus titer determination in standard plaque titration and for measuring the concentration of interleukin 6 (IL6), tumor necrosis factor (TNF), and chemokine (C-C motif) ligand 2 (CCL2) using a custom multiplex cytokine/chemokine assay (Millipore) analyzed with a Luminex xPOTENT 3.1 system (Bio-Rad) following manufacturer's protocol.", "For analysis of lung physiology upon influenza virus infections, animals were anesthetized with 1 mg/ml xylazine (Vedco) and 7 mg/ml Euthasol (Virbac) prior to surgical intubation and attachment to the flexiVent FX1 small animal ventilator (SCIREQ). Using the ''mouse inhaled dose response'' script, baseline and responses to 25 mg/ml acetyl-b-methacholine (Sigma-Aldrich) were gathered. Software-generated values for the respiratory system resistance (Rrs), compliance (Crs), and elastance (Ers) and Newtonian resistance (Rn), tissue damping (G), and tissue elastance (H) were recorded. The mean for each was calculated for each animal prior to obtaining the mean and SD of the mean for the group." ] },{ "paper_id": "5322d3b9f5ee17d5b931f0c32173125d6a7304ed", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We washed cells in PBS and lysed them in radioimmunoprecipitation assay buffer (25 mM Tris, pH 7.6, 150 mM NaCl, 1% NP-40, 1% Nadeoxycholate, and 0.1% SDS) with added protease inhibitors. We resolved", "Abbreviations used in this paper: BiP, immunoglobin-binding protein; FRT, ferritinlike protein recombination target; hIre1, human Ire1-\ue061; MEF, mouse embryonic fibroblast; qPCR, quantitative real-time PCR; RIDD, regulated Ire1-dependent decay; Tm, tunicamycin; UPR, unfolded protein response." ] },{ "paper_id": "5335dd626c2c607a3a6f7abefb0d341f0fd63164", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "533f8d39de2e16fb92614d2441621e8fddd85bbe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Abbreviations: see Table 1 ." ] },{ "paper_id": "53c5b444db5bde8e975a22df9e3c80250e8ad3d1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "53cf48ec1726de4e093378e48a74632bf485cca6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial No Derivatives (by-nc-nd) License. (CC-BY-NC-ND 4.0: https://creativecommons.org/licenses/by-nc-nd/4.0/)", "NOTE", "Virology" ] },{ "paper_id": "53f05daf7342372ab5fbeb2f4f5710254fcad893", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "53f9b02ce4cc149507a9d402dcf9d4c191b3bb29", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All human protein sequences were retrieved from Refseq database ftp site (ftp://ftp.ncbi.nlm.nih.gov/genomes/H_ sapiens/protein/) and essential proteins were subjected to BLASTP search against the human proteins with BioEdit. Only the non-hit proteins at e-value cut off 10 \u221210 , were ", "Drug target identification by subtractive genome analysis approach selected as non-homologous proteins to avoid any functional similarity with host proteome.", "As no exact protein data bank (PDB) structure was available for dnaE in PDB, it was subjected to BLAST search against PDB structures using 0.001 e-value cut off. The template for homology modeling was chosen considering X-ray diffraction resolution and highest sequence similarity. Homology modeling was done on ESyPred3D server. 43 " ] },{ "paper_id": "5407b1aabede9eeed76c59a7b890be9f513712b7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Primers for EGFP-P1 fusion", "ARTICLE HISTORY" ] },{ "paper_id": "541efff1146fcb123189ad615099b67769ed41c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The interviews were transcribed and translated into English. The English translations were thematically coded using the qualitative research software, NVivo 10. Data on specific topics of interest were systematically compared across interviews and variations by gender and site noted. ", "American people through the United States Agency for International Development (USAID)." ] },{ "paper_id": "543ac2431685616436dfe9f7ff063a02a741686f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Sophie L. Nixon https://orcid.org/0000-0003-4375-434X" ] },{ "paper_id": "544a005c6288491bc6229435fddcdec62d6e24b9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "544a170a18bae9bf44c531c2b0b4bdc5e85ea8f5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "54560eb4cc2e0affe21b8b21435c907232764c8a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors declare that there is no conflict of interests regarding the publication of this article. ", "Coronaviruses belong to the Coronavirinae subfamily. Currently, this subfamily is classified into the four genera Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus, which fall into distinct groups on the phylogenetic tree. (5, 11, 26) . The taxonomy of swine coronaviruses is shown in Table 1 . ", "PEDV is easily inactivated by heating to 71\u00b0C for 10 min. At lower temperatures, pH is a factor in PEDV inactivation. The resistance of PED virus in different pH values is given in Table 3 . PEDV-inactivating disinfectants are oxidising agents, bleach, 2% phenolic compounds, 2% sodium hydroxide, formaldehyde and glutaraldehyde, 4% sodium carbonate, ionic and nonionic detergents, iodophors in 1% phosphoric acid, and lipid solvents such as chloroform (15, 24) . " ] },{ "paper_id": "545cc28cf80d7f18232d1eafdcd3a7e9680a4b9f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "RNA interference (RNAi) is a short, double-strand RNA induced-process that can target the mRNA of a specific sequence for degradation [9, 10] . Post-transcriptional gene silencing can be mediated by endogenous microRNAs (miRNAs), exogenous small interfering RNAs (siRNAs), and short hairpin RNAs (shRNAs). RNAi technology is recognized as a promising, novel nucleic acid-based tool for use against various diseases, including cancer, infectious diseases and genetic disorders. RNAi reagents have also been reported to potently and specifically inhibit the replication of different viruses, including HIV, HBV [11] , HSV [12] , SAR-CoV [13] , influenza virus [14, 15] , coxsackievirus [16] and others. Thus, the development of RNAis as possible antiviral agents for hantavirus infection is of considerable interest [17] .", "At the experimental point of 5 dpi, the brains, lungs and kidneys were harvested, weighed and homogenized into a ~10% (weight/volume) suspension in test medium. The homogenates were frozen and thawed twice and centrifuged at 3000 rounds per minute for 10 min. The virus titers were determined as described above.", "Oligos Sequences", "All of the data were analyzed with SPSS 17.0 software. The data are expressed as the mean\u00b1SD for all experiments. Oneway ANOVAs were used to assess the significance of the differences between the means. P values below 0.05 were considered statistically significant." ] },{ "paper_id": "54e77bff1912076bccf12a6b099e48a59f634d5f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "54e82ae1126dc9eed820d7a255cb4edca68a9f82", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Characterisation of the monoclonal antibody was conducted by indirect immunofluorescence assay (IFA). For IFA, Vero cells inoculated with PEDV, ST cells inoculated with transmissible gastroenteritis virus (TGEV) or porcine respiratory coronavirus (PRCV), and MA-104 cells inoculated with porcine rotavirus were grown in cell culture chamber slides. The slides fixed with cold acetone were incubated with the PEDV mAbs at 37\u00b0C for 45 minutes. After washing, the slides were reacted with goat antimouse IgG conjugated with FITC at 37\u00b0C for 45 minutes and examined under a fluorescence microscope.", "The sensitivity of ICA was evaluated by comparing the detection limit using real-time RT-PCR as previously described with some modifications. 13 Briefly, real-time RT-PCR was carried out in a total volume of 20 \u00b5l containing viral RNA, PEDV forward (5'-CGC AAAG ACTG AACC CACTAATTT-3') and reverse (5'-TTG CCTC TGTT GTTA CTTGGAGAT-3') primers, probe (6-carboxyfluorescein", "Piglets inoculated with the PEDV strain experienced moderate to severe diarrhoea starting on 1 dpi. Most infected piglets showing clinical signs died between 2 and 9 dpi except for one piglet, which recovered from clinical signs at 9 dpi and survived during the experimental challenge (Table 4 ). In a comparison of the diagnosis methods, examination with the ICA kit using swab samples showed consistent results with real-time RT-PCR in identifying PEDV." ] },{ "paper_id": "550738a7abf0b8378627958a3a5c429f36586d69", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Such issues are not limited to infectious diseases. For example, while it has long been known that human exposure to unsafe levels of methylmercury is predominantly through dietary consumption of contaminated fish and shellfish, recent technological advances in high-resolution mass spectroscopy now provide a means to \"fingerprint\" the contributing mercury and determine its source [26] . For example, many locations are impacted by both point-source releases as well as nearly ubiquitous atmospheric fallout of mercury. This new fingerprinting capability has extended the capacity to determine which mercury sources contribute to fish, wildlife, and human exposures, thereby informing environmental decision makers of the most effective means to reduce such exposures.", "The US surveillance program for HPAI in wild birds is also seen as a model of One Health collaboration through its communication and outreach efforts to stakeholders and the public. The Interagency Steering Committee and its member agencies have produced numerous fact sheets, frequently asked questions, webinars, presentations, and web pages to keep scientists, policy makers, industry, and the public up-to-date on the global status of avian influenza and the US HPAI surveillance program, on how producers can minimize the risk of transmission to poultry, and on how hunters and poultry workers can minimize the risk of acquiring diseases from handling birds.", "As a demonstration of an interconnected system, bats contribute up to 50 billion USD annually to the United States of America (US) agricultural economy through their part in insect control [4] . However, the emergence of white-nose syndrome has resulted in the death of over 6 million bats in North America resulting in a marked decrease in insect control [3] . Additionally, while bats are critical components of world ecosystems, they are also potential reservoirs of zoonotic viruses, including rabies, Marburg virus, and Nipah virus [27] . In today's age of dynamic changes in the emergence of infectious diseases associated with increasing interactions among humans, domestic animals, and wildlife, the need to consider these interactions fully becomes crucial for effective management that balances the needs of humans, animals, and the environment." ] },{ "paper_id": "551d200fafe21b575108018aeb0f39b995c99dce", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "55eb127fae1e7e297c11baca53a758cac2a77329", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The human colon cell line Caco-2 was purchased from the Type Culture Collection of the Chinese Academy of Sciences, Shanghai, China. Cells were placed into 75 cm 2 tissue culture flasks and grown at 37\u2103 under a humidified 5% CO 2 atmosphere in DMEM medium with high glucose, 10% FBS, 100 units/mL penicillin and 100 units/mL streptomycin.", "The", "In vitro anticancer efficiency study" ] },{ "paper_id": "55f664e8e3b18388964ec14c61a7b655b786ef31", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This research was submitted to our university institutional review board and was approved. The IRBNet ID is 1083099-2.", "As pediatricians, we follow the guidelines published by the American Academy of Pediatrics. The 2014 guidelines dealing with evaluation and management of viral bronchiolitis promote supportive care, and note that routine radiographic or laboratory studies are not necessary. 3 While these guidelines are paramount to treating viral illness, it is imperative that the physician recognizes at what point further investigation is warranted. Missing a secondary pneumonia could result in delay in antibiotic treatment, transfer to the pediatric intensive care unit (PICU), or intubation.", "Susan Flesher https://orcid.org/0000-0002-3208-7097" ] },{ "paper_id": "562e3acb22b8ed4cf3edec403ade2e3e425af531", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Three of the 12 HBV-and HLA-related SNPs (Fig. 2B , dotted lines; rs9276370, rs3128917, and rs9380343) also showed significant differences between LWK in Africa and GIH in South Asia ( Table 2 ; P < 0.001). In contrast, we found the allele frequency of NPC-related SNPs (18) (19) (20) to be relatively stable among different populations (Fig. 2C ).", "Among two HBV-and immune-related SNPs in the CFB and CD40 regions (14, 15) and three hepatitis C virus-related SNPs in the IFNL4 regions, (16) (17) (18) allele type differences can be found between Africa and Europe or between Africa and South Asia ( Fig. 2A ). All these immune-related SNP genotypes differed significantly between Esan in Nigeria and Toscani in Italy and between Luhya in Webuye, Kenya (LWK) and Gujarati in India (GIH) ( Table 1 ; P < 0.001).", "Based on a literature review, 12 HBV-and HLArelated SNPs, (7) (8) (9) (10) (11) (12) (13) five hepatitis-and immune-related SNPs in complement factor B (CFB), clusters of differentiation molecule 40 (CD40), and interferon lambda 4 (IFNL4) loci (14) (15) (16) (17) (18) , and five nasopharyngeal carcinoma (NPC)-related SNPs in HLA regions (19) (20) (21) were selected for this analysis (Tables 1 and 2 ). These SNP data from around the world were downloaded from the phase 3 data of 1,000 genomes (http://www. 1000genomes.org/). (22) The subjects participating in the 1,000 genome project were older than 18 years and had three out of four grandparents who identified themselves as members of the group. The location of the 26 populations evaluated in the 1,000 genomes are shown by abbreviation on a global HBsAg prevalence map reported by Hou et al. (2) (Fig. 1) . The allele frequencies of different geographic groups in viral hepatitis-related SNPs and NPC-related SNPs are illustrated in Fig. 2 . The SNP genotype differences between groups are listed in Tables 1 and 2 . We used interactive chi-square tests to calculate the difference in genotypes between groups (http://quantpsy.org)." ] },{ "paper_id": "5644db6f53b8425eedbdb33ae2c8924e02cdf447", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5650690daf962117b9831c42178ffd6a6a969300", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00515-12/-/DCSupplemental. Figure S1 , TIF file, 0.1 MB. Figure S2 , TIF file, 0.2 MB. " ] },{ "paper_id": "5667ab8a8565a702defd98b5736e32a3bb9c5ad4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "567a4ae944e5286ed25f8ab20dc098ed570b74d8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5699971f98dab3c45f237878901e4c8b247bc234", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Methods. This was a retrospective study at a tertiary care adult and pediatric teaching hospital. Study patients met a priori criteria for definite or possible nosocomial respiratory viral infection.", "This was a retrospective, Institutional Review Board-approved study of patients who developed laboratory-confirmed respiratory viral infections and whose symptoms began during hospitalization at Rhode Island Hospital and Hasbro Children's Hospital (HCH) between April 1, 2015 and April 1, 2016. Rhode Island Hospital is licensed for 719 beds, 87 of which are licensed for HCH. The two hospitals are located in adjoining buildings on the same campus as part of the Lifespan Hospital System." ] },{ "paper_id": "56ac158658a5eb9ee2efbc07d6ec1474417fe8ba", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Patients and samples A prospective study was performed of 28 children, aged from 5 months to 14 years (12 males and 16 females), hospitalised for PPE between April 4, 2007 and March 30, 2009 in the paediatric intensive care unit of Hospices Civils de Lyon (Lyon, France). This study was approved by all participating institutional review boards (CE 06-139) and signed informed consent was obtained from all parents. 28 nasopharyngeal aspirates were obtained using disposable mucus extractors within 48 h of admission. 25 pleural effusion samples were collected at the time of chest drain insertion. The samples were kept frozen at -70uC until further study.", "Taken together, these results suggest that TTMV-LY isolates can invade the alveolar cells, where they replicate and induce innate immune imbalance in the respiratory tract. Further studies aimed at understanding the physiopathological implications of TTMV as an aetiological agent in respiratory diseases are necessary, as required for every newly discovered pathogen. These investigations would allow to us learn about the presumed need to enlarge the range of researched pathogens to the anelloviruses in the case of PPE, in order to improve the efficiency of diagnosis and treatment of this pathology.", "This study reports the description of replicative TTMV-LY isolated from parapneumonic effusions of children hospitalised with PPE, suggesting a potential role of the virus in the pathogenesis of pneumonia.", "A pathogen discovery protocol based on random RT-PCR was performed on the five negative pleural effusion samples, and several short sequences related to TTMV were obtained for three of them. The characterisation of TTMV required the amplification and sequencing of the full-length virus genome." ] },{ "paper_id": "56f69c9790f32dd7649fa2e14be26ae099321ee6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "570064e6a308ec28efcc76ef74ba3f0e6ea5e5a5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The author(s) received no financial support for the research, authorship, and/or publication of this article. ", "In silico screening of DPP-4 inhibitors Virtual screening has been seamlessly integrated into drug discovery and development 75 and its success significantly relies on compound library, 76 especially the structural diversity of compound library. 77 For instance, microalgal metabolites were screened for DDP-4 inhibitors. 78 Compared with the synthesized chemicals, natural compound libraries generally consist of more structurally diverse compounds than their synthetic counterparts, 79 providing a better screening resource. As such, numerous studies have adopted various natural compound libraries to find novel DDP-4 inhibitors as listed in Table 2 .", "Traditional Chinese Medicine Database (TCM Database@Taiwan) Chen 80 Naturally Occurring Plant-based Anti-cancer Compound-Activity-Target database (NPACT)", "Previous sections have described the biological functions, assay methods, and known natural DPP-4 inhibitors, which are purported to treat DM. However, DPP-4 inhibition can possibly cause unexpected sequela owing to its entanglement with immune response and endothelial functions. In fact, the roles of DPP-4 in tumorigenesis and progression, respectively, have been reviewed recently. 144, 145 In lung cancer and 153 In conclusion, DPP-4 inhibitors can be used to treat DM, whereas their complications with other immune disease or cancer should be seriously considered." ] },{ "paper_id": "571e8706c0aff7482c60e60cad9d1334c917df12", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "idly than do boas, which may survive for months or years after symptom onset if provided with supportive care. Although there is evidence that IBD is transmissible, the precise mode of transmission is unknown (3) . Conclusive identification of an etiologic agent or agents has the potential to enable IBD treatments, vaccines, diagnostics, and prevention policies.", "In addition to being worthy of study in their own right, animal viruses are of great relevance to human health. The simple reason for this is that humans are animals, and many viruses that infect other animals also infect humans. Some of the most medically important human viral pathogens originated from animals or have animal reservoirs, including influenza viruses, HIV-1 and -2, severe acute respiratory syndrome (SARS) coronavirus, henipaviruses, West Nile virus, rabies virus, hantaviruses, filoviruses, and arenaviruses. Furthermore, animal viruses and their hosts often provide excellent models for the study of pathogenic mechanisms, immune response to infection, host-pathogen interactions, treatments, and vaccines." ] },{ "paper_id": "5738e88fe3a742f9f6f69919bd4e6b094d52eded", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The outbreak of the SARS (severe acute respiratory syndrome) epidemic in 2003 exposed serious deficiencies in Taiwan's health care and medical education systems. 1 The Department of Health (DOH), Executive Yuan therefore focused effort on implementation of the \"Project of Reforming Taiwan's Medical Care and Public", "Senior professors and trained lectures also hosted CbD meetings five times each", "Rarely (1) Occasionally (2) Often (3) Frequently (4) Always (5) -outpatient department (OPD) teaching training 6. Articles should list each author's contribution individually at the end; this section may also include contributors who do not qualify as authors. 7 . Any checklist and flow diagram for the appropriate reporting sttement, e.g. STROBE (see below). 8 . Any article that contains personal medical information about an identifiable living individual requires the patient's explicit consent before we can publish it." ] },{ "paper_id": "5777ec2785cb535789796e239cc3627e92e24b83", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "using single stranded G template from E. coli JM103 and screening plaques by differential hybridization. The following oligonucleotides were used for mutation of El (with mutated nucleotides underlined) :", "The Journal of Cell Biology, Volume 115, 1991", "NIZZ : 5'-AAAGAGTATATCTTATTTATAACTG-3' ; T133 : 5'-GTTGTTCTTAATTATAAATACTTCAG-3' ; QI37 : 5'-CATAATACTTATATATGGCTATGC-3' ; mlins : 5'-ACTGCATTCTTGATAATATTGTTCTTAACC-3 ; and LQ30 : 5'-CTGCATTCTTGCAGTTCTTAACCA 3 ." ] },{ "paper_id": "57a30fc4f036048830b77fa87c64358c48c946d6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A chest radiograph showed multi-node and patchy consolidation in the lower and middle lobe of both lungs on 4 February (Figure 1 (a)), with rapid progression of groundglass opacities and consolidation in both lungs on 6 February ( Figure 1(b) ).", "The authors declare that there is no conflict of interest. " ] },{ "paper_id": "57b32baae9c8cfd1be336a341fe0df2a55ad57bb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistics. The Student's t test was used for a comparison of the means between sample groups. Error bars represent one SD.", "Antibodies. The following monoclonal antibodies were used for flow cytometry: PE-conjugated anti-TCR \u2424 (clone H57-597), hamster anti-IgG (clone Ha4/8), rat anti-IgG (clone R35-95), anti-CD3 (clone 17A2), anti-V \u2424 8.1,8.2 (clone MR5-2), and anti-V \u2423 2 (clone B20.1); FITC-conjugated anti-CD44 (clone IM7), anti-IgG (clone R35-95), anti-CD3 (clone 500-A2), anti-CD4 (clone GK1.5), anti-CD8 (clone 53-6.7), anti-TCR \u2424 (clone H57.597), and anti-CD45RB (clone 16A); biotin-conjugated anti-TCR \u2424 (clone H57.597), anti-CD49d (clone R1-2), anti-IgG (clone R35-95), anti-V \u2424 8 (clone MR 5-2), anti-CD45R (clone RA3-6B2), anti-CD8 (clone 53-6.7), anti-V \u2423 2 (clone B20.1), anti-CD4 (clone RM 4-5), anti-CD45RB (clone 16A), and anti-CD62L (clone MEL-14); and purified anti-CD16/CD32 (Fc \u2425 III/II receptor, clone 2.4 G2). All monoclonal antibodies were purchased from BD PharMingen except anti-CD3, which was purchased from Caltag. Biotin-conjugated primary monoclonal antibodies were detected by streptavidin-conjugated Tricolor from Caltag.", "Splenocytes were purified over a lympholyte M gradient (Cedarlane) and RBCs were lysed before staining. LNs (cervical, inguinal, brachial, and axillary) were teased with tweezers and filtered through wire mesh (Small Parts) to create a single-cell suspension. In some experiments, cervical and inguinal LNs were harvested separately." ] },{ "paper_id": "57b3f365b56a5db10967e1e3f16ade5a85eb296d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All data were entered into a standardised, secure REDCap (Research Electronic Data Capture, Vanderbilt University, Nashville, Tennessee, USA) database. 13 We performed data quality checks on a minimum of 10% of the charts and verified data from all case report forms after entry.", "Nasal and throat swabs were collected and combined in transport medium (M4RT, Remel, USA), aliquoted into MagMAX Lysis/Binding Solution Concentrate (Life Technologies, USA), snap-frozen and then stored at \u221280\u00b0C. Aliquots were shipped on dry ice to Nashville, Tennessee, USA, and were tested by RT-PCR for 11 viruses: RSV; human rhinovirus (HRV); human metapneumovirus (HMPV); influenza (influenza) A, B and C; parainfluenza virus (PIV) 1, 2 and 3; adenovirus (AdV) and Middle East respiratory syndrome coronavirus (MERS-CoV). [14] [15] [16] Blood was placed directly onto filter paper and air dried for \u226530 min before storage at room temperature and kept dry through shipment to ZRT Laboratory (Beaverton, Oregon, USA) for 25(OH)D (vitamin D) level measurement (techniques published previously). 17 statistical analysis Descriptive statistics were presented as frequency (percentage) or median and IQR where appropriate.", "Written informed consent was obtained from parents or guardians.", "Here, \u03c0 is the proportion of the Amman population that is eligible to be sampled, which accounts for the market share m and the sampling intensity (5 days out of 7):" ] },{ "paper_id": "57b88add1645a89614742dc32b0e11922c5f37d2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Immunohistochemistry was performed using formalin-fixed, paraffin-embedded tissues. Four \u03bcm-thick sections were cut and dewaxed in xylene, rinsed in graded ethanol, and rehydrated in distilled water. After antigen retrieval with sodium citrate buffer (10 mM sodium citrate, pH 6.0), endogenous peroxidase activity was blocked with 3% H 2 O 2 . Then the sections were added with the appropriate antibody at appropriate dilution, then DAB staining solution was added. The sections were counter-stained with hematoxylin, dehydrated, and sealed. For immunofluorescence, antigen was retrieved with EDTA buffer (1 mM Tris/EDTA, pH 9.0) and endogenous fluorescence was eliminated with AutoFluo Quencher (Servicebio, Cat# G1221). The details of the antibodies used for immunofluorescence and immunohistochemistry are given in Table S6 . Staining for each marker was scored using Image-pro plus (v.6.0). Integrated optical density (IOD) to area ratio was calculated for each marker to assess the staining intensity.", "ARTICLE HISTORY" ] },{ "paper_id": "57d3826bb67ec3a479bc58f5e9210de44845b802", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Gammacoronavirus, and its genome encodes four structure proteins, spike glycoprotein (S), and membrane, envelope and nucleocapsid (N) proteins [2, 11] . New variant IBV strains in chickens continually emerge worldwide owing to the high mutation rate of its genome [4] . Various vaccines have been developed but the disease still occurs, because different serotypes of the virus do not cross-protect and vaccine failures are often associated with the emergence of antigenic variants that differ from the vaccine viruses [9, 14] .", "All the tracheas from the slaughterhouses and from LC flocks were free of obviously gross lesions. Sixty-six flocks were sampled in the study period. Twenty tracheal samples per flock were taken for a total of 1,320 tracheal samples. The lower prevalence in LC flocks might be due to sampling differences, because 20 tracheas were sampled from each broiler flock but only one trachea was sampled from each LC flock.", "The samples that were IBV positive with the N-specific primer were subjected to RT-PCR and sequencing using the S-specific primer, oligo5/rC3-r for genotyping [17] . The sequences of these primers are as follows: oligo5: 5\u2032-AAACT GAACA AAAGA CAGAC TTAG-3\u2032 (20251-20274, H120 numbering, GenBank accession number: FJ888351) and rC3-r: 5\u2032-(A/G) CAAT GTGTA ACAAA (T/C) ACT-3\u2032 (20655-20637). The same RT-PCR procedure was performed, except the annealing temperature for this primer set was 52\u00b0C. For LC field cases, one trachea from each flock was subjected to RT-PCR using the same method described for broilers. The prevalence differences among different seasons or chicken types were analyzed using chi-square tests or Fisher's exact tests when any cell having expected value less than 5 [12] . The level of a significant difference was set at \u03b1 0.05.", "Eight tracheal samples positive for the IBV gene were selected for virus isolation, including S14, S41, S78, TC3, TC4, TC5, TC17 and TC38, using specific-pathogen-free (SPF) chicken embryos (Animal Health Research Institute, Chiding, Taiwan). Tracheal samples were frozen at \u221220\u00b0C. After thawing, the organs were homogenized in sterile TPB in a 1:10 ratio. The homogenate was then centrifuged at 1,500 rpm for 5 min. The supernatant was treated with a 1% mixture of ampicillin, streptomycin and amphotericin (Biological Industries, Kibbutz Beit-Haemek, Israel) for 1 hr at room temperature and then inoculated into the allantoic cavity of five 9-to-11-day-old SPF embryonated eggs. The eggs were incubated for 5 days and candled each day. After 5 days of incubation, the eggs were chilled at 4\u00b0C, and the allantoic fluid was collected. Each sample was given two blind passages before being considered negative. The presence of IBV in the allantoic fluid was detected using RT-PCR with NP1/NP2 primers [8] . Only two IBVs, S78 and TC3, were isolated. The IBVs were confirmed as IBV using sequencing. The IBV isolates were then used for one-direction neutralization tests with reference anti-IBV antisera." ] },{ "paper_id": "57f7bd687c1b968f782d3a1aa7f7fd051acdcaee", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We have created a library of flavonoids to systematically investigate SARS-CoV 3CLpro inhibitory compound by a FRET method.", "ARTICLE HISTORY" ] },{ "paper_id": "582505fda401e9da61e9632a110b2e57806d2e61", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Methods. Setting and participants. Four tertiary hospitals in Riyadh, Kingdom of Saudi Arabia (KSA) were included in this study: King Khalid University Hospital, King Fahad Medical City Hospital, King Abdulaziz Medical City Hospital, and King Faisal Specialist Hospital. We included all Saudi Board Internal Medicine residents who rotated into these hospitals between November 2015 and January 2016. Data were collected using self-administered questionnaires, which were distributed and collected before resident education activities. The questionnaire contained a short description of the study aim and objectives. The study was conducted after obtaining ethical approval from the King Saud University Research Center (Research Project Number E-16-1873).", "Statistical analysis. All data were summarized as frequencies (percentages) or medians (interquartile ranges [IQRs]). We examined the relationships between age and the main variables (emotions, attitudes, and knowledge) using Spearman's rank correlations. Spearman's correlations were also used to determine the relationships between work-related concerns and knowledge of an MERS outbreak. All statistical analyses were performed using the Statistical Package for the Social Sciences (IBM Corp., Armonk, NY) version 21.", "\u202b\u0631\u0627\u062a\u0647\u0645\u202c \u0651 \u064f \u202b\u0648\u202c \u202b\u0635\u064e\u202c \u064e \u202b\u0648\u062a\u202c \u202b\u0631\u0647\u0645\u202c \u202b\u0634\u0627\u0639\u0650\u202c \u064e \u202b\u0648\u0645\u202c \u202b\u0627\u0645\u0644\u0642\u064a\u0645\u0646\u064a\u202c \u202b\u0627\u0621\u202c \u0651 \u064e \u202b\u0627\u0623\u0644\u0637\u0628\u202c \u202b\u0645\u0648\u0642\u0641\u202c \u202b\u062d\u062a\u062f\u064a\u062f\u202c \u202b\u0627\u0623\u0644\u0647\u062f\u0641:\u202c \u202b\u0641\u064a\u0631\u0648\u0633\u202c \u202b\u0639\u0646\u202c \u202b\u0651\u0627\u062c\u0645\u0629\u202c \u064e \u202b\u0627\u0644\u0646\u202c \u202b\u0651\u0633\u064a\u0629\u202c \u064f \u202b\u0627\u0644\u062a\u0646\u0641\u202c \u202b\u0627\u0623\u0644\u0648\u0633\u0637\u202c \u202b\u0627\u0644\u0634\u0631\u0642\u202c \u202b\u0645\u062a\u0627\u0644\u0632\u0645\u0629\u202c \u202b\u064a\u202c \u0651 \u202b\u062a\u0641\u0634\u0650\u202c \u202b\u062c\u062a\u0627\u0647\u202c \u202b\u0643\u0648\u0631\u0648\u0646\u0627.\u202c \u202b\u062c\u0631\u0649\u202c \u202b\u0629\u060c\u202c \u0651 \u064e \u202b\u0630\u0627\u062a\u064a\u202c \u064d \u202b\u0627\u0633\u062a\u0628\u064a\u0627\u0646\u0627\u062a\u202c \u202b\u0634\u0643\u0644\u202c \u202b\u0639\u0644\u0649\u202c \u202b\u0629\u060c\u202c \u0651 \u064e \u202b\u0645\u0642\u0637\u0639\u064a\u202c \u064c \u202b\u062f\u0631\u0627\u0633\u0629\u202c \u202b\u0647\u0630\u0647\u202c \u202b\u0627\u0644\u0637\u0631\u064a\u0642\u0629:\u202c \u202b\u0627\u0645\u0644\u0642\u064a\u0645\u0646\u064a\u202c \u202b\u0627\u0621\u202c \u0651 \u064e \u202b\u0644\u0623\u0644\u0637\u0628\u202c \u202b\u0629\u202c \u0651 \u064e \u202b\u0627\u0644\u062a\u0639\u0644\u064a\u0645\u064a\u202c \u202b\u0627\u0623\u0644\u0646\u0634\u0637\u0629\u202c \u202b\u0621\u202c \u202b\u064e\u062f\u0652\u202c \u202b\u0628\u202c \u064e \u202b\u0642\u0628\u0644\u202c \u202b\u0647\u0627\u202c \u064f \u202b\u0648\u062c\u062a\u0645\u064a\u0639\u202c \u202b\u0647\u0627\u202c \u064f \u202b\u064e\u0648\u0632\u064a\u0639\u202c \u202b\u062a\u202c \u202b\u0627\u0644\u0633\u0639\u0648\u062f\u064a\u0629.\u202c \u202b\u0627\u0644\u0639\u0631\u0628\u064a\u0629\u202c \u202b\u0628\u0627\u0645\u0644\u0645\u0644\u0643\u0629\u202c \u202b\u0627\u0644\u0631\u064a\u0627\u0636\u060c\u202c \u202b\u0641\u064a\u202c \u202b\u0645\u0633\u062a\u0634\u0641\u064a\u0627\u062a\u202c \u202b\u0623\u0631\u0628\u0639\u0629\u202c \u202b\u0641\u064a\u202c 2015 \u202b\u0646\u0648\u0641\u0645\u0628\u0631\u202c \u202b\u0634\u0647\u0631\u064a\u202c \u202b\u0628\u0646\u064a\u202c \u202b\u0627\u0627\u0644\u0633\u062a\u0628\u064a\u0627\u0646\u202c \u202b\u0628\u064a\u0627\u0646\u0627\u062a\u202c \u202b\u0639\u0644\u0649\u202c \u064f \u202b\u0627\u062d\u0644\u0635\u0648\u0644\u202c \u202b\u0648\u062c\u0631\u0649\u202c \u202b\u0628\u0627\u0644\u0628\u064a\u0627\u0646\u0627\u062a\u202c \u202b\u0642\u0629\u202c \u0651 \u0650 \u202b\u0645\u062a\u0639\u0644\u202c \u202b\u0623\u0633\u0626\u0644\u0629\u064d\u202c \u202b\u0639\u0644\u0649\u202c \u202b\u0627\u0627\u0644\u0633\u062a\u0628\u064a\u0627\u0646\u064f\u202c \u202b\u0627\u0634\u062a\u0645\u0644\u202c .2016 \u202b\u064a\u0646\u0627\u064a\u0631\u202c \u202b\u0648\u202c \u202b\u0648\u0645\u0648\u0642\u0641\u0647\u0645\u202c \u202b\u0648\u0645\u0634\u0627\u0639\u0631\u0647\u0645\u202c \u202b\u0642\u064a\u0645\u0646\u064a\u060c\u202c \u064f \u202b\u0644\u0644\u0645\u202c \u202b\u0645\u064a\u0648\u063a\u0631\u0627\u0641\u064a\u0629)\u202c \u0651 \u202b(\u0627\u0644\u062f\u0650\u202c \u202b\u0627\u0646\u064a\u0629\u202c \u0651 \u064e \u202b\u0627\u0644\u0633\u0643\u202c \u202b\u0645\u0644\u062a\u0627\u0644\u0632\u0645\u0629\u202c \u202b\u0628\u202c \u0651 \u0650 \u202b\u0627\u0645\u0644\u0633\u0628\u202c \u202b\u0643\u0648\u0631\u0648\u0646\u0627\u202c \u202b\u0641\u064a\u0631\u0648\u0633\u202c \u202b\u064a\u202c \u0651 \u202b\u062a\u0641\u0634\u0650\u202c \u202b\u0625\u0644\u0649\u202c \u202b\u0628\u0627\u0644\u0646\u0633\u0628\u0629\u202c \u202b\u0631\u0627\u062a\u0647\u0645\u202c \u0651 \u064f \u202b\u0648\u062a\u0635\u0648\u202c \u202b\u0651\u0633\u064a\u0629.\u202c \u064f \u202b\u0627\u0644\u062a\u0646\u0641\u202c \u202b\u0627\u0623\u0644\u0648\u0633\u0637\u202c \u202b\u0627\u0644\u0634\u0631\u0642\u202c" ] },{ "paper_id": "584690fd413d25e55ee5599071bd23b1be00add0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Multivariate analyses in a forward stepwise manner were performed with P = 0.050 as the threshold for entering and removing variables. For all analyses, a 2-tailed P value of 0.05 was considered significant. Statistical analyses were performed with PASW for Windows (version 18 software package; SPSS, Inc., Chicago, IL, USA).", "The Institutional Review Board at the Seoul National University Hospital approved the study. The board waived the requirement for written consent (IRB registration number 1607-062-775)." ] },{ "paper_id": "5856a3f4b9fc9b0947bf045feb20d32d581221dc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "58a0c3ad6fd3ce5eae8b1199bd8e04ad8dadac81", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Among HSCT recipients, hMPV was associated with 19% mortality.", "Screening of all positive laboratory results for hMPV by both direct fluorescent antibody (DFA) and real-time reverse-transcriptase polymerase chain reaction (RT-qPCR) was performed to identify patients between the ages of newborn to 19 years who were diagnosed at Seattle Children's Hospital in Seattle, WA during the years 2006-2010. Of 368 total patients with positive hMPV laboratory results, we performed retrospective chart review to identify a subset of 55 patients with immunocompromised conditions. We defined an immunocompromised condition as presence of hematologic malignancy, solid tumor, rheumatologic disease receiving immunosuppressive therapy, solid organ transplant, primary immunodeficiency, receipt of chronic immunosuppressive therapy, or receipt of a hematopoietic stem cell transplant (HSCT). Using electronic chart review, we abstracted sociodemographic variables, symptoms, laboratory and radiologic values, clinical course, and treatment outcomes for these patients.", "Human metapneumovirus infections in our immunocompromised patient population was associated with high rates of LRTI at presentation, and an attributable mortality of 5%, rates substantially higher than that in the general population where hMPV is most commonly a self-limited URTI. In our study, 12 (23%) of immunocompromised children with hMPV were classified as having severe disease, and neutropenia was identified as a significant risk factor for disease severity. This rate is comparable or even higher than previous rates reported in seriously immunocompromised adult patients [13] .", "A prospective randomized study of ribavirin and IVIG administration, or of newer therapeutic agents under development for treatment of paramyxovirus infections [24, 25] , would be helpful given the high morbidity associated with hMPV in the immunocompromised population. In particular, a study of the use of novel agents, including fusion inhibitors [26] , could be studied in this population given their potential to serve as postexposure prophylaxis in high-risk individuals. The documentation of severe hMPV disease in immunocompromised children supports previous data documenting severe and fatal hMPV disease reported in adult HSCT recipients [9, 13] and highlights the need for treatment options in this population." ] },{ "paper_id": "58b5c77c9fb3f68a3ad84a3f15275dc0e4554192", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "58b95b98f9016190301e31fa9809932a4d8169c2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Codetection was defined as a positive detection of >1 microbe from the sample, and it was used instead of coinfection since coinfection means all the detected microbes must contribute to the pathogenic effect, whereas codetection may not indicate the necessary causative role." ] },{ "paper_id": "58be092086c74c58e9067121a6ba4836468e7ec3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "58c87ea90b23dc0d106427b76bb5525b6aa01b77", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In six of the nine cases reported, the patients were Japanese. This may be due to racial differences in the risk of drug-induced lung injury and better recognition of the complication by clinicians in Japan because of better awareness. An additional contributory factor may be the difficulty in excluding viral syndrome with high accuracy by performing a viral panel test, because the test is not approved by the Ministry of Health, Labour and Welfare and is not commercially available in Japan. However, the involvement of these factors is purely theoretical, and the real reason is currently unclear.", "Our findings suggest that clinicians should be aware of the possibility of interstitial pneumonia as a complication of the influenza vaccine, ask closed questions about vaccination in medical interviews, and educate patients about this complication, as these will facilitate early detection and treatment. Although the safety of this vaccine has been confirmed, relatively newer drugs warrant further investigation to confirm their association with interstitial pneumonia.", "The authors state that they have no Conflict of Interest (COI)." ] },{ "paper_id": "58ef15f083c00ee3ae8e604a9c6e258576b7c7af", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Infectious diseases are a major health concern worldwide, causing millions of illnesses and deaths each year. Newly emerging viral diseases, such as swine H1N1 influenza, severe acute respiratory syndrome (SARS) and bacterial infections, such as the recurrent Salmonella and Escherichia coli outbreaks not only lead to wide-spread loss of life and health, but also result in heavy economic losses. To better navigate this landscape of infectious diseases, it is important to not only understand the mechanisms of individual diseases, but also the commonalities between them. Combining knowledge from related diseases will give us deeper insights into infection and host immune response, will enhance our ability to comprehend new diseases and lead to efficient development of therapeutics.", "we present a novel way of combining experimental PPI data coming from several organisms we incorporate domain knowledge in designing a prior that causes the learned models to exhibit the requisite common structure across the tasks to optimize the resulting non-convex objective function, we implement a concave convex procedure (CCCP)-based method", "Algorithm 1 CCCP procedure 1: Initialize w \u00bc w 0 2: repeat 3: Compute rG using w k 4: Compute current value L approx 5: Solve w k\u00fe1 \u00bc argmin w \u00bdF\u00f0w\u00de \u00fe w T rG 6: Set k \u00bc k \u00fe 1 7: Compute new value L 0 approx 8: \u00bc L approx \u00c0 L 0 approx 9: until 5" ] },{ "paper_id": "58f660cec9eb4423fc12e1b14bc70a951a5edad0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Sample handling and preparation for mass spectrometric analyses was performed according to Wulfmeyer et al. (54) . Peptide mass fingerprinting was performed by trypsin digestion of proteins 'in-gel'. Obtained peptides were analyzed with matrix-assisted laser desorption/ionization--time of flight on an Axima Performance mass spectrometer (Shimadzu). Identity of selected peptides was confirmed by sequencing with high energy collision induced dissociation. Mascot MS/MS search software (Matrix Science) was used to identify the proteins.", "Secondary structure of DDX1 protein constructs was predicted with psipred (55) and analyzed by recording circular dichroism (CD) spectra from 200 to 260 nm using a Jasco J-810 CD spectropolarimeter (Jasco Corp.). A typical measurement was performed with 5 M ( = 0.42 mg/ml) protein in 200 l total volume of storage buffer and the cuvette was thermostated to 298 K. Melting curves were recorded at 222 nm by heating the sample cuvette from 293 K to 368 K at a rate of 1 K per min and potential refolding was monitored by returning to the start temperature. Melting curves were fitted to a two-state-unfolding equation (56) .", "Binding affinities for nucleotides were determined by fluorescence equilibrium titration, using N'-methylanthraniloyl (mant)-labeled nucleotide analogs. Fluorophores were excited at 356 nm, emission spectra were recorded from 370 to 520 nm and the fluorescence sig-nal at 448 nm was used to plot binding curves. Titration data of protein binding to mantADP/mantdADP were fitted to a quadratic binding equation (57):" ] },{ "paper_id": "591779cb69e83083aa7b2d9b031983c802ba2405", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Diameters of coronary arteries were converted to Z scores by using previously published regression equations 9) . All statistical analyses were performed using SAS ver. 9.1 (SAS Institute Inc., Cary, NC, USA), and P values of <0.05 were considered statistically significant. The median value with interquartile range was used to summarize data. Numerical variables were compared using the Wilcoxon rank sum test, and Fisher's exact test was used to compare categorical variables.", "We obtained informed consent from the parents of all 133 subjects, and the Institutional Review Board of the Asan Medical Center, Seoul, Korea, approved this study (2010-0467).", "Nasopharyngeal swabs were taken by flocked swab and were submitted in Universal Transport Medium (COPAN, Brescia, Italy). Viral RNA was extracted from the swabs with NucliSENS easyMAG (Biomerieux, Marcy l'Etoile, France). cDNA was synthesized using a Revert Aid First Standard cDNA Synthesis kit (Fermentas, York, UK), and each cDNA preparation was subjected to three sets of multiplex PCR with an RV15 ACE Detection kit (Seegene, Seoul, Korea). The RV15 ACE Detection kit targets 15 respiratory viruses, including respiratory syncytial viruses A and B, adenovirus, rhinovirus, parainfluenza viruses 1 to 4, influenza viruses A and B, metapneumovirus, bocavirus, corona viruses OC43/229E and NL63, and enterovirus. This set of 15 respiratory viruses corresponds exactly to the set of viruses causing respiratory infections in Korea that is monitored weekly by the Korea Centers for Disease Control and Prevention 8) ." ] },{ "paper_id": "595ec9383d19b691e17362abb472fa1103074014", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Data are presented as the mean \u00b1 standard error of mean (SEM). Statistical significance was assessed using one-way analysis of variance (ANOVA) and post hoc Tukey's multiple comparisons test.", "To detect S0-specific IgG levels, sera were analyzed by ELISA. 96-well immunoplates (SPL, Korea) were coated with 10 \u03bcg/mL of purified recombinant S0 (100 \u03bcL/well) in carbonate- ", "Porcine epidemic diarrhea (PED) is one of the most catastrophic swine diseases and is characterized by severe diarrhea, vomiting, dehydration and even death [1] . The mortality rate of PED is up to 80-100%, especially in neonatal piglets [2, 3] , resulting in large economic losses for swine farms across the globe, including Europe, Asia and the USA for the past three decades [1, 4, 5] , and making the development of an effective PED vaccine a necessity." ] },{ "paper_id": "59a6b0bbb0666fddb456723c185f04bb97858b08", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "COMMENTARY", "837", "Janko Nikolich-ugich \u017d" ] },{ "paper_id": "59c84e06ac8246b44efc595cafef84b946f24219", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5a0058a8f5c282059a2cc172807b09340161ae77", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5a0937374802cad6f72576fb6c511715aa884b18", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study included a total of 206 patients.", "The results of this study suggest that sex and the presence of an implant significantly affected PC-SPT.", "\u2022 ", "Before SPT was started, patients were grouped on the basis of the periodontal treatments performed. Scaling and root planing (SRP) and flap operation (FO) were defined as periodontitis treatments. Implantation (including bone graft) and mucogingival surgery (e.g., keratinized gingiva widening, root coverage, gingivectomy, and gingivoplasty) were defined as other treatments." ] },{ "paper_id": "5a1a3d864a2110b730b3cbf6b7a1c01a0870be42", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In this analysis, we have rejected those phytochemical ligands that violate Lipinski's rule of five [41] . That is, ligands with MW > 500 g/mol, hydrogen-bond-donating atoms > 5, hydrogen-bond-accepting atoms > 10, or ClogP > 5, even though they may have strong docking energies, were not considered.", "The purpose of this work was to examine whether higher plants may serve as a source of antiviral agents for treatment of dengue fever. A molecular docking approach was used to examine a selection of phytochemicals from our virtual library (2194 different compound structures) with the protein targets of dengue virus.", "In addition to docking energies, it is useful to consider proximity of electrophilic ligands (e.g., epoxides or enones) to nucleophilic residues in the active site. A search of the docked ligands with DENV protease has revealed three sesquiterpenoid -methylene lactones that dock in close proximity to the -OH group of Ser196. Ineupatorolide A, bigelovin, and 2-de-ethoxy-2-methoxyphantomolin (Fig. 2) dock with the methylene carbon within 3.6 \u00c5 of the serine -OH. These ligands can presumably undergo conjugate addition with the -OH group and form a covalent intermediate thereby inhibiting the protease." ] },{ "paper_id": "5a9de698acd2aea68074eb45c0925d4377a41011", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5aaa0dfb49b42f8fab7ce125f89360b828ee9298", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Detection of HBs and HBe Antigens. HBs antigen was quantified by enzyme-linked immunosorbent assay (ELISA) as described previously. 23 HBe antigen was detected by a Chemiluminescent Immuno-Assay (Mitsubishi Chemical Medience).", "Additional experimental procedures are included in the Supporting Information.", "However, CsA did not affect the entry of HCV, in contrast to the inhibition of HCV entry by heparin, bafilomycin A1, or an anti-HCV E2 antibody (Fig. 3B) ." ] },{ "paper_id": "5ab92ddf1bb39b6863b28e2e9946415f7a5adf34", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "V ALID RESPONSES WERE received from 303 hospitals (58.6%)." ] },{ "paper_id": "5af9c3bce43b90c81887d5102c0e5c114d40f5dc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Holmes KV, Dominguez SR. 2013. The new age of virus discovery: genomic analysis of a novel human betacoronavirus isolated from a fatal case of pneumonia. mBio 4(1):e00548-12.", "A new human betacoronavirus in lineage c, tentatively called HCoV-EMC, was isolated from a patient from the Kingdom of Saudi Arabia who died from acute severe pneumonia and renal failure. The viral RNA has been detected in eight additional cases. Sequencing and bioinformatic analysis of the viral genomic RNA showed that it is a novel virus not previously detected in any other species and that its closest relatives are two Asian bat coronaviruses. HCoV-EMC may represent a sporadic spillover to humans from an unknown animal reservoir. In a recent article, van Boheemen et al. demonstrated how state-of-theart sequencing technology and bioinformatic analysis can quickly provide critical insight into the viral genome sequence, phylogeny, replication strategy, and potential drug and vaccine targets and generate tools to evaluate the possible epidemic risk associated with this novel human virus.", "What can analysis of its RNA genome tell us about this new human coronavirus? Analysis of the HCoV-EMC genome was able to distinguish whether HCoV-EMC was a known human coronavirus with mutations that increased its virulence or a product of recombination between two or more known coronavirus species or, like SARS-CoV, a spillover of a zoonotic coronavirus that was transmitted, either directly or indirectly, to humans from an animal reservoir. The genomic analysis showed that HCoV-EMC is a new coronavirus that had never before been detected in any other species." ] },{ "paper_id": "5b0eeabeded14c9e02fc7bcfacb52a8fa0b3ae3c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No potential conflicts of interest were disclosed.", "Pt2L4. Cassava storage roots differentially produce an interesting Pt2L4 protein 238 with low sequence complexity characterized by a reduced amino acid alphabet (just 13 amino acids). This 107 residue-long protein contains 56 glutamic acids, 30 alanines, 24 valines, 20 prolines, 18 serines and 15 lysines, but does not have any arginines, asparagines, cysteins, histidines, phenylalanines, tyrosines and tryptophanes.", "PPE antigens. Proline and glutamic acid rich proteins (or PPErepeat containing proteins, or PPE proteins) are important T-cell antigens produced by Mycobacterium avium subsp Paratuberculosis (Map). 237 One of the PPEs is a 34.9 kDa protein (359 residues, pI 4.31) which following recombinant expression in E. coli was shown to elicit significant delayed type hypersensitivity skin reaction in mice sensitized with Map, suggesting that this recombinant PPE protein of Map was definitely associated with cellular immune response. 237 Curiously, this PPE contains 73 alanines, 44 glycines, 37 prolines, 20 aspartic acids but just 10 glutamic acids." ] },{ "paper_id": "5b25c21a882848393a88f2036871db32f76c7a80", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All statistical analyses were conducted using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA). Differences between groups were analyzed using the two-tailed Student's t-test of means. " ] },{ "paper_id": "5b2945b68e31dfe32f721791a52b95f09b6a31bc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Rickettsial species, such as Coxiella burnetii, causative of Q-fever, comprise bacteria which exist within another cell, and as such Q-fever is contracted when humans are exposed to aerosolized droplets from the urine, milk, faeces or birth detritus from infected sheep, goats and cattle [50] .", "In contrast, EA submissions are for products used under an IND or a protocol (treatment plan), or submitted as a protocol amendment to an existing or new IND. The EA categories cover use under either an individual patient IND or protocol, individual emergency EA use, or EA for an intermediate-size population or for widespread use (large populations). Other US regulatory programmes for biologicals and drugs to treat serious or life-threatening conditions include fast-track designation, breakthrough therapy designation, accelerated approval pathway and priority review designation." ] },{ "paper_id": "5b2c74eaf9dc747307ec2d91ba16771cd505e44c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The samples consisted of conjunctival, nasal and, Table 2) .", "As previously noted, the female/male ratio was comparable, whereas the viral isolation frequency was twice as frequent in females as in males (Table 1 and Results). The large amount of positive samples obtained from females was not an expected result. In quite a few studies performed in cat populations from numerous locations, no gender difference was observed (11, 25) .", "With regards to the origin of the cats, females were positive in 16 locations, males in 9 locations and both male and female in 3 locations (data not shown)." ] },{ "paper_id": "5b355d4f9adcfca08906339ef42a4990b1e9c8b0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The quantitation of [ 35 S]sulfate-labeled macromolecules was carried out as previously described (33, 34) .", "Neutral oligosaccharides were analyzed on an AX5 anion-exchange column using a 40-80% gradient of acetonitrile in 25 mM NaPO4, pH 6.5, in 30 min at a flow rate of 1 ml/min. Fractions of 0.5 ml were counted . Each run included an internal standard of \"C-fucitol and an ovalbumin glycopeptide, [\"C]AcAsnMan6GlcNAc2 . 0-galactosidase digestions were carried out in 50 Al of 100-mM citrate-P04 buffer at pH 4 .5 for 16 h at 37\u00b0C using 0.05 U of enzyme .", "We are grateful to Sandoz Pharmaceuticals (Basel, Switzerland) for the gift of brefeldin A . " ] },{ "paper_id": "5b7753b6a659e6afa0a46fe171a372e682b07010", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The KEMRI Ethical Review Committee in Kenya and University of Warwick Biomedical Research Ethical Committee in the United Kingdom approved the study. Verbal assent was sought from participants aged <18 years, and written informed consent obtained from all participants or their parents/guardians.", "Background. The characteristics, determinants, and potential contribution to transmission of asymptomatic cases of respiratory syncytial virus (RSV) infection have not been well described.", "Supplementary materials are available at The Journal of Infectious Diseases online (http://jid.oxfordjournals.org). Supplementary materials consist of data provided by the author that are published to benefit the reader. The posted materials are not copyedited. The contents of all supplementary data are the sole responsibility of the authors. Questions or messages regarding errors should be addressed to the author." ] },{ "paper_id": "5b96fac306b9b57121152798668506aabb688cac", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The purpose of these organelles remains uncertain, but it seems logical to predict that DMVs help to concentrate viral proteins and their precursors and may offer some protection from the antiviral detection and elimination machinery of the cell.", "Previous DMV studies reported that while the outer DMV membranes open onto a network of connecting tubules that is connected to the endoplasmic reticulum, the inner DMV membranes contained abundant viral RNA (2, 8) but generally did not have visible openings (2) .", "A solid-walled DMV would be a tomb for any RNA synthesized inside and is difficult to reconcile with the generally understood role of DMVs in supporting viral replication. Furthermore, it was difficult to imagine how a closed DMV architecture could have evolved.", "In conclusion, the study of IBV DMVs highlights the plasticity of the coronavirus replicative organelle, a satisfyingly pleomorphic home for a pleomorphic virus. But perhaps the most important contribution is to show, for the first time, a coronavirus organelle with a clear exit strategy. " ] },{ "paper_id": "5c1dd2b19bb6b3016ba2654f69905bf4ec65bd54", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The translation of basic biomedical research discoveries into robust pipelines of products yielding licensed, appropriate, usable, affordable, equitable and accessible tools, such as diagnostics, vaccines, drugs or devices, is essential to achieving universal and global health.", "The funding to develop new NTD vaccines comes from government, philanthropic funding and occasionally from biotech funds. Seldom is any funding raised from private equity.", "ARTICLE HISTORY", "Because our PDP is embedded within an academic health center, the Texas Medical Center, and it is a key research and training arm of the National School of Tropical Medicine at Baylor College of Medicine, 27 we have established a hybrid model (of biotech and academic cultures) to train the next generation of vaccine researchers. Trainees can learn both at their site or via short exchanges the ins and out of " ] },{ "paper_id": "5c49361dc3511c5c14855745fedcbafc97d9ca96", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5ca05808cfc6d2139bc1ab6112d67dff9411f9ce", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Historically, research articles were placed under dissemination embargo until final publication. 1 This served to protect copyright and preserve the novelty of data. It also ensured that the public and the media were not privy to datasets and analyses that had the potential to change significantly between prepublication status and final article publication.", "Prepublication data release increases the risk of having data \"scooped,\" with \"scooping\" defined as \"when 2 independent groups studying the same system produce the same or similar results, and 1 group publishes their results first.\" 12 There is a concern that being \"scooped\" decreases the prestige of the original author. The medical literature has limited discussion of this phenomenon. However, publications in biology 4, 12 and the life sciences 13 cover the topic extensively, in part due to the enormous surge in clustered regularly interspaced short palindromic repeats (CRIS-PR)/Cas9 publications and a recent scandal in which multiple simultaneous developers of CRISPR technology were scooped. 25 The literature suggests that scooping not only does not harm the reputation of the authors, but also adds Table 2 ", "Of the 10 surgical conferences, authors were cautioned or prohibited against submitting work which would be published before presentation by 5 societies. The use of social media while at the conference was generically encouraged by 3 (Table 1 ). No specific guidelines or cautionary statements about how data should be disseminated by the authors or used by the audience were provided.", "Presentation and publication guidelines of 10 national surgical society meetings and 13 major surgical journals were reviewed for mention of embargo and social media policies. National meetings were chosen as being probable sites of presentations by society members and those likely to be attended by a wide representation of the respective society. Journals were chosen as being the official organs of the specialty or those very likely to be read by members of a specialty." ] },{ "paper_id": "5cba1e45c2829cb0ebaa7bf5384fa685f543c6d6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Since demonstration of FCoV RNA in ascites of FIPsuspected cats using RT-PCR was a useful indicator to diagnose FIP [3, 10] , the results of this study likely represent the epidemiology of effusive FIP in domestic cats in Japan. However, whether or not cats negative for the 3'-UTR gene were infected with FCoV was unknown. This status needs to be investigated further, such as by antibody test and quantitative RT-PCR.", "Ascites was obtained from a total of 854 privately owned domestic cats that were clinically suspected of having FIP from veterinary clinics throughout Japan in the period of June 2008 to October 2012. Viral RNA was extracted using a QIAamp Viral RNA Mini Kit (Qiagen, Tokyo, Japan). Detection of FCoV RNA was performed using a QIAGEN On-eStep RT-PCR Kit (Qiagen) with the P205-P211 primer pair providing a 223 bp amplicon of the 3'-untranslated region (UTR) gene of FCoV [10] , according to the manufacturer's instructions. FIPV strain 79-1146 (American Type Culture Collection, Rockville, MD, U.S.A.) was used as a positive reference virus. Furthermore, for samples in which the 3'-UTR gene was detected, genotyping was performed with the nested RT-PCR reported by Addie et al. [4] , providing 360 and 218 bp amplicons of FCoV types I and II, respectively. FIPV strain UCD1 (kindly provided by Azabu University) and FIPV strain 79-1146 (same as above) were used as positive reference viruses for the types I and II, respectively. Gene positivity was analyzed by chi-square test (StatView, Adept Scientific, Herts, U.K.), and a P value of <0.05 was considered statistically significant.", "Then, the positivity was investigated in various purebreds. As shown in Table 1 , the positivities in the Norwegian forest cat (92.3%) and Scottish fold (77.6%) were significantly higher than the average for purebreds (62.2%) (P=0.0274, \u03c7 2 =4.9 and P=0.0251, \u03c7 2 =5.0, respectively), whereas that in the American shorthair (30.0%) was significantly lower than the average for purebreds (P<0.0001, \u03c7 2 =26.3); the positivity in the American shorthair was also lower than that in crossbreds, although the difference was not significant. The The breeds that consisted of fewer than 10 cats were classified together as others. A significance test (\u03c7 2 test) was performed between each breed and the average of purebreds (62.2%)." ] },{ "paper_id": "5cded487793694de49b640b3972285bfc8431cfb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The focus so far has been on those genes/cytokines that have, historically, been regarded as of particular interest and/or have been selected for interrogation. The advent of global transcriptome profiling has helped to identify genes whose function maybe less well understood. However, in time, some of these genes and their respective pathways could be particularly important in determining the susceptibility or resistance of chickens to diseases. Table 2 outlines some genes, and their functions, from NE studies that maybe particularly relevant in determining disease susceptibility/resistance based on consistent (relative) up or downregulation in more resistant birds.", "Coccidiosis and necrotic enteritis (NE) are major intestinal disorders of chickens and were identified as the top two issues affecting broiler production by US poultry veterinarians in a recent survey (Hofacre and Mathis, 2015) . It is estimated that coccidiosis and NE cost the poultry industry around US$ 3 and 6 billion per annum, respectively, through lost productivity, prevention strategies, and/or therapeutic interventions (Wade and Keyburn, 2015) . The true cost to the industry may, C The Author(s) 2018. Published by Oxford University Press on behalf of Poultry Science Association. This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/ by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@ oup.com.", "Overall, this review highlights some of the genes more consistently associated with relative resistance (or susceptibility) to some of the most important diseases and foodborne pathogens of commercial poultry and helps to inform/support appropriate immune-based strategies to optimize poultry health and productivity. The optimum immune response is balanced to effectively counteract the pathogen and minimize tissue damage and associated nutrient costs. However, it does seem that steering the immune system towards a more proinflammatory capability (in different compartments) provides better protection against pathogens and (thus) improved growth performance. Global gene expression profiling is providing a greater overview of genes and pathways involved in the bird's response to pathogen challenge and mechanisms of resistance. Further studies, particularly incorporating bird growth performance, are, however, necessary to better develop our understanding and application of informed outcomes.", "Coccidiosis is caused by species of the Eimeria parasite and is probably the most significant enteric disease affecting chickens. Eimeria are ubiquitous and can persist in the environment for long periods (Blake and Tomley, 2014) . There are seven species of Eimeria that are known to infect chickens, with Eimeria acervulina, Eimeria maxima, and Eimeria tenella being the most prevalent and pathogenic for broilers (McDougald, 1998) . Each Eimeria species is recognized for targeting specific regions of the gut. E. acervulina affects the proximal small intestine, E. maxima affects the mid-intestine, and E. tenella affects the ceca (Hammond and Long, 1973) . Following ingestion of a sporulated Eimeria oocyst, mechanical disruption and digestive processes release four sporocysts and subsequently their sporozoites, which attach to, and invade, epithelial cells in the susceptible region of the intestine (Blake and Tomley, 2014) . The sporozoite then proceeds through further developmental phases (e.g., trophozoite, merozoite, gamete, zygote, etc.,) in the host before the formation of an unsporulated oocyst that is excreted into the environment, where it eventually sporulates. Invasion of epithelial cells causes damage to the epithelium and leads to haemorrhagic or malabsorptive disease, which results in poor growth performance or even death. Whilst good husbandry can play a part in managing coccidiosis, anticoccidial drugs and vaccination are necessary options for coccidiosis control, but each has their own drawbacks. Resistance to anticoccidial drugs has been a problem for many years, and vaccination costs can be prohibitive for the broiler industry (Blake and Tomley, 2014) ." ] },{ "paper_id": "5ceca9883a0930498d29cdfc09b942f6a9c6bf89", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5cf53c279192e23b92dd29e74cf9bdbb3b598244", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Contributors MA, MH, MMH and MAH were the main researchers, with the major roles in data collection, data analysis and manuscript preparation. TMR, MEH, MHR, LBP and MAS contributed to study design, data collection and preparation of the final manuscript.", "Funding This work was supported by the University Grants Commission of Bangladesh (grant number UGC 22, 2014) .", "The cortisol hormone was determined using an ELISAbased technique using the commercial kit of Monobind with its protocol (http://www. monobind. com/ site/ index. html, accessed on March 12, 2015) .", "Diarrhoea was assessed by inspecting the perianal area for adhesion of faeces, observing faeces characteristics around the animal holding area, and history taken from the cattle trader on increased frequency and volume of defecation (if the trader observed and recalled this information). 18 Dehydration was evaluated by looking at the condition of the eyes (sunken eye) and by performing skin fold test 19 (Table 1) ." ] },{ "paper_id": "5d2201d0059d6b9e0702278a74cb46e036434053", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Infectivity titers for both the seed virus and material recovered from infected mice were determined by plaque titration on Vero E6 or LLC-MK2 cells using an overlay supplemented with 1 mg TCPK trypsin/ml and expressed as plaque-forming units. SeV serially diluted in sterile phosphate-buffered saline (PBS) was inoculated onto the wells and incubated at 37 C for 45 min with agitation every 15 min. Wells were overlaid with 3 ml of 2\u00c2 MEM (Life Technologies, Gibco) with 100 IU/ml penicillin/100 mg/ml streptomycin (Gibco), 2% BSA (Gibco), 2 mg/ml of TCPK trypsin (Sigma), and 1.6% agarose. Plaques were visualized at day 3 by staining with crystal violet in 20% methanol processed as described earlier.", "SeV strain 52 was obtained from ATCC (Manassas, VA; VR-105). Seed virus was prepared by inoculation of 10-day embyonated chicken eggs, harvesting allantoic fluid 2 days later and storing aliquots at \u00c080 C.", "Formalin-fixed tissues were embedded in paraffin, sectioned at 5 mm and sections stained with hematoxylin and eosin. An experienced veterinary pathologist evaluated tissues and score for pathology. Tissues were scored as follows: 0 \u00bc no change; 1 \u00bc minimal change (or possibly non-specific background or appearance compounded by lung collapse, i.e. not inflated); 2 \u00bc mild inflammation and/or pneumocyte hypertrophy; 3 \u00bc moderate inflammation and/or pneumocyte hypertrophy; 4 \u00bc marked inflammation and/or pneumocyte hypertrophy; 5 \u00bc severe inflammation and/or pneumocyte hypertrophy affecting <50% of lung lobe; 6 \u00bc severe inflammation and/or pneumocyte hypertrophy affecting >50% of lung lobe.", "Cytokine expression was also measured using a cytokine multiplex assay. Lung homogenates were processed according to manufacturer instructions and then analyzed using a Bio-Plex 200 system (Bio-Rad, Hercules, CA). Briefly, tissue homogenates were centrifuged for 10 min at 1,000 rpm at 4 C to remove cellular debris. Aliquots of the cleared supernatants were transferred into 96-well round bottom plates and processed for use on the Bio-Plex system. The cytokines/chemokines were coupled to cytokine/chemokine specific multi-plex beads (R&D Systems, INC., Minneapolis, MN) . This panel measures the concentrations of cytokines and chemokines IL-1b, IL-4, IL-6, IL-10, IFN-c, CCL2 (MCP-1), CCL3 (MIP1a), CCL4 (MIP1b), CCL5 (RANTES), CXCL10 (IP-10), and tumor necrosis factor-a (TNF-a)." ] },{ "paper_id": "5d352d8eaadb17dc1ed4cd7501e3533d366c939c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The result obtained above implicated that low pH treat-ment removes IBAV outer capsid proteins from the particle and initiates its infection. Figure 3b shows the viability of HmLu-1 after a series of treatment without virus infection, and no significant difference was observed (P=0.983, Welch's t-test).", "Ibaraki virus (IBAV) is one of the strains of epizootic hemorrhagic disease virus (EHDV) serotype 2, a member of genus Orbivirus in Reoviridae family [11, 19] . It is known as a causative agent of Ibaraki disease characterized by the paralysis of swallowing muscles. Although the effective vaccine is widely used, the recent reemergence of Ibaraki disease in combination with the co-circulation with other EHDV raised the alert level for the epidemic of Ibaraki disease [13] . In addition, orbivirus family contains many viruses causing severe loss in the livestock industry. Therefore, it is important to understand the detailed molecular mechanism of their infection.", "Virus infection is initiated by the release of viral genome to the intracellular compartment of target cells. Several mechanisms are known for the genome release to cytoplasm, and one of the most well known mechanisms is the direct fusion mechanism utilized by several enveloped viruses, such as human immunodeficiency virus-1, mouse hepatitis virus and Paramyxoviruses [5, 6] . Enveloped viruses are also known to use host endosomal pathway to facilitate their infection [12] ." ] },{ "paper_id": "5d38ec30f0a4ea9b504808bc6bb2c8793db72e7a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5d3cad66ff27b7d70f1895c653f79d63379af069", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Environment (RIVM, the Netherlands). Poliovirus Sabin 1, 2, and 3 strains were obtained from the late B. Rombaut (Vrije Universiteit Brussels, Brussels, Belgium) . Human rhinoviruses 2 and 14 were a kind gift of Joachim Seipelt (Medical University of Vienna, Austria). ERAV (NM11/67) was kindly provided by David Rowlands and Toby Tuthill (University of Leeds, United Kingdom). Virus titers were determined by endpoint titration according to the method of Reed and Muench and expressed as 50% cell culture infective doses (CCID 50 ).", "Briefly, cells were seeded at a density of 5 x 10 3 cells per well in a 96-well cell culture plate in complete DMEM. Following incubation of 24 hours at 37\u00b0C, serial dilutions of the test compounds in complete DMEM were added in a total volume of 100 \u03bcL. Replicon RNA levels after 3 days of incubation were determined by reverse transcription quantitative polymerase chain reaction (RT-qPCR). Primers used for detection of HCV replicon RNA were: 5'-CCGGCTACCTGCCCATTC-3' (forward primer), 5'-CCAGATCATCCTGATCGACAAG-3' (reverse primer) and 5'-FAM-ACATCGCATCGAGCGAGCACGTAC-TAMRA-3' (probe).", "HeLa R19 cells (2 x 10 3 cells/well of a 96-well plate) were reverse transfected with 2 pmol of small interfering RNA (siRNA) per well using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. Scramble siRNA (AllStars Negative Control; Qiagen) was used as a negative control, siRNA against PI4KIII\u03b2 (5'-UGUUGGGGCUUCCCUGCCCTT-3') was from Qiagen, and siRNAs against OSBP (two siRNAs mixed at a 1:1 ratio, 2 pmol total per well, 5'-", "Purified OSBP (3,3 \u03bcM) was incubated at 30\u00b0C under constant agitation in the presence of 2 \u03bcg/ml trypsin, and the reaction was stopped 5 min after trypsin mixture by addition of 2 mM PMSF. Absence of residual full-length protein and accumulation of the ~35kDa ORD fragment [as identified in (Mesmin et al., 2013) ] was checked by 15% SDS-PAGE before DHE or PI4P transfer assay." ] },{ "paper_id": "5d492015c79953419dd1cfc47ebf6b50297e0334", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. All data were analyzed using an unpaired two-tailed t test and GraphPad Prism statistical software (GraphPad Software Inc., San Diego, CA, USA). A value of P , 0.05 was considered statistically significant (*, P , 0.05; **, P , 0.01; and ***, P , 0.001)." ] },{ "paper_id": "5d4f1f02d0e731966dddd635e8fa7bfdc169d3b9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This is a case report requiring only chart review and literature review, without any direct intervention or harm to the patient referred to in this case, and as such, informed consent and ethical approval was not needed.", "At outpatient follow-up, very long chain fatty acids were normal, eliminating adrenoleukodystrophy as a possible etiology for the adrenal insufficiency. The diabetes autoimmune test group was normal, but the TSH remained elevated with a normal T4, confirming autoimmune hypothyroidism. Follicle-stimulating hormone and luteinizing hormone were normal, eliminating concomitant hypogonadism, but tissue transglutaminase immunoglobulin A was elevated, raising suspicion for celiac disease. Levothyroxine was started and he was referred for intestinal biopsy to confirm celiac disease.", "In a study of 18 pediatric patients with primary adrenal insufficiency, hypotension was the presenting sign in 13, hyperpigmentation in 12, hyponatremia in 16, and hyperkalemia in 9. Of 15 who underwent a cosyntropin stimulation test, all failed. 16 Our patient did not have hypotension, yet he had hyperpigmentation, hyponatremia, hyperkalemia, and failed a cosyntropin stimulation test." ] },{ "paper_id": "5d58ccdb0252429f7c74ece67b505a2afd7e08c9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Twenty-five patients underwent transbronchial lung biopsy (TBLB) and 2 underwent video-assisted lung biopsy. Histological samples showed intraluminal organization (n=21), alveolitis characterized by thickened alveolar septa and infiltration of the inflammatory cells to the alveolar septa (n= 26), intraalveolar hemorrhage (n=12), and fibrin exudate (n= 3) (Fig. 4d-f ).", "The number of cases of virus infection diagnosed each month was higher in the winter months and lower in the summer months (Fig. 3) ." ] },{ "paper_id": "5d78b139da9ef9b2070d532b2bd773c367656ca8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org/ lookup/suppl/doi:10.1128/mBio.01265-15/-/DCSupplemental. Figure S1 , TIF file, 1.7 MB. Figure S2 , TIF file, 1.6 MB. Figure S3 , TIF file, 1.5 MB. Figure S4 , TIF file, 2.7 MB. Figure S5 , TIF file, 2.6 MB. Figure S6 , TIF file, 0.7 MB. Table S1 , DOCX file, 0.1 MB. Table S2 , DOCX file, 0.1 MB. Text S1, DOCX file, 0.1 MB.", "ELISA. IFN-\u2424 in the supernatant of ivtDVG RNA-transfected TC-1 cells was determined by enzyme-linked immunosorbent assay (ELISA) in accordance with the manufacturer's instructions (PBL Assay Science).", "Cell lines and viruses. LLC-MK2 rhesus monkey kidney epithelial cells (ATCC catalog no.CCL-7), A549 human type II alveolar cells (ATCC catalog no. CCL-185), and wild-type, Ddx58 \u03ea/\u03ea (RIG-I \u03ea/\u03ea ) and Mavs \u03ea/\u03ea MEFs (kindly provided by J. Kagan and J. Chen) were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 2 mM glutamine, and 50 mg/ml gentamicin or penicillin and streptomycin (all from Invitrogen). TC-1 mouse lung epithelial cells (ATCC catalog no.CRL-2785) were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 2 mM L-glutamine, 2 mM nonessential amino acids, 10 mM HEPES, and 50 mg/ml gentamicin or penicillin and streptomycin (all from Invitrogen). All cell lines were treated with mycoplasma removal agent (MP Biomedicals) before use. SeV Cantell HD and LD (SeV HD, high DVG particle content; SeV LD and 52, low DVG particle content) were prepared in embryonated chicken eggs as described previously (25) . Influenza A/PR8/34 virus (IAV) was grown in 10-day-old embryonated chicken eggs (Specific-Pathogen-Free Avian Supplies, Charles River Laboratories) for 40 h at 37\u00b0C.", "Statistical analysis. Statistical analysis was performed with GraphPad Prism version 5.0 (GraphPad Software, San Diego, CA). A statistically significant difference was defined as a P value of \u03fd0.05 by either one-way analysis of variance (ANOVA) or Student's t test with or without a post hoc test, as indicated in each figure legend, on the basis of the specific data set." ] },{ "paper_id": "5d98d889c1739957886a3c27dc6552e695fee2f7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This review aims to summarize our current knowledge and to discuss the gaps in knowledge regarding AR in early childhood.", "Non pharmacological therapy with saline nasal rinses has also shown modest improvement in rhinitis symptoms in those above the age of 6 years [49] .", "Allergen immunotherapy is another therapeutic strategy that is attractive in that it reduces new sensitizations, reduces the risk of asthma and has a long term carry over effect even after cessation of therapy [2] ." ] },{ "paper_id": "5da2c99de592512c4295cc5c1b941e5f6548f065", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All in all, we believe that research on new antibacterials should meet the needs of the day-to-day clinicians working in hospitals, where fast responses should be granted within easy technological access to user-friendly databases. If we could conceive such a scenario, then novel avenues will open to explore real novel drugs.", "Editor: Grzegorz Wegrzyn" ] },{ "paper_id": "5db655de0fdc5e28e3fc13f279b5068c30e9cdc2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5dd80841cfa8fbf952df8516dd9ff3e4233b977f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All constructs were made using standard cloning procedures (Maniatis et al., 1989) .", "For immunoprecipitation, the in vitro translation reactions were diluted fivefold with dilution buffer (50 mM \"his, pH 8.0, 1% NP-40, 150 mM NaC1, I mM PMSF) and incubated with 5/~1 of control guinea pig serum or anti-p58 guinea pig serum (Worman et al., 1988) . The immune complexes were precipitated with protein A-Sepharose (Pharmacia Fine Chemicais), washed three times with dilution buffer, and then analyzed by SDS-PAGE as described above.", "A pepfide containing amino acids 2-17 of chick p58 was coupled to keyhole limpet hemocyanin (Calbiocbem Behring Corp., La Julia, CA) through an additional carboxy-terminal cysteine with maleirnido bis succinimide (MBS; Pierce Chemical Co., Rockford, IL) as described (Green et al., 1982) and used for the preparation of rabbit pelyclonal antisera as described (Harlow and Lane, 1988) . The p58 synthetic peptide was coupled to SulfoLink coupling gel (Pierce Chemical Co.) according to the suppliers protocol. Anti-p58 IgG were then affinity purified by passing crude serum over the peptide resin, washing with 0.5 M NaCI, eluting with 0.1 M glyeine, pH 2.5, and dialyzing against PBS." ] },{ "paper_id": "5e2fc4aaa3045d5c12525483a0f18010601b015a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Technical data: Table 1 .", "Analysis of risk factors and a plan for actions allow to improve a program for ECMO transport of persons affected by ALI or ARDS to a referring centre. In order to achieve this goal, four factors seem to be crucial: identification of a vehicle with specific tech features, systematic and precise settings of equipment, a toolsystem to sort out equipment and a dedicated training program for nurses involved in these missions.", "In addition, it must be underlined the importance of clinical stabilization of the patients before transport (29) . The number of adverse events observed in our patients during transport were comparable to those reported by other centers or networks that have implemented similar programs aimed at the centralization of ECMO candidates (7, 8, 12, 30) ." ] },{ "paper_id": "5e3baaac3cdc7bfad5ed84c6e7cc324a8396ebb9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5e8abc62533a447422d5ead64d4ae4991cc99052", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5ea02beeb65f975de027e3b6fedc6b239e9f2e8f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "39 primer: 59-GGCAAGCTGACCCTGAAGTTCTTTTAGGAGTGACGTA-AAC-39 59 primer: 59-TAATACGACTCACTATAGGGAGGACGATGCGG-39" ] },{ "paper_id": "5ea6161f1a3799d02f910658992bc4df2a1cefae", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5eb49e806422f7b236b088d46352af5874b52700", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "One-way ANOVA and independent t-test were used for statistical analyses in IBM SPSS Statistics 21 software (Chicago, IL, U.S.A.). Results were considered as statistically significant at P<0.01. Graphics were created with GraphPad Prism software (San Diego, CA, U.S.A.).", "SBV titration is performed on Vero cells as described previously [17] with some modifications. Briefly, Vero cell line was inoculated in 12-well cell culture plate and after 18 hr cells were infected with SBV dilutions. After 3 hr of incubation of virusinfected cells in 37\u00b0C incubator with 5% CO 2 virus dilutions, inocula were removed and 1:1 mixture of 2\u00d7 DMEM and 2% carboxymethyl cellulose (CMC) were dispersed to all wells. After incubation for 6 days cells were fixed with 10% neutral buffered formalin solution and stained with crystal violet. Plaques were counted and stock virus titration was calculated as PFU/ml.", "CONFLICTS OF INTEREST. The authors declare no conflicts of interest. " ] },{ "paper_id": "5ed43fc646fb368da6a9cf9d0029891a4b8248d1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Epithelial cells accumulate distinct popula-", "permeabilized before incubation with the primary antibodies, this technique ensures that all membrane domains will be equally accessible to labeling. The linearity and accuracy of similar methods have been previously established (Vega-", "zymes occupy distinct membranous domains within the gastric parietal cell." ] },{ "paper_id": "5f071d0350cb9013deb98f9a52070bbf0f70bb84", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5f2fed24630132d29e1336b240edc9ab68e459aa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5f3fc1bf0b828ea47a282433d84726eb5b25447c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5f4261729c0f4fadccac90a0da2c995f13b65802", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A prior study with a commercial AKAP7 antibody (from Pro- ", "Supplemental material for this article may be found at http://mbio.asm.org/ lookup/suppl/doi:10.1128/mBio.01312-14/-/DCSupplemental. Figure S1 , PDF file, 0.7 MB. Figure S2 , PDF file, 2 MB. Figure S3 , PDF file, 2.4 MB." ] },{ "paper_id": "5f52ac4738312fdb215ad06e5a2e886a6fb63efd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5f56a9b712608c599a21191b06b78bfa70ad523f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "5f7bc4da553becc28ba03a2ac4a98133d4689adc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Contributors All authors were involved in drafting the article or revising it critically for important intellectual content, and all authors approved the final version to be published.", "Other relatively common clinical findings in KD include arthritis, aseptic meningitis, pneumonitis, uveitis, gastroenteritis, meatitis and dysuria and otitis. 2 9 Relatively uncommon abnormalities include, hydrops of the gallbladder, gastrointestinal ischaemia, jaundice, cranial nerve palsy, renal involvement (pyuria, proteinuria, tubular disturbances, tubulointerstitial nephritis and renal failure), petechial rash, shock syndrome, febrile convulsions and encephalopathy or ataxia. 2 9 Additional rare complications of KD include macrophage activation syndrome (secondary haemophagocytic lymphohistiocytosis), and syndrome of inappropriate antidiuretic hormone secretion resulting in hyponatraemia. 45 46 ", "Provenance and peer review Commissioned; externally peer reviewed." ] },{ "paper_id": "5f88b4180ba190e37e27776b11432d61770529ef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Digital materials such as tweets are also a potential tool for communication in public health [18, 19] with hopefully an improvement of knowledge and attitudes. However, the indicators and the methods to be used for evaluating social media must be adapted to this specific context. Digital tools used in epidemiology need to be validated as any other measure [20] .", "Public Health and Epidemiology Informatics reviewed the 97 references and drafted a consensual list of 14 candidate best papers. All pre-selected 14 papers were then peer-reviewed by Yearbook editors and external reviewers (at least four reviewers per paper). Two papers were finally selected as best papers (Table 1) . A content summary of these selected papers can be found in the appendix of this synopsis. Lamy et al. [10] describe the whole selection process.", "A comprehensive literature search was performed using two bibliographic databases, Pubmed/Medline (from NCBI, National Center for Biotechnology Information), and Web of Science\u00ae (from Thomson Reuters). The search was targeted at public health and epidemiology papers that involve computer science or the massive amount of web-generated data. References addressing the topics of the other sections of the Yearbook, such as those related to interoperability between data providers were excluded from our search. The study was performed at the beginning of January 2018, and the search over the year 2017 returned a total of 843 references.", "Articles were separately reviewed by the two section editors, and were first classified into three categories: keep, discard, or leave pending. Then, the \"keep\" and \"leave pending\" lists of references built by the two section editors were merged, yielding 97 references. The two section editors jointly Table 1 Best paper selection of articles for the IMIA Yearbook of Medical Informatics 2018 in the section 'Public Health and Epidemiology Informatics'. The articles are listed in alphabetical order of the first author's surname." ] },{ "paper_id": "5fbe76b0ae7ef869d483dfa3844a8d4f66f65c8f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To make a useful comparison, this review will investigate the ", "However, no inflammation was observed in those organs. This experiment proved that hamsters develop a more severe syndrome than mice.", "However, unlike camels, alpacas did not demonstrate observable nasal secretion.", "This is an open access article under the terms of the Creative Commons Attribution-NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes." ] },{ "paper_id": "5fc9523915b057c03afa54f111fe9fd1995dd1ad", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This article does not contain any studies with human participants or animals performed by any of the authors. ", "The author(s) declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.", "Background: Viruses are obligate parasites that depend on the cellular machinery of the host to regenerate and manufacture their proteins. Most antiviral drugs on the market today target viral proteins. However, the more recent strategies involve targeting the host cell proteins or pathways that mediate viral replication. This new approach would be effective for most viruses while minimizing drug resistance and toxicity. Methods: Cytomegalovirus replication, latency, and immune response are mediated by the intermediate early protein 2, the main protein that determines the effectiveness of drugs in cytomegalovirus inhibition. This review explains how intermediate early protein 2 can modify the action of cyclosporin A, an immunosuppressive, and antiviral drug. It also links all the pathways mediated by cyclosporin A, cytomegalovirus replication, and its encoded proteins. Results: Intermediate early protein 2 can influence the cellular cyclophilin A pathway, affecting cyclosporin A as a mediator of viral replication or anti-cytomegalovirus drug. Conclusion: Cyclosporin A has a dual function in cytomegalovirus pathogenesis. It has the immunosuppressive effect that establishes virus replication through the inhibition of T-cell function. It also has an anti-cytomegalovirus effect mediated by intermediate early protein 2. Both of these functions involve cyclophilin A pathway.", "There are several CsA derivatives ( Figure 2 ) that interact well with viruses and do not cause serious side effects. [194] [195] [196] Among these derivatives, alisporivir (Debio-025) (Figure 2(a) ), a non-immunosuppressive analog of CsA, was synthesized to contain sarcosine instead of d-methylalanine at position 3 of the PPIase domain and methyl-leucine instead of ethylvaline at position 4 of the calcineurin domain. These modifications have altered the PPIase activity and calcineurinbinding ability of the derivatives. 197 However, alisporivir still results in side effects including reversible hyperbilirubinemia and pancreatitis when used in combination with PEG-IFNa2a and ribavirin to treat hepatitis C virus (HCV) infection. 198 NIM811 ( Figure 2 (b)), another nonimmunosuppressive analog of CsA, is similar in structure to the parent molecule with one modification: methyl-leucine at position 4 being replaced by methyl-isoleucine. This derivative has antiviral effects 195 while exhibiting the same pharmacokinetic profile as CsA without nephrotoxicity. 196, 199 In 2010, SCY-635 ( Figure 2 (c)) was synthesized. 200 This CsA derivative inhibits HCV infection 201 without detectable inhibition of calcineurin phosphatase. Treatment with this drug is associated with transient increases in interferon a, k1, and k3, the cytokines responsible for the clearance of the viruses. 202 Another derivation of CsA, EDP-546, is metabolically stable with favorable pharmacokinetics that allows for less frequent and low therapeutic dosing of the drug. It is also an effective bilirubin transporter without affecting CYP450, a major protein in drug metabolism. 203, 204 Sanglifehrin A (SFA) (Figure 3 ) is a new immunosuppressive agent 205 isolated from the Streptomyces strain A92-308110. This protein interacts strongly with CyPA 206-208 but not with calcineurin phosphatase. 209 It is also a potent inhibitor of mitochondrial permeability transition and heart reperfusion injury. 210." ] },{ "paper_id": "5fedd08f111b588bface2d146740bad23bbbb3e3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For a set of coupled ordinary differential equations", "Step 4: Record (X, t) as desired. Return to Step 1, or else end the simulation." ] },{ "paper_id": "6005b8055730f4625c1995a57def5c32fa3f4ec7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "601d3c7ae4ebcd2d835e9cf8d7427ebd0b5db83f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplementary data to this article can be found online at https:// doi.org/10.1016/j.meegid.2020.104272.", "This work was supported by the MEXT-Supported Program for the Strategic Research Foundation at Private Universities (grant number S1511028 to T.I) and the Takeda Science Foundation.", "Coronaviruses are enveloped RNA viruses that infect many species, including humans, other mammals, and birds. After infection, the host may develop respiratory, bowel, liver, and neurological diseases (Weiss and Leibowitz, 2011; Cui et al., 2019) . Coronaviruses are members of the order Nidovirales and subfamily Orthocoronavirinae. This subfamily is divided into four genera: Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. Generally, Alphacoronavirus and Betacoronavirus tend to infect mammals, while Gammacoronavirus and Deltacoronavirus typically infect birds. However, some Gammacoronavirus and Deltacoronavirus can infect mammals under specific conditions (Woo et al., 2012) ." ] },{ "paper_id": "602981d75e74595af0e2de9e046a9cc9e05a1c0e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00198-11/-/DCSupplemental. Figure S1 , PDF file, 0.1 MB. Figure S2 , PDF file, 0.1 MB. Figure S3 , PDF file, 0.1 MB. Figure S4 , PDF file, 0.3 MB. Figure S5 , PDF file, 0.8 MB. Figure S6 , PDF file, 0.1 MB. " ] },{ "paper_id": "6050d0c1b7c6990972e6cdfca89f79745b13cc14", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Immunoprecipitates were released from the protein A-Sepharose beads by boiling for 3 min in 30 Ixl 200 mM Na-citrate, pH 5.5, 2% SDS in the presence of protease inhibitors, frozen at -20\u00b0C for 30 rain, and boiled again for 3 min. Then the samples were diluted with an equal volume of distilled water containing protease inhibitors and incubated with 4 mU endoglycosidase H (endo H) for 22 h at 37\u00b0C.", "ERGIC-53 is a lectin-type membrane protein that continuously recycles between the ER, ER-" ] },{ "paper_id": "60522266645f5d89d709c2a6dc0f45a072f64dfd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Categorical variables are expressed as numbers and percentages. Fisher exact tests and the chi-square tests were used to evaluate statistical significance. Continuous variables are expressed as means and standard deviations (SD). Independent t test was used to evaluate statistical significance. All statistical analyses were performed using SPSS version 21.0 (IBM Corp., Armonk, NY, USA). A p-value of <0.05 was considered statistically significant.", "The primary study subjects were 5,298 patients, who underwent multiplex real-time polymerase chain reaction (PCR) for simultaneous detection of respiratory viruses, among who visited the emergency department or outpatient clinic with respiratory symptoms at Ulsan University Hospital from April 2013 to March 2016 ( Figure 1 ). The medical records of all these patients were retrospectively reviewed in detail.", "No potential conflict of interest relevant to this article was reported." ] },{ "paper_id": "606233835c3d6d195b7d230745ccb0fded626aa7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(1) Data model" ] },{ "paper_id": "6092602066323176223cd6d8deadfb8f689c0ea0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "60b766c8bbe49fb1702f0784263e8a258ed067f3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In vitro measure of ability of PBMCs to promote either Th1 or Th2 immunity", "In vitro measure of ability of immune cells to produce/release cytokines in response to an immune stimulus.", "An allele at \u00fe 874 is associated with reduced IFN-g production and consequent reductions in Th1 activity \u00fe 874 A predisposes for hepatitis B and C persistence and negatively affects clinical course of these diseases. 290 Reference numbers in Table 3 correspond to reference numbers in paper bibliography.", "Reduced PBMC production of IFN-g and IL-12 is associated with increased severity of respiratory syncytial virus symptoms in infants under 1 year of age. 277 Increased activity alleles of the IL-10 gene (i.e., \u00c01082G)" ] },{ "paper_id": "60bcf8aea7134c49453a05d2b9d52728cc6edcd6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. Experimental data are presented as means \u00b1 standard error of the mean. Significant differences of the variability among different groups were analyzed by two-way ANOVA test or t-test using GraphPad Prism (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA) software. A P<0.05 was considered to indicate a statistically significant difference.", "Porcine reproductive and respiratory syndrome (PRRS), which is characterized by reproductive disorders in pregnant sows and respiratory diseases in growing pigs, is a viral disease caused by PRRS virus (PRRSV) (1, 2) . Since its first outbreak in 1987 in USA (3), PRRS has spread to the major pig-producing countries and regions (4) , causing tremendous economic losses to the world pig industry. The emergence and prevalence of highly pathogenic (HP)-PRRSV with a 30-aa discontinuous deletion in its nsp2-coding region devastated the Chinese swine industry in 2006 (5, 6) . PRRSV, a single positive-stranded RNA virus, is classified into the genus Arterivirus of family Arteriviridae in the order Nidovirales (7) (8) (9) . This virus can be divided into two genotypes, namely types 1 and 2 (10) (11) (12) .", "F and R, primer pairs were annealed and inserted into pmirGLO dual-luciferase miRNA target expression vector digested with PmeI and XbaI; b NotI restriction endonuclease site is underlined; MRE, miRNA recognition elements; IFN-\u03b2, interferon-\u03b2; 3'UTR, 3' untranslated region." ] },{ "paper_id": "60cc55d9df1b0ff215bcaefe413b7b6edc5eb182", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "KEY WORDS: avian coronavirus, cell-mediated immunity, humoral immunity, mucosal immunity, oil adjuvant", "Inf.", "Ep. Dec." ] },{ "paper_id": "60e51d3d13b027492b9f3b8693c58dd8b5385ada", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "60f1455bed921da2e4f3df7aae854cb8e142ff44", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For the second library, we created a genomic backbone for further editing by using the oligos \"a3034g\" and \"g3319a t3321a\" to introduce the three most commonly observed mutations in OmpF + \u03bb genotypes. Next, we performed a number of different MAGE trials to maximize the number of unique alleles we observed. See Table S2 for our MAGE strategy. We screened for \u03bb genotypes able to infect through OmpF by isolating strains that produced plaques on lawns of E. coli with lamB deleted. We sequenced 88 isolates from the lawns and uncovered 34 unique genotypes.", "We calculated gap entropy at each position as:", "For all nonparametric bootstrap calculations, we used 100,000 bootstraps, and chose groups of sites without replacement; that is, if calculating a statistic for a group of 17 residues, we would choose 17 different residues for one sample, and resample 100,000 times.", "One possible problem with this analysis would occur if indels themselves disproportionately contributed to branch length, thereby causing an artificial correlation between branch length and these mutations. This possibility can be ruled out: when FastTree estimates branch lengths, positions with gaps are either ignored (when comparing two sequences) or weighted by their proportions of nongaps (when comparing two sequence profiles)." ] },{ "paper_id": "6101fcc0282d2e355b5e094de10aafaa05e749c6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No potential conflict of interest relevant to this article was ", "Because many reports are contradictory on the relationship between transfusions and NEC, additional studies are necessary involving larger patient groups. In addition, the patient's general condition and the risk of NEC based on the transfusion must be considered when treating preterm infants <1,500 g.", "PDA was diagnosed based on echocardiographic findings. The number of transfused patients, the frequency of transfu sions per patient, Hgb level at the time of transfusion, and cases in which the NEC diagnosis was made within 48 hours of transfusion were also analyzed. The Statistical analysis was performed with SPSS ver. 12.0 (SPSS Inc., Chicago, IL, USA) using the t-test, and logistic regression. P value under 0.05 was considered significant." ] },{ "paper_id": "6107c0ccde81ea8fb7c6a10fc39048eedf5c2447", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No potential conflicts of interest were disclosed.", "The systematic characterization and classification of knots has engaged scientists since the introduction of Tait's knots table, whose first entries are shown in Fig. 1A . It is readily seen that the different types of entanglement are permanently trapped in the closed curves. In fact, any two curves cannot be continuously deformed into one another unless they are cut open, rearranged and resealed.", "In our everyday life, the knots that typically surround us differ from these well-defined mathematical ones because they are tied in open chains (Fig. 1B) . These knots are clearly not permanently trapped and hence are termed \"physical knots\". Many of the physical knots that we encounter have been purposely introduced in, for example, the yarn of sewn clothes or in ropes secured to anchoring points. Not infrequently, however, we have to deal with their unwanted spontaneous occurrence, as in the earphone cords pulled out of our pocket.", "Though an equal footing comparison with proteins is difficult for the different typical length (number of monomers) of the two types of molecules and the PDB entry redundancy, the total absence of knots in the > 7,000 available RNAs structures is notable." ] },{ "paper_id": "611a37c75e97cd0e251685d63fbbb42dbe3827b9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The results are presented as the mean 6 standard deviation (SD). Statistical significance between different vaccination groups was calculated by Student's t-test and Kaplan-Meier analysis using the statistical package for the social sciences (International Business Machine Corporation, Armonk, NY, USA) statistical software. P-values less than 0.05 were considered significant.", "Viral RNA copies in mouse lung homogenates were measured by quantitative reverse-transcription polymerase chain reaction (QRT-PCR) as described previously. 23 Briefly, viral RNA of mouse lung homogenate was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA). The extracted viral RNA was reverse-transcribed to cDNA using Superscript II (Invitrogen, Waltham, MA, USA) and primer Flu12 (AGC AAA AGC). The viral RNA copy numbers in the samples were determined using a Lightcycler 96 (Roche Applied science, Penzberg, Germany) with SYBR green I master (Roche Applied science, Penzberg, Germany). Primers specific for influenza viral M gene (forward primer: 5-CTT CTA ACC GAG GTC GAA ACG-3; reverse primer: 5-GGC ATT TTG GAC AAA KCG TCT A-3) were used in the QRT-PCR assay.", "Virus titers were detected by TCID 50 assay as described previously. 20 Briefly, the infected allantoic fluid and mouse lung homogenates were serially diluted 10-fold in minimum essential medium (Invitrogen, Waltham, MA, USA) containing a cocktail of antibiotics. The diluted samples were added to PBS-prewashed Madin-Darby canine kidney cell monolayer in a 96-well plate. The cell cultures were incubated at 37 6 C for 1 h, and the supernatants were replaced with fresh minimum essential medium containing a cocktail of antibiotics. The cytopathic effect that appeared in the infected Madin-Darby canine kidney cells was observed daily and recorded on the third-day post-infection." ] },{ "paper_id": "61316d789f66022b466f2924837aaff7f0bf65f5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "61610467351ceab87933d94e3c6e487654d316a8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "These two scenarios can result in a monophyletic distribution of the blue gene (D) without a de novo origin within an overlapping reading frame. Figure S4 : Phylogenetic relationships among coronavirus sequences. A phylogenetic tree based on the full protein sequence of the ancestral gene and the corresponding genomic maps are shown. The tree was inferred using the BIONG method (Gascuel 1997).", "are the results of two independent origins, is less parsimonious. Because the black gene has no significant sequence similarity with the other genes in the clade, we did not use it for calculations of relative divergence and selective constraint. This scenario corresponds to taxa (4, 5, 6, 8, and 9) in which one (taxa 4, 8, and 9) or two (taxa 5 and 6) de novo genes within a monophyletic clade have no sequence similarity." ] },{ "paper_id": "616cdd0a8b488fcf0b28781f710cc7fba8625a4d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The phylogenic tree was constructed using the neighbor joining method and MEGA software (version 4.0; Biodesign Institute, Tempe, USA). The topological stability of the tree was evaluated by 1000 bootstrap replications.", "The cDNA was synthesized using PrimeScript TM RT reagent kit (Takara, Tokyo, Japan) according to manufacturer's instructions. 8 A fragment of the S1 gene (464 bp) was amplified using a pair of specific primers including XCE1 (5'-CACTGGTAATTTTTCAGATGG-3') and XCE2 (5'-CTCTATAAACACCCTTACA-3'). 9 The PCR reaction and its thermal condition were set up as previously described. 10 The PCR products were electrophoresed on 1.00% agarose gel.", "Extraction of RNA from the allantoic fluid was carried out using RNX-plus Solution (CinnaGen, Tehran, Iran) according to manufacturer's instructions. The isolated RNAs were stored at -80 \u02daC." ] },{ "paper_id": "616d2117cb63fecdaa5ae2901cca9d1b610dd799", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "617197cc751a9208cb0af1b4e31baeddc8d2e985", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "618a793838421a7bf238e8f6ae2635ca3d2f5a25", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cell culture-HeLa cells were maintained in 1x DMEM supplemented with 10% FBS and 1x Antibiotic Antimycotic solution (Sigma #A5955) at 37\u00b0C, 5% CO 2 in a humidified incubator. For RNAi experiments, EndoU siRNA was purchased from Dharmacon (SMARTpool: siGE-NOME ENDOU siRNA for EndoU, M-012187-00-0005). Lipofectamine RNAiMAX Transfection Reagent (ThermoFisher, #13778075) was used for delivery of siRNA, following the manufacturer's instructions. Knockdown efficiency was assessed by qPCR.", "Student's t test was done in Excel. Pearson's chi-square test ( Figure 5C ) and two-way ANOVA test ( Figures 2C, 6H , S1C, and S5C) were performed in GraphPad Prism 5. One way ANOVA and Tukey's range test was performed in Python 3.7.4 using scipy (1.2.0) and statsmodels (0.10.2) packages. For statistical analysis of lifespan results, see \"Lifespan Assay\" section above.", "This study did not generate any unique datasets or code." ] },{ "paper_id": "61ad64021b0e34d5e3a82a4310cc92d123a7061c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org/ lookup/suppl/doi:10.1128/mBio.00019-16/-/DCSupplemental. Figure S1 , TIF file, 0.2 MB. " ] },{ "paper_id": "61b8415c8659a58c24af2b8a2456bed96b61b609", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "As-GST-1", "A strategy for the discovery, expression, isolation and preclinical development is being advanced for lead candidate antigens to prevent both ascariasis and trichuriasis.", ". Avoiding the potential allergic responses by down-selecting antigens that elicit IgE among endemic populations.", "Trichuris trichiura is a parasite of the superfamily Trichinelloidea, known as the common whipworm of humans and nonhuman primates. Due to its host specificity, there is no established laboratory animal model for this pathogen. Fortunately, the closely related Trichuris muris parasite, specific for rats and mice, has emerged as a useful surrogate for immunogenicity and efficacy models. Additionally, animal models for Trichinella spiralis (a cause of trichinellosis), also a member of the Trichinelloidea superfamily, exhibit some immunological similarities for Trichuris sp. Both Trichuris sp. and Trichinella sp. possess a unique stichosome -a modified esophagus and esophageal gland that contains longitudinally arranged cells known as stichocytes -which is a rich source of ES Photo courtesy of Florian R\u00f6 ber, originally published in [85] \u00d3 Florian R\u00f6 ber." ] },{ "paper_id": "61c1d57c318f5a10b2d31abd543d55e24d1fa47c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All statistical analyses were performed using the statistical package STATA for Windows (version 11.0). A P-value of .05 was considered to represent statistical significance.", "A score of 1 was added when the subjects had co-morbid myocardial infarction, congestive heart failure, peripheral vascular disease, cerebrovascular disease, dementia, chronic pulmonary disease, connective tissue disease, peptic ulcer disease, mild liver disease, or diabetes without end-organ damage. A score of 2 was added when the subjects had co-morbid hemiplegia, moderate or severe renal disease, diabetes with end-organ damage, tumor without metastases, leukemia, or lymphoma. A score of 3 was added when the subjects had co-morbid moderate or severe liver disease. A score of 6 was added when the subjects had co-morbid metastatic solid tumors or acquired immunodeficiency syndrome. The total score was obtained by adding the relative weight of all comorbidities. For each decade > 40 years of age, a score of 1 is added to the sum of the abovementioned scores. [34] [35] [36] [37] " ] },{ "paper_id": "61c74b574c1b33ece0ca2f53861597d70c61a720", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "and to facilitate implementation of CID policy in the PHSs regions.", "Because of limited experience with and exposure of infectious disease, extensive investment in developing protocols and training in, for example, donning and doffing of personal protective equipment was necessary. \"The fear of contamination, we really were afraid that the fear of EVD would cause more casualties than EVD itself.\" \"It took us months to install the correct personal protective equipment procedures.\" Peripheral hospital", "The EVD laboratory tests were negative for all patients, and alternative confirmed diagnoses were malaria (n = 7), bacterial sepsis (1), norovirus (1), and no diagnosis (4) ." ] },{ "paper_id": "61d0aa9a148a88e0354e36508c925eeb87a6b685", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "61d252869a226c4393e4637cb90fa3b4df082ae3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "61f4cc62aa5a8b65d63664101a7e4af71a7c1df4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6214d0592f9322221375a64360716a1cae0add5f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6220d2580a3a4a5c86ea58944be947b5d4c0bc0b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Consistent with the distal signal being closely related to the CD33, chain di-leucine signal, Ile s could be modified to leucine without loss of activity. Interestingly, the nonconservative mutation of Pro ~5 to leucine did not reduce the internaliTation activity of the membrane-proximal signal (Table HI) .", "Immunoprecipitates were quantitated on a model 425 Phos-phorImager (Molecular Dynamics). The data shown are from one of two similar experiments." ] },{ "paper_id": "62219dc0553022e4faac2b1523e7e0a2d1eaec30", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Abbreviations: AST = aspartate transferase, MELD-Na = model for end-stage liver disease with incorporation of serum-sodium.", "The general, socioenvironmental, and clinical factors of 263 patients were as follows ( " ] },{ "paper_id": "622504276a8cd63e834d19f7b3c26ca4c2bbcb40", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For epon embedded sections animals were perfused with 4% paraformaldehyde and 2.5% glutaraldehyde in Sorensons phosphate buffer. Spinal cord segments were placed in fixative overnight, post fixed in Osmium tetroxide, and processed to Epon by standard procedures. Cross-sections of cervical, thoracic, and lumbar cord segments were cut on an ultramicrotome at a thickness of 1 micron and stained with toluidine blue.", "This is an open access article under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made. 2106 V C 2015 The Authors. Glia Published by Wiley Periodicals, Inc. enhances astrocyte migration, and improves functional recovery (Okada et al., 2006) .", "Morphological differences in focal versus expanding lesions were examined in Epon embedded sections at day 31 p.i. (Fig. 3C,D) . Demyelination was confined to relatively small areas at the outer perimeter of the WT spinal cord (Fig. 3C ). Debris filled macrophage/microglia were not prominent 2110", "Volume 63, No. 11 TCTCGGCCTGTT-3 0 ; Arginase-1 (Arg-1) sense, 5 0 -TGGGTG GATGCTCACACTGA-3 0 , Arg-1 antisense, 5 0 -CAGGTTGC CCATGCAGATT-3 0 ; IL-1 receptor antagonist (IL-1Ran) sense, 5 0 -AGATAGACATGGTGCCTATTGACCTT-3 0 , IL-1Ran antisense, 5 0 -CATCTCCAGACTTGGCACAAGA-3 0 . For IFN-g (Mm01168 134_m1) and GAPDH (Mm99999915_g1) expression levels were determined using Applied Biosystems gene expression arrays with Universal TaqMan Fast master mix (Applied Biosystems). PCR conditions were 20s at 958C followed by 40 cycles of 958C for 3 s and 608C for 30 s. Transcript levels were calculated relative to the levels of the housekeeping gene GAPDH using the formula 2 [CT (GAPDH) -CT(target gene)] 3 1,000 where C T is determined as the threshold cycle at which the fluorescent signal becomes significantly higher than that of the background." ] },{ "paper_id": "626bcea8ab6811ee19f946cb84a273601cfd7bcc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u2022 General practitioners are the first line of defense against antibiotic resistance within communities.", "\u2022 Antibiotic resistance mechanisms in general practice are diverse.", "This publication was supported by a Horizon2020 EU grant under grant agreement GA-633780 ('DIAGORAS' -www.diagoras.eu)." ] },{ "paper_id": "62cd5be77a70a55d18199836987e521d4b992cbd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In some TCRs, the two different orientations (a-P2A-b and b-P2A-a) resulted in nearly equal expression. This similarity between orientations was primarily observed in TCRs with the highest TCR V beta expression (.25% of CD8 T cells). These TCRs may be particularly stable and thus expression is not influenced so significantly by endogenous TCRs. The end result is that a majority of the TCR cassettes have an optimal orientation and testing both can be an easy solution that significantly increases expression.", "PBMC were stimulated with 600 U/ml interleukin-2 (IL-2; R&D Systems) and 50 ng/ml anti-CD3 (OKT-3; eBioscience, San Diego, CA) for 48 h. Untreated 24 well tissue culture plates were coated with 30 ug/ml Retronectin (Takara Bio) overnight at 4uC one day prior to transduction. Wells were then washed with HBSS and blocked with PBS 2% BSA. Lymphocytes were harvested, washed, counted and 5 3 10 5 cells plated into retronectin coated wells and mixed with 1.5-2 ml of unconcentrated retroviral supernatants collected as described above. After 24 h, the viral supernatant was replaced with Aim-V medium with 2% human AB serum, supplemented with 100 U/ml IL-2. TCR surface expression was tested with HLA-pentamers (ProImmune), HLA-tetramer produced by peptide exchange 39 or anti-Vb antibodies 72 h post transduction. Functionality of TCR redirected T cells was tested 7 days post transduction as described below.", "We then tested whether the inflammatory environment led to increased Th1 polarization or caused non-specific bystander activation to account for the increase in IFN-c1 T cells. Unlike figure 4 , where HLA-pentamer and IFN-c staining were performed in separate assays, we measured IFN-c production in HLA pentamer1 or TCR Vbeta1 cells to measure cytokine production in TCR transduced cells." ] },{ "paper_id": "62d641575bf71e839a2c4f4c7a6dc398ef2b5a0a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Animal Model Exp Med. 2018;1:247-249.", "None." ] },{ "paper_id": "62f47ced8c3249f702f0058dc3b6cdb93ca083eb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Note that 5S rRNA, tRNA and miRNA are pseudoknot-free.", "KnotSeeker due to the inclusion of pseudoknots with one interrupted stem.", "DotKnot has excellent accuracy for simple H-type pseudoknots as those reported in many viral 3 0 -UTRs and frameshifting regions. We found that the energy models CC06 and CC09 used for predicting such " ] },{ "paper_id": "62f8fe75756cfe9bee96096f566d79994b7ff5de", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors report no conflict of interest in this work.", "Finding novel therapeutics to treat and cure diseases is a fundamental challenge in biomedical research due to the high cost and failure rate. Drug repositioning is considered a promising strategy to revitalize the slowing drug discovery pipeline due to shorter development time and lower failure and toxicity risks. Although drug repositioning has its intrinsic limitations, it represents an alternative pathway to achieve therapeutic success in the postgenomic era." ] },{ "paper_id": "630a6b5851e9d6362eb68f157fa704bfd97f1705", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6328beb961554b05276359e9c5b26d2e57cd52e9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The Journal of Cell Biology, Volume 102, 1986 2154", "Parallel immunoprecipitations of detergent extracts with antibodies directed against either u or K chains demonstrated that excess free heavy or light chains were detectable immediately after synthesis (Fig. 4, lanes 4 and 6) and not at later times (Fig. 4, lanes 2, 3, 8, and 12) appeared complete as early as 30 min after synthesis, since the ratio of Um:K at this and all later times of chase (Fig. 4 , lanes 8-15) closely resembled the steady-state ratio of the two polypeptides (data not shown). These results indicated that in our pulse-chase experiments, we were examining assembled IgM molecules rather than a pool of free ~mS blocked in transport in rough ER due to a deficiency of association with K light chains. Similar rates of intracellular transport of urnS have been suggested for IgM molecules synthesized in murine spleen cell populations (60) .", "Oligonucleotide-directed mutagenesis was" ] },{ "paper_id": "632bcacf9702ee34c5424827ab7e5449dd21ddcf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All ethical issues including plagiarism, Informed Consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc have been completely observed by the authors.", "Respiratory virus infections in children are a leading cause of morbidity and mortality worldwide. Methods: A total of 897 clinical specimens were collected from February 2007 to January 2008 and transported to the National Influenza Center. Two hundred and two samples belonged to children under the age of six from 897 specimens, described above, were selected. Then they were tested for influenza virus types and subtypes by real time PCR assay subsequently, the specimens were tested for RSV and hMPV by hemi-nested multiplex PCR and parainfluenza viruses type 1-4 by hemi-nested multiplex PCR and adenovirus by hemi-nested PCR. Results: The throat swab was taken from the Kawasaki case with the history of chicken`s contact. The specimen was tested for all influenza subtypes especially H5N1 and the results were negative. Meanwhile PCR was done for screening of other respiratory viruses that results came out positive for RSV and hMPV. Conclusion: In the present study, we demonstrated the possibility to detect dual infection caused by RSV and hMPV, but because of the extravagant pattern of this case, more investigation is suggested specially on Kawasaki patients.", "In the present study, we demonstrated the possibility to detect dual infection which caused by RSV and hMPV. Due to the lack of sensitivity of conventional methods detection of co-infections with different respiratory viruses had been un-derestimated (13) . Severe RSV bronchiolitis in small patient series had been recognized because of co-infection with other viral pathogens (14) . Some previous studies have lighted up increased clinical severity in case of dual infection caused by RSV and hMPV (8, 9) . Greensill et al. observed a 70% co-infection rate with HMPV and RSV and a 90% co-infection rate among intubated infants with hMPV and RSV admitted to their PICU (8) . Although Greensill et al. did not include an appropriate control group in their study, these findings suggest that co-infection with both hMPV and RSV is common and that together the two viruses may contribute to increase the severity of disease (9, 14) . Whereas in other reports hMPV did not contribute to the severity of RSV infection (15, 16) . The basis of the pathogenesis of severe RSV disease is multifactorial. Since severe RSV disease may develop in apparently healthy children, known host risk factors cannot completely account for instances of severe illness. Preexisting or maternally acquired immunity, innate immunity, viral factors and genotypes and environment all likely contribute to disease pathogenesis. We detected co-infection of hMPV and RSV in Kawasaki patient without special respiratory sign and symptoms, we could not find the patient to follow up her and study more about the immunity status and other possibilities of this scenario. More investigation is suggested specially on Kawasaki patients to detect the viral pathogens." ] },{ "paper_id": "634128ea7d7736750e1c3cd0a48bb37843d06dac", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cooccurrence. Patterns of association/disassociation were explored with the Fortran software program PAIRS (11) , utilizing the C score statistic as our measure of species cooccurrence. PAIRS implements a Bayesian approach (Bayes M criterion) to detect nonrandom associations between pairs of species (12) .", "viruses can exist in a single sample. Not only does this reveal information about the carrying capacity and composition of discrete viral niches within an individual bat, it also demonstrates the number of different viruses that could potentially spill over to a new host from a single exposure event.", "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00598-13/-/DCSupplemental. Text S1, DOCX file, 0.1 MB. Figure S1 , PDF file, 0.1 MB. Figure S2 , PDF file, 0.3 MB. Table S1 , PDF file, 0.6 MB.", "All analyses were conducted with the fossil package (62) implemented in R (63). We followed Chao et al. (10) to calculate how many additional samples would be required to detect any proportion (including 100%) of the asymptotic virus richness. All statistics were incorporated into a single plot." ] },{ "paper_id": "636a2debbb56c9142bbf960d9a200665c556e05a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "637939a0f462b9e821ff62fc20e9fedfe78df73e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The ethical approval or individual consent was not applicable.", "Not applicable. ", "All data and materials used in this work were publicly available." ] },{ "paper_id": "6380762dca586738fd20d4b1c4bbdc3722a313aa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "638c624925ed19a692dcd98a7285191537b1c7c0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "63aed9fa99e7df7846c24993fbf4d7aebb4d957a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A demyelinating disease induced in Dr. Friedrich's current address is Brookdale", "A segment of each spinal cord was excised with a sterile razor blade before glial cell isolation. Segments were fixed by overnight immersion in 1% glutaraldehyde and 2% paraformaldehyde in 0.1 M phosphate buffer. The tissue was then washed for 1 d in buffer, postfixed with 2 % osmium tetmxide for 2 h, dehydrated in graded alcohols, cleared with propylene oxide, and embedded in Epon resin. Transverse sections (1 ~m) were stained with toluidine blue.", "Female C57B1/6N mice, without prior exposure to MHV-A59, were obtained from the Frederick Cancer Research Facility (Frederick, MD). At 28 d of age each mouse was injected intracranially with 1,000 plaqueforming units of coronavirus (MI-IV-A59), which had been propagated in the 17 CI 1 line of spontaneously transformed BALB/c 3T3 cells (Sturman et al., 1980) . This age and inoculation dosage op \"ttmized the proportion of mice developing demyelinating lesions ('069 %) relative to the incidence of acute mortality (,o11%)." ] },{ "paper_id": "63c64ba93501a9ec60ab113b55c23d5bc602a13c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Finally, a filter referred to as the replicate combination filter is applied, wherein results from two independent replicates are combined and SNPs present in both the experiments are accepted. This step is performed after the other filters have been applied to individual data sets generated for any single sample.", "Whole-genome sequencing is probably the most accurate and reliable method to identify and type strains of a species. SNPs and other polymorphisms that serve as informative genetic characters are globally determined and therefore enable a more complete evaluation of inferred evolutionary relationships. The cumulative differences between two or more sequences provide a larger framework upon which reliable phylogenies may be established. Strain genotypes that are built upon SNP variation are highly amenable to evolutionary reconstruction and can be readily analyzed in a phylogenetic and a population genetic context to: (i) assign unknown strains into well-characterized clusters, (ii) reveal closely related siblings of a particular strain and (iii) examine the prevalence of a specific allele in a population of closely related strains that may in turn correlate with phenotypic features of the infectious agent (1) . More directly and for a variety of purposes such as forensic investigations or epidemiological investigations, SNPs provide potential markers for the purpose of strain identification.", "Detection, identification and typing of infectious microorganisms are crucial in many areas of basic and translational research. There is an urgent need for accurate, high-resolution microbial genotyping methods, in spite of the existence of a number of widely used typing methods. That is because the current methods offer only low-resolution and limited genotyping. Single nucleotide polymorphisms (SNPs), horizontal gene transfer and/or intragenic recombination are all known to lead to variations and genome plasticity in an organism. The diversity of an organism can be explicitly understood provided these events are identified and analyzed quantitatively and qualitatively at the whole-genome level." ] },{ "paper_id": "64026e37a33880c07a23deabc68e8e0d8d790c59", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Leishmaniasis is a disease caused by the protozoa Leishmania, which affects 12 million and threatens 350 million people in 88 different countries. There can be different clinical presentations such as cutaneous and visceral (42) . Leishmaniasis is transmitted by the vector phebotomine sandflies. When rural migrants bring their domesticated animals to urban settings, often slums, they create favourable conditions for an urban transmission (43) . It has been shown that it is a growing health problem and the ongoing urbanization has contributed to the increase (44) .", "The rapid urbanization has also interfered in previously untouched ecosystems. These new settlements create new and closer encounters with wildlife, which can be a potential source of zoonotic diseases. These can be both previously known or new pathogens, which make the shift from their animal host to generate infections in humans. Surveillance is of primary importance to monitor the burden of disease and will give both local authorities and the global community a chance for a quick response to public health threats. ", "The zoonotic disease dengue is endemic in most tropical and subtropical regions, which often are also popular tourist destinations. Travellers to endemic countries can contribute to the spread of the disease. The burden of disease is on the rise, and estimations are that in returning travellers from Southeast Asia, dengue is now a more frequent cause of febrile illness compared to malaria (49) . Dengue is now an urban health problem, which is one of the major reasons why the rise is exceptional." ] },{ "paper_id": "64212980bf5953f369ec10e8a54517ec6ce10227", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Inflammatory bowel disease (IBD) has been long ago recognized as a systemic inflammatory entity and as such, it is anticipated to induce changes exceeding the boundaries of bowel mucosa, being reflected in a broader spectrum of tissues, including blood [1] [2] [3] [4] [5] [6] [7] .", "AHSG serum levels were determined in treatment-na\u00efve newly-diagnosed patients, 96 with ulcerative colitis (UC), 84 with Crohn's disease (CD), 62 with diarrheapredominant or mixed irritable bowel syndrome (IBS, D-and M-types) and 180 healthy controls (HC), by an enzyme linked immunosorbent assay (ELISA).", "To investigate the impact of inflammatory bowel disease (IBD) on \u03b12-Heremans-Schmid Glycoprotein (AHSG/fetuin A) and potential associations with disease and patient characteristics." ] },{ "paper_id": "643f2dd329f342e9e85753ab315722bc1120d0ef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "On admission, he was fully conscious and oriented. Vital signs showed a blood pressure of 88/51 mmHg, heart rate of 97 beats/min, respiratory rate of 27 breaths/min, and body temperature of 38.7 o C. His heart beat was regular without murmurs, and breath sounds were clear on both lung fields. His abdomen was soft and flat with normoactive bowel sounds. However, there was tenderness in the right upper quadrant region and hepatomegaly of 3 fingerbreadths and splenomegaly of 1 fingerbreadth were palpated below the costal margins. Erythematous maculopapular skin rashes without pruritis were observed on both lower extremities. Neurologic examination was normal.", "Initial laboratory exams showed a hemoglobin of 13.1 g/dL, hematocrit 37.0%, white blood cell (WBC) count of 6,310/mm 3 Chest radiography conducted on admission was normal without any lesions in the lung (Fig. 1) . Computed tomography (CT) scans of the abdominal revealed mild hepatomegaly with periportal edema ( Fig. 2A) . Diffuse edematous change of the gallbladder and small amount of ascites was also found on CT images (Fig. 2B) .", "The patient was followed at the outpatient clinic two weeks after discharge. Laboratory exams showed normalization of levels that were above normal range prior to discharge, revealing a CRP of 0.03 mg/dL, AST of 33 IU/L, ALT of 24 IU/L, CK of 87 IU/L, LD of 412 IU/L. Serum antibodies to M. pneumoniae detected by ELISA were 79.6 AU/mL for IgG, and 2.6 index value for IgM, confirming the diagnosis of M. pneumoniae infection." ] },{ "paper_id": "64531e8dca54414b55f67981cd6e67b77fe8c43c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All tissues were fixed in 10% neutral-buffered formalin, routinely processed and embedded in paraffin wax. Tissue sections of 4 \u00b5m-thick were stained with hematoxylin and eosin (HE). Selected brain sections were subjected to immunohistochemical examinations. Normal feline brain tissue was also stained as a control. Deparaffinized and rehydrated sections were treated through the antigen retrieval methods listed in Table 2 . After being immersed in 3% hydrogen peroxide in methanol at room temperature for 5 min, the sections were treated with 8% skim milk at 37\u00b0C for 40 min. The sections were then incubated with the primary antibodies listed in Table 2 at 4\u00b0C overnight, and then incubated with the Dako EnVision + System horseradish peroxidase (HRP)labelled anti-rabbit (Dako-Japan, Tokyo, Japan) or anti-mouse secondary antibodies (Dako-Japan) at 37\u00b0C for 40 min. The antigenantibody reaction was visualized with 0.05% 3.3\u2032-diaminobenzidine and 0.03% hydrogen peroxide in tris-hydrochloric buffer. Counterstaining was performed with hematoxylin." ] },{ "paper_id": "645a3eaa114cc4a4827d02c0ef31b8a19c45b802", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "647f5293613f9be827c37bb609d3248db9889d78", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Anemia-anaemiaimmun* 723", "Anemia-anaemiaimmun*-inclusion 248", "Anemia-anaemiaimmun*-inclusion 181" ] },{ "paper_id": "6485112a971484dfa041b32b35b25707954807db", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The intracellular transport of newly synthe-", "A summary is presented in Tables II and III of Bars, 100 nm.", "Received for publication 19 January 1988, and in revised form 19 October 1988." ] },{ "paper_id": "649b681845a59b87d339917c75ef51c6c55b3a46", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We have used the sedimentation behavior of catalase and thyroglobulin in parallel gradients as markers to get an estimate of the size of M/S complexes. These proteins peaked in fractions 13 and 12, respectively (data not shown). This indicates that most complexes migrated as structures with sedimentation values higher than 20S.", "When the m A b a M was used instead, coprecipitation of labeled S was not observed immediately, but only after 10-20 min of chase. Later, the amount of coprecipitated S, including its cleaved form S/gp90, gradually increased. These observations indicate that S associated with M before its processing to the mature forms S/gpl80 and S/gp90. M and S thus engage in complex formation at different rates: M rapidly associates with S, while S does so only after a considerable lag time. This implies that newly synthesized M molecules associate with S molecules already present.", "Under conditions of analysis, the stability of the envelope glycoprotein complexes is critically dependent on the detergents used for their solubilization. M-S interactions are preserved in a combination of NP-40 and sodium deoxycholate. Several observations indicated that M/S complexes do not form nonspecifically after solubilization. First, other proteins were not significantly coprecipitated with M and S. Second, newly synthesized S started to associate with M only after a lag time of about 20 min. Third, M/S complexes were not formed upon mixing lysates containing M and S that had been separately expressed. Moreover, flotation analysis ruled out the possibility that M and S were coisolated as part of detergent-insoluble membranes (data not shown). Collectively, these data provide evidence for the existence and specificity of M-S interactions.", "If these interpretations were correct, the M and S proteins would be incorporated into virus particles with different kinetics. We therefore performed a pulse-chase labeling of infected cells and monitored the appearance of labeled proteins in extracellular virus. Because MHV is assembled intracellularly, such an analysis provides an indirect measurement of the kinetics of incorporation of newly synthesized proteins into virus particles. Virus was purified by pelleting and analyzed by SDS-PAGE (Fig. 3 A) . The results of the quantifications of the radioactivities in the bands representing M and S (S/gp180 + S/gp90) are shown in Fig. 3 B." ] },{ "paper_id": "64b6854e48706ee2c77c4450292e72d11b7e4252", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Imperiale MJ, Casadevall A. 2015. The importance of virology at a time of great need and great jeopardy. mBio 6(2):e00236-15.", "Despite all this good news, much remains to be done. It was recently estimated that there are 320,000 mammalian viruses (2), many of which may have the potential for human transmission. Even if only a small fraction of these viruses can jump into humans and cause disease, humanity is living under a tremendous threat from viral zoonoses. Less expensive drugs are needed for treating those with viral infections such as hepatitis C. While the HPV vaccine can prevent many infections, there are viral types that are not covered by the vaccine, and many millions of people were infected before the vaccine came on the market. Infections with numerous other viruses are not treatable due to the lack of effective antivirals. Clearly, vaccines against HIV, hepatitis C, and Ebola, to name a few, would save countless lives. New pathogens continue to emerge, and existing nonviral pathogens become resistant to common antibiotics. Hence, we are living at a time of great need for the discipline of virology.", "We think that the field of virology and, by extension, the field of microbiology are at a critical crossroads. Funding for research in the United States and elsewhere is stagnant, if not losing pace with inflation. Working with the most pathogenic organisms requires even higher costs and is heavily regulated. Some senior scientists are rethinking their career choices, and there is growing concern that young scientists will be discouraged from entering the field, especially in areas of controversial research, such as studies of the transmissibility of highly pathogenic influenza viruses (3). While some have argued that virology is a dying field, that assertion has been elegantly refuted by Dan DiMaio (4). Adding to these stresses, scientists and society are struggling with a new antiintellectual movement that challenges scientific conclusions, from anthropomorphically induced climate change to the absence of any link between vaccines and autism. The rise of antivaccine movements is of particular concern to society, for reduced vaccination rates threaten to undermine some of the greatest accomplishments of virology and public health in the 20th century. The combination of reduced funding, increased regulation, experimental controversies, and the emerging antiscience intellectual milieu is a toxic blend that makes this time one of great jeopardy for virology." ] },{ "paper_id": "64d31d4587a86108556e52c45e1ea3750fa7303f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The JEE process in Taiwan in 2016 involved the participation of at least 19 government agencies or institutions.", "The key to success in achieving such large-scale multisectoral collaborations for JEE is the 10-month preparatory work beforehand: advocacy of the One Health concept among stakeholders, sensitization of high-level political leadership across levels and agencies, and the Taiwan government's strong commitment to transparency and accountability.", "At the end of the pilot visit, the 3 experts and Taiwan's JEE working group discussed next steps, jointly planned for work to be completed before the experts' next visit in June 2016, and developed a proposed agenda for the next visit." ] },{ "paper_id": "653ebe846e79113660523aeb3d87942c3890cd05", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "65648f466638ba2c4b63d49a1c46e834719890a5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "656804baa38b83efc3fbbc24cbc19b89e6d778f0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u2022 We also outline the current knowledge of existing IAV proteins and the role of alternative splicing and frameshift in their formation. The potential functions of these proteins, if known, are also discussed.", "The IAVs are among the fastest evolving families of viruses [6] and are notable for their ability to rapidly change from one season to the next or even within seasons [7] . Over the course of a few generations, the virus can change sufficiently to become virulent. Like many emerging infectious diseases such as Ebola virus or severe acute respiratory syndrome (SARS) [8] , IAV depends on animal reservoirs, where they can reside [9] [10] [11] [12] [13] and transfer between species that share the same environment [14] . As one major reservoir involves migratory birds [15] , the potential to rapidly spread an infection throughout the world is of major concern and IAV is under constant watch (http://www.who.int/ csr/don/archive/year/en/). During the past 100 years, there have been three major epidemics with extensive fatalities [16] and one minor one (mostly because of quick action from the WHO and health practitioners) [17, 18] , the Spanish flu (1918, H1N1, 75 million fatalities worldwide), the Asian flu (1957, H2N2, 2 million fatalities), the Hong Kong flu (1968, H3N2, 1 million fatalities) and more recently the swine flu (2009, H1N1, 14 000 fatalities).", "Function unknown but may be an important protein factor for adaptation to new hosts [31] clear how the vRNPs combine in the filamentous virion; however, it seems reasonable that the filamentous-shaped virus also preserves this '7 \u00fe 1' pattern.", "\u2022 In this work, we summarize our current understanding of the structural aspects of transcription and replication." ] },{ "paper_id": "657558034931a24e09f761877fed36cb70f4f6fe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "use, and it is a powerful tool for the control of PED. However, virus variability and co-infections of PEDV with other enteric viruses are unpredictable. These factors make it difficult to understand and control PEDV infections. Therefore, future work should continue to trace the variability of PEDV strains and co-infections of other enteric viruses, improve PEDV vaccines using variant strains as candidates and elucidate the pathogenicity of PEDV variant strains.", "Porcine epidemic diarrhea (PED) is a highly contagious, intestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV). The disease is characterized by severe diarrhea, vomiting and dehydration. PEDV infections can occur in pigs of all ages, and infections are most serious in piglets, with morbidity and mortality often reaching 100% [9, 40] . Pigs that tolerate PEDV infections usually exhibit growth retardation, reduced food conversion rates, increased feeding costs and the co-occurrence of other diseases. Furthermore, PEDV infections result in reduced pig slaughter rates, insufficient pork supplies and pork price instability, because of a large number of piglet deaths.", "Recently, a large number of studies of PEDV have provided an in-depth understanding of PEDV infections in the pig population in China. In particular, a trivalent live vaccine for viral diarrheal diseases of swine has been authorized for (b) Fast neighbor-joining (NJ) tree (1,000 replicates, Kimura two-parameter distance) constructed using the recombinant region of each potential recombinant event; (c) Fast neighbor-joining (NJ) tree (1,000 replicates, Kimura two-parameter distance) constructed using the non-recombinant region of each potential recombinant event.", "Porcine epidemic diarrhea (PED) is an intestinal infectious disease caused by porcine epidemic diarrhea virus (PEDV); manifestations of the disease are diarrhea, vomiting and dehydration. Starting from the end of 2010, a PED outbreak occurred in several pig-producing provinces in southern China. Subsequently, the disease spread throughout the country and caused enormous economic losses to the pork industry. Accumulating studies demonstrated that new PEDV variants that appeared in China were responsible for the PED outbreak. In the current mini-review, we summarize PEDV epidemiology and vaccination in China.", "Genetically engineered vaccines: Mucosal immunity plays an important role in the immune mechanism of viral diarrheal diseases. Immunoglobulin A (IgA) antibodies secreted by the intestinal mucosa can defend against invading pathogens. Oral vaccines can stimulate mucosal immunity and produce protective mucosal and serum IgA antibodies, and they are an effective method for prevention of intestinal infectious diseases. For PEDV oral vaccines, Hou et al. reported that lactic acid bacteria expressing the PEDV N protein could activate the production of mucosal IgA and circulating IgG antibodies against the PEDV N protein [16] . Ge et al. reported that recombinant lactobacilli expressing * Group was defined based on the phylogenetic tree of S1 gene of the selected PEDV strains in our study (see Fig. 2 )." ] },{ "paper_id": "65a29504e9fb777dea5b6642112095999a8892ec", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Initial phases were improved by mutation of the sequence to poly-Ala followed by \"atoms update and refinement\" mode of ARP/wARP (Perrakis et al., 2001) . Symmetry operators were applied to the first monomer to create the two trimers. The structure was refined with iterative cycles of manual model-building using COOT (Emsley and Cowtan, 2004) , restrained refinement with REFMAC5 (Murshudov et al., 1997) and density improvement with ARP/wARP as the correct sequence was gradually built into the improving electron density maps. Data collection and final refinement statistics are summarised in Table 1 .", "N-CEACAM1 was manually docked into its putative binding site (the hydrophobic patch identified from the crystal structure) on UspA1 (527-665) using guidance from the mutational data of both components and visual inspection of shape complementarity. This model complex was then soaked with a 5 \u00c5 layer of water and relaxed with 2000 steps of conjugate gradient energy minimisation and the CVFF forcefield. Multiple 0.1 ns molecular dynamics simulations of UspA1 -with none, one and two N-CEACAM1s bound -were performed at 300 K under 12 different initial random velocities to investigate possible bending of the coiled-coil. A representative example of each is shown in Supplementary data 6. InsightII 2005/ Discover 2.98 (Accelrys) were used to view, manipulate molecules and for the molecular mechanics calculations.", "Bacterial cells were disrupted with 0.5mm glass beads at 48000 oscillations per minute for 30 sec in a mini-bead beater\u2122 (Biospec Products Inc. OK, USA). Unruptured bacteria were removed by centrifugation (2500g, 5 min), bacterial membranes were collected by ultracentrifugation (30,000g, 30 min at 4 o C) and suspended in PBS. Samples (5 \u00b5l) of envelopes, either native or pre-incubated with N-CEACAM1 (2.5 ng/ml) were applied to glow-discharged collodion coated copper grids. The grids were then washed by placing face down on two consecutive drops of sterile filtered water and negatively stained using 1% methylamine tungstate. The grids were viewed using an FEI CM10 EM operated at 80KV. Images were recorded at 39,000 x magnification on Kodak 4489 film with the first zero of the contrast transfer function in the range 20 -25\u00c5." ] },{ "paper_id": "65d508add328dceec3427a9bc54cff552b6a2271", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "662b7fe72aeb5beee387582742e087253b27201c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "663f66630b5b3b7914dcbcaed555d5865da925dd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Here, we report our experience in EQA carried out during this MERS-CoV outbreak." ] },{ "paper_id": "66b67940ae16f657fd93fad230081d20d98c55f7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(i) A respiration rate greater than 30 breaths per minute, dyspnea;", "(ii) Treatment recommendations for patients in severe or critical conditions:", "\u2022 Noninvasive ventilation for 2 hours first, withdrawn gradually when the patient shows better signs." ] },{ "paper_id": "6708dd7c675e9a967e9f5487cd3f3b6bc225775a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "2.", "3.", ", ,", ", (personal protective equipment, PPE) [11] ." ] },{ "paper_id": "671e9e8a89727d0b94d1798c56f5120c63c83617", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. Descriptive statistics were performed, with continuous variables summarized as median and range, and categorical variables summarized as frequencies and proportions. The statistical significance between various groups was tested using the x 2 -test or Fisher exact test for categorical variables and independent t test or nonparametric test for continuous variables. A two-sided P value of less than 0.05 was considered to be statistically significant. Analyses were performed using SPSS version 11.5 (SPSS).", "SAFV strains accession numbers. The sequences obtained from the study were submitted to NCBI with the GenBank Accession Numbers KJ944637-KJ944718. The genomic sequences were assembled using Lasergene's DNA SeqMan software (version 7.1.0, DNA Star Inc. Madison, WI, USA). The MEGA program (version 6.0, Sudhir Kumar, Arizona State University) was used for alignments and phylogenetic tree construction by maximum likelihood method using 1000 bootstrap pseudo replicates. Nucleotide identities among strains were calculated using BioEdit (version 7.13, www.mbio.ncsu.edu/bioedit/bioedit.html).", "myocardium of a previously healthy child who experienced sudden death, suggesting that the virus might cause serious invasive infection in children 25 ." ] },{ "paper_id": "671f008a0c8884f741c6500eb243db4d06391004", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Relative rescue activity was calculated as described (Chang and Gould, 1998) .", "The yeast strain BY3168 (Vidal et al., 1996) was used for all dihybrid assays. Pairs of plasmids, one encoding the appropriate binding domain (BD) fusion, the other encoding the appropriate AD fusion, were used to transform the yeast to leucine and tryptophan prototrophy. After selection, the modified strains were incubated at 30 \u040a C for 2 d, transferred to BA-85 membranes (Schleicher and Schuell), grown for an additional 2 d, and assayed for \u2424 -galactosidase activity.", "For blot overlay assays, all in vitro transcription/translation reactions were performed using TNT rabbit reticulocyte lysates (Promega). 5 g of 6xHis-PEX19 and a nonspecific control protein (XECI, a nuclear enoyl-CoA isomerase) were resolved by SDS-PAGE electrophoresis and transferred to PVDF membrane. The membrane was blocked for 2 h at room temperature in buffer A (500 mM Tris-HCl, pH 7.5, 50 mM NaCl, 100 mM sodium acetate, 100 mM KCl, 1 mM DTT, 5 mM MgCl 2 , 1 mM EDTA, 0.3% Tween 20, 0.1 mM ZnCl 2 , 5% milk, 0.1 M methionine). The membrane was incubated for 2 h at room temperature with 5 ml of buffer A containing 35 S-labeled PMPs that had been synthesized in vitro, washed, and exposed to film. For far Western analysis, membranes containing 5 g of each protein were blocked as before, incubated with 10 ml of buffer A containing 2 g of purified 6xHis-PEX14, washed, and probed with affinity-purified anti-PEX14 antibodies.", "Preparation of rat liver postnuclear supernatant, separation of the peripheral nervous system by Nycodenz centrifugation and assay of marker enzymes were performed as described previously using a 15-45% Nycodenz gradient (Mihalik, 1992) . For differential centrifugation analysis, a rat liver was homogenized, a postnuclear supernatant was generated, and then spun at 25,000 g for 30 min. This supernatant was removed and subjected to further centrifugation at 200,000 g for 1 h. Equal proportions of the resulting homogenate, supernatants, and pellets were processed for immunoblot with anti-PEX19 antibodies. For the differential release assay, GM5756-T fibroblasts were harvested by trypsinization, washed, and divided into seven equal fractions. The cells were gently resuspended in 100 l of STE (10 mM Tris, 1 mM EDTA, 250 mM sucrose) that was adjusted to various concentrations of digitonin (0, 50, 100, 200, 300, and 400 g/ml) or 400 g/ml digitonin and 1% Triton X-100. After a 10-min incubation on ice, clarified supernatants were generated by centrifugation and analyzed by immunoblot. All immunoblots were performed using HRPconjugated secondary antibodies and chemiluminescent detection (Amersham)." ] },{ "paper_id": "674e4b0b5ce420b596a783bf0d9d7fccc5a76403", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The data was analyzed using descriptive statistics and analyzed using Statistical Package for Social Science Software version 22.0 (SPSS Inc, Chicago, IL, USA).", "Yes n (%)" ] },{ "paper_id": "6755e8b9e6792097d1be5bdf0041c3df1980ec60", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Brefeldin-A was either the generous gift of Dr. R. Klausner (National Institutes of Health) or purchased from Epicenter Bioteclmolngy (Madison, WI). RCA-I agarose, 3-[(3-cholamidopmpyl)dimethylammonio]-l-propanesulfonate (CHAPS), galactosyltransferase, ~-galactosidase, and deoxymannojirimycin (dMM) were from Sigma Chemical Co. (St. Louis, MO). Pentamannosyl phospbate-Sepharose and L/maxflovus slug lectin-Aifigel were prepared as described (17, 34) .", "Protein was determined according to the method of Bradford (5) using BSA as standard. Autoradiograms were quantified using a densitometer (model 300A; Molecular Dynamics, Sunnyvale, CA). Neuraminidase treatment of man6P receptors was carried out using Arthrobacter ureafaciens neuraminidase as described (17) .", "Cells were labeled with [35S]methionine and cysteine (Translabel; Amersham Corp., Arlington Heights, IL) at 0.1 mCi/ml in aMEM lacking cysteine and methionine but containing 10% dialyzed FCS. Chase periods were initiated by washing cells twice in TD (25 mM \"Iris C1, pH 7.4, 5.4 mM KC1, 137 mM NaC1, 0.3 mM NazHPO4), followed by addition of complete media. After the times indicated, cells were washed once in ice-cold TD and lysed with 1.0 ml RIPA buffer (50 mM Tris HCI pH 7.2, 0.15 M NaCI, 1% Triton X-100, 1% deoxyeholate, 0,1% SDS, and 0.1% gelatin). Lysates were centrifuged at 330000 g for 10 rain in a centrifuge (model TL-100; Beckman Instruments, Fullerton, CA). Suspension cells were labeled at a density of ~2 x l(P/ml." ] },{ "paper_id": "67595d2304315ae4af47ec96fbd42c55bd6855e2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "c According to RDP II database, release 9.60.", "ORMA scripts were developed under Matlab 6.1 (Mathworks, Natick, MA, USA) environment (Release 12.1). No additional toolboxes are required. All statistical analyses and representations were made by the same software. Probe designs and simulations were run onto a hp Workstation xw4100, with a Dual-core 3.2 GHz. Intel Processor and 2.5 GB RAM. ORMA functions and m-code are available for free upon request.", "a Clonal DNA from environmental sample." ] },{ "paper_id": "67629939944591734aa3934d4a2c9aadf49ccedf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Militaries and nonstate actors alike are using health interventions to serve their political aims in conflict situations.", "Tropical Medicine, University of London, London, United Kingdom (Kelley Lee).", "Conflict of interest: none declared." ] },{ "paper_id": "679aafff5a2403fb48ab7bf416b6d5d97c02b798", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors report no conflicts of interest in this work.", "The initial cases of MERS-CoV were detected among patients admitted with severe community-acquired pneumonia and the ", "People working with camels such as farm workers, slaughterhouse workers, and veterinarians may be at higher risk of MERS-CoV infection than other people. 39 Goats, cows, sheep, water buffalo, and birds were negative for antibodies to MERS-CoV. 16, 31, 39 Thus, so far no other animal link has been identified apart from camels and bats. 40, 41 " ] },{ "paper_id": "67a52569919632f4bf58782538ff24838ac7f26c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Pre-DCm019", "Pre-DCm009", "Pre-DCm020" ] },{ "paper_id": "67a530bb1b7075edffe904df66644b0a1da97d1f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "67c79979c388cfcad87bb12d0ea644699500d736", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "67db14be4e5b68f4d42496330429a1d86266a161", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "avian influenza / epidemiology / poultry farming / spatial analysis / Thailand", "All data were integrated into a geographical database and geoprocessing was carried out with the Spatial Analyst extension of ArcGIS software v. 9 " ] },{ "paper_id": "67f40427adfd7f712e114a8f5da4a33158fc9f37", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We thank David I. Meyer and Christian Zwieb for helpful discussion and comments. We also thank Annie Steiner for typing this manuscript." ] },{ "paper_id": "6803ffb755ca44defc371b10e0ad52ccdbb67108", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A recent case report in Saudi Arabia has led to the discovery of a sixth new coronavirus. The patient had pneumonia and acute respiratory distress syndrome with multi-organ dysfunction syndrome and died 11 days after admission [7] . This has also been recently referred to as the Middle East respiratory syndrome coronavirus.", "All guidelines recommend severity scoring tools in conjunction with clinical assessment in adult communityacquired pneumonia management, although controversy remains about which scoring system to use and when to use it.", "Abbreviations ATS-IDSA, American Thoracic Society-Infectious Diseases Society of America; BTS, British Thoracic Society; COPD, chronic obstructive pulmonary disease; HCoV-EMC, Human Coronavirus-Erasmus Medical Center; ICU, intensive care unit; LBP, lipopolysaccharide-binding protein; proADM, pro-adrenomedullin; PSI, pneumonia severity index." ] },{ "paper_id": "680adbe0c280f4774383793afb8b70fd9ab3d5d0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All clinical samples from suspected patients were cultured on plates of Sabouraud glucose agar (Merck, Darmstadt, Germany), with chloramphenicol and cycloheximide (SCC). The plates were incubated for 4 -6 weeks at 28\u00b0C. All colonies were examined macroscopically and microscopically in Lactophenol Cotton Blue. The Trichophyton species were identified based on microscopic morphology and in vitro tests including urease and hair perforating tests, as required.", "Purified PCR products (1 \u00b5L) were mixed with 2 U Pfu (1 \u00b5L) DNA ligase (Bioneer ISO 13485, Alameda, CA, USA) and 1 \u00b5L of padlock probe in 500 mM Tris-HCl (pH 7.5), 50 mM KCl, 100 mM MgCl2, 2.5 \u00b5L/mL bovine serum albumin (pH 7.5), 10 mM ATP, and 50 mM DTT with a total reaction volume of 10 \u03bcL. Multiple cycle ligations were conducted with one cycle of denaturation at 94\u00b0C of 5 min, followed by five cycles at 94\u00b0C for 30 s and 4 min of ligation at 62\u00b0C. ", "RCA reactions were performed in a 25-\u03bcL volume containing 8 U of Bst DNA Polymerase (New England BioLabs, Ipswich, MA, USA), 200 \u00b5M deoxynucleoside triphosphate mix, 1 \u00b5L of each RCA primer, and 2 \u00b5L of ligation product. Probe signals were amplified by incubation at 65\u00b0C for 60 min and 85\u00b0C for 2 min, and the accumulation of doublestranded DNA products was detected by electrophoresis on 1% agarose containing ethidium bromide (Sigma, St. Louis, MO, USA). Ladder-like patterns were interpreted as positive reactions, while negative reactions showed no illumination." ] },{ "paper_id": "687611906b82bcee9941de1cf6543e8e7871da06", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "68ad2dd709c43428a872d1d91ff37534082da3f7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "68c6921af95469f234a2405a9234d5c5e9695bb8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "68e2c47647afe4bf0237d9f17bb7787738fc8663", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "BHZC36972_Beihai_picobirna-like_virus_10", "BHJJX25356_Beihai_picobirna-like_virus_1", "Lysoka_picobirna-like_virus_P16-366*" ] },{ "paper_id": "68f9d17b3481fc9b2466a48716d7e977ca9bbfad", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This method is an isothermal template amplification technique that can be used to detect trace amounts of DNA or RNA of a particular sequence (Becton Dickinson and Company, Sparks, MD). In its current format, strand displacement amplification occurs in two phases, target generation and exponential target amplification [22] .", "For more information, it can see the article entitled \"Human papillomavirus (HPV) genotyping: automation and application in routine laboratory testing\".", "The author declares that they have no competing interests.", "These techniques use enzyme-mediated processes, in which the enzymes synthesize several copies of target nucleic acid. The amplification products are detected by two oligonucleotide primers that bind to complementary sequences. The final result is the production of millions of copies of the targeted sequence. There is possibility of contamination, so false positive results must be reduced through special laboratory design, practices and workflow." ] },{ "paper_id": "6909d7db535645308e0b2e726b5dea3b854a1aa5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00884-14/-/DCSupplemental. ", "Arabia, where the index case and the majority of cases of MERS have been reported. Citation Alagaili AN, Briese T, Mishra N, Kapoor V, Sameroff SC, de Wit E, Munster VJ, Hensley LE, Zalmout IS, Kapoor A, Epstein JH, Karesh WB, Daszak P, Mohammed OB, Lipkin WI. 2014. Middle East respiratory syndrome coronavirus infection in dromedary camels in Saudi Arabia. mBio 5(2):e00884-14." ] },{ "paper_id": "6931b5e9ff438fd47df998904ce32f6f027514e8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6979d40067c7917b6b92917ff8c3db8a440f5f4c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "I am indebted to the Canadian Institutes of Health Research (grant # MOP82921) for funding our proteomics research. I also wish to thank Kerstin Radtke for excellent suggestions and Daniel Henaff for critical reading of the manuscript.", "Moreover, ICP0 interacts with the host cyclin D3 (Kawaguchi et al., 1997) . However, it was recently reported that stress, rather than the cell cycle per se, may be a critical feature (Bringhurst and Schaffer, 2006) . Clearly, the interaction of herpesviruses with the cell proliferation apparatus is complex and likely involves several host and viral proteins. Identifying novel players that might be incorporated into mature virions may thus be very useful to clarify this process.", "Interestingly, HSV-1 does not require cells to be in the S-phase and even arrests the cell cycle at the G1/S transition step (Shadan et al., 1994; Song et al., 2000) , which partly explains why it can grow in non-dividing neurons. While the precise mechanism of this arrest is unclear, it is known that the viral ICP0 protein and the VP16 cellular partner HCF modulate the cell cycle (Hobbs and DeLuca, 1999; Lomonte and Everett, 1999; Piluso et al., 2002) .", "An interesting scenario is the possible regulation of apoptosis by host proteins loaded onto viral particles. Apoptosis is regulated both negatively and positively by several viruses (Teodoro and Branton, 1997; Goodkin et al., 2004) , presumably to insure their survival at the early stages of the infection but their efficient release later on. Conceptually, the presence of anti-apoptotic proteins in herpes particles might thus provide a mean to quickly evade death upon entry, while the presence of pro-apoptotic proteins on newly assembled/enveloped viral particles may trigger or stimulate their extracellular release. Only further work will resolve this open question." ] },{ "paper_id": "69ca8c0a79935fbe985f02fc53c1a9da5c42acd3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The protocol of the current study was reviewed and approved by the Institutional Review Board (IRB No 2015-11-134) of each institution and was conducted in accordance with the declaration of Helsinki. Written informed consent was obtained from all participants. " ] },{ "paper_id": "69ec8583af7713749c3c85d5a3eb5e506196150b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6a14ff1798aa6ca90d45bab127740593ab37fac3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Grip strength is measured non-invasively by taking advantage of the mouse's instinctive tendency to grab as they are gently pulled backward. This method can be used to test for limb grip using a horizontal bar with small diameter 0.1 cm which is attached to a force transducer. The advantages are that the grip strength is reproducible and can be measured repeatedly in rodents to detect progressive motor deficits, value of therapy and genetic modifications [16] . Mean latency to fall was determined with a maximum cut-off at 60 s.", "This task is used to assess sensorimotor function and balance in rodents.", "Protein extracts from cortex brain were mixed with equal volumes of SDS buffer (0.125 M Tris-HCl, pH 6.8, 2% SDS, 0.5% (v/v) 2-mercaptoethanol, 1% bromophenol blue and 19% glycerol) and then boiled for 5 min. Protein concentration was determined using a modified Lowry method [17] . Proteins were separated by SDS-PAGE gels and transferred to nitrocellulose membranes using standard techniques." ] },{ "paper_id": "6a2d45016115d187120a5c232f671df30422870b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Descriptive statistics were used to explore and analyse the association between host and environmental factors and viruses with nasal microbiota. Assuming non-normal distribution, Kruskal-Wallis and Wilcoxon-signed rank sum tests were used. Fisher's exact tests, Chi-squared tests and enrichment analyses [22] were employed where appropriate. Associations between clusters and symptoms were evaluated using logistic regression analyses and adjusted for season and age. A p-value of <0.05 was considered statistically significant. Statistical analyses were performed using Stata 11 software (StataCorp. 2009. Stata Statistical Software: Release 11; StataCorp LP, College Station, TX, USA) and Matlab 2015b (The MathWorks, Inc., Natick, MA, USA)." ] },{ "paper_id": "6a3c7595bc8fa30e3f74fd3d350d7cb7e3a1668b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In conclusion, we propose a novel model to describe -1 PRF, in which three tRNAs are involved. A detailed understanding of -1 PRF mechanism should contribute to the development of novel anti-frameshift agents that affect the replication capacity of viruses, such as HIV-1.", "Present address: Dominic Dulude, Centre de recherche, Ho\u02c6pital Ste-Justine, 3175, chemin de la Co\u02c6te-Ste-Catherine,", "Frameshift assays in eukaryotes were monitored by transient transfection of the dual-luciferase plasmids (pDual-HIV derivatives) into human embryonic kidney 293T cells (HEK293T) maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% (v/v) FBS (Wisent), with 2 \u00c2 10 5 cells/well seeded in 6-well plates. Two mg of plasmids were diluted in 3% of the initial culture volume in fresh serum-free medium and mixed with an equivalent volume containing 5 mg of PEI (polyethylenimine, Polysciences Inc.). The mixture was incubated for 15 min at room temperature prior to the addition to cell culture. Cells were cultured for 48 h before being washed twice with 2 ml of PBS, and lysed with 450 ml of the Cell Passive Lysis Buffer 1X (Promega). Fluc versus Rluc activities of each construct were measured for 10 s as relative light units (RLU) with an EG&G Berthold Lumat LB 9507 luminometer, using a non-commercial dualluciferase enzyme assay system (48) ." ] },{ "paper_id": "6a8fc2a90c03d2ade186c1a30777f5e56dc174a0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A single attribute a has L a levels. A single set of policy/ outcome options contains A attributes in all, and so the information about the set is contained in the object (l 1 , l 2 , . . . , l A ). To facilitate analysis, the information is reformulated as a vector of dummy variables,", "Contributors Conceived the study: ARC, MICC, EAF. Oversaw data collection: EAF. Performed analyses: ARC, XZ. Wrote the paper: ARC, XZ, MICC, EAF.", "Each pair contains the same attributes but different levels of each attribute; the attributes and levels used are found in table 2." ] },{ "paper_id": "6aa4476feb03bb59ab1cd8452bb48c77c9816a73", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis was performed using one-way analysis of variance (ANOVA) with GraphPad Prism software. The p-value of <0.05 was considered statistically significant.", "Western blot was performed according to the protocols described in Molecular Cloning: A Laboratory Manual (Sambrook and Russell, 2001). Each sample was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12% acrylamide gel and transferred electrophoretically to a PVDF membrane. The primary antibodies used were anti-Flag (Sigma), anti-HIV-1 p24 (Santacruz), anti-Fluc (Cal Biochem, USA), anti-glyceraldehyde 3-phosphate dehydrogenase (GAPDH), anti-beta-actin (abcam), anti-RFP polyclonal, and anti-GFP monoclonal (Clontech/Takara Bio Co, USA). The secondary antibodies used were HRP-goat anti-mouse IgG conjugate and HRP-goat anti-rabbit IgG conjugate (Zymed, USA). Specific protein bands were developed using LAS-4000 (Fujifilm, Japan). The density of each band was analyzed using the software Image J (32).", "The amounts of p24 in each sample were determined using an HIV-1 p24 ELISA kit following the manufacturer's protocol (Xpressbio). Coated monoclonal antibodies against p24 epitopes were used in this kit to detect p24." ] },{ "paper_id": "6aaf920479e8c440f99cd8a14a3e9ebd9250d15f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u2022 Influenza pseudotypes can be employed to determine which proteases are involved in haemagglutinin activation of individual subtypes.", "\u2022 TMPRSS2 functions in effecting the activation, presumably by cleavage, of Group-2 influenza A virus haemagglutinins to produce high-titre influenza pseudotypes.", "\u2022 Group-2 influenza pseudotype particles are neutralized by matched or related reference antisera." ] },{ "paper_id": "6ae4586f198b9710e0285939e265149fbdb3bdab", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6b881730788724e674806854f0c20fec32ee9d96", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We see several barriers to realizing the goal of active, on-theground surveillance and early detection of viruses with epidemic potential.", "These authors contributed equally to this work." ] },{ "paper_id": "6bb0038a55ff68a2f47a36e8c845126da7fea61b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. The viability and cytokine assay results are presented as the mean \u00b1 standard deviation (n=3). All CdCl 2 -treated cell data are presented as a percentage value compared with the untreated control cells (100%). The data were analyzed for significance by Dunnet's multiple comparison test, using GraphPad Prism software version 3.0 (GraphPad Software Inc., San Diego, CA, USA). P<0.05 was considered to indicate a statistically significant difference.", "Protein estimation. The protein concentration of the cell lysates were determined using a Bicinchoninic Acid Protein Assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA) with bovine serum albumin as a standard protein. The protein standards and working reagents were prepared, according to the manufacturer's instructions. In triplicate eppendorf tubes, 25 \u00b5l standard or lysate sample were added. The working reagent (500 \u00b5l) was added to each tube, incubated at 37\u02daC for 30 min and was subsequently measured at 562 nm in a Beckman spectrophotometer (Beckman Coulter, Inc., Fullerton, CA, USA). The concentration of the lysate samples were determined using the standard curve.", "Chemicals. The F12 K medium, penicillin/streptomycin antibiotic solution (100X), fetal bovine serum (FBS), trypsin-EDTA solution (1X), amphotericin B (1,000X), phosphate-buffered saline without calcium and magnesium, CdCl 2 , 25% glutaraldehyde and crystal violet were purchased from Sigma-Aldrich (St. Louis, MO, USA). The human IL-10 (cat. no. ELH-IL10-001) and human IL-1\u03b1 (cat. no. ELH-IL1alpha-001) enzyme-linked immunosorbent assay (ELISA) kits were purchased from Ray Biotech, Inc. (Norcross, GA, USA)." ] },{ "paper_id": "6bb631f4a1c7c8c53d07c971b5e52a2563c66106", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No other viruses were isolated from specimens, and PCR was also negative for all specimens from cases 1 and 2 when tested for bovine viral diarrhea virus [27] , bovine coronavirus [26] , rotavirus [3, 10, 25] , bovine torovirus [11] , bovine enterovirus [12] , paramyxoviruses [24] , bovine adenovirus [14] and bovine herpesvirus 4 [1] .", "Neutralization test for paired sera of case 2: A significant increase in antibody against 24-100 strain was confirmed by neutralizing tests using paired sera. Neutralizing titers in sera collected during the acute phase of infection were less than 1:2, but increased to 1:4 during the convalescent phase.", "Although the standard method for detecting antibodies to Chlamydiaceae spp. in animals is still the complement fixation test [18] , our study showed that a neutralization test was also a useful method for diagnosis of C. pecorum infections." ] },{ "paper_id": "6bbd4c83266579a2afbe995cf64f3200d4d4cb7b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Newly identified sequences were aligned with kobuvirus reference sequences from NCBI database using ClustalW (Larkin et al. 2007 ). We used SSE V1.3 software to calculate uncorrected distance of new sequences against reference sequences (Simmonds 2012 ", "Supplementary data are available at Virus Evolution online. ", "Conflict of interest: None declared." ] },{ "paper_id": "6bc66c3abc451b39ae1bba08b1f1ff3f7e7f5b95", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6bc8969058239852857384c5a87a7e75f41193b6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6bd2dac1db0e974c27b6b7b5a17aaab35fc8d36c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6bd9a619434c6c57efe77c253b97c31d98369b02", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Subsequently, the patient could feed orally without complications. The patient was hospitalized for two weeks to recover.", "There is limited evidence for other therapies like intravenous immunoglobulin and cyclophosphamide. [1] [2] [3] Rehabilitation and physical therapy role are essential in the management. Children generally have a better outcome than adults with 50% of pediatric cases making a complete recovery by 2 years. 1-3 Yet it is important to remember that M. pneumoniae induced transverse myelitis can result in significant neurological sequalae despite appropriate treatment. 8 Infants tend to have a worse outcome possibly due to inability of their immature nervous system to recover and higher incidence of LETM in this age group. 1 Mortality is associated with respiratory failure and high cervical cord lesions. Risk factors for relapse are female gender and abnormal brain MRI. 1" ] },{ "paper_id": "6bdb41aa63efed5063efbecbb615896b8ea4ae5e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Whole genome sequences were downloaded for all viruses available from the NCBI FTP site ftp://ftp.ncbi.nlm.nih.gov/ genomes/Viruses. Of the 5757 viral genomes, 2548 were RNA viruses with linear genomes, and these were selected for analysis. All 6408 coding regions (annotated with a CDS in Genbank) were analyzed, excluding 291 regions annotated with a \"join\" indicating some form of midsequence frameshift in the established gene such as a ribosomal slippage (leaving 6117 coding regions analyzed).", "This analysis was performed using R (version 3.3.2; R_Core_Team 2016) and required the packages seqinr ", "Supplementary data are available at Molecular Biology and Evolution online." ] },{ "paper_id": "6c3132687a4cd25b59f39f851b6b924c99afe345", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "[CST], Shanghai, China), phosphorylated FAK Tyr576/577 (CST), \u2424-actin (Sigma-Aldrich), and \u2424-tubulin (Sigma-Aldrich) were used. The intensity of the bands was measured using ImageJ software (43) .", "IMPORTANCE", "We are greatly indebted to our colleagues who shared valuable reagents with us, and we are grateful to" ] },{ "paper_id": "6c51eafc88ddf46d27452c1a1b7a009c5341e848", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The PCR product was purified using HiBind DNA spin-column of the E.Z.N.A DNA probe purification kit (Omega) and eluted in ultrapure water. A total amount of 500 ng of each purified PCR product was used for in vitro transcription using the MEGAshortscript T7 kit (Ambion) or the HiScribe TM T7 High Yield RNA Synthesis Kit (NEB). The reactions were performed according to the manufacturer's instructions (1x T7-polymerase buffer, 7.5 mM ATP, 7.5 mM CTP, 7.5 mM GTP, 7.5 mM UTP, 25 U T7-enzyme mix) for at least 5 h at 37 \u2022 C. The DNA template was removed by digestion with 1 l TURBO-DNase for 1 h at 37 \u2022 C. The in vitro transcript was phenol-extracted, ethanol-precipitated and analyzed by electrophoresis in a 10% polyacrylamide-urea gel and subsequent staining with ethidium bromide.", "As one of the rare examples of 5 -UTR-derived sRNAs, the trans-acting attenuator RNA rnTrpL characterized in this study highlights the regulatory potential and the versatility of bacterial mRNA leaders.", "Plasmid constructs were transferred to S. meliloti, A. tumefaciens or B. japonicum by diparental conjugation with E. coli S17-1 as the donor (46) . Bacteria were mixed, washed in saline and spotted onto a sterile membrane filter, which was placed onto a TY plate without antibiotics. After incubation for at least 4 h at 30 \u2022 C, serial dilutions were plated on TY agar with selective antibiotics." ] },{ "paper_id": "6c6b13bdca7f70d6afec7257e4769bb5c10b1a19", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Banerjee S, Chakrabarti A, Jha BK, Weiss SR, Silverman RH. 2014. Cell-type-specific effects of RNase L on viral induction of beta interferon. mBio 5(2):e00856-14.", "Our studies suggest that during viral infections, the OAS/RNase L pathway can either enhance or suppress IFN production, depending on the cell type. IFN regulation by RNase L is suggested to contribute to tissue protection and survival during viral infections.", "The interferon (IFN)-inducible antiviral state is mediated in part by the 2=,5=-oligoadenylate (2-5A) synthetase (OAS)/ RNase L system. 2-5A, produced from ATP by OAS proteins in response to viral double-stranded RNA, binds to and activates RNase L. RNase L restricts viral infections by degrading viral and cellular RNA, inducing autophagy and apoptosis, and producing RNA degradation products that amplify production of type I interferons (IFNs) through RIG-I-like receptors. However, the effects of the OAS/RNase L pathway on IFN induction in different cell types that vary in basal levels of these proteins have not been previously reported. Here we report higher basal expression of both RNase L and OAS in mouse macrophages in compari-" ] },{ "paper_id": "6c7341f17bfd790cdc05b6d1010c63f4f8eb5890", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6ce22e4f892e54b0f6317315b113f3fd46ed7245", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Virchow's classical triad of abnormalities including blood stasis, hypercoagulability and vessel damage has been regarded as the authentic theory for explaining pathogenesis of VTE since 19's century (13) , however, the triad does not fit all clinical profiles.", "Similar to GO analysis, Fisher's exact test was employed for the study of over-representation of selected genes.", "In 2010, we reported a patient who died of SARS developed VTE in multiple organs, which implies the viral infection induced systemic VTE and there is correlation between viral infection and occurrence and VTE (28) ." ] },{ "paper_id": "6d04e85d2c994d73c9a7e2692af91470f407ddeb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Disclosure of potential conflicts of interest James A. Williams has an equity interest in Nature Technology Corporation. Due to this relationship with Nature Technology Corporation, the author acknowledges that there is a potential conflict of interest inherent in the publication of this manuscript and assert that an effort to reduce or eliminate that conflict has been made where possible.", "systems can increase gene expression, as well as, DNA vaccine immunogenicity. Although many of the earliest carrier formulations did not show a significant clinical benefit, more recent studies highlighted herein yielded promising clinical data. As microparticles can be prepared with significant structural diversity (size, surface charge, lipid content), they offer considerable flexibility of vaccine formulation. This allows for optimization of the vaccine based on the specific needs of the clinician.", "The constant emergence, and re-emergence, of known and novel pathogens challenges researchers to develop new vaccination technologies that allow for the rapid development of safe and effective vaccines. Nucleic acid (DNA and RNA) vaccines have characteristics that meet these challenges, including ease of production, scalability, consistency between lots, storage, and safety. DNA vaccine technology usually is based on bacterial plasmids that encode the polypeptide sequence of candidate antigens. The encoded antigen is expressed under a strong eukaryotic promoter, yielding high levels of transgene expression. 1 Inclusion of transcriptional enhancers, such as Intron A, enhance the rate of polyadenylation and nuclear transport of messenger RNA (mRNA). 2 The vaccine plasmids are generally produced in bacterial culture, purified, and then used to inoculate the host." ] },{ "paper_id": "6d16e166279a7d116a78a21d4bd4c00b505a617e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6d28097d6542b0b34f34ca4d2359856cc461b5f5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The median duration of ILI episodes was 15 days. No clear patterns were seen in terms of episode duration according to virus type, although the numbers were small (data not shown).", "rhinovirus/enterovirus (40%). Dyspnea and wheezing were most frequent in RSV infections (51% and 46%, respectively). Cough was present in >90% for all virus types.", "Supplementary materials are available at The Journal of Infectious Diseases online (http://jid.oxfordjournals.org/). Supplementary materials consist of data provided by the author that are published to benefit the reader. The posted materials are not copyedited. The contents of all supplementary data are the sole responsibility of the authors. Questions or messages regarding errors should be addressed to the author." ] },{ "paper_id": "6d479d399ca496281c8dccc3198cb86d965deb1e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6d53690848c0b900e6d766993d9fefd2c4c27c48", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6d6294ef224683962e08a1059ea4b027b769e5ed", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Total RNA was isolated from each group using the QIAamp viral RNA Mini Kit (Qiagen, Hilden, Germany). Reverse transcription was performed using RNase Inhibitor, M-MLV RT 5\u00d7 Buffer, M-MLV Reverse Transcriptase, Oligo(dT)15 primer, and dNTP mixture manufactured by Promega (Madison, WI, USA), and quantitative real-time PCR was performed using the THUNDERBIRD TM SYBR qPCR Mix (Toyobo, Osaka, Japan) on the CFX96 TM Optics Module (Bio-Rad, Hercules, CA, USA), with the following primers: HRV5\u2032-NCR-up: 5\u2032-TCC TCC GGC CCC TGA ATG-3\u2032, HRV5\u2032-NCR-down: 5\u2032-GAA ACA CGG ACA CCC AAA G-3\u2032, CCL2-up: 5\u2032-TTA AAA ACC TGG ATC GGA ACC AA-3\u2032, CCL2-down: 5\u2032-GCA TTA GCT TCA GAT TTA CGG GT-3\u2032, IL-6 up: 5\u2032-CTG GAG TCA CAG AAG GAG TGG-3\u2032, IL-6 down: 5\u2032-GGT TTG CCG AGT AGA TCT CAA- ", "We used Student's t-test to compare differences between two groups. To compare multiple groups, we carried out oneway ANOVA followed by the Newman-Keuls test. Values of p<0.05 were considered significant at a 95% confidence interval.", "Original Article" ] },{ "paper_id": "6daf14d0342bca1c7e6c9f52a65ba4fa3fe618ba", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Five commercially available hand antiseptics, which were based on propanol and ethanol, were chosen to study the virucidal effects against HBV. These included Sterillium classic pure (100 g contain: 45 g 2-propanol; 30 g 1-propanol; 0.2 g mecetronium ethylsulfate), Manorapid Synergy (100 g contain: 57.6 g ethanol 96%; 10 g 1-propanol), Poly-Alcohol Hand Antisepticum (100 mL contain: 70 mL 2-propanol), Sterillium med (100 g contain: 85 g ethanol) and desderman pure (100 g contain: 78.2 g ethanol 96%; 0.1 g 2-biphenylol).", "Supplementary material and methods" ] },{ "paper_id": "6db877f61327ae24341591d620abda3793639462", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Many laboratories (75%, 30/40) used phosphate-buffered saline for pretreatment of sputum specimens. All reagents for the detection of MERS-CoV were components of ready-made kits, and the PowerChek MERS Real-time PCR Kit (KogeneBiotech, Seoul, Korea) was the most commonly used kit (72.5%, 29/40). Most laboratories used CFX96 (Bio-Rad Laboratories, Hercules, CA, USA) or ABI7500 or 7800 systems (Life Technologies, Carlsbad, CA, USA) for rRT-PCR (85.0%, 34/40) ( Table 4 )." ] },{ "paper_id": "6dfe2e77c8175b3eb38d6fc3ccc440fb81a0e2f0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All HRCT images were reviewed by two chest radiologists with over 10-year working experience (Yang ZG and Li Y) blindly to the clinical information.", "All the patients were kept in supine position and imaged with a 256-detector CT scanner (Revolution CT, GE Healthcare, Milwaukee, Wis) during full expiration and without injection of any contrast. The scanning parameters were as follows: 120 kilovolt peak, 146 mA, 0.28 s gantry rotation, 80-mm collimation, a 360-mm field of view and 512-mm matrix. Images were reconstructed with a high-spatial-resolution algorithm for parenchymal analysis.", "We also recorded the presence of nodules, masses, cavitation or calcification, pleural effusion, lymphadenopathy, and any other abnormalities of the chest images." ] },{ "paper_id": "6e1cd91f28e6a422438a943b5ef37b9911ddad2c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Refer to Web version on PubMed Central for supplementary material.", "Results are from one of two independent experiments, acquiring 2,500 cells per sample each time (**p < 0.01, *** p < 0.005). ", "This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/)." ] },{ "paper_id": "6e33bf088cfbcde318f35f3be8dea6810b0b96ce", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6e4cdb85e0a4e9f66a92f231bba4bb3b91f9f822", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Infectious diseases have caused great catastrophes in human history, as in the example of the plague, which wiped out half of the population in Europe in the 14th century. Ebola virus and H7N9 avian influenza virus are 2 lethal pathogens that we have encountered in the second decade of the 21st century. Ebola infection is currently being seen in West Africa, and H7N9 avian flu appears to have settled in Southeast Asia. This article focuses on the current situation and the future prospects of these potential infectious threats to mankind.", "Three (H7N9, H6N1, and H10N8) avian influenza viruses broke the animal-human barrier in Asia in 2013. 31 One avian influenza case was detected in Taiwan due to H6N1 subtype, whereas 2 of 3 H10N8 human infections observed in China were lethal. 31 However, human infections due to H7N9 have been progressively increasing since its first identification in 2013, and approximately one-third of the H7N9-infected patients died. 31-33 Avian flu had the potential to spread \"silently\" among poultry and H7N9 infections did not cause severe disease in poultry, accordingly. 34 Viral characteristics. Influenza is an infection of birds and mammals caused by RNA viruses from the family of Orthomyxoviridae. There are 2 main types of influenza virus, type A and type B. Type A viruses are the most virulent human pathogens among the other influenza types and cause the most severe disease. Influenza A viruses are divided into subtypes based on the hemagglutinin (H) and the neuraminidase (N) localized on the virus surface. So far, 18 hemagglutinin and 11 neuraminidase subtypes were documented. 35 Influenza B almost exclusively infects humans and is less common than influenza A. 36", "O utbreak is an epidemiological definition to describe an unexpected occurrence of an infection at a certain time and place. It may affect a small and a localized group, or impact on millions of people across continents. Two cases of a linked rare infection can be defined as an outbreak. A revisit through the history discloses that outbreaks were vast, deadly, and basically changed the course of human history. 1 As an example, the plague reshaped the landscape of Europe and the world between 1347 and 1351. During this period, the global population was estimated to be 450 million, and 75 million at a minimum are believed to have perished. Consequently, half of Europe died in a period of 4 years. 2 In the pre-antibiotic era, bacterial outbreaks caused much more mass destruction compared with other outbreaks with different infectious agents. 1 But, this trend changed with the advent of antibiotics and viral outbreaks emerged. We believed that Ebola virus and H7N9 avian influenza virus are the most potential pathogens to cause mass destruction in the world. Thus, in this paper, we will focus on the current outbreaks of these 2 viral infections with the potential to cause mass destruction, and to greatly impact the international travelers." ] },{ "paper_id": "6e4d9a7b61701ca9620df0205d89b7fb8c22f265", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A randomized controlled trial might also be undertaken, although with 1:1 randomization, a statistically significant reduction in mortality from 50% to 25% would require 210 patients, and only half would receive active treatment. Given the known high mortality rate of untreated patients, investigators might instead choose an adaptive trial design. This would minimize the number of untreated placebo subjects and allow different treatment regimens to be tested simultaneously for efficacy and safety.", "It must be emphasized that treating the host response would not prevent or cure Ebola virus infection itself, but it might allow individual patients to survive long enough to develop an immune response that eliminates the virus. These agents could be used in combination with antivirals if they are available.", "Unfortunately, supervising physicians and health officials in Sierra Leone have not released reports of the treatment results, although they exchanged letters and memoranda describing their experience, with one letter noting \"remarkable improvement\" on treatment (O.M.R., unpublished observation). It will be up to others to rigorously review and validate these findings. (22) . Perhaps atorvastatin and irbesartan treatment of some of these patients helps explain the decrease in the Ebola case fatality rate observed at the Hastings Center." ] },{ "paper_id": "6e6e7f0218c6b5affa20bb27bb263517a113f7b1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6e99aa3d7287b2e04d3c2a975ba94212158ac45c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6edbfac15ca59eb0e18859543190088f7a52112e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6f1014ef2ef3a31e4e58cad28dc625df3701ac42", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Finally, it should also be noted here that, owing to the constraints of this study, namely, the paucity of healthy, normal human brain tissue samples and respective available data, the F 1 super variable needs to be further validated with a larger, independent cohort.", "Computer software. All analyses in this study were carried out with custom software written in MATLAB R2012b. All computer programs in connection with the model were also created using MATLAB R2012b.", "Mathematical modeling of aging. Given the aforementioned biovariability in connection with hippocampal gene expression, I wanted to explore whether, via mathematical modeling, I could generate a function that could" ] },{ "paper_id": "6f5c8e7b610ecc3b139756ce244a25c699d33946", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6f64870ea0f8f51525b16926dc6dbb42911f850f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "6fa649c67f566b9bcd0450e3a9614cbd6fddf74c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u00f0\u00c0 log p\u00de k k!", "The candidate taxa are then ranked by this combined P-value.", "sharing the same state for a given probe, and applying Bayes' rule:", "Detection array analysis offers the opportunity to understand microarray behavior in much greater detail, because the samples analyzed are produced from genomic DNA. Sequences are known for many microbial genomes, and standard laboratory techniques exist to measure the concentration of DNA in a sample. Therefore, one can design experiments in which sample DNA molecules with known degrees of similarity to probe sequences are present, at a wide range of known concentrations." ] },{ "paper_id": "6fe5c74868af62cfacb629af957915de0b094af9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Immunofluorescence Assay. Immunofluorescence assays were performed as described previously (46), using primary antibody mouse-\u03b1-G3BP1 (611126, 1:1,000; BD Biosciences), and secondary antibody donkey-\u03b1-mouse-Alexa488 (A-21202, 1:200; Thermo Fisher Scientific).", "Western Blot Analysis. Western blot assays were performed as described previously (46) , using primary antibodies rabbit-\u03b1-puromycin (MABE343, 1:1,000; Merck Millipore), rabbit-\u03b1-eIF2\u03b1 (9722, 1:2,000; Cell Signaling), rabbit-\u03b1-eIF2\u03b1-P (ab32157, 1:1,000; Abcam), or mouse-\u03b1-tubulin (T9026, 1:5,000; Sigma-Aldrich), and secondary antibodies goat-\u03b1-mouse-IRDye680 (1:15,000; LI-COR) or goat-\u03b1-rabbit-IRDye800 (1:15,000; LI-COR)." ] },{ "paper_id": "6ff336c5f099acbe84cf7cfe5f68bd5ba672d6b8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To the best of our knowledge, this is the first report of the direct effects of a PED outbreak on the subsequent numbers of pigs marketed. We are continuously recording the production parameters of these herds with our data-recording system PigINFO and plan to investigate the potential risk factors for PED outbreaks. Sporadic PED continues to occur in 2015, and the strict biosecurity measures against PED must be strengthened because PED outbreaks cause serious economic losses.", "Although many case reports have described PED outbreaks and compared PED viruses genetically, very little information is available regarding the effects of PED outbreaks on swine productivity and economic factors. The objective of this study was to summarize the characteristics of the PED infections in the second epidemic in Japan using data from herds belonging to the clients of consulting veterinarians. We also investigated the effects of the herd-level PED status on productivity using a data recording system (PigINFO) recently developed for Japanese swine producers [17] .", "In Japan, PED was first confirmed at one swine farm in 1982 [14] . In 1996, a large PED epidemic occurred in 102 affected herds, and 39,539 pigs died [10] . From 1997 to 2006, only sporadic cases of PED were reported (1-3 cases/ year), and no cases were reported from 2007 to 2012 [10] . On 1 October 2013, a new case of PED was reported in a herd located in Okinawa Prefecture. From December 2013 to February 2014, the first PED epidemic (0-25 cases/week) was reported, primarily involving herds located on the southern island of Japan. From March to June 2014, a more severe PED epidemic (5-100 cases/week) was reported among herds throughout Japan [10] . By the end of August, these two PED epidemics had affected 817 herds, detected in 38 prefectures [9] and caused serious economic damage to the swine industry, as in the United States." ] },{ "paper_id": "6ff8826ca04c185f3a88ab4b0d5a912aea4ab1a6", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We have shown that these TNT-PNA probes hybridize quantitatively and specifically to their targets and that the probes perform reliably over a wide dynamic range providing a new platform for multiplexed and quantitative genomic analysis.", "Biotinylated, fully complementary target 50-mer oligodeoxyribonucleotides for the hybridization experiments were synthesized by Yorkshire Bioscience (York, UK) on a 1-mmol scale. Target sequences are shown in Table 3 .", "FMOC-protected peptides were custom synthesized by PepSyn Ltd (Liverpool, UK) using commercially available FMOC-protected amino acids on a Beckman synthesizer." ] },{ "paper_id": "7037460cc980744603573744bf370ee8f49a4ffe", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Sciences, Foster City, CA, USA, and hold stock interests in the company.", "Drug preparation GS-441524 was provided by Gilead Sciences as a pure and highly stable powder and diluted to a concentration of 10 or 15 mg/ml in 5% ethanol, 30% propylene glycol, 45% PEG 400, 20% water (pH 1.5 with HCI). The mixture was placed in sterile 50 ml glass injection bottles, agitated until in suspension, and then placed in a sonicated water bath for 5-20 mins until clear. The diluted drug was refrigerated and used within 3-4 weeks.", "ORCID iD Niels C Pedersen https://orcid.org/0000-0001-6269-929X" ] },{ "paper_id": "7048d2fc8e7a1daab3747ea6d2257a874a9723b0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "CONFLICT OF INTEREST. The authors declare no conflicts of interest directly relevant to the content of this article. ", "Furthermore, we examined four infectious diseases including Toxoplasma gondii (T. gondii), Feline coronavirus (FCoV), feline leukemia virus (FeLV) and feline immuno-deficiency virus (FIV) that are major diseases of the cat and compared the seroprevalence in feral cats and domesticated cats.", "Testing for antibodies against E. cuniculi was performed using an enzyme-linked immunosorbent assay (ELISA) with glutathione S-transferase fusion polar tube protein 2 as the antigen [16] . Individual cat serum samples diluted to 1:400 and horseradish peroxidase-conjugated goat anti-feline immunoglobulin G antibody (MP Biomedicals, Santa Ana, CA, U.S.A.) diluted to 1:10,000 were used as the first and second antibodies, respectively.", "In cats, clinical disease is reportedly rare [12] . Infections with E. cuniculi occur in subclinically infected cats and may represent a reservoir and potential risk for immunocompromised patients and animals [7, 8] ." ] },{ "paper_id": "707804d48dc9d8ebd7016536cf785c6c0be25bf8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "70785546b2ab863782992d42183b0df0a1916ddb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7089e8b9423d428a8e1539366978157492f89f19", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To examine the TL1/PK2 tertiary interaction (13, 16) , antisense-interfered SHAPE (aiSHAPE) strategy has been applied (37) . In this method, displacement of one strand of an RNA duplex by hybridizing an antisense oligonucleotide would disrupt long-distance interactions and would be characterized by enhanced NMIA sensitivity of the displaced nucleotides ( Figure 3A) .", "Locked nucleic acid (LNA)/DNA chimeras were ordered from Exiqon, the sequences of which are provided in Supplementary Table S1. Chimeras were added at 10-fold excess after folding. Samples were subsequently incubated at 37 C for 15 min before NMIA treatment (see earlier in the text). To quantify alterations induced by ai-oligonucleotides, raw data were processed as described earlier in the text. Tertiary interactions were introduced manually into RNAstructure version 5.3 generated models (22) .", "Unlike cellular mRNAs, which only contain translational regulatory motifs, viral RNA genomes have evolved functional regions, which act at different stages of their life cycle. These specific structures, their interactions and association with host proteins and ligands, together orchestrate the multifunctionality of viral RNA genomes. Often, RNA-RNA interactions spanning significant distances (1,2) bring regulatory motifs into proximity, changing our view of a functional viral RNA genome from that of a linear molecule to one whose 3D structure is an important contributor during the life cycle (3, 4) .", "In addition, the apex of the rightmost hairpin showed lowered cleavage intensity as compared with DENV-MINI RNA (Supplementary Figure S2) ." ] },{ "paper_id": "7096c575274ae29d1398ec04938f568e5187c9a1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Student's t test was used for data analysis. P < 0.05 was considered to be statistically significant.", "we tested the infectivity of MERS-CoV after exposure to fed-state simulated gastric fluid (FeSSGF) or fed-state simulated intestinal fluid (FeSSIF), which contains a high concentration of bile salts that solubilize the lipid membrane of enveloped viruses. The results showed that MERS-CoV survived FeSSGF while being less tolerant to FeSSIF. Nevertheless, a small proportion of the virus can survive FeSSIF after treatment for 2 hours. As a control, EV71, a prototype human enterovirus, was generally resistant to all the tested gastrointestinal fluids." ] },{ "paper_id": "709c30173f5cfdd55b8636f71cf76d3788a0553d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Diagnoses: He was diagnosed with PCP, and further evaluations revealed underlying X-linked hyper-IgM syndrome.", "Interventions: He was treated with trimethoprim/sulfamethoxazole for PCP, and eventually received allogeneic hematopoietic cell transplantation for hyper-IgM syndrome.", "Outcomes: Twenty months have passed after transplantation without severe complications." ] },{ "paper_id": "70fd2c4e38970a59c42925daef90f674d7b21302", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There are a handful of case reports on MERS outcomes in other vulnerable populations, including three cases in pregnant women and one in an HIV-positive individual.", "Kinetics of response may also be important. An antibody kinetics study with 17 patients in South Korea (from the same research group that later reported waning antibody titers in patients over a 1-year follow-up) found that most patients produced a robust neutralizing IgG antibody response beginning at about 2 weeks and peaking by about 3 weeks; delayed response was generally correlated with a less favorable prognosis .", "Currently, the main treatment strategy is symptomatic supportive care; mechanical ventilation and ICU admission are usually required for severe cases." ] },{ "paper_id": "71195817c4cfe2c8b7bc13418d2062226a71d0e9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To mitigate the worrying trend of EIDs, the One Health (OH) strategy is expected to gain momentum as a tool to address both associated multisectoral impacts and environmental, animal and human health drivers for their emergence and spread. Major drivers for (re-)emergence of pathogens include increased movements and contacts of people, wildlife and livestock; intensification of livestock production; and low biosecurity in farms and live animal or wet markets (13\u00c115). A main driver of RVF is climate change where El Nino events influence the frequency of outbreaks.", "*Correspondence to: Tabitha Kimani, PO Box 1510-00200 Nairobi, Kenya, Email: mugethikimani@yahoo.com I nfectious diseases are likely to continue emerging and re-emerging in the foreseeable future, with profound negative impacts on multiple sectors and global economies (1) . Zoonoses account for 70% of emerging infectious diseases (EIDs) and 60% of human pathogens/ diseases (2\u00c14). About 80% of human infectious disease pathogens could be used for bioterrorism (5) . Major zoonotic EIDs that have occurred over the last 20 years include bovine spongiform encephalopathy, highly pathogenic avian influenza (HPAI), severe acute respiratory syndrome (6) , Hendra virus disease (7), Nipah virus encephalitis (8) , West Nile fever (9) , pandemic H1N1 influenza (10) , Middle East respiratory syndrome (11) and Ebola (12) . Apart from the EIDs, endemic zoonoses such as Rift Valley fever (RVF) are also of great concern.", "To generate sociograms or visual diagrams of the network, the interval data were binarised where scores 0 and 1\u00c18 were coded as absent '0' and present '1', respectively." ] },{ "paper_id": "711ffbd9492fb8100b4c89fea6842c38682e4410", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Before reverse transcription reaction, all RNA samples were individually treated by Genomic DNA elimination reaction gene was normalized to glyceraldehyde-3-phosphate dehydrogenase (GAPDH). The primer and probe sequences are shown in Table 1 ", "Total RNA was extracted from 12 individual chicken organs (12 kidneys) per group by homogenization in TranZol reagent (TransGen Biotech, China) using a homogenizer under low temperature according to the manufacturer's protocols. RNA was diluted in nuclease-free water, then quantified based on UV spectrophotometry at 260 nm. The integrity of the extracted RNA was confirmed by 0.8% agarose gel electrophoresis.", "All data were analyzed by SPSS (ver. 17.0; SPSS, USA). Data were determined to be normally distributed by the Shapiro-Wilk test. Differences between the control and the affected group were identified by one-way analysis of variance (ANOVA). The results were expressed as the means \u00b1 the standard deviation (SD). Data were considered statistically significant at p \uff1c 0.05." ] },{ "paper_id": "715842fa536064980818ad7e31ce511272a4b6bc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "715fec9052e391ea2d2bd055e7fea736b2882bc7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "71a02ec5050593d346595f2af85aa3ce3b403bdc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "71b1e5b3dcbccd130699fbbdbc537a66a24598bc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "rMERS-CoV-\u232cE could also be used as the starting point to generate an inactivated vaccine in case of an urgent need to control the disease. In order to guarantee the absence of virulent viruses after an incomplete chemical inactivation due to clump formation, potential noninactivated viruses would be propagation defective and, therefore, attenuated.", "The assembled infectious cDNA clone was stable during its propagation in Escherichia coli DH10B cells for more than 200 generations, as determined by restriction endonuclease analysis (data not shown).", "rMERS-CoV-\u232cE, in which one of the nonessential accessory proteins was deleted, could be considered a marker vaccine, as it will allow the sera of field-infected patients to be distinguished from sera of vaccinated patients, based on the lack of antibodies specific for nonessential viral proteins (60) .", "likely have not required hospital assistance. In fact, recent data suggest that mild respiratory illness might also be part of the clinical spectrum of MERS-CoV infection (3) . In addition to mild or acute respiratory illness, other reported clinical symptoms are abdominal pain and diarrhea, fever, and in some cases, renal failure (9) . Many hospitalized cases occurred in persons with chronic underlying medical conditions or immunosuppression (3, 13) . The virus loads are highest in lower respiratory tract samples, although low concentrations of viral RNA can also be found in stool, urine, and blood samples (12) ." ] },{ "paper_id": "71b5ffbc04fa339eed42ead8bb5dd1bf0e471b8f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Three bovine RVA strains (IS1 (G6P [5] ), NCDV (G6P [1] ) and KK3 (G10P [11] )) were subjected to study of sensitivity of detection. An established fetal rhesus monkey cell line (MA-104) was used for virus propagation, and culture fluids were used for tests. The titers of each virus stocks were 10 7.0 TCID 50 /ml. Thirteen fecal samples were taken twice daily from seven beef farms located in Ishikawa Prefecture, Japan, that had an epidemic history of RVA. These specimens were collected between 2012 and 2013 from calves (aged<1 year) that showed watery or sticky diarrhea that was white, yellow or greenish brown.", "Thirteen fecal samples, which were negative for the Dipstick and RT-PCR, were subjected to next-generation DNA sequencing. Bovine RVA reads were recovered from all samples ( Table 2 ). The two of them yielded 155 and 828 reads covering 11 segments (24 and 59 VP1, 17 and 19 VP2, 29 and 94 VP3, 20 and 30 VP4, 13 and 76 VP6, 21 and 73 VP7, 3 and 60 NSP1, 7 and 117 NSP2, 10 and 191 NSP3, 5 and 38 NSP4 and 6 and 72 NSP5 sequences). Mapping the 50-mer short reads of two samples to the reference VP4 and VP7 sequences allowed genotyping of G and P. Almost all of the reads of No. 3 and No. 8 were aligned with G10P [11] and G6P [5] reference sequences, respectively (Fig. 1) .", "We investigated the sensitivity of human rotavirus rapid antigen detection (RAD) kits, RT-PCR and next-generation DNA sequencing (NGS) for detection of bovine group A rotavirus (RVA). The Dipstick 'Eiken' Rota (Dipstick) showed the highest sensitivity out of the seven RAD kits against all selected strains in limited dilution analyses, which was consistent with the results for equine rotavirus previously reported. RT-PCR had 10 0 -10 3 -fold higher sensitivity than the Dipstick. NGS using thirteen RT-PCR-negative fecal samples revealed that all samples yielded RVA reads and especially that two of them covered all 11 genome segments. Moreover, mapping reads to reference sequences allowed genotyping. The NGS would be sensitive and useful for analysis of less dependent on specific primers and screening of genotypes." ] },{ "paper_id": "71b8c50ee0e1f4e79e6618301b768befbf943a5d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cite this article as: Patel S, Shah NM, Malhotra AM, et al. Inflammatory and microbiological associations with near-fatal asthma requiring extracorporeal membrane oxygenation. ERJ Open Res", "We performed a retrospective review of all adult asthmatics requiring mechanical ventilatior and/or ECMO for near-fatal asthma admitted to our single large tertiary hospital between 2011 and 2016. Clinical and demographic data including ventilator parameters, biochemical and immunological indices, and microbiology isolates were recorded. We compared patients requiring ECMO with patients requiring conventional mechanical ventilation only, to identify any factors that were significantly associated with the need for ECMO.", "Extracorporeal membrane oxygenation (ECMO) has developed as a critical tool permitting lung protection in severe respiratory failure. Its use was largely confined to acute respiratory distress syndrome [1]; however, as technology has advanced, it is now used in a range of respiratory diseases, including asthma. In the context of near-fatal asthma exacerbations, ECMO provides a management strategy for difficult-to-ventilate patients who would otherwise be unlikely to survive. Importantly, in asthma, traditional mechanical ventilation strategies can be associated with volutrauma and barotrauma due to the high pressures required in the presence of severe bronchospasm [2] . To date, there is a paucity of data for ECMO use in acute asthma and it is unknown whether specific clinical or inflammatory characteristics are associated with the need for ECMO." ] },{ "paper_id": "71cb2319da3251ef1b4bc99ce5c4ca633b2cb1b9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Enforce laws and regulations that protect health and ensure safety.", "Development of policies and institutional capacity for health planning and management.", "**Skills development and maintenance." ] },{ "paper_id": "71edbd57cdd9af956a12054932e0cbdb87ce1fea", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Men (n=273) Women (n=384)" ] },{ "paper_id": "721b3e6ae8af24a4f625540bbb6e2c02fb77b491", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Escherichia coli strain MAS90 [E. coli K-12, recA1 D(pro-lac) thi ara F 0 : lacI q1 lacZ::Tn5 proAB + ]. Liquid cultures were grown in minimal MOPS media (32) using glycerol as carbon source. Cultures were incubated with shaking at 37 C for at least 10 generations in the log phase prior to being used in frameshift assays.", "All pseudoknots investigated stalled some fraction of the frameshifted ribosomes, however, significantly more ribosomes stalled in the artificial pseudoknots than in those resembling naturally occurring pseudoknots (PK400 and PK401).", "structures more similar to naturally occurring pseudoknots (Figure 1 insert), inspired from structures in the infectious bronchitis virus (22, 28, 30) . The pseudoknot structures in this type of virus are selected for their effects on vertebrate ribosomes, but the stem1 length variations were found to yield approximately the same relative stimulatory effect in E. coli (25) and suggest that stem1 strength is equally important for stimulating bacterial ribosomes to frameshift.", "The in vivo frameshift assays were performed as described previously (25) . Briefly, 1 ml of an exponentially growing culture was induced with Isopropyl b-D-Thiogalactopyranoside (IPTG) to a final concentration of 1 mM at an optical density of 0.4-0.7 measured at 436 nm (OD 436 ). After induction for 15 min, the culture was pulse-labelled with $10 mCi L-[ 35 S]-methionine for 20 s and chased with 100 mg L-methionine for 2 min before being transferred to 25 ml of chloramphenicol (100 mg/ml) on ice. The cells were harvested by centrifugation and proteins were boiled in SDS buffer and separated by 9% SDS-PAGE. The gel was dried and placed on a phosphor imager screen (Molecular Dynamics) and left to expose for 1-3 days. Relative amount of protein of the relevant polypeptides was quantified using ImageQuant software and the frameshift efficiency (e) was determined as follows:" ] },{ "paper_id": "7220982ea4592afc5109160c63d728f1fdaa8373", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Our study provides an opportunity to consider how this strategy might be established.", "diseases. However, the allocation of R&D funding for neoplasms was more than nine times that of musculoskeletal disorders. Neurological disorders, which include Alzheimer's dementia, were ranked second after neoplasm in the MOHW R&D funds.", "The recognition of the importance of non-communicable diseases is growing worldwide, 13,14 including in Korea. In a previous study by Prince, 15 Studies for behavioral risks Behavioral risks \u00b7 Tobacco smoking \u00b7 Alcohol use \u00b7 Diet high in red meat \u00b7 Diet high in processed meat \u00b7 Diet high in sodium \u00b7 Diet low in calcium \u00b7 Diet low in fiber \u00b7 Physical inactivity and low physical activity Socio-economic risks \u00b7 Childhood sexual abuse \u00b7 Intimate partner violence Climate & environmental risks \u00b7 Unimproved water and sanitation \u00b7 Ambient particulate matter pollution \u00b7 Household air pollution from solid fuels \u00b7 Ambient ozone pollution \u00b7 Residential radon \u00b7 Lead exposure" ] },{ "paper_id": "722738d238370488034852a1867cfa04b564d331", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There was no interference by any of following substances: hu-man blood (1:20 dilution), barium sulfate (0.25 mg/mL), loperamide (0.25 mg/mL), metronidazole (0.25 mg/mL), hemoglobin (0.25 mg/mL), bilirubin (0.25 mg/mL), or triglyceride mix (0.25 mg/mL)." ] },{ "paper_id": "723d2ca57cbcc702c68347fb8183376d16d80f1a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "the glucose concentration in the incubation medium was increased from 3.3 to 16.7 mmol/l (Fig. 1) .", "Insulin release. The quantity of insulin released from the INS-1 cells was significantly increased, as expected, when ", "Statistical analysis. Statistical analyses were performed using GraphPad Prism 5 (http://www.graphpad.com/), and data are expressed as means \u00b1 standard error of the mean. One-way analysis of variance followed by Tukey's or Dunnett's tests were used to compare all groups or selected groups to the control and P<0.05 was considered to indicate a statistically significant difference." ] },{ "paper_id": "7248a954a71c38b84dcc81be1105e231728286fc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "www.e-trd.org of the manuscript, or decision to publish.", "Supplementary material can be found in the journal homepage (http://www.e-trd.org)." ] },{ "paper_id": "724a937a58d4217e5d5cc6d1d1e438a5b5b35d6e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "725f0a6590f20c15be0ae719463c0624a34ee1af", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Blood (0.5 mL) was taken from mice of each group through eyeball extraction, and serum was separated by centrifugation at 4000 rpm for 10 min at 4\u00b0C and stored at -80\u00b0C. An ELISA kit Shanghai Jianglai Biotechnology Co., Shanghai, China) was used to measure CXCL5 expression and IL-1b, IL-6, TNF-a, and IL-10 expressions (Shanghai Enzyme-Linked Biotech Co., Shanghai, China) following the manufacturer's protocol. The 96well microplates were read using a microplate reader (Thermo, Waltham, MA) at 450 nm.", "Abbreviations: ARDS -acute respiratory distress syndrome; CXCL5 -Cxc chemokine ligand 5; CXCR2 -Cxc chemokine receptor 2; MMP2 -matrix metalloproteinases 2; MMP9 -matrix metalloproteinases 9; LPS -lipopolysaccharide; UCC -uterine cervix cancer; H&E staining -hematoxylin-eosin staining; W/D -wet-to-dry; ELISA assay -enzyme-linked immunosorbent assay; SDS-PAGE -sulfate polyacrylamide gel electrophoresis; PVDF -polyvinylidene fluoride; TBST -tris-buffered saline plus 0.1% Tween 20", "Full-text PDF: https://www.medscimonit.com/abstract/index/idArt/915835", "Acute respiratory distress syndrome (ARDS) is a common acute and severe disease in clinic. Recent studies indicated that Cxc chemokine ligand 5 (CXCL5), an inflammatory chemokine, was associated with tumorigenesis. The present study investigated the role of the CXCL5/Cxc chemokine receptor 2 (CXCR2) bio-axis in ARDS, and explored the underlying molecular mechanism." ] },{ "paper_id": "72903336c1c94d9acc0491f7aadc93d7365a6934", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "72bf8d8fff5a84e84e219df26f0d4cbdfa0bb15c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Keywords: germanium biotite, immune enhancement, porcine reproductive and respiratory syndrome virus 136 Bock-Gie Jung et al.", "The mice were fed the control or experimental diets for 2 weeks. The animals were then sacrificed and the spleen was collected. The spleens were aseptically removed with scissors and forceps, placed in cold phosphate-buffered saline (PBS), and single-cell suspensions were prepared by pushing the tissue through a 40-\u03bcm nylon mesh (BD Biosciences, USA). Erythrocytes in the cell mixture were destroyed by incubation with Tris-NH 4 Cl. The lymphocytes were washed with PBS twice prior to resuspension in complete medium consisting of RPMI-1640 medium (Lonza, Switzerland) containing 10% (v/v) fetal bovine serum (FBS; Gibco, USA) and 2% (v/v) antibiotic-antimycotic solution (Lonza, Switzerland). Live cells were detected by staining with trypan blue.", "Source and composition of the GB feed supplement GB used in this study as a feed supplement was provided by Seobong Biobestech (Korea). The supplement was composed of silicon dioxide (SiO 2 , 61.90%), aluminum oxide (Al 2 O 3 , 23.19%), iron oxide (Fe 2 O 3 , 3.97%), sodium oxide (Na 2 O, 3.36%), and 36 ppm germanium." ] },{ "paper_id": "72e25d8530d2d778392e2ca2a1ec1b7e13e24a30", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "One set of five mice from control and treated groups were lavaged as described in Poulsen et al. (27) . In brief, a total of 2 mL of 0.9% sterile saline was injected in lungs and was recovered. The BALF was immediately put on ice until further processing. BALF was centrifuged at 4\u00b0C and 400 g for 10 min to collect cells, which were resuspended in 0.5 mL PBS.", "Genes showing expression changes of at least 1.5-fold in either direction compared with their matched controls and showing FDR P \u2264 0.05 were considered as significantly differentially expressed genes (DEGs) and were used in all downstream analyses. All microarray data have been deposited in the NCBI gene expression omnibus database and can be accessed via the accession number GSE81570.", "Supplementary Tables 1 to 7 and Supplementary Figures 1 to 8 ", "Five-to-seven-week-old female C57BL/6 mice (Jackson Laboratory, Bar Harbor, ME, USA) were housed in autoclaved cages with a 12-h light-dark cycle. All mice were given food and water ad libitum throughout the experiment. Animals were weighed before beginning the exposure and once every week during the course of the experiment. Mice were housed in pairs. All animal procedures were conducted in accordance with the guidelines of the Canadian Council for Animal Care and approved by Health Canada's Animal Care Committee." ] },{ "paper_id": "7307753da247144e66cc91b8f48c33e5a9ceff2b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "CONFLICT OF INTEREST. The authors declare no conflicts of interest." ] },{ "paper_id": "731ee91af20f34fccc9866d85a18b787c16bbe1e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(Medicine 95(14):e3014)", "Abbreviations: CAP = community-acquired pneumonia, PBS = phosphate-buffered saline, PCR = polymerase chain reaction, RSV = respiratory syncytial virus.", "Editor: Roman Leischik." ] },{ "paper_id": "7321a41ee2054c07a18ede4e04a420621cb33087", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "734f6b97fbdf729498fe7077f74f49db8311d2b9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "73706c27f129eddf80395baf777ba70dd9432e8e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Labeling with charged topographical markers and affinity studies revealed that S-layers from several Bacillus strains do not possess a net negative charge as demonstrated for the underlying peptidoglycan-containing layer or other bacterial surface structures (S ara & Sleytr, 1987a; Gruber & Sleytr, 1991; S ara et al., 1992) . In native S-layers, carboxyl groups are neutralized by an equal number of amino groups, leading to a charge neutral outer surface (Weigert & S ara, 1995) .", "To summarize, S-layer carrier conjugates are superior vaccine carriers because (1) they elicit DTH and immuno-protective antibody responses without the use of extraneous adjuvants, (2) they can be administered by several different immunization routes (intramuscular, subcutaneous, nasal/oral), and they are immunological unique, which means that antibody and delayed-type hypersensitivity responses to each S-layer are specific and not cross-reactive (Malcolm et al., 1993b) .", "[The copyright line for this article was changed on 7 October 2014 after original online publication]", "Furthermore, S-layers have been suggested to fulfill a protective function for the living cells by excluding hostile lytic enzymes such as muramidases and proteases. However, this could only be confirmed for a few examples.", "Self-assembly products are formed in solution during the dialysis of the disrupting agent against selected buffer solutions (ionic strength and pH). Monitoring the time course of self-assembly by light scattering yielded multiphasic kinetics with a rapid initial phase and slow consecutive processes of higher than second order (Jaenicke et al., 1985) . The rapid phase may be attributed to the formation of oligomeric precursors. Concentrationdependent light scattering measurements gave evidence for a 'critical concentration' of association, suggesting that patches of 12-16 proteins are formed and recrystallize into the final (native) S-layer structure.", "In a recently carried out detailed study using in situ AFM, it was shown that the reassembly of SbpA S-layer proteins from Lysinibacillus sphaericus CCM2177 on mica does not necessarily follow the classical pathway of crystal growth. Instead, a kinetic trap keeping the system at a higher-energy, long-lived transient state may hinder the reassembly into extended matrices . Over time, finally the trapped state transforms into a stable, low energy state. Careful analysis of the time and temperature dependence of formation and transformation yielded an energy difference by only 1.6 kJ mol \u00c01 (or 0.7 kT). But the energy barrier to transform into the final low energy state is 38 times higher (61 kJ mol \u00c01 )." ] },{ "paper_id": "737650f6ab6664da7582430d4b45ff9dd2e76866", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Two review authors independently extracted data and assessed study risk of bias and confidence in effect estimates (certainty of evidence) for each outcome using GRADE (Grades of Recommendation, Assessment, Development and Evaluation). We described results and presented them in GRADE tables." ] },{ "paper_id": "7377d7ad2d731e3fbd3ed4fa15ed541b06e3587c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.", "HLH can also be secondary to other conditions, such as autoimmune disorders (adult-onset of Still's disease) (7), malignancies (particularly T cell lymphomas) (8) , viral, bacterial, fungal, or parasitic infections (4), or immunosuppression (9) .", "Patients with X-linked lymphoproliferative syndrome, a rare disorder that affects males, can develop HLH after infection by the Epstein-Barr virus (10) ." ] },{ "paper_id": "73aa8683fd7c4fd68b73f231b6bc3e609d4e9af9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study", "This study RNA half-life analysis mRNA half-lives were determined in yeast strains containing the rpb1-1 temperature-sensitive mutation and tetO7 promotor substitutions using methods described previously (19) . MF2 and ACT1 band intensities were normalized against SCR1 band intensity (a pol III transcript).", "Cell cultures of cells expressing C-terminally TAP-tagged Dhh1 were centrifuged and 10-ml cell pellet volumes of exponentially growing (OD 600 = 0.5) or post-diauxic shift (OD 600 = 2.0) cells were processed as detailed previously (20) . After elution proteins were then concentrated by TCA precipitation and resolved by SDS-PAGE and stained with Sypro Ruby protein stain. Following excision of Sypro Ruby stained (or control) bands, the gel slices were subjected to in-gel proteolysis with trypsin and peptides were analysed by LC-ESI-MS using a Bruker AmaZon ETD system Data were processed using DataAnalysis (4.3) and searched against SwissProt v57_15 using MASCOT (21) . Figure S8 )." ] },{ "paper_id": "73f48a992c779f349ff5e305afe2f0538699ec33", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "746804f73409212ee4161597d1ebb4fd5e8cd296", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To facilitate efficient infections, viruses have evolved a wide range of evasion strategies, targeting host DNA sensors, adaptor proteins and transcription factors. In this review, the current literature on virus-induced activation of the STING pathway is presented and we discuss recently identified viral evasion mechanisms targeting different steps in this antiviral pathway.", "Cellular sensing of virus-derived nucleic acids is essential for early defenses against virus infections. In recent years, the discovery of DNA sensing proteins, including cyclic GMP-AMP synthase (cGAS) and gamma-interferoninducible protein (IFI16), has led to understanding of how cells evoke strong innate immune responses against incoming pathogens carrying DNA genomes. The signaling stimulated by DNA sensors depends on the adaptor protein STING (stimulator of interferon genes), to enable expression of antiviral proteins, including type I interferon.", "With the accumulating insight into the mechanisms of viral evasion of DNA sensing, there is now a need to understand the importance of these mechanisms in vivo. Further knowledge on the cellular targets and mechanisms of action of viral strategies to evade the DNA sensing machinery will lead to better understanding of the pathogenesis of viral diseases, and could also uncover potential targets for future immunomodulatory drugs." ] },{ "paper_id": "748d4c57fe1acc8d9d97cf574f7dea5296f9386c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Mean measurements (\u03ee standard deviations [SD]) were derived from three separate experiments, unless otherwise indicated. Statistical significance was established by Student's t test or by one-way analysis of variance (ANOVA) with a post hoc Dunnett's test (**, P \u03fd 0.01; ***, P \u03fd 0.001; ****, P \u03fd 0.0001).", "Text S1, DOCX file, 0.01 MB. Figure S1 , TIF file, 0.1 MB. Figure S2 , TIF file, 0.1 MB. Figure S3, " ] },{ "paper_id": "74b7e481670a3a785ee8f82702d4be3b5488eb88", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ginseng is divided into fresh ginseng, white ginseng, and red ginseng depending on the processing method.", "Patients receiving glucosamine sulfate showed improvement in symptoms of pain and stiffness and radiographic findings showed reduced joint space narrowing. 38 After these two long-term studies presented favorable results, glucosamine has attracted much attention in managing osteoarthritis.", "Moreover, they addressed that red ginseng has no favorable effect on DM." ] },{ "paper_id": "74bc0b72bd1e1984f0428c90223d5f9cceda5f22", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Growth inhibition Piboonpocanun et al. (2005) ", "Stimulation of immature DCs by SP-A also inhibits the allostimulation of T cells, enhances dextran endocytosis, and alters DCs chemotaxis toward RANTES (Brinker et al., 2003) .", "Does not enhance phagocytosis Rosseau et al. (1997) Coccidioides posadasii + nd Disrupts levels of pulmonary surfactant Awasthi et al. (2004) Cryptococcus neoformans + Mannose, glucose (requires capsule)" ] },{ "paper_id": "750eb3af6059e879b20beac9fb982f85332dd552", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplementary data are available at DNARES Online.", "In order to visualize the clustering, a principal component analysis (PCA) was applied to project the RSCF vectors to a plane spanned by their first two principal components. In order to visualize the separation between clusters a maximum margin separation line-a line for which the distance between it and the nearest point from either of the groups is maximized, was calculated and plotted." ] },{ "paper_id": "751591a95a9673f692d3a0189ca5a9b0c7e8781c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Since the age of 5 mo, the patient had a history of recurrent fevers (3-5 d/mo) associated with digestive features including diarrhea, abdominal pain without any vomiting, transient cutaneous rash, and intermittent urticaria, initially suggestive of an auto-inflammatory syndrome since no infectious agent was identified. Prior to any supportive treatment, IL-1\u03b2 and TNF\u03b1 were positive, respectively, at 17.9 pg/ml (0-15) and 25.1 pg/ml (0-20), whereas IL-6 and IL-10 were normal and negative. MEFV, MVK, CIAS1, and TRA PS were sequenced and found without any deleterious variation. Anti c1q antibodies were consistently positive, but sequencing of DNA SE1L3 was normal.", "Intravenous Igs at 0.4 g/kg/3 wk were begun at 2 yr 8 mo of age because of recurrent viral infections, resulting in an improvement of her recurrent fever profile, digestive symptoms, and susceptibility to viral infection.", "For viral replication, the Prism 7 software (GraphPad) was used to calculate P values using one-way ANO VA with Dunnett's multiple comparisons, Kruskal-Wallis test with Dunn's multiple comparisons.", "Standard immunological tests were performed. Serum levels of IgG, IgA, and IgM were unremarkable. T and natural killer lymphocyte count were conserved, whereas a modest B lymphocytosis was measured (Table S1 ). Lymphocyte proliferation was normal for PHA, tuberculin, and candidin (n > 50), but low in the presence of tetanus, CMV, and HSV antigens (n > 10; Table S2 ). T and B cell counts were within normal ranges. The patient was IgG seropositive for tetanus, diphtheria, haemophilus, measles, mumps, rubella, and HBV (Ag HBs negative, anti-HBs positive, anti-HBc negative) following routine vaccination. She remained seronegative for HIV1/2, HAV, HCV, VZV, Parvovirus B19, EBV, CMV, and pneumococcus despite proper vaccination for the latter." ] },{ "paper_id": "751764ca73c84e497075d172d6417ea95c1a7e09", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "75251cc3d312b0d2c63117458c68dba563715155", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "St. John's Rehabilitation Centre (SJR) is a 154-bed rehabilitation facility located in Toronto, Ontario, Canada and is a tertiary care teaching hospital affiliated with University of Toronto. The patient population includes cardiac, amputee, stroke, trauma, medical debility, burn and musculoskeletal patients. The average length of stay is approximately 21 days and there are about 2500 admissions per year.", "Interventions Based on comprehensive analysis of prior outbreaks, the following changes were implemented:" ] },{ "paper_id": "75275e1adbc2a3dcb78893dd1cf92d7fcf2915cc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "756dbc931627ce595e70224e084e8cb89d38287c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The computations of RR, RD and WMD were given by the following standard formulas:", "The Table 1 , where anti-SARS formulae were evaluated in ten studies, herb extracts were evaluated in three studies, and other combinations of herbal medicines were evaluated in eleven studies." ] },{ "paper_id": "75fbdec55c05102f8337e48dda0c8b6cf27dac52", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All experiments were approved by the Committees on the Ethics of Animal Experiments of Kitasato University and the University of Tokyo. For immunohistochemistry, 48 samples of canine mammary gland tissue embedded in paraffin blocks were obtained from the histopathological files in the Veterinary Pathology Laboratory, Kitasato University. Although the classification method about simple carcinoma is under controversy [18] , the diagnosis of all specimens was based on the WHO classification [11] . Immunohistochemical staining was performed using the rabbit polyclonal antibodies against human SSTR2 (1:300 dilution, bs-1138R, Bioss, Boston, MA, U.S.A.). Peroxidase-conjugated anti-rabbit immunoglobulin G (Histofine Simple Stain MAX-PO (R), Nichirei, Tokyo, Japan) was used as the secondary antibody. After immunoreaction, sections were colorized with diaminobenzidine and counterstained with hematoxylin. Canine pancreas tissues were used as positive controls. Negative controls were carried out by replacing the primary antibodies with antibody diluents.", "Somatostatin (SST) is a peptide hormone produced in the hypothalamus, pancreas and intestine; it regulates both endocrine and exocrine gland function [17] , and downregulates cell proliferation in various tissues of many species including dogs [1, 3, 4, 10, 14] . Among the SST receptor (SSTR) superfamily, SSTR2 is the most dominant receptor, with the highest affinity to the ligand and the strongest antiproliferative effect [3] . In human breast cancer, tumor tissues that express SSTRs are less aggressive and more differentiated than tumors with little SSTRs expression, which are massive and highly malignant [5] . These findings lead to the speculation that SSTR signal transduction is closely related to the malignancy of human breast cancer.", "In dogs, all subtypes of SSTRs, except SSTR4, have been already identified, and their expression was confirmed in just several tissues, such as pituitary and pancreas [2, 16] . Although SSTRs are predicted to be a molecular target of breast cancer therapy, there is little information about SSTRs in dogs. Hence, in this study, we examined and compared the distribution and expression of SSTR2 in normal canine mammary tissues, benign mammary gland tumor (MGT) and malignant MGT. Immunohistochemistry and Western blotting methods were utilized." ] },{ "paper_id": "760fa9225c5f571c77674f53a1f2d9648eb2adb0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was conducted as a prospective longitudinal observational study." ] },{ "paper_id": "7627a1c7020be9b495eb7345fb3867484d618d78", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "766b9c02fdb5aaeee2c3a399ae9a6d5e179eca8f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Lipkin WI. 2012. Biocontainment in gain-of-function infectious disease research. mBio 3(5):e00290-12.", "The discussion of H5N1 influenza virus gain-of-function research has focused chiefly on its risk-to-benefit ratio. Another key component of risk is the level of containment employed. Work is more expensive and less efficient when pursued at biosafety level 4 (BSL-4) than at BSL-3 or at BSL-3 as modified for work with agricultural pathogens (BSL-3-Ag). However, here too a risk-to-benefit ratio analysis is applicable. BSL-4 procedures mandate daily inspection of facilities and equipment, monitoring of personnel for signs and symptoms of disease, and logs of dates and times that personnel, equipment, supplies, and samples enter and exit containment. These measures are not required at BSL-3 or BSL-3-Ag. Given the implications of inadvertent or deliberate release of high-threat pathogens with pandemic potential, it is imperative that the World Health Organization establish strict criteria for biocontainment that can be fairly applied in the developing world, as well as in more economically developed countries.", "In lieu of a shift to BSL-4, it may be feasible to introduce specific requirements for research at BSL-3-Ag for agents with pandemic potential, particularly research concerned with a gain of function that enhances virulence or transmissibility. Such requirements could be developed by the World Health Organization as an extension of the International Health Regulations circular Laboratory Biorisk Management: Strategic Framework for Management 2012-2016 (6) . Given the implications for humankind, whatever course we pursue must be developed with global consultation and oversight." ] },{ "paper_id": "7680374114c808d702b43749801a6418bc371f42", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "from 0.1 to 20 \u03bcM. All reactions were performed in triplicate and in parallel. The change in FP was measured in the linear range over a period of 0-7 min, with readings recorded every 5 s. The FP measurements were plotted over time, and initial velocities of ISG15-TAMRA cleavage were determined. Michaelis-Menten parameters were calculated using Prism 6 GraphPad Software.", "Swatek et al. www.pnas.org/cgi/content/short/1710617115" ] },{ "paper_id": "7688b1a7662e60226e0011fe6262f6d9114e1906", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Biosensing is an important activity due to myriads of cell signaling pathways and circuits in cells. It is an important component of two-way communication between implanted engineered cells and natural cells of the body. Examples of synthetic biosensing are [9] : (1) Transcriptional biosensors are built by linking environment-responsive promoters to engineered gene circuits for programmed transcription. (2) Translational biosensors are typically built by linking RNA aptamer domains to RNA regulatory domains. (3) Posttranslational biosensors consist of membrane-bound protein receptors that trigger signal transduction cascades.", "In conventional one-way biosensing, a therapeutic substance is released from an implanted device or a genetically engineered cell in response to a programmed mechanism, e.g. release of insulin according to rise of blood glucose level. A two-way communication between the host, enabled by construction of synthetic circuits, can enable more personalized control of adjustment of therapy from implanted cells.", "The ability to control expression in target areas within a genome is important for synthetic biologists who are developing chemical-producing organisms for commercial applications. In Transcription Activator-Like (TAL) Effector Technology, two hypervariable amino acid residues in each repeat recognize 1 bp in the target DNA [10] . Recognition sequences of TAL effectors are predictable. The TAL code is similar to a navigation system for the genome, allowing pinpoint delivery of functional control elements to any specified sequence. The modular protein architecture has enabled the construction of artificial effectors with new specificities. ", "To apply this method to other types of cells, researchers will have to design and synthesize the DNA of choice and develop a system to boot up the genome. These two tasks will have to be accomplished in parallel for every new species. Accuracy in the genetic code is important for engineering of synthetic genes. The J. Craig Venter Institute is currently working on a project with the National Institutes of Health of the USA and Novartis on vaccine production using this technology." ] },{ "paper_id": "76bbd67d210cfbd619123b103b0aa1966857b75a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Frequency of tuberculosis among diabetic patients in the PRC infection and an increased prevalence of latent TB infection. Therefore, improvements in the diagnosis and treatment of MDR-TB are needed. In addition, the incidence of TB is increasing with the increase in DM, chronic diseases such as AIDS, and increased drug resistance. Although over the last 20 years the People's Republic of China has successfully reduced its TB burden with its excellent free China National Tuberculosis Program (incorporating the \"DOTS\" [directly observed treatment + short-course chemotherapy] model for TB control), the disease is still a considerable problem. 22", "We conducted another investigation of DM and TB from January 2003 to December 2012 in our DM clinic at the Chinese PLA General Hospital, Beijing, People's Republic of China (Table 3) , which identified 15,302 ward patients with DM and 758 (4.95%) ward patients with DM + TB in the past 10 years. The number of ward patients with DM increased yearly and the number of ward patients with DM + TB also increased yearly. Our data are in line with a previous report. 20 We also strictly ruled out other risk factors for TB including HIV, steroid use, and immunocompromised states that may coexist in patients with DM and TB. ", "The frequency of TB among patients with DM in the People's Republic of China is about 958 per 100,000 people, which is much higher than that of the general population (78 per 100,000), as reported by the WHO in 2011. 18 Active TB screening in patients with DM may increase earlier detection, facilitating better treatment of TB. It also may improve clinical outcomes with anti-TB treatment and DM routine care. Moreover, early diagnosis of TB in DM patients will reduce the risk of TB transmission. The introduction of active TB screening in DM patients may lead to better use of the well-established DOTS system to monitor, record, and report information about TB patients. Bidirectional screening for DM and TB should be of significant benefit in the People's Republic of China." ] },{ "paper_id": "76cbada4dbb0c067cbffac6a1f1cede25aec708b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We conducted this study in compliance with the principles of the Declaration of Helsinki.", "A pediatric patient was defined as a patient who was younger than 18 years of age. We subdivided the pediatric patients into 3 groups: younger than 1 year of age (infants), 1 to 4 years of age (young children), and 5 to 17 years of age (school-aged children).", "The protocol of this study was reviewed and approved by the Institutional Review Board of Seoul National University Hospital (IRB No. 1511-015-715). The informed consent was waived." ] },{ "paper_id": "76d2990a2663635e195b8a9818f9664872b6d3af", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.01714-14/-/DCSupplemental. Table S1 , DOCX file, 0.1 MB.", "Citation Baldwin DA, Feldman M, Alwine JC, Robertson ES. 2014. Metagenomic assay for identification of microbial pathogens in tumor tissues. mBio 5(5):e01714-14." ] },{ "paper_id": "778e12208f719a2e26d1387a5a489cdc93c612f4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Word Counts: 299 words (abstract); 2658 words (text);", "were only TPPA positive, and 1136 (43.7%) were false positive (Figure 1) ", "The authors declare no competing interest.", "The global population is ageing as a combined result of the demographic transition from high to low levels of fertility and mortality. 1 Population ageing increases the total global disease burden, with approximately 23% attributable to disorders in people aged \u226560" ] },{ "paper_id": "77cdb9f7f5451fd710304093391bca2637411c85", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A d C 7 -i n l a n d E V 7 1 -i n l a n d Antibody responses to enterovirus and adenovirus X Wang et al 3", "Antibody responses to enterovirus and adenovirus X Wang et al 5", "Human rhabdomyosarcoma (RD) and human embryonic kidney (HEK293) cells were maintained in complete Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Gibco BRL, Grand Island, NY, USA), 2% penicillin and streptomycin (HyClone, Logan, UT, USA). EV71 strain G082 (genogroup C4) and CA16 strain SZ05 (GenBank accession NO EU262658), kindly provided by Dr Zhong Huang (Institute Pasteur of Shanghai, Shanghai, China), were amplified in RD cells and purified by sucrose density gradient centrifugation. Recombinant replication-defective adenoviruses AdHu5 and AdC7 expressing green fluorescent protein were constructed in our laboratory using published protocols. 17 The recombinant adenoviruses were amplified in HEK293 cells to generate high-titer viral stocks and then purified by cesium chloride density gradient centrifugation. All four viruses were dissolved in phosphate buffered saline with 10% glycerol and stored at 280 6 C for use in all tests in this study." ] },{ "paper_id": "77dd0ff052179336391f3256d7a4afb57a71a6b2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "77fcb3d2473e9f9c05c8f0bce3f4ebecdd5252ca", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7818d1ffe60f6ea1d6b44e73402132ce41453ab2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "- - - - N N - - - CH-STC-12-2014 N - - - N N - - - CH-TPC-12-2014 N - - - N N - - - CH-CLC-01-2015 N - - - N N - - - CH-GGC-01-2015 N - - N N N - - - CH-GLC-02-2015 N - - - N N - - - CH-HFEC-01-2015 - - - - N N - - - CH-HGC-01-2015 N - - - N N - - - CH-HSYKFC-01-2015 N - - - N N - - - CH-JPYC-02-2015 N - - - N N - - - CH-QTC-01-2015 N - - N N N - - - CH-SBC-03-2015 N - - - N N - - - CH-WTC-02-2015 N - - - N N - - - CH-XBC-01-2015 - - - - N N - - - CH-YGC-01-2015 - - - - N N - - - CH-ZSC-01-2015 N - N N N N - - - CH-ZWBZa-01-2015 - - - - N N - - - CH-ZWBZb-01-2015 N - - - N N - - - CH-ZWC-01-2015 - - - N - N - - - South", "Previous research has shown that the Severe Acute Respiratory Syndromes (SARS) corona virus (CoV) originated from Guangdong Province in southern China and has a recombinant history with lineages of type I coronavirus such as PEDV [21] . Moreover, the high frequency of recombination events in CoVs may result in the generation of novel viruses with high genetic diversity, and it could invoke unpredictable changes in virulence during human infections [23] . As such, the information we have gathered about the mutation of S genes could be informative for monitoring and predicting the potential emergence of a recombinant CoV from animals.", "Phylogenetic analysis of S gene showed that all PEDV strain sequences could be divided into four groups ( (MB-021). Forty-five of the fifty-five South China PEDV strains belonged to G2b.", "High morbidity and mortality were observed in pigs that were immunized with inactivated or attenuated PED vaccines based on CV777 [19] , suggesting that the CV777 vaccine is unable to provide full protection in swine. We have reported on further investigations into the S gene mutations responsible for the failure or otherwise of the existing CV777 vaccine [28] ." ] },{ "paper_id": "782f0ba982d2370ea1a79af73ac66052cd4ad504", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cellular \u00c01 RF signals are mRNA destabilizing elements", "Full length EST2 expression vectors (pJD641), EST2 mutant vectors (pJD796) and null plasmids (pJD315) were transformed into WT (JD1281), EST2 deletion (JD1287), UPF2 (JD1288) and EST2/UPF2 (JD1276) deletion strains. Total RNA was extracted with acid phenol/chloroform (pH = 4.5) from mid-logarithmic cell cultures. In parallel, total RNAs were extracted from isogenic rpl3D strains expressing wild-type RPL3 (JD1228), the down-frameshifting rpl3-R247A allele (AM-L3R247A), or the up-frameshifting rpl3-W255C/ P257S allele (JD1229). To prevent amplification from contaminating cellular DNA, RNA was treated with DNase I before reverse transcription using Turbo DNase (Ambion). cDNA was generated using the Bio-Rad iScript cDNA synthesis kit and used in the LightCycler real-time PCR system. PCR reactions were performed with 2 ml of cDNA in 20-ml reaction mixtures containing $10 nM each sense and antisense primer, and 1x LightCycler 480 SYBR Green I Master Mix (Roche). PCR cycles were run as follows: 1 cycle of 95 C for 10 min; 40 cycles of 95 C for 10 s, 54 C for 20 s and 72 C for 20 s. U3 snoRNA was chosen as a reference gene.", "It is now clear that PRF is employed by organisms representing every branch in the tree of life, suggesting an ancient and possibly universal mechanism for controlling the expression of actively translated mRNAs (8) . The past few years have witnessed several reports describing in silico identification of recoding signals using a variety of computational approaches (9) (10) (11) (12) (13) (14) (15) (16) . While the methodologies of each study covered a broad range of bioinformatics techniques, the general goal with the exceptions of (9, 15) was to first find out-of-frame ORFs followed by the identification of PRF signals in the overlapping region between them. While this can identify new classes of PRF signals, it is based on the assumption that PRF outcomes should mimic those observed in viral genomes and thus cannot identify new operational outcomes of frameshifting." ] },{ "paper_id": "786282089d03a2eaed7139f503755faa30dd741f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "789ca66c03e2a2aaf30da4cf0df1d25b6b37b9d5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "78dc2abf39a665aec9b4a48738a2b4b838bfe72e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.", "Recently, a lot of effort has been made to discover biologically active components from marine plants. Ecklonia cava is", "Abstract" ] },{ "paper_id": "7910f7d2d13423c6eecb4ac66c0349e7830a57aa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All experiments were performed in triplicates, and the results are expressed as mean \u00b1 standard deviation (SD). Statistical analysis was analyzed by One-Way ANOVA analysis and LSD test using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). Differences with a probability value (P) <0.05 were considered to be statistically significant.", "These results indicate that emodin may induce apoptosis in HepaRG cells via the mitochondrial caspase-dependent pathway. ", "Emodin (1,3,8-trihydroxy-6-methylanthraquinone) (Fig. 1) is a naturally occurring anthraquinone derivative, which is found in a variety of tradition Chinese herbs including Rheum palmatum (9) , Polygonum cuspidatum (10) , Polygonum multiflorum (11) and Cassia occidentalis (12) . Modern pharmacological studies have revealed that emodin possesses anti-proliferative effects on various cancer cells, such as pancreatic cancer (13) , breast cancer (14) , hepatocellular carcinoma (15) , lung carcinoma (16) , gastric carcinoma (17) and prostate cancer (18) . Furthermore, this drug has also been reported to exhibit antiviral (19) , antibacterial (20) , anti-allergic (21) , anti-osteoporotic (22) , anti-diabetic (23) , immunosuppressive (24) and neuroprotective (25) activities. Nevertheless, an increasing number of recently published studies have reported the deleterious effects of emodin in in vivo and in vitro investigations (26, 27) . Panigrahi et al reported that emodin isolated from the methanol extracts of Cassia occidentalis might be one of its main hepatotoxic ingredients (28) . Furthermore, an in vivo study demonstrated that emodin may be one of the primary chemical components in Rheum palmatum L. that causes hepatic and renal toxicity (29) ." ] },{ "paper_id": "7925057cfe0cb75ae6079879cb2d22d23e42dfa5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "792b2b2b74f58b9a32b31b57c7930dbfea9895c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There have been many reports of long-term sequelae of severe acute respiratory syndrome (SARS), 5-10 but to the best of our knowledge no report has addressed long-term sequelae in", "In summary, patients with more severe MERS-CoV pneumonia may have more impaired pulmonary function at 1 year, which is compatible with the radiological sequelae." ] },{ "paper_id": "793bb8ec176e4a5df8323e0bd2276e134b958b5f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Ciliary beating plays an essential role in human airway biology and pathology, and 50-80% of airway epithelial cells are ciliated (17) . However, immunostaining (Fig. 1A ) and flow cytometry indicated that ciliated cells were apparently underrepresented in these AOs. Therefore, despite the discernible multilineage differentiation and the ability to support replication of IAVs, further improvements in morphology and differentiation appeared required.", "Plaque Assay. A plaque assay was performed to determine titers of the virus stocks and supernatant samples as described elsewhere (26) , with minor modifications. Briefly, MDCK cells were seeded in 12-well plates. Confluent monolayers were inoculated with 400 \u03bcL of 10-fold serial dilutions of samples and were incubated for 1 h at 37\u00b0C. After the inoculum was removed, the monolayers were overlaid with 1% low melting point agarose (Invitrogen) supplemented with Eagle's minimal essential medium (MEM) and 1 \u03bcg/\u03bcL TPCK-treated trypsin and were further incubated for 2-3 d. The monolayers were fixed with 4% paraformaldehyde (PFA) and were stained with 1% crystal violet to visualize the plaque after the agarose plugs were removed. Virus titers were calculated as plaque-forming units per milliliter.", "Statistical Analysis. Student's t test was used for data analysis. P < 0.05 was considered statistically significant. *P < 0.05; **P < 0.01. ***P < 0.005." ] },{ "paper_id": "79697e89c89116547c539a46e2041bd81d52d5d0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(Medicine 95 (15):e3090) Abbreviations: ICU = intensive care unit, LRTI = lower respiratory tract infection, NPA = nasopharyngeal aspirate, RSV = respiratory syncytial virus.", "Meteorological data for each city were obtained from the National Institute of Meteorology database and included the average monthly temperature (8C), relative humidity (%), solar radiation (kJ/m 2 ), and precipitation (mm).", "Editor: Susanna Esposito." ] },{ "paper_id": "79c0f8dbc31024ca3901227a97df7d35341d5229", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00862-13/-/DCSupplemental. Table S1 , PDF file, 0.1 MB. Figure S1 , PDF file, 0.4 MB. Figure S2 , PDF file, 0.2 MB. Figure S3 , PDF file, 0.1 MB. Figure S4 , PDF file, 0.1 MB. Figure S5 , PDF file, 0.1 MB. Figure S6 , PDF file, 0.1 MB. Figure S7 , PDF file, 0.1 MB. Figure S8 , PDF file, 0.1 MB. Text S1, DOC file, 0.1 MB.", "In these experiments, transfection of a TIM-1-expressing plasmid served as a transduction control, since TIM-1-dependent entry into endosomes is GP independent and should be independent of the GP glycosylation status (16, 30) . Consistent with this, the entry of all pseudovirions was similarly enhanced by transfection of TIM-1 (Fig. 4A) .", "Lennemann et al.", "Antibody/antiserum neutralization assay. Serial dilutions of fractionated IgG pooled from 36 convalescent, vaccinated cynomolgus macaques challenged with EBOV (gift from John M. Dye, USAMRIID) or pooled convalescent sera from mice challenged with mouse-adapted EBOV (gift from Gene Olinger, USAMRIID) were incubated at 37\u00b0C for 30 min with pseudotyped VSV bearing the glycoproteins studied and normalized for the amount of matrix protein. The mixtures were diluted 5-fold in growth medium and added to Vero cells plated in a 48-well format. GFP-positive cells were enumerated with flow cytometry. The relative antiserum sensitivities were calculated as the reciprocals of the 50% infective concentration (IC 50 ) values determined with GraphPad Prism 5." ] },{ "paper_id": "79e75fc82b515edcb68d6c8a6b83d630e3b21193", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "\u2022 Owners should be questioned about specific environmental exposures and identified mineral dusts should be avoided.", "Authors declare no conflict of interest.", "Authors declare no off-label use of antimicrobials." ] },{ "paper_id": "79f2edaa6e757d6032bd265f4735512738f51797", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ACKNOWLEDGMENT. This work was in part supported by MEXT/JSPS KAKENHI Grant Number JP16K08027.", "Anti-FCoV antibody-negative seven specific pathogen free (SPF) cats aged 5-6 months were used. The cats were maintained in a temperature-controlled isolated facility. All experiments were approved by the President of Kitasato University through the judgment of the Institutional Animal Care and Use Committee of Kitasato University (2004, and 18-050), and performed in accordance with the Guidelines for Animal Experiments of Kitasato University. Sample sizes were determined based on the previous study, and the minimum number of cats was used. ", "RNA was isolated from rectal swab samples by a method reported previously [8] . To synthesize cDNA from FIPV genomic RNA, 1 \u00b5l RNA extract and 0.02 mol sense primer for the FIPV nucleocapsid (N) gene (positions 876-895, 5\u2032-CAACTGGGGAGATGAACCTT-3\u2032) were added to Ready-to-Go RT-PCR beads (GE Healthcare Life Sciences) and the volume was adjusted to 50 \u00b5l with water. The resulting solution was incubated at 42\u00b0C for 1 hr to synthesize cDNA. cDNA was amplified by PCR using primers specific for the FCoV N gene (sense primer, positions 876-895, 5\u2032-CAACTGGGGAGATGAACCTT-3\u2032; antisense primer, positions 1644-1663, 5\u2032-GGTAGCATTTGGCAGCGTTA-3\u2032). PCR was performed as reported previously [8] . " ] },{ "paper_id": "7a0d4f63df57cc9873f41c16e27b5ec3d2b76f88", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "and the probability of observing a reference allele is:", "Because each y i is in fact a Bernoulli variable, we can write down the log of the likelihood function as a sum of log-likelihood functions:", "A P-value can be similarly derived using Wilks' theorem:", "where F X 2 1 is the cumulative distribution function of the chi-square distribution with one degree of freedom." ] },{ "paper_id": "7a11ebc3954fa5d2d95ad487b8540bc73feb68f1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7a3b1df462ac5224e195a12287ee156064910bf0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "acknowledgements The authors would like to thank Mr. Joshua Steele for graphic design.", "Competing interests None declared.", "Patient consent Not required." ] },{ "paper_id": "7a5d731cd59597da7bcef171af936c0af4d7528c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Guests who stayed on the same floor of the same lodging facility underwent active monitoring as well.", "2) Self-quarantine and active surveillance and monitoring of the contacts Lodging and restaurant staffs who were confirmed to be close contacts through travel channel determination underwent selfquarantine. Meanwhile, the general contacts who were confirmed based on CCTV recordings underwent active monitoring.", "Although it was fortunate that none of the Jeju citizens was diagnosed with MERS, this incidence was reported to have caused Jeju Island a loss of 150 billion won in June [5] . Considering the industrial economic structure and geographic environment of Jeju Island, the depicted MERS incidence shows that operation of a center that can proactively and preemptively monitor external infectious diseases is urgently needed [6] ." ] },{ "paper_id": "7a819c63e6e9a3c1979c34b11e3866d23dbed476", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "ADAM33 is a transmembrane protein which contains ADAM. 9 Based on the ADAM protein structure, it is presumed that ADAM protein family members play a critical role in cell adhesion, proliferation, differentiation, signaling, apoptosis and inflammatory responses.", "The importance of the 17q21 gene locus to asthma was initially suggested from a GWAS study which identified the 17q21 region as an important asthma susceptibility locus for childhood onset asthma. 38 This 17q21 locus harbors a cluster of genes including ORMDL3, and GSDMB. 39 The association between 17q21 gene polymorphisms and childhood-onset asthma has been demonstrated in many studies. [40] [41] [42] ", "Periostin is a member of the matricellular family of proteins that are highly expressed at the site of injury or inflammation. Periostin can potentially interact with other extracellular matrix proteins in asthma to mediate airway remodeling in particular fibrosis. Th2 cytokines, such as IL-13, are potent inducers of periostin, and periostin has thus been utilized as a Th2 biomarker. Periostin has the potential to mediate peribronchial fibrosis as it activates TGF-\u03b21, 51 up-regulates type I collagen, 51 induces differentiation of fibroblasts to myofibroblasts, 52 and promotes epithelial-mesenchymal transition. Overexpressed periostin in epithelial cells upregulates collagen fibrils." ] },{ "paper_id": "7a920d6b53c292f53323cb6c5109732a9575e33c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "LGPVKLSAEGPT, TAAKTHTVRGFKV, SYFAADRLVP SAG1, GRA2, GRA7 [41] KLFETTDMY, VRQEAIARALARAAA", "ARTICLE HISTORY" ] },{ "paper_id": "7aa307b2fa1b8d8aa3fa0a19abc0bd86c1c139cd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. Values were expressed as percentages for discrete variables, or as mean and standard deviation for continuous variables. Clinical characteristics and laboratory variables were compared using the chi-square or the Student t-test or Fisher's exact test, as appropriate. Statistical significance was defined as a p-value less than 0.05. All analyses were performed with the Statistical Package for the Social Sciences (SPSS), version 15.0 (SPSS Inc., Chicago, IL, USA).", "Demographic data and clinical presentation of patients were compared to general pathogens identified ( Table 2 ) and the individual viral pathogens (Table 3) ." ] },{ "paper_id": "7aaaac381f47fcb8d47d69b810efd23a0db7bf15", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "That is, within a run, each abundance value for peptide j is compared with the median peptide abundance values of the run i.", "2.1.5 Metric 5: kurtosis The peakedness, or 'heavy-tailedness', of a distribution is described by kurtosis. The same parameters are used as skew.", "Kurtosis is calculated as,", "Groups (N = 8 biological replicates) of regular weight (RW) and diet-induced obese (OB) C57BL/6 mice (15 weeks old) were exposed to either filtered air (SCs), mainstream (MS) or side stream (SS) cigarette smoke by nose-only inhalation exposure for 5 h/day for 8 days. Target cigarette smoke exposure concentrations were 250 \u00b5g wet-weight total particulate matter (WTPM)/L of air for the MS exposures and 85 \u00b5g WTPM/L for the SS exposures. RW mice are defined as those mice fed a regular diet (PMI 5002 Rodent Diet\u00ae, Richmond, IN, USA; \u223c5kal% fat) throughout the study." ] },{ "paper_id": "7ab7699be02b690053288d296a55d2cead606c40", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Varying concentrations of ATP were then added to initiate the reaction and the OD 340 nm value of NADH was measured using the Perkin-Elmer Envision. The K m value was calculated using GraphPad Prism.", "The protein solution was collected and concentrated to 6.7 mg/ml and then incubated with 25 thymine single-stranded DNA(dT25) at a molar ratio of 1:1.2 and then incubated with 2 mM AMPPNP at 4 \u2022 C for 3 h. The hanging-drop vapor-diffusion method was used to grow the Nsp13 crystals. The conditions for optimal crystal growth were 12% (w/v) polyethylene glycol 20 000, 2 M ammonium sulfate and 0.1 M MES monohydrate pH 6.5 at 16 \u2022 C. The protein and this crystallization buffer were mixed in equal volumes.", "Data collection and processing statistics are summarized in Table 1 .", "Atomic coordinates and structure factors for the reported crystal structures have been deposited with the Protein Data bank under accession number 6JYT.", "H/DX MS is an established method for protein-protein and protein-DNA interaction detection on peptide level (20) . The exchange of amide backbone hydrogens for deuterons is monitored by mass spectrometry, and can be localized to specific peptides within the primary structure, upon proteolytic digestion. It can report on interaction related regions with backbone amide groups involved in interactions or sequestration of regions of a protein in a solvent-inaccessible hydrophobic core, as deuteration will require both exposure of the region to solvent and fluctuations in hydrogen bonding (21) ." ] },{ "paper_id": "7acb13da2225f2c681714a69df8d7787d3312203", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "www.e-shaw.org at predicting the risk of an epidemic or at least at detecting early signs of its onset.", "Environmental pollution may expose wildlife species to infectious agents that can be disseminated. Open-air landfill sites, manure dispersal and, more recently, the attitude of some breeders of wasting in the environment without costs, the carcasses of the animals sacrificed in as preventive measure against bovine spongiform encephalopathy diffusion, represented very good opportunities for foxes, stray dogs, prey birds as well as marauders, especially seagulls, to pick up and disperse pathogenic agents, such as enterobacteria, mycobacteria, brucelles and other biological agents [17] .", "In developing countries, as reported by Kock et al. [9] in Africa, the close contact between human and livestock populations have led to major health problems, and in particular to the creation of a cycle of degradation and disease affecting especially traditional pastoral systems with a close physical association between people, livestock, and wild animals. An example is the recent outbreaks of M. bovis in wildlife in Kruger National Park, whose onset originated from an infected cattle herd [10] .", "In some cases, at the basis of the disease's emergence, there are increases in the density of animal or wildlife populations associated with intensive breeding methods for domestic animals, and proximity with human and animal populations caused by growth of the human settlements [8] . Examples diseases are Mycobacterium bovis (M. Bovis), Brucella spp. or Francisella tularensis' infection in cattle breeders." ] },{ "paper_id": "7af72db19cf1096560e19d5265dc5783ea8dc2cc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All sampling techniques and the study protocol were revised by the local ethical committee and permitted under experimental license number EC2014-164.", "The random herd effect was significant in all models." ] },{ "paper_id": "7afb40ff1e8710f31b4805249e6e6fcce6467e96", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The experimental protocol was reviewed and approved by the Animal Care and Use Committee at WSU (ASAF# 04793-001). Owner consent was obtained prior to sampling.", "Macarena G. Sanz https://orcid.org/0000-0001-6565-9947", "Although this approach is complete, it is costly and may not always be achievable." ] },{ "paper_id": "7b0abf2414de3794e54ed37050884f636333972f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7b1dd68a2de5fb4b3902e834ecc2fb6bd12f28f2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The anti-malaria drug chloroquine is well known as autophagy inhibitor. The compound is also known as drug with ", "The authors declare no conflict of interest." ] },{ "paper_id": "7b3a1e17837723ff83422617fef30925bab713a4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Electron microscopy. Infected and healthy P. equestris leaves were investigated for virus particles by both negative staining and thin sections under H-7650 Hitachi transmission electron microscope (Tokyo, Japan) at 80 kV as described (Lan et al., 2016) .", "Reverse transcription polymerase chain reaction (RT-PCR). Total RNA was extracted from 0.1 g symptomatic leaves of P. equestris with Trizol reagent (Invitrogen, Carlsbad, CA, USA) as instruction. RT-PCR was performed with the primers to amplify the coat protein (CP) gene of CymMV and ORSV with Invitrogen SuperScript IV VILOTM kit (ThermoFisher, Waltham, MA, USA) as instruction.", "sRNA-seq and analyzing. The RNA extracted from infected and healthy P. equestris (n = 3) was used for library construction and sequencing for three times by Novogene Technology Co. Ltd. (Beijing, China) as described previously (Lan et al., 2015) . To identify siRNAs, using the software Bowtie v.0.12.7 with 0 mismatch, we aligned all the cleaned reads to the viral genome sequences and calculated the average depths and the genome coverages. The average depth is calculated as the total number of nucleotides of the aligned reads divided by the read-covered positions on the reference genome. The genome coverage represents the proportion of read-covered positions against the genome length. Reads obtained above were analyzed using Excel. Single-base resolution maps along with virus genomes were created using Bowtie tools and in-house Perl scripts. sRNAs from each sample were assembled de novo using Velvet. Assembled contigs were used to search the Gen-Bank/EMBL/DDBJ database using BLASTn or BLASTx. Coverage and distribution of virus-specific contigs by siRNAs were determined using the program MAQ under default parameters, and results were exported to Microsoft Excel for further analysis. Primers were designed for amplification and Sanger sequencing based on the identified viral contigs using Vector NTI (Invitrogen). Phylogenetic tree analysis was performed using MEGA 5.0.", "In this study, we analyzed the characterizations of the siRNAs in CymMV-and ORSV-coinfected P. equestris plants, and explored their potential roles in targeting a series of P. equestris genes which are related to host stress response, RNAi antiviral immunity defense, cytoskeleton, metabolic processes (chloroplast photosynthesis and mitochondria energy supply pathways, fatty acid biosynthetic process and protein phosphorylation), pathogenesis and symptomology. We also found that siRNAs derived from CymMV and ORSV could decrease the expression levels of all target genes in P. equestris. All results in this study provide an understanding of the RNAi mechanism and an insight into the function and implication of RNAi pathway in viruses-P. equestris interactions." ] },{ "paper_id": "7b9f9339ac1f541b560e1c3c0ce6697cb8c8cc3b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(a/a+b)", "values >38 excluded (n=7,856)." ] },{ "paper_id": "7be16a5fe61f446de54e71a73b7686d629f24059", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7c5c81226bc5cf7d5506fb44115d566dfc3fa1db", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "controlled studies to investigate the relationship between IMHA and Borrelia infection may be warranted.", "Three studies were identified and evaluated. [5] [6] [7] One prospective case-control study asking if D.", "caninum. 19 IMHA resolved in all 3 dogs when treated concurrently with fenbendazole and a 4" ] },{ "paper_id": "7c8829abbf6087d8a19a616952acf92bb76dc38d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "D E statistically significant." ] },{ "paper_id": "7c9b0de06457ee197e904b3bc7f312ccb888baa7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Koatech Laboratory Animal Center (Pyeongtaek, Korea). Experimental procedures involving laboratory animals were approved by the Institutional Animal Care and Use Committee of Chonbuk National University (approval numbers: CBU 2011-0061 and CBU 2015-0004) and carried out in accordance with the guidelines suggested by the committee.", "Statistical analyses were performed using Prism 7 (GraphPad Software, La Jolla, CA, USA). Data are presented as means\u00b1standard error of repeated experiments unless otherwise specified. Differences in the means of multiple independent variables were compared between the control and treatment groups using 1-way analysis of variance, followed by Tukey's post hoc test. Differences were considered significant at p<0.05.", "For western blot analysis, the protein lysate was treated with or without isopropyl \u03b2-D-1-thiogalactopyranoside, subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis, and transferred to polyvinylidene fluoride membranes. Immunoblotting was performed using an anti-GST Ab (Santa Cruz Biotechnology, Dallas, TX, USA). For visualization, a horseradish peroxidase (HRP)-conjugated secondary Ab was added, and bands were detected using an enhanced chemiluminescence detection kit (GE Healthcare Life Sciences)." ] },{ "paper_id": "7ca300b9a142c9df5da9d660610782ace344a412", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7d1b56a1da849ab1a3e0ee57807511ebac91de24", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7d23656771268d325fc276045ff002b7d0184e7b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Totura AL, Baric RS. 2015. Reply to \"Statins may decrease the fatality rate of MERS infection.\" mBio 6(5):e01303-15.", "Our study and others indicate that, in animal models of highly pathogenic coronavirus infection, the aberrant signaling stemming from a lack of either Toll-like receptor (TLR) adaptor TRIF or MyD88 leads to severe lung disease or death (7, 13, 14) . If", "MyD88 signaling was largely repressed by the use of statins in MERS patients, this could lead to exacerbated compensatory signaling by other innate immune factors, resulting in a poor disease outcome in coronavirus patients. Of critical importance is that the absence of these central TLR adaptor molecules results in increased viral loads that persist for longer periods of time than in wild-type mice following SARS-CoV or MERS-CoV infection (7, 13, 14) . Currently, high viral titers during the acute phase of infection are thought to be a potential factor that increases the likelihood of person-to-person transmission of highly pathogenic coronaviruses. Caution must be used when weighing potential therapeutic options that may increase the likelihood of the spread of these viruses." ] },{ "paper_id": "7d2c839823df05875ad1170a68a88c981bf0e859", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7d3facc82a83039b3871ebb8a299bcdb9700156f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "of the ZnF of USP9X, we mutated residues chelating the zinc ion, C1727A, or H1729A, and measured their activities.", "Generation of ABPs and Assays Using the ABPs. The monoUb-based probe was synthesized by reacting the Ub 1-75 -MESNA with PA or Gly-VME for 40 min followed by HiTrap SP HP cation exchange (GE Healthcare) column purification.", "Ubiquitination is an important posttranslational modification that regulates almost every aspect of cellular functions. Ubiquitin can form chains of different topology; each has a distinctive role in dictating the function and fate of the modified proteins. Deubiquitinases (DUBs) reverse ubiquitination. How DUBs recognize ubiquitin chains is a topic of immense interest due to the therapeutic potentials of human DUBs. We obtained the atomic details of the USP9X catalytic core, a DUB involved in cancers and developmental disorders, and revealed its unusual mechanisms of action using a set of activity-based ubiquitin probes. These probes will propel future investigation of how DUBs recognize and process ubiquitin chains and identify potential new sites on DUBs for drug discovery." ] },{ "paper_id": "7d780290822a5408a54dfdf2ae32139cf1a2892c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was conducted in accordance with the Declaration of Helsinki and approved by the ethics committee of Collegium Medicum in Bydgoszcz, Nicolaus Copernicus University in Torun. All patient data were analyzed in anonymity. As neither individual data were published nor any intervention was performed on patients, patient consent was waived by the ethics committee.", "ACV, aciclovir; ADV, adenovirus; a/cGVHD, acute/chronic graft versus host disease; ALL, acute lymphoblastic leukemia; allo-, allogeneic; AML, acute myeloblastic leukemia; ANC, absolute neutrophil count; ARAC, cytarabine; auto-, autologous; BCNU, carmustine; BKV, polyoma BK virus; BM, bone marrow; CARV, community-acquired respiratory virus; CI, confidence intervals; CIBMTR, Center for International Blood and Marrow Transplant Research; CMV, cytomegalovirus; D, days;", "The study was designed as multicenter nationwide cohort analysis performed on behalf of the Polish Society of Pediatric Oncology and Hematology. Viral infections diagnosed during a six-year period (between January 1, 2012 and December 31, 2017), were reported by all Polish pediatric HCT centers (Bydgoszcz, Krakow, Lublin, Poznan, Wroclaw) and data were analyzed centrally by two independent researchers. Data from the first 2-year period were collected retrospectively, then prospectively afterwards." ] },{ "paper_id": "7d7bab4809a66048899e1e95227eb5d72e46818f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7d9c27d988dd4ca25668f573e610145140d2266e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Coronavirus, and Severe Acute Respiratory Syndrome Coronoavirus to", "Supplementary materials are available at The Journal of Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.", "One part by volume of the test virus suspension and 1 part by volume of the organic load were mixed with 8 parts by volume of 1 of the 2 WHO formulations at different concentrations. Additional information is provided in the Supplementary Data." ] },{ "paper_id": "7da1a3651e1aba73bc607cf4aaa93105af0c2bf7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "PIL in eight non-affected adjacent provinces (region 3) were also calculated as potential economic losses. The direct PIL of 27 prefectures for the H7N9 cases are described in detail in table 4." ] },{ "paper_id": "7db910e35a0a22ccef05b0a5b4c9789acfef2daa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Little or no effect Suppression of PB1-F2 neither affected viral replication nor virus loads in the lungs of mice (McAuley et al. 2010 ).", "3", "Supplementary information and figures S1-S7 are available at Molecular Biology and Evolution online (http://www.mbe .oxfordjournals.org/).", "Moderate effect Suppression of L* decreases the ability of Theiler's virus to induce a chronic infection of the central nervous system (Stavrou et al. 2010 )." ] },{ "paper_id": "7db9b801730d8b60d1fc331ba3389460e9ea3794", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "We configured the platform to the static state, and the patients underwent posture maintenance training and center of gravity transferring postural training in eight directions after initially aligning the center of gravity with the middle line of the monitor. We did not restrict any of the groups' activities to balance training, and we advised the subjects to perform their same daily activities as before (Fig. 2B ).", "A decrease in balance control can be caused by various factors, including central nervous system diseases (such as stroke and traumatic brain injury), musculoskeletal disorders (such as back pain or arthritis), and vestibular diseases. Loss of balance control decreases the ability and speed of patients' gait, especially in those with hemiplegia caused by brain damage. Fear of falling in these patients reduces their activity level and makes daily activities of living difficult for these patients. Therefore, improvements in balance control and mechanical movements are important treatment goals [1] .", "The Berg Balance Scale (BBS), 10-m walking test (10mWT), Timed Up and Go (TUG) and Functional Reach Tests (FRT), and trunk strength evaluated using Spine Balance 3D system's evaluation program were used as clinical indicators to evaluate the level of function before the exercise. The Korean version of the Fall Efficacy Scale-International (KFES-I) was recorded using the information from the survey. The patients performed 30-minute exercises, three times a week for 7 weeks (Fig. 1) .", "We performed the statistical analyses using SPSS ver. 18.0 (SPSS Inc., Chicago, IL, USA), and analyzed the demographics of the two groups and pre-treatment evaluations by using an independent t-test. We compared the pre-treatment evaluations with post-treatment evaluations in both groups to determine whether statistical changes were present. We analyzed the measured values before and after the treatment in each group by using Wilcoxon signed-rank tests, and considered only p-values less than 0.05 to be statistically significant." ] },{ "paper_id": "7e1d33cf80c62e4e7de67f8beb280c86266b887f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The Gini coefficients of these four conditions are presented in Table 1 . In the first two conditions (C1 and C2, without temporal variability), the Gini coefficients were both very close to zero, indicating all individuals had almost equal contribution to the new infection, despite C1 having no degree order change and higher prevalence. In the latter two conditions (C3 and C4, with temporal variability), C3 had a larger Gini coefficient, indicating the individuals with constantly high degree order contributed to more new infections than the lower order ones.", "In our simulation of disease dynamics, we assume that the disease does not substantially change the individual's behavior. This implicit assumption is appropriate for non-clinical conditions and for demonstrating the importance of dynamic networks on disease dynamics. Nevertheless, in realistic systems modeling clinical diseases, animals may change their behavior during the infected stage, resulting in a different contact pattern [37] [38] [39] [40] . Furthermore we have assumed frequency-dependent transmission through contact to simplify the model. To model more realistic directly transmitted disease systems and design effective controlling strategies, it is important to make the correct assumptions about transmission mode (frequencydependent or density-dependent, or a combination of both), observe the actual contact network for all the individuals over time, and understand both temporal and individual heterogeneity in the contact network [41] [42] [43] .", "The time series of hourly number of contacts is shown in Fig. 1 for all three pens. The analysis of variance (ANOVA) was carried to investigate temporal and individual variability. ANOVA results revealed highly significant hourly variability nested in day (P 5 0.003), individual variability nested in pen (P 5 0.001), and at pen level (P 5 0.003) but marginal insignificance between day variability (P 5 0.06). Further spectrum analysis confirmed a peak frequency correlated to an approximate 6.25-h period in number of contacts. Thus there was a clear pattern of diurnal cycle in network degree distribution.", "An analysis of variance (ANOVA) was performed to further test whether the degree distribution of the networks varied among different individuals in different pens and/or in different hours on different days. The hour factor was nested in the day and the individuals were nested in the pen. Furthermore, spectrum analysis was performed with timeSeries package in R to explore the periodic (within-day) change of the time series of aggregated degrees (number of total contacts of all calves in each pen) in the networks." ] },{ "paper_id": "7e2390fbb36e75e858fe46a1c81266144ab176de", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7e3f8778b0ccf9aa5fe2a4e0ee2740f01691bca5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In 1996 Clarke et al. [13] recognised that whilst GIS had been in development for over 30 years, it was only then that such systems had become readily usable for those not extensively trained in their use. Their review article 'On epidemiology and geographic information systems: a review and discussion of future directions [13] ' specifically addressed the disciplinary crossover between GIS and public health and epidemiology.", "She stated that at that time, GIS-based research on service performance and effectiveness was in its infancy and that whilst efforts were underway to integrate GIS with spatial decision support systems they were still in the stages of early evolution. www.e-hir.org", "In 2011, Nykiforuk and Flaman [3] continued the debate by reviewing once again GIS for health promotion and public health. They identified four predominant themes from a systematic review which was comprised of 621 journal articles and book chapters: 1) disease surveillance, a) disease mapping, b) disease modeling; 2) risk analysis; 3) health access and planning; and 4) community health profiling.", "The mapping of community characteristics, such as ethnic identification, socio-economic status, gender, health behaviours, mortality and morbidity, together combine to provide profiles of population groups which allows for the explanation of general relationships between health and setting.", "Current examples include supporting Hispanic community transitions [68] , assessing community primary care needs [69] , community development [70] , community pharmacy populations [71] , and developing an understanding of the spiritual dimension of health for communities [72] ." ] },{ "paper_id": "7e54f67d82b8e54609d3029b20d765865895928d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7e757d19351d6680088ee7343c19873de2e1bcfa", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "S2 Contents S1.", ".", "General information \u2026S3" ] },{ "paper_id": "7e7c6670854897412ce9930eefc95f348ae432a2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7e92581ed1b5f05b3002790d3cd71974982f7a3f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "These disadvantages have made it essential to explore alternative novel approaches for future vaccine development. Preference will be given to those vaccines that are capable of stimulating broad neutralizing antibody responses and cross-protective immunity against divergent IAVs, including the pandemic strains of 2009 H1N1 and highly pathogenic strains of H5N1.", "The latest influenza pandemic caused by 2009 swine-origin IAV H1N1, coupled with the continuing threat of the highly pathogenic avian influenza A virus H5N1, makes it essential to develop efficacious vaccines to prevent future influenza pandemics and epidemics.", "RBD vaccine could elicit strong neutralizing antibody responses and protection against SARS-CoV challenge. [15] [16] [17] These findings suggest that this RBD-based vaccine has considerable potential for development into a safe and effective SARS vaccine to prevent future SARS epidemics.", "To design vaccines with the ability to induce highly potent and cross-reactive neutralizing antibodies with high binding affinity, we recommend the following strategies: (i) construct an immunogen containing the discontinuous sequences of bonding set and/or induced epitopes; (ii) induce conformational changes by mutation or glycan shield of the non-neutralizing immunodominant epitopes from the immunogen in order to reduce the immunogenicity of these epitopes; and (iii) add an immunopotentiation motif to the immunogen in order to enhance the immunogenicity of the RBDbased vaccine.", "IAVs belong to the family of Orthomyxoviridae. The genome of the virus consists of eight single-stranded, negative-sense RNA segments, encoding several important proteins, including surface proteins hemagglutinin (HA), neuraminidase (NA) and matrix 2 protein (M2), nucleoprotein (NP), matrix protein 1 (M1), non-structural proteins (NS1, NS2), as well as polymerase proteins PB1, PB2 and PA. 44 HA and NA are two important envelope glycoproteins of the virus, and all IAVs are classified into 16 antigenically distinct HAs (H1-H16) and 9 different NAs (N1-N9), according to the serotypes of HA and NA." ] },{ "paper_id": "7ec5f725610673671e1703613932224d6494e880", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The best laboratories maintain careful training and testing of operators, tracking and testing of pathogen samples, and rigorous safety protocols. Notwithstanding these efforts, lapses of protocol occur, as recently documented at the CDC high-containment laboratory (http://www.usatoday.com/news/nation/story/2012-06 -13/cdc-bioterror-lab/55557704/1). Infections of laboratory workers occur, as most recently emphasized by the tragic death of a technician working on Neisseria meningitidis B in a BSL-2 laboratory in San Francisco, CA (6) , and other events before that. Standards of laboratory safety vary by institution (given the strong reliance on institutions and even individual investigators to enforce the details of biosafety between government inspections) and by country, with tremendous heterogeneity in the precautions required for working on a particular pathogen (7).", "Recommended measures. While the current moratorium is operative, we have an opportunity to define a set of conditions that will minimize the risks of laboratory-released infections or epidemics. Clearly we must continue to emphasize the importance of learning about the pathogenesis of high-risk infectious agents and recognize the likelihood that the greatest infectious risks come from nature, like H5N1 influenza. Hence, there is a continuing need for research on a wide variety of pathogens, including those that are not currently fashionable; we note that study of coronaviruses would never have been considered \"pandemic preparedness\" before SARS, but it was. Only a very limited number of experiments need to be done with potential pandemic pathogens themselves. We urge consideration of the following policies.", "While these figures may sound low, the key problem is that they increase as more laboratories undertake work on PPPs and as they do so over a longer period. Even at the NIAID, the intramural estimated rate of 2 exposures per 100,000 operator-hours, a remarkably low rate that likely reflects very careful practices, one would expect 1 out of every 50 technicians working half-time (1,000 h) in such a laboratory to be exposed each year and 1 of every 600 to become infected. Over a 10-year period, with 100 such laboratories each employing 5 such technicians, one would expect 100 exposures and about 8 infections. Klotz and Sylvester estimate that with 42 laboratories working on PPP and a 0.3% risk of an escape per laboratory-year, there is an 80% risk of an escape of a PPP every 13 years (5) .", "With the proliferation of BSL-3 and BSL-4 laboratories across the globe, including many set up for surveillance and response to a natural influenza pandemic, decisions by the United States and other biomedical research leaders about research on mammaliantransmissible H5N1 viruses will have rapid consequences for the scale of research around the globe. If the wealthy countries adopt a policy that any experiment with these viruses is acceptable as long as it is done in a containment facility, a similar ethic will likely prevail globally, but the quality of containment will vary. If, on the other hand, they acknowledge the unique risks posed by potential pandemic pathogens and help to generate a process that has international support, a global framework for evaluating proposed research in this area would be a great contribution." ] },{ "paper_id": "7ed89e5691a56b6757c21984c3bbb733b5a2dfdc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7f070cac1f9fd46107d2a521e65b385e87efea85", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "7f37181b66f15b8ca2d62b6943d9a6f92e843a66", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "His eye-opening research findings were published in the Customs Gazette and later the Journal of Linnean Society of London, Zoology in 1878. 6 While his paper was read out in the society's meeting, one critic remarked that`what they had heard represented either the work of a genius or more likely the emanations of a drunken Scots doctor in faroff China, where everyone was aware, they drank far too much whisky'. With time, his experiments were reproduced and his mosquito hypothesis was widely accepted.", "We are very grateful to Dr Samson S Y Wong (the University of Hong Kong, Hong Kong, China) who proofread this review and supplied three of the figures. Emerging Microbes and Infections", "KKW To and KY Yuen 4 Memorial Hospital. In Manson's presidential address to the Society, he indicated the lack of education and research on tropical medicine which rendered doctors unable to differentiate malaria from typhoid fever. Due to such gaps in training, there was often wastage of quinine for non-malarial fever. His philosophy towards the judicious use of antimicrobials is even more important in the present era of rising antimicrobial resistance. Though newly recognized clinical entities such as tropical (fatty) liver could be easily be treated by heavy exercise and dietary (food and alcoholic beverages) discretion, there was no portal of sharing on such important knowledge between doctors till the founding of this medical society.", "Amoy was known as just another white man's grave in the tropics which is hot and humid. The streets were narrow, irregular and filthy with excreta and litters. In those days, the only machinery for sanitation at Amoy was the pigs and dogs which ate up the excreta and litters. The inhabitants were in extreme poverty who subsisted on rice and sweet potatoes occasionally flavoured with vegetable pickles and salted fish. The area was highly endemic for malaria, typhoid fever, dengue fever and leprosy. His estimation by survey showed that about 1 in 450 inhabitants were infected by leprosy. In the 1877 cholera outbreak in Amoy, 95% of the population was affected and 2% died. Unfortunately, his younger brother David Manson also died in Amoy in 1878." ] },{ "paper_id": "7f69a764a32e9fefc971d79582da33db151cdeb5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Cell culture and transfection BFP-CLC RPE cells were grown in 1:1 F12: DMEM supplemented with 10% FBS, 20 mM Hepes, Pen/Strep/l-glutamine (100 U/ml, 100 \u00b5g/ml, and 300 \u00b5g/ml, respectively) and incubated at 37\u00b0C with 5% CO 2 . Cells were seeded onto acid-washed coverslips at a density of 5 \u00d7 10 4 cells per coverslip for 24 h before transfection with 1-2 \u00b5g of plasmid DNA using 3 \u00b5l Fugene transfection reagent per microgram of DNA (Promega). Cells were imaged 16-20 h after transfection. Two independent transfections were performed for each plasmid construct, and data were pooled from both transfections.", "A spinning disc confocal microscope (Zeiss Axio Observer Z1 with Yokagawa CSU-X1M) was used to image GUVs, tethered vesicles, and live RPE cells. Laser wavelengths of 488 and 561 nm were used for excitation. Emission filters were centered at 525 nm with a 50-nm width, and 629 nm with a 62-nm width. A triple-pass dichroic mirror was used: 405/488/561 nm. The microscope objective was a Plan-Apochromat 100\u00d7, 1.4 numerical aperture oil immersion objective. Images were collected on a cooled (\u221270\u00b0C) EMC CD iXon3 897 camera (Andor Technology).", "In cell experiments, Fig. 4 C displays data from n > 90 cells per condition from two independent transfections. Fig. 4 D displays a subset of the data in Fig. 4 C that is within the specified protein expression range, with n > 20 cells per condition. Bars represent mean \u00b1 SEM. Fig. 4 E displays the lengths of individual tubes from cells within the specified protein expression range, where n > 80 tubes per condition. Fig. 4 F displays the lifetimes of individual tubes measured from TIRF videos, where n > 40 tubes per condition. Black lines in Fig. 4 , E and F, indicate means. The indicated P values were calculated using unpaired, two-tailed Student's t tests." ] },{ "paper_id": "8016c07acf423bde29ea3e2742fb37286a9b013a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The following recommendations are based on the information available at the time of this writing. For clarity, the consensus panel subdivided pathogens into the following categories for the dog and cat:", "1.", "Blood Collection Procedure Recommendations", "Initial clinicopathologic screening of potential donors is advised (eg, CBC, serum biochemistry, urinalysis, fecal examination). Determination of the PCV is advised before each collection." ] },{ "paper_id": "801bdee04f820908695b58d1d23a04d3ecbf103f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "801d5411eaa50cb50b03e37bf199b1636341c5c2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "PVA-co-PE (ethylene content of 27 mol %), BA, 3,3\u2032,4,4\u2032-benzophenone tetracarboxylic dianhydride (BPTCD), CDI, tetrahydrofuran (THF), dioxane, acetone, chloroform, isopropanol, CDI, polyphosphoric acid (PPA), 25 weight % (wt %) glutaraldehyde solution, 37% formaldehyde solution, 4 wt % osmium tetroxide (OsO 4 ), potassium iodide, sodium hydroxide, ammonium molybdate tetrahydrate, potassium hydrogen phthalate, PI, and SG dye were purchased from Sigma-Aldrich. p-Nitrosodimethylaniline (p-NDA), CA, Luria-Bertani (LB) broth, LB agar, Tryptic soy broth, and Tryptic soy agar (TSA) were purchased from Thermo Fisher Scientific. Phosphate-buffered saline (PBS) and tris-buffered saline were obtained from USB Co. Ltd.", "All calculations were performed using computational chemistry software package Gaussian 09 ver. 08. Initial geometries at ground state were optimized at unrestricted DFT-B3LYP/6-31+G(d,p) level of theory in conductor-like polarizable continuum model (CPCM)-H 2 O solvent. Using these geometries, the nature of singlet and triplet excited energy calculations was performed using the TDDFT-B3LYP/6-31+G (d,p) level of theory in CPCM-H 2 O solvent. The Gibbs free energies of all compounds were obtained by frequency calculations at unrestricted DFT-B3LYP/6-311+G(d,p) level of theory in CPCM-H 2 O solvent using geometries optimized at unrestricted DFT-B3LYP/6-31+G(d,p) level of theory in CPCM-H 2 O solvent. The ESP calculation was performed by single-point energy calculations with CHELPG 5 ESP population analysis at unrestricted DFT-B3LYP/6-31+G(d,p) level of theory in CPCM-H 2 O solvent. Total electron density was first plotted and then mapped with ESP-derived charges to show a distribution of charges on the molecular structure.", "Characterization SEM images were examined by a Philips FEI XL30. UV-vis absorption spectra were collected with an Evolution 600 spectrophotometer (Thermo Fisher Scientific), and the diffuse reflection spectra were collected with a DRA-EV-600 diffuse reflectance accessory (Labsphere). 1 H NMR spectra were recorded on a 400-MHz Bruker Avance HD spectrometer, and DMSO-d 6 was used as a solvent. A TSI Model 8130 automated filter tester (TSI Inc.) was used to measure the filtration efficiency and pressure drop, and NaCl monodisperse aerosols with a size of 0.3 to 0.5 mm and an SD less than 1.86 were used as the model particles. The filtration QF values were defined by the formula: QF = \u2212ln(1 \u2212 h)/Dp, in which the h was the filtration efficiency and the Dp was the pressure drop." ] },{ "paper_id": "801e028d1c0aa75910dbe03019538ed0dc28b905", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Foot-and-mouth disease (FMD) is an extremely contagious disease that affects more than 33 species of cloven-hoofed animals including This is an Open Access article distributed under the terms of the Creative Commons Attribution-Noncommercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted use, distribution, and reproduction in any noncommercial medium, provided the original work is properly cited.", "foot-and-mouth disease virus / RNA interference / Salmonella choleraesuis / conserved sequence / swine" ] },{ "paper_id": "80228934cbb48467699deb5d9ea5826c635939a9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Citation Klotz LC. 2015. Danger of potential-pandemic-pathogen research enterprises. mBio 6(3):e00815-15.", "Solving equation 1 for y gives", "I certainly do provide a rationale for the 10% likelihood of LAI (4) through references 8 and 9 (risk assessment studies).", "log(1 \u03ea E) \u03ed log(1 \u03ea P 1 ) yxn \u03ed y \u03eb n \u03eb log(1 \u03ea P 1 )," ] },{ "paper_id": "802c4e9e532b2a48928179795754847a229252ec", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Bornavirus nucleic acid detection by polymerase chain reaction (PCR)", "ARTICLE HISTORY" ] },{ "paper_id": "80522e9ca5c69f759fcb3da6fcfdf3523891594e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "80786183397e485664fd049d086f6e3e38ba210f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Autophagy inhibitors are considered as potent chemosensitizers and might therefore be introduced into combination regimens for optimal anticancer therapies. Methods to measure autophagy include electron microscopy for quantifying autophagosomes, immunoblotting for detecting the lipidation of microtubules-associated protein 1 light chain 3 (also known as LC3), or immunofluorescence microscopy for monitoring the redistribution of LC3 from a diffuse pattern to a punctate one. 41 Complementary techniques are necessary as the autophagosomal accumulation of LC3 can be influenced by lysosomal acidification. For instance, another way is to assess the autophagic flux, thanks to several methods: pulse-chase, immunoblotting, or luciferase-based methods for monitoring the degradation of autophagic substrates. A luciferase coupled with LC3 has recently been used to develop a real-time HTScompatible assay for monitoring the autophagic flux. Moreover, firefly luciferase has been shown to constitute a preferential autophagic substrate and is hence a trustful marker of autophagic degradation that may be applicable to HTS studies. In addition, recent developed assays allow determining the phosphorylation status of substrates from critical autophagy regulator kinases, such as mTORC1 and UNC51-like kinase 1. Besides, several of these assays have been recently adapted for HTS. Finally, these methods should be used to identify the underlying molecular mechanisms of autophagy more than quantifying its levels. [42] [43] [44] [45] Detection of necrosis, ferroptosis, and immunogenic cell death", "The assessment of new potential chemotherapeutics and drug screening involve cell viability and cytotoxicity assays to identify and define safety thresholds for subsequent clinical use. Such assays rely on several cell functions, including enzyme activity, cell membrane activity, cell adherence, adenosine triphosphate (ATP) production, coenzyme production, and nucleotide uptake activity. If a compound interferes with cellular attachment, causes dramatic morphologic changes, affects cell growth rate, or leads to a reduction in overall viability, it is considered to be cytotoxic. 19 However, cytotoxicity reflects the cell-killing property of a chemical compound and is not associated with a specific cell death pathway. Cell viability can be defined as the number of healthy cells in a sample, without any distinction between cells which are actively dividing or quiescent ones, whereas cell proliferation is the measurement of the M\u00e9ry et al 3 number of cells that are dividing in a culture. Viability assays aim to measure cellular maintenance and survival parameters. Thereby, a myriad of assays have been designed and used so as to measure viability or cytotoxicity in vitro, including, in particular, classical dye inclusion or exclusion and colony formation assays. 20", "Cell death plays a crucial role for a myriad of physiological processes, and several human diseases such as cancer are characterized by its deregulation. There are many methods available for both quantifying and qualifying the accurate process of cell death which occurs. Choosing the right assay tool is essential to generate meaningful data, provide sufficient information for clinical applications, and understand cell death processes. In vitro cell death assays are important steps in the search for new therapies against cancer as the ultimate goal remains the elaboration of drugs that interfere with specific cell death mechanisms. However, choosing a cell viability or cytotoxicity assay among the many available options is a daunting task. Indeed, cell death can be approached by several viewpoints and require a more holistic approach. This review provides an overview of cell death assays usually used in vitro for assessing cell death so as to elaborate new potential chemotherapeutics and discusses considerations for using each assay." ] },{ "paper_id": "808ed8eb35c9674d24e464888c76c898ea979691", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "808f6be54af8e7c20446dc1ebdeeb68af2c28fba", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "80a789fb3ed3279911f241585e315718b54c9a91", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "& $ %", "The steps followed were as per the manufacturer's instructions (Beckman Coulter).", "Statistical analyses were performed by paired or unpaired Student's t test (unless otherwise stated). Values of P < 0.05 were considered statistically significant." ] },{ "paper_id": "80cdffc26a496e89e2d94c7478749adbabafe180", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The objectives are to introduce a provincial level surveillance system, which has been initiated in response to the MERS-CoV outbreak of South Korea, and describe findings from systematic investigation of individual admissions attributed to acute febrile illness for the first year.", "Gyeonggi-do province was the most affected region in the 2015 MERS-CoV outbreak, 67 of 185 cases were residents of this province. GAFINet Initiative is a meaningful step for rapid detection of emerging or overseas imported infectious diseases at the provincial level. To validate data and co-analysis with pre-existing surveillance data, we need a more long-term of continuous operation of GAFINet. As a next step, we are preparing the additional lab-based surveillance system to detect new or re-emerging pathogens. ", "Between 30 September and 3 December 2016, about 6,000 of patients visited ED of ten hospitals a week, and 10% of them were AFI cases. The proportion of AFRI was the largest, 33.64 to 71.96 per 1000 visits/week, and the second-largest was the other infectious AFI. The proportion of AFRI showed the highest rate at the age 1-9 years, while those of AFGI and AFEI were the highest at the age under 19 year and 70-79 years, respectively. 31 cases with international travel history were reported, and the majority of them traveled China and South East Asian counties. Some of them were suspected cases of Zika viral infection, MERS-CoV, or viral hemorrhagic fever. 3 cases undiagnosed until discharge were also reported." ] },{ "paper_id": "80dc6a5a5b823d6e1fb9802becae1575ddb8dd89", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "However, even if contaminations were underestimated, the number of reported incidents is still alarming.", "Recommendations for decontamination mainly emphasize hand washing. However, despite hand washing, healthcare workers could touch other parts of their bodies or clothing that has not been properly decontaminated and consequently infect themselves. 18 More intensive education and training is required for safe doffing. Evaluation of the effectiveness of training is also required.", "Conclusion A significant number of contaminations occur during the doffing process of personal protective equipment. Clin Exp Emerg Med 2015;2(3):162-167 http://dx." ] },{ "paper_id": "80f0bc76680d66fa78c6665807bedcf74b190751", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Among viral pathogen species known to cause human diseases, 76.0% also infect other vertebrate animals [18, 19] . Moreover, a 41.8% seropositive rate against SFTSV has been reported in domestic animals in China, strongly suggesting that animals are major reservoirs of tick-mediated SFTSV transmission [1, 3, 4] . In addition, seropositive shrews and rodents were recently implicated as potential animal hosts susceptible to SFTSV [9] . A study in Korea showed that SFTSV-positive ticks are widespread throughout most provinces, particularly during summer [13] . Moreover, recent evidence has shown that SFTSV acts as a zoonotic pathogen, and further studies of serological prevalence in farming or wild animal species are necessary.", "SFTSV isolated from a human patient in Korea in 2013 was kindly provided by the Korea Centers for Disease Control and Prevention (KCDC) [25] . The SFTSV was grown in Vero E6 cells (American Type Culture Collection, USA) according to a previously described method [23] .", "Bovine field serum samples (n = 416) were collected from breeding cattle in the southern part of Korea (Gyeongsang province) from September 2013 to August 2014." ] },{ "paper_id": "810e609cbc20ab7c1543f7131f18b7fd0a3e2ca8", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Finally, DPO can be used for any PCR approach which makes use of the ability of primers to specifically hybridize to complementary sequences except for the case of long and accurate PCR (LA-PCR) which is achieved by DNA polymerases having proofreading activity (e.g. Pfu). It was found that such DNA polymerases have a tendency to completely drop off the DNA when they encounter inosine in a PCR primer (20) .", "Since the development of the polymerase chain reaction (PCR), a variety of modifications in primer design and reaction conditions have been proposed to enhance and optimize specificity (1-3), but a fundamental solution for eliminating non-specific priming still remains a challenge and limits the versatility of PCR in nucleic-acid-based tests (NATs). Achieving a high level of specificity in priming currently requires very rigid primer search parameters and optimization of PCR conditions. Even when these requirements are satisfied, a high risk of nonspecific priming is inevitable.", "fragments, and no false positives. In addition, DPO primers detected the influenza A virus in patient 1 (lane 6), which was not detected using the conventional primer system (lane 1). The presence of respiratory viruses in each patient was further validated by sequencing the fragment. These results indicate that a DPO-based multiplex PCR approach is a reliable tool for detecting multiple pathogens." ] },{ "paper_id": "817a885e9613363e08ef920a9e5826a4cb9e1c1e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "818b42cf815357fc1ee73a17caa5dfef24c55027", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.", "PEDV specific IgG titer was increased gradually until 32 dpi PEDV specific IgA titer was increased until 21 dpi Duodenum" ] },{ "paper_id": "818d12fd5ffa6680a7624f66305538221c85300e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A full ophthalmological examination, including slit lamp biomicroscopy (portable Keeler PSL \u00ae , Keeler Ltd., Windsor, U.K.) and indirect ophthalmoscopy (Vantage Indirect Ophthalmoscope \u00ae , Keeler Ltd.), was performed. Based on the history and the ophthalmic findings, a tentative diagnosis of hypovitaminosis A was made. Blood samples were collected, transferred into lightblocking containers, and sent to the laboratory for serum vitamin A measurement using liquid chromatography.", "No clinical response was identified in the affected calves. However, no further ocular problems were observed in this herd. The affected calves were planned to be brought to market weight and presented for slaughter.", "Vitamin A levels in the animal body depend on dietary sources of \u03b2-carotene as de novo synthesis of this micronutrient does not occur in vertebrates [5] . Therefore, it has been reported that vitamin A deficiency could occur more often in winter or spring, when the animal diet might lack green plants, an important source of \u03b2-carotene. It is well-known that hypovitaminosis A occurs in young cattle [3, 6] . However, hypovitaminosis A accompanied by blindness has been uncommonly reported in Hanwoo calves [10] . The purpose of this case report is to present two bovine patients of hypovitaminosis A and to discuss its cause and the ways to prevent it.", "A standard physical examination was performed on all cattle in the herd. No abnormalities were observed, except for complete blindness noted in the two calves from among 11 cattle, a morbidity rate of 18%. The calves exhibited bilaterally dilated pupils on slit lamp biomicroscopy, with no menace response or pupillary light reflex. The fundus examination using the indirect ophthalmoscope and a portable fundus camera (Genesis \u00ae , Kowa, Tokyo, Japan) revealed swollen optic discs with indistinct margins bilaterally in both calves. No retinal changes, except for papilledema and an enlargement of the retinal veins, were observed ( Fig. 1) ." ] },{ "paper_id": "8198fbb4175a2f90bcb43dafc0a365677c916d77", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Primer A 5'-GTTTCCCAGTCACGATA-(N 9 )-3' Primer B 5'-GTTTCCCAGTCACGATA-3' ", "The video component of this article can be found at http://www.jove.com/video/2536/", "The steps of the Virochip assay include (1) nucleic acid extraction from clinical samples, (2) reverse transcription of extracted RNA and 2 nd strand cDNA synthesis, (3) PCR amplification of randomly primed cDNA, (3) Cy3 fluorescent dye incorporation, (4) hybridization of labeled material to the Virochip microarray, and (5) scanning and analysis ( Figure 1 ). The protocol shown below will demonstrate the use of the Virochip assay on a nasal swab sample from a child with an influenza-like illness." ] },{ "paper_id": "81a11c6680ce725535704809655d945cd1d4a088", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "smFRET measurements were performed using a homebuilt total internal reflection fluorescence (TIRF) microscope (IX71, Olympus) equipped with a 100\u00d7 objective (UAPON 100XOTIRF, Olympus), a 532-nm laser (CL532-075-L, CrystaLaer) and an EMCCD (iXon DU-897D, Andor). Details of the microscope setup are described in Supplementary Methods.", "Dye-labeled RNA complexes were immobilized on a slide surface, in a buffer containing 40 mM HEPES-KOH (pH 7.5), 70 mM NH 4 Cl, 7 mM Mg(OAc) 2 and 1.7 mM Trolox (Sigma-Aldrich). To improve dye stability, the following oxygen scavenging system (43) was also included in the buffer: 2.6 mM protocatechuic acid (PCA; Sigma-Aldrich) and 48 nM protocatechuate 3,4-dioxygenase (PCD; Sigma-Aldrich). Fluorescence movies were recorded at 20 Hz using SMET, a LabView-based program package (44), and processed by the IDL (Exelis) scripts released from Taekjip Ha's lab (https://cplc.illinois.edu/software). Time-evolved smFRET traces were analyzed by custom-written MAT-LAB programs. The first 10 data points from each trace were averaged and reported for FRET distribution.", "Dye-labeled RNA oligomers were synthesized by Dharmacon, with Dy647 (acceptor) and Dy547 (donor) covalently linked to the 5 and 3 ends, respectively. Singlestranded DNAs (dna9-dna16) were synthesized (Life Technologies) with a (dC) 21 linker and a biotin tag on the 5 end for immobilization." ] },{ "paper_id": "81b22a5b5989dfc8f57c6d05fd29d3c735785887", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Middle East respiratory syndrome coronavirus (MERS-CoV) continues to cause outbreaks in humans as a result of spillover events from dromedaries. In contrast to humans, MERS-CoV-exposed dromedaries develop only very mild infections and exceptionally potent virus-neutralizing antibody responses. These strong antibody responses may be caused by affinity maturation as a result of repeated exposure to the virus or by the fact that dromedariesapart from conventional antibodies-have relatively unique, heavy chain-only antibodies (HCAbs). These HCAbs are devoid of light chains and have long complementarity-determining regions with unique epitope binding properties, allowing them to recognize and bind with high affinity to epitopes not recognized by conventional", "To sequence the inserts, colony PCR was performed using PfuUltra II Fusion HS DNA Polymerase (Agilent Technologies) and primers (29) 5\u2032-TTATGCTTCCGGCTCGTATG-3\u2032 (MP57) and 5\u2032-CCA-CAGACAGCCCTCATAG-3\u2032 (GIII) under the following conditions: initial denaturation at 95\u00b0C for 3 min, followed by 39 cycles of (95\u00b0C for 20 s, 55\u00b0C for 30 s, and 72\u00b0C for 40 s), and a final extension at 72\u00b0C for 5 min. The amplicons were gel-purified and sequenced in both directions using the BigDye Terminator v3.1 Cycle Sequencing Kit and an ABI PRISM 3100 genetic analyzer (Applied Biosystems). The obtained sequences were assembled and aligned using CLC Genomics Workbench (CLC Bio 4.9)." ] },{ "paper_id": "81c92759c804f01629de5c8499535a5b300b5f16", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "81cfdc6601a05ba9db405a714d3372ea328a2186", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study included 6138 FRI episodes among 5677 participants (enrolled over approximately 5 years; " ] },{ "paper_id": "82256b182006e2f9abcd1475c906b290a8daad13", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "824e4aebd39a0531625542fb7328917bb061e5a4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "MERS-CoV has caused sporadic infections, along with several local outbreaks throughout the Middle East since its discovery in 2012 [25, 26] . Although much remains unknown, closely related viruses have been isolated from camels [27] and highly homologous MERS-like bat CoVs have been identified in African Neoromicia capensis bats [28] . Local surveillance efforts have detected high levels of antibodies that recognize MERS-CoV in dromedary camels [29] ; furthermore, sampling of archived camel serum samples has revealed MERS antibodies from as early as 1992 [30] . These data suggest that bat to camel to human transmission routes may have seeded the 2012 outbreak in human populations, perhaps associated with the expanding camel trade that has emerged between equatorial Africa and Saudi Arabia over the past 20 years.", "In this review we focus solely on hCoV interactions within the context of the respiratory system and infection of relevant cell types. More specifically, we review some CoV-host interactions that alter cell-intrinsic antiviral defence programmes and other host pathways that contribute to pathological findings of ARDS, with its associated exudative and organizing phase diffuse alveolar damage and pulmonary fibrosis.", "Acute lung injury (ALI) and its more severe form, acute respiratory distress syndrome (ARDS), can arise after many types of injury to the lung, including sepsis, mechanical and chemical injury and bacterial and viral infections [1] . In ALI, the mortality rate is in the range 20-30%, with about 55% of the cases progressing to ARDS within a few days. ARDS causes significant morbidity and approximately 40% mortality, resulting in \u223c75 000 deaths/year in the USA alone [2] . In the past two decades, five emerging viruses have been known to cause significant ARDS-related mortality, including influenza H1N1 2009 and, in particular, the highly pathogenic avian influenza H5N1 and H7N9 viruses and the SARS and MERS coronaviruses. In this review we focus on mechanisms of coronavirus-induced lung pathogenesis and ARDS." ] },{ "paper_id": "8263c153cb3159c41641227ad129b668e9bc2d76", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "82742db34be3eee4be2483c14909b1e62e3912ae", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Serum samples collected from RVFV G-protein-immunized mice were used to generate 2-fold serial dilutions. Next ", "A polyclonal antibody against the RVFV G-protein (1:4,000 dilution; IBT Bioservices) was diluted 20-fold and 40-fold.", "To enhance expression, codon optimization was performed on the G-protein gene sequence of the RVFV ZH501 strain. The cloning primers were designed based on optimized sequences, and Not I and Kpn I restriction sites were introduced at the 5\u00b4 ends of the upstream (5\u00b4-CGGGGTACCATGGCTGGTATC GCTATGAC-3\u00b4) and downstream (5\u00b4-ATTTGCGGCCGCTT AAGAGGCTTTCTTTGTGGC-3\u00b4) primers. The primers were synthesized by Sangon Biotech (China)." ] },{ "paper_id": "82994e41869e2ada2685ca424ac757c20e6c88c3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A definite mechanism for SILI is not yet known. However, some authors proposed that the potential toxicity mechanism might be mediated by intracellular lipid metabolism, mitochondrial metabolism, and immunologic response, as well as some genetic or other predisposing factors 7 . Diagnosis of SILI generally depends on the relationship between causative agents and clinical symptoms, as well as radiologic findings and the exclusion of infectious diseases, because of its unclear mechanism.", "Statins, hydroxymethylglutaryl CoA reductase inhibitors, are known to lower the plasma low-density lipoprotein (LDL) cholesterol level and reduce the incidence of cardiovascular events and mortality 1, 2 . Currently available statins include lovastatin, pravastatin, simvastatin, fluvastatin, atorvastatin, Tuberc Respir Dis 2015;78:281-285", "Although the histopathological findings are also non-diagnostic, based on prior reports and studies, the possibility of diagnosis is significantly increased if the alveolar macrophages have a foamy appearance, as confirmed by cytology, along with the patient' s clinical history 8 . Furthermore, some reports suggested that the most prominent feature of DILD on BAL fluid was a lymphocytic alveolitis either pure or associated with neutrophil and/or eosinophilic alveolitis along with an imbalance in T lymphocyte phenotype 9 ." ] },{ "paper_id": "829ce386c84e17559ca6a06ee9aee0475e473343", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Parents were trained to recognise respiratory symptoms and provided with diary cards designed in a tick-box format and listed with predefined respiratory symptoms or diagnoses to be completed daily and returned by regular mail monthly. The diary cards were modified from a prior study 16 and used successfully elsewhere. 17", "What is the key question?", "Of 891 potential participants approached, 165 (18.5%) eligible singleton infants from 163 families were enrolled (two families enrolled two siblings) (figure 1). Seven were excluded subsequently; one from ineligibility (born <36 weeks) and six for failing to provide any swabs. " ] },{ "paper_id": "82b0cd320ba1e619c08fee764bec158f166fab55", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplementary materials are available at Open Forum Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.", "Ribonucleic acid was extracted using QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany) following the manufacturer's protocol. Complementary deoxyribonucleic acid (cDNA) was synthesized using ReverTra Ace qPCR RT kit (Toyobo, Osaka, Japan). Ribonucleic acid was quantified using real-time polymerase chain reaction (PCR) with an Applied Biosystems 7300 real-time PCR system. Real-time PCR was performed using 2 \u03bcL of cDNA with specific primers targeting the genes of interest (\u03b2-actin, forward, AGTGTGACGTGGACATCCGCAAAG and reverse, ATCCACATCTGCTGGAAGGTGGAC; ZIKV, forward, CAACTACTGCAAGTGGAAGGGT and reverse, AAGTGGTCCATATGATCGGTTGA) and 5 \u03bcL of quantitative PCR SYBR Green real-time PCR Master Mix (Toyobo) in a final reaction volume of 10 \u03bcL. The cycling conditions were 45 cycles of 95\u00b0C for 15 seconds, 60\u00b0C for 15 seconds, and 72\u00b0C for 30 seconds. Messenger RNA (mRNA) expression (fold induction) was quantified by calculating the 2 \u2212\u0394CT value, with \u03b2-actin mRNA as an endogenous control.", "Various concentrations of compounds were added to Vero cells for 3 days, and the cell viability was determined using CellTiter-Glo luminescent cell viability kit (Promega, Madison, WI) according to the manufacturer's instructions." ] },{ "paper_id": "82dcb53e236df1adb5c3c9f5291dc4e8eabb354a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Klebsiella pneumoniae 4", "Pseudomonas aeruginosa 2", "Stenotrophomonas maltophillia 1", "To assess the goodness of fit of the logistic regression model, the Demographic and clinical data are summarized in Table 1 . The patients (32 boys and 25 girls) ranged in age from 1 month to 9 years (median, 9 months) and 44 (77%) children were less than 1 year old." ] },{ "paper_id": "82f9d88193226177c20342d42a29a26ebba90fa1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "A random group of 105 camels that presented for slaughter in February (n053) and March (n052) 2014 were sampled for MERS-CoV analysis (Table 1) . Animals either had come directly from within Qatar or KSA, or had been sold through the central animal market (CM).", "Two of the earliest Middle East respiratory syndrome (MERS) cases were men who had visited the Doha central animal market and adjoining slaughterhouse in Qatar. We show that a high proportion of camels presenting for slaughter in Qatar show evidence for nasal MERS-CoV shedding (62/105). Sequence analysis showed the circulation of at least five different virus strains at these premises, suggesting that this location is a driver of MERS-CoV circulation and a high-risk area for human exposure. No correlation between RNA loads and levels of neutralizing antibodies was observed, suggesting limited immune protection and potential for reinfection despite previous exposure.", "To obtain further insight in the diversity of the viruses that circulated in dromedary camels at the slaughterhouse, MERS-CoV strains were sequenced according to a recently developed technique that enables the identification of divergent MERS-CoV types [sequences and technique in (8)]. In total, five different sequence types were identified with three different types found at both sampling moments (Table 2) . Camels either came from the large Al-Shahaniya international racing complex (ASH) or from different sources elsewhere in Qatar (indicated by the initial arrow for animals 6\u00c18 and 10\u00c112 in (Table 2) . Subsequently, they were either brought to a showing area (Al Mazad, AM), to the barns at the CM for a holding period, or immediately sent to the slaughterhouse (SH). Therefore, the sampling for animals 1\u00c15 and 9\u00c113 reflects MERS-CoV sequence diversity as a result of import from other regions in Qatar, whereas virus circulation at the CM more likely explains the virus diversity for animals 6\u00c18." ] },{ "paper_id": "8301fef06e9bbbde5f145096ba75e82f3e0ec160", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Flow cytometric analysis. cancer cell apoptosis was calculated via flow cytometry. cells were harvested and washed three times with PBS, after which they were stained with Annexin V-fluorescein isothiocyanate (FITC) and propidium iodide (Pi) in binding buffer. apoptosis was assessed using a FACSCalibur flow cytometer (BD Biosciences, Franklin Lakes, nj, uSa) after 15 min incubation at room temperature in the dark. fluorescence was detected at an excitation wavelength of 480 nm via FL-1 (530 nm) and FL-2 filters (585 nm). The number of apoptotic cells was then analyzed using Win-mdi software (version 2.9; http://facs.scripps.edu/wm29w98.exe).", "Fluorescence imaging. tissue samples were washed twice with PBS and fixed with 3.7% (v/v) formaldehyde in PBS for 15 min. cells were permeabilized for 5 min with 0.1% triton X-100. for immunofluorescence, phosphorylated (p)-nf-\u03baB and 50 \u00b5g/ml mouse anti-caspase-3 antibodies were employed, followed by incubation with 2 \u00b5g/ml alexa fluor 488-goat anti-mouse secondary antibodies. daPi (Sigma-aldrich; merck KGaa, darmstadt, Germany) was also used to stain cells. images were acquired by confocal laser scanning using epifluorescence microscopy (nikon te2000-e; Shanghai Sunny Biotech co., ltd., Shanghai, china).", "Cell culture and treatment. B16f10 murine melanoma cells and Hs68 human foreskin fibroblast cells were purchased from american type culture collection (manassas, Va, uSa). the cells were maintained in a monolayer culture in dulbecco's modified Eagle's medium (dmem; Gibco, Grand island, nY, uSa) supplemented with 10% fetal bovine serum (fBS; Gibco), 0.012% penicillin G, 0.027% streptomycin, 0.022% sodium pyruvate and 0.26% sodium bicarbonate at 37\u030ac in an atmosphere containing 95% air and 5% co 2 . juglanin stock solution was prepared in dimethyl sulfoxide (dmSo) and was diluted to the desired final concentration (10 and 20 \u00b5M) in culture medium 24 h prior to use. The final concentration of DMSO did not exceed 0.1% (v/v)." ] },{ "paper_id": "830267d850fecba497f80f0c51331a397a734a94", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8318896fad2acf22ac94d15d6d571dd2f7cf121d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "83303635687128ac583152565ba1d7e29540f2af", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In support of this, the WHO has produced guidelines to promote hand-washing practices among member countries.", "The topic of HCAIs is a very broad issue, and it has therefore not been possible to cover all aspects of HCAIs in one paper; hence, we have been selective in selecting key aspects of the current debate. " ] },{ "paper_id": "8387ba520ac3172c8b428e5c95b6aad52d23d509", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "839df627ece5b5fc7bb1ce3b4f96127677fd0494", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "83bb5fda8d9d959fe92af64a2f154c9dcbe38bc0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Unlike animal-based toxicology testing, there are clearer definitions and greater agreement for what constitutes cytotoxicity in vitro. Classically speaking, a compound or treatment is considered to be cytotoxic if it prevents cellular attachment, causes dramatic morphological changes, adversely affects replication rate, or leads to a reduction in overall viability [2] . It should be noted that the manifestation of these effects is greatly dependent on length of compound exposure and mechanism of cytotoxicity [3] .", "Well Number signal from serum sources of LDH found in supplemented growth media [47, 48] . Exogenous sources of LDH greatly elevate background values and negatively impact the overall signal window. This experimental detriment can be largely mitigated by careful pre-screening of serum sources for cell culture prior to LDH assay. LDH assays are also subject to assay artifacts by compounds that inhibit the LDH activity and by standard fluorescence and color quenching interferences [49] [50] [51] .", "Reagent compatibility is a major consideration in samewell multiplexing. There is an absolute requirement that individual signal readouts are distinct and can be parsed for meaningful data set analysis. Also, reagent formulations must not compromise functional aspects of the chemistries. For instance, lytic assays for ATP measurement or caspase activation must be conducted in a sequence-specific order after first measuring experimental cytotoxicity.", "All commercial ATP quantification reagents contain luciferase enzyme and luciferin substrate supplied with a lytic buffer. Cell lysis is necessary to liberate cellular ATP and is typically facilitated by detergents in the buffer. The most useful formulations for HTS applications also contain thermostable recombinant luciferase and ATPase inhibitors which allow for \"glow-type\" luminescence that produces a sustained signal with a half-life on the order of 5 hr [34, 35] . Prolonged maintenance of the luminescent signal allows for batch processing of plates and obviates any inter-plate kinetic variability." ] },{ "paper_id": "83dee742692ed551c9fcdc5d76742f44acce2057", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Variants from the reference sequence comprising at least 5% of reads were identified by the quality-based variant detection algorithm in CLC Genomics Workbench, using a neighbourhood radius of 5, minimum neighbourhood quality score of 25 and a minimum central quality score of 29.", "Next-generation sequencing data were analysed using a custom workflow in CLC Genomics Workbench 8.5 (Qiagen, Hilden, Germany). Adapters, and an additional 26 bp, were trimmed from each end to remove any residual PCR primer sequence. Remaining reads were trimmed from the 3\u2032 end using a CLC cumulative quality score of 0.05. Trimmed reads were aligned to a reference, and a consensus sequence was called based on regions that had 10\u00d7 or greater coverage.", "Refer to Web version on PubMed Central for supplementary material." ] },{ "paper_id": "83e5553035f500f4bcc4aeeaa41aa74ebf578567", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analyses were performed using SPSS (version 18) and unpaired Student's t test, considering a P < .05 as significant.", "Nasopharyngeal samples were collected using nylonflocked nasal swabs. The swabs were immersed in 3 mL of 1\u00d7 phosphate buffered saline and kept at \u221270\u00b0C until further use (see below). Relevant clinical information as well as demographic data, including age, gender, and epidemiological data, were collected with a standardized questionnaire and from medical files of patients included in this study.", "The study protocol was reviewed and approved by the research ethics committee of the College of Medicine, Hawler Medical University, and the collection and use of clinical samples and data from patients at the Raparin Pediatric Teaching Hospital was approved by the Erbil Director of Health. Informed consent was obtained from the parents of all the participating children." ] },{ "paper_id": "845be0716daab542bf27a9d735e03f86a8f3ea85", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Marcia Slater and Elen Ortenberg are employees of Thermo Fisher Scientific Inc. that produces reagents and instruments used in this article.", "NOTE: Keep all reagents and samples used in the preamp reaction on ice at all times. Following preamp, keep all reagents at room temperature.", "The Center for Disease Control (CDC) influenza matrix assay described by Shu et al. 7 ). The significance of adapting these tests to a high-throughput platform with a species-independent internal control is that they can be incorporated into a OneHealth surveillance approach. Having both of these assays on a high-throughput testing platform will facilitate emergency preparedness for clinical facilities, shelters, and performance events.", "With the demand for rapid and comprehensive detection of multiple agents in clinical diagnostics for humans and animals, single-organism molecular diagnostic methods for pathogen detection are burdensome unless used for large numbers of samples being tested for a single disease. In the veterinary context, high-throughput diagnostic methodologies are particularly important due to the additional need for covering pathogens from a wide variety of species. OneHealth approaches for management of food-borne disease and emerging pathogen surveillance are examples of testing needs that include a number of bacteria, viruses (DNA or RNA based), parasites, and fungi. The challenge to combining tests for multiple analytes together (multiplexing) in order to improve testing efficiency is a possible loss of sensitivity and a large burden for optimization and validation of assays." ] },{ "paper_id": "84d00088f2124eac73c0e79cb15fbe4924109178", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "84d3fe51518523e73a65e73756e4496587e4f2f4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The affinity-purified protein sample was concentrated by tangential flow filtration using Amicon Ultra centrifugal filters (Merck) to 1 mg/ml for further analysis. For size exclusion chromatography, concentrated protein sample was mixed with BSA control and loaded onto a Superdex 200 increase 10/300 GL column (GE Healthcare) after pre-equilibration with buffer containing 50 mM HEPES-KOH (pH 8.0). Chromatography was taken with BioLogic Nucleic Acids Research, 2019, Vol. 47, No. 11 5839 DuoFlow system (Bio-Rad) at a flow rate of 1 ml/min. Peak analysis was performed using the ASTRA software package (BioLogic Chromatography Systems).", "A BioLux Gaussia luciferase assay kit (New England Bio-Labs, Ipswich, MA, USA) was used to measure the GLuc activity. Culture supernatants were harvested and centrifuged at 10 000 g for 3 min. A 20-l volume of supernatant was added into a 96-well white plate, and 50 l of GLuc assay solution was added and mixed with culture supernatant immediately before measurement of the luminescence by the use of a VarioSkan Flash reader (Thermo Fisher Scientific).", "Supplementary Data are available at NAR Online.", "Total cellular RNA was isolated using TRIzol reagent (Tiangen, Beijing, China). RT was performed using a Re-verTra Ace qPCR RT kit following the protocol of the manufacturer (Toyobo, Kyoto, Japan). Quantitative PCR was carried out utilizing SYBR green real-time PCR master mix (Toyobo). The RT and qPCR primers were described previously (41) ." ] },{ "paper_id": "84da44d2366d3f082d0ec30cbaff70807ca732c7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/ licenses/by-nc/3.0) which permits unrestricted noncommercial use, distribution, and reproduction in any medium, provided the original work is properly cited.", "A new strain of influenza A virus, H1N1 subtype as \"Pandemic H1N1 influenza\", proved by the Institutional Review Board of Dongguk University Gyeongju Hospital." ] },{ "paper_id": "84dc4e9ee5f8dd324d2d436d7c07c7d0044a58a4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "84ef152ba76ced39a6ab7f082895541c1b3ea9ec", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Patient consent for publication Not required.", "Provenance and peer review Not commissioned; externally peer reviewed." ] },{ "paper_id": "84f8946f903a07243c54bde0a3e6d5ccecf9c5b9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study showed that a BCoV vaccine provides horses with antibodies against ECoV to some extent. It is unclear whether the antibodies provided by the BCoV vaccine are sufficient to be effective against ECoV, and therefore ECoV challenge studies in horses are needed to evaluate the efficacy of the vaccine in the future.", "Statistical analysis was carried out using Ekuseru-Toukei 2012 (SSRI, Tokyo, Japan). Logarithmic transformations of the reciprocal antibody titers were made to stabilize variances. Antibody titers after logarithmic transformation were analyzed by one-way ANOVA with Dunnett's multiple comparison post hoc test using the antibody titers at 0 dpi as control. A P-value of <0.05 was considered statistically significant.", "doi: 10 .1292/jvms. first isolated in the United States in 1999 [4, 17] . Two-fold serial dilutions of serum were mixed with an equal volume of viral suspensions containing two hundred 50% tissue culture infective doses per 0.1 ml and incubated for 60 min at 37\u00b0C. Then, 0.1 ml of each mixture was applied to HRT-18G cells on 96-well plates and incubated for 6 to 7 days. Virus-neutralizing antibody titers were expressed as the reciprocal of the highest serum dilution that inhibited viral cytopathic effects." ] },{ "paper_id": "8509342038d6b5c6a8a9d980bf207a83f37cd970", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "They were asked open-ended questions about their ongoing participation in increased consultation time, to ascertain the chances of institutionalizing the protocol and to obtain their suggestions for improving the project.", "The study protocol was reviewed and approved by the Institutional Review Board (IRB) in Seoul National University Hospital (IRB No.H-1707-139-871) and written informed consents were collected from all subjects.", "Data for baseline characteristics were presented as mean \u00b1 standard deviation, number, and percentage. Differences in perceived and preferred consultation time were tested using the Student's t test. The control group was selected after adjusting for the effects of gender and age. All analyses were conducted using SPSS (version 23.0; SPSS, Inc., Chicago, IL, USA) and GraphPad Prism (version 8.0; Graphpad Software, Inc., San Diego, CA, USA) software. Statistical significance was indicated when P values were < 0.05.", "Patients visiting the tertiary hospital for the first time could only be enrolled if they fit the protocol of the 13 participating departments, and possessed a referral letter from their primary care physician explaining why the referral was recommended and what medical services were anticipated (Supplementary Fig. 1) . We defined serious and non-curable disease as four serious diseases-cancer, stroke, coronary artery disease, and rare and intractable disorders-by regulations." ] },{ "paper_id": "854545208a6bc7cafa8744604899e32237ff2047", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Statistical analysis. In the cell viability assays and MMP experiments, all data were expressed as the mean \u00b1 standard deviation. Statistical significance among groups was assessed using one-way analysis of variance and the Tukey test. P<0.05 was considered to indicate a statistically significant difference. Finally, statistical analyses were performed using GraphPad Prism 5.0 (GraphPad Software, Inc., La Jolla, CA, USA).", "Determination of mitochondrial membrane potential (MMP). At 24 h following transfection, the culture medium of the NCI-H292 cells was replaced with DMEM that did not include phenol red and was supplemented with 5 mg/l JC-1 dye (Beyotime Institute of Biotechnology) in the dark for 20 min at 37\u02daC. Subsequently, the cells were washed twice with PBS and placed in fresh medium without serum. Finally, MMP was analyzed by calculating the ratio of fluorescence intensity at 555-488 nm in triplicate.", "Avian influenza A (H5N1) virus is a highly pathogenic contagious agent that causes severe impairment in poultry and humans, particularly limited person-to-person transmission (1) . The cumulative number of confirmed human cases of H5N1 from 14 countries between November 2003 and July 2014 reached 667, 393 of which were fatal according to a report issued by the World Health Organization (2). In total, 47 individuals infected with H5N1 were identified in China and 30 (63.8%) succumbed to the H5N1 infection (2). H5N1 causes primary viral pneumonia with rapid progression to lung failure following invasion of epithelial cells in the upper and lower respiratory tracts (3) . However, the exact mechanism for elucidating the severity of human H5N1 infection remains unclear. Previously, apoptosis was not only observed in the alveolar epithelial cells of 2 patients who succumbed to H5N1 infection, but was also induced by H5N1 in numerous cell types in vivo and in vitro (4) (5) (6) . These results indicated that apoptosis may be important in H5N1 pathogenesis in the human body." ] },{ "paper_id": "8582184d3d2e497088f716ad0fa5bd49976f0dd3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Teresa Keico Nagasse-Sugahara RESUMO A abordagem metagen\u00f4mica tem sido ferramenta muito importante atualmente na descoberta de novos v\u00edrus em amostras ambientais e biol\u00f3gicas. Aqui discutimos a maneira como essas descobertas podem ajudar a elucidar a etiologia de doen\u00e7as e os crit\u00e9rios necess\u00e1rios para que a associa\u00e7\u00e3o causal entre um v\u00edrus e uma doen\u00e7a seja estabelecida.", "Because of the difficulties encountered when applying the postulates of causality, it is accepted that not all criteria listed by authors need to be fulfilled. 7, [9] [10] [11] 19 In case it is impossible to fulfill all the criteria, the evidence accumulated over time and the common sense of researchers will be important to identify the causal agent of a certain disease. 9,13,19", "In the end of the 19 th century, Koch 11 defended the fundamental principles that helped establish the causal association between microorganisms and infectious diseases according to a set of criteria laid out by him. According to this author, a proof of causality requires the agent to be present in every case of a particular disease, to be absent in other diseases, and after isolation and culture, be sufficient to reproduce the disease by inoculation of a susceptible host." ] },{ "paper_id": "85b24dcdfc025236507fb1a3bdbb8eb816bbef92", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "85c04886b69b27eeddd4a72c74e2e1727a80598f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Coronaviruses are found in a wide variety of animals and are associated with respiratory, enteric, hepatic and neurological diseases of varying severity. Based on genotypic and serological characterization, coronaviruses were divided into three distinct groups (1) (2) (3) . As a result of the unique mechanism of viral replication, coronaviruses have a high frequency of recombination (2, 4) .", "CoVDB is constructed by the Department of Microbiology, the University of Hong Kong. It is available at no charge at http://covdb.microbiology.hku.hk. ", "MyBlast. 'MyBlast' employs the same blast program as the Blast page mentioned above. However, instead of selecting a predefined nucleotide or amino acid sequence database, multiple sequences can be pasted into the second sequence input box to generate a temporary sequence database. One or more query sequences can be pasted into the first sequence input box for blastn or blastp search against the temporary sequence database." ] },{ "paper_id": "85dfb59af4c4ec824f1f62c645e5b91a6e3cc814", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "85e8b1143c1869125270527aa26d4e48ad63fb5b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Seasonal influenza is a significant problem for travellers that should be routinely addressed in pre-travel counselling and in the differential diagnosis of any returning traveller with fever.", "There are several ways to decrease the risk of catching influenza. First of all hygienic measures, including active ventilation of crowded places, hand sanitation and (possibly) wearing a facemask can reduce the risk of spreading influenza. Influenza prevention by vaccination and specific problems associated with vaccinating travellers against influenza, are discussed in more in detail below. As an adjunct to vaccination, the value of early antiviral therapy or prophylactic antiviral usage is also discussed.", "Conflict of interest: None declared." ] },{ "paper_id": "85f0fe06df221d355fc228db1495a4f940e7c9b7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "85f4ff3ff33bcc47e9826ee3bd468626fba5870d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "85f7430c807f1334c2b9c5621304e9e7fa8ad64a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "19", "Upload your completed checklist as an extra file when you submit to a journal.", "In your methods section, say that you used the SPIRIT reporting guidelines, and cite them as: " ] },{ "paper_id": "860ffcab2771f1935ac5a59e986d416a603b3de3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study protocol was reviewed and approved by the Animal Ethical Experimentation Committee ", "ARTICLE HISTORY" ] },{ "paper_id": "8682e080613d625a9f6955e5eb0fe80bbbaefda9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Plasmids and transfection. All plasmids used were created as previously described using a Gateway expression system (Invitrogen) (56) . Briefly, all constructs had a modified pCAGGs backbone containing a Woodchuck hepatitis virus posttranscriptional regulatory element (WPRE) and were C-terminally tagged with either an HA tag sequence followed by a tobacco etch virus (TEV) cleavage site and a biotinylation signal sequence (HA-Bio) or an HA tag sequence followed by a 3\u03eb FLAG tag sequence (HA-3\u03ebFLAG). Transfections were conducted using Lipofectamine 2000 (Invitrogen) per the manufacturer's protocol." ] },{ "paper_id": "869a5a7ca9cf0fc9a2f5cd0332ac7c6b8e8e2ab9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Furthermore, our results show that Irf8 depletion does not promote pDC differentiation into tDC-like cells.", "Wu, X., Satpathy, A.T., Kc, W., Liu, P., Murphy, T.L., and Murphy, K.M. (2013) . Bcl11a controls Flt3 expression in early hematopoietic progenitors and is required for pDC development in vivo. PLoS ONE 8, e64800.", "Wu, X., Brise\u00f1 o, C.G., Durai, V., Albring, J.C., Haldar, M., Bagadia, P., Kim, K.-W., Randolph, G.J., Murphy, T.L., and Murphy, K.M. (2016) . Mafb lineage tracing to distinguish macrophages from other immune lineages reveals dual identity of Langerhans cells. J. Exp. Med. 213, 2553 -2565 . Zhang, H., Gregorio, J.D., Iwahori, T., Zhang, X., Choi, O., Tolentino, L.L., Prestwood, T., Carmi, Y., and Engleman, E.G. (2017 . A distinct subset of plasmacytoid dendritic cells induces activation and differentiation of B and T lymphocytes. Proc. Natl. Acad. Sci. USA 114, 1988 USA 114, -1993 " ] },{ "paper_id": "86afebc58ebd3a14ab6d730d4c5fc32dc56ec3c5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Anti-Ly6G (1A8) antibody (UCSF Monoclonal Antibody Core, San Francisco, CA) or total rat immunoglobulin G (Sigma-Aldrich) as control were given to mice. A total of 50 \u03bcg of the antibodies were administered once i.n. 4 hours before bacterial infection.", "Levels of cytokines and chemokines in BAL fluids were quantified using Luminex multianalyte technology (Luminex Molecular Diagnostics, Toronto, Ontario), according to the manufacturer's protocols. Levels of IFN-\u03b1 were measured in BAL, serum, and culture supernatants using the VeriKine Mouse Interferon Alpha ELISA Kit (PBL Interferon Source, Piscataway, NJ).", "Flow cytometry was performed on BAL and lung cells. Cells were incubated for 15 minutes with the CD16/CD32 Fc block antibody and then stained with extracellular antibodies (BD Biosciences unless otherwise stated) for antigen-presenting cells (APC-Cy7-anti-CD45, Alexa Fluor 700-anti-MHCII (eBioscience, San Diego, CA), Pacific Orange-anti-Gr1 (Life Technologies, Burlington, Ontario), APC-anti-CD11c, PECy7-anti-CD11b), NK cells (V450anti-CD3, PE-anti-NK1.1), and T cells (V450-anti-CD3, APC-Cy7-anti-CD4). Stained cells were analyzed on the LSRII flow cytometer (BD Biosciences) and analyzed using FlowJo software (Tree Star, Ashland, OR). Neutrophils (CD45 + CD11b + Gr1 + ), macrophages (CD45 + Gr1-AF + CD11c + ), NK cells (CD3-NK1.1 + ), and CD4 + T cells (CD3 + CD4 + ) were assessed as total number of cells per tissue compartment by multiplying the \"frequency of total\" of the population by total cell number in the tissue." ] },{ "paper_id": "86f8e5cdfe075d029d603b36ce6f43a5ed86a8a5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8793343683237029bac548225ba51f403489cd35", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Competing interests JV has received research grants from Maquet. RMK is a consultant for Covidien and has received honorarium from Maquet for lecturing.", "Provenance and peer review Not commissioned; externally peer reviewed.", "Data sharing statement No additional data are available." ] },{ "paper_id": "879df084e06fcce1980e3f73c36748068b39f049", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "87b8b85391605bcd1b6c7ddaf1189b3229db4e06", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "and p 1 , p 2 , q 1 , q 2 are non-negative parameters. The standard SIR model can then be modified as S'~L{mS{P S SI{n S SzlS q , I'~P I SI{ d I zazmzd I \u00f0 \u00de I, S' q~QS SI{ lzn Sq zm \u00c0 \u00c1 S q , I' q~QI SIzd I I{ d Iq zazm \u00c0 \u00c1 I q , R'~n S Szn S q S q zd I Izd I q I q {mR,", "with", ":" ] },{ "paper_id": "87dcbcb15da36050308aca4284d842193d99cd6c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Until now, little or no resistance to zanamivir has been observed [13] , and only a small percentage of A(H1N1)pdm09 viruses had highly reduced peramivir inhibition [19] . Although oseltamivir resistance was found in virtually all former seasonal A(H1N1) viruses, the frequency of oseltamivir resistance in A(H1N1)pdm09 viruses has remained low on a global scale. However, with the appearance of permissive mutations in A(H1N1)pdm09 viruses, the risk that oseltamivir-resistant viruses may spread globally is increasing [13] . With the appearance of permissive mutations in A(H1N1)pdm09 viruses, the risk that oseltamivir-resistant or even multidrug-resistant viruses may spread globally is increasing [13, 20] , and there is a need for new antivirals with other mechanisms of action." ] },{ "paper_id": "885674f9e88e504ac2fed625ec9c64fdc3ad71f0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The immunocomplex on Sepharose beads was resuspended in 300 Al of 0.1 M sodium citrate, pH 5.5, 0.1% Triton X-100, 0.1% 0-mercaptoethanol, 100 mg/ml aprotinin, and 1 mM CaC12. 10 mU of endo H was then added. After overnight incubation at 37\u00b0C, the beads were recovered and lysed in 80 Al SDS sample buffer followed by SDS-PAGE.", "The Journal .of Cell Biology, Volume 117, 1992 S46D. Chimeric cDNA coding for S46D was similarly constructed by using oligonucleotides 1 and 5 .", "Immunoprecipitated proteins were eluted from beads by boiling in 80 Al SDS sample buffer (without \u00df-mercaptoethanol) followed by dilution in several milliliters of lectin buffer (40 mM Tris-HCI, pH 7.5, 150 mM NaCl, 1 mM CaC12, 1 mM MgC12, and 1 MM MnC12). An aliquot of this was incubated withthe various lectin-agaroses (120 Al slurry) for 60-120 min. After extensive washing, the bound materials were eluted by boiling in SDS sample buffer and analyzed by SDS-PAGE." ] },{ "paper_id": "887264fa70bfd2130e5ef9089f058332364d6313", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Because of the severity and complexity of STIs, feasible and effective screening approaches are essential for timely implementation of effective infection control measures to prevent further transmission. Additionally, increases in antimicrobial drug resistance in N. gonorrhoeae and M. genitalium remain an important concern. 1 Large-scale epidemiological studies and surveillance programs are needed to determine optimal prevention strategies and to reduce the global burden of STIs." ] },{ "paper_id": "8894efb9895e24c82697cf864b69e9a2eb0751c2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The fractionation of membranes in the presence of high pH sodium carbonate was performed as described (Roberts et al., 1989) .", "The Fusl-LacZp expression plasmid pCJRll4 as follows: a 6-kb NheI-HindllI fragment, encoding the 254 NH2-terminal amino acids of the FUS1 protein fused to ~-galactosidase, under the GALl promoter (isolated from pCJRll3, a derivative of pSB231 (Trueheart and Fink, 1989) ) was cloned into the Xbal-Hindlll sites of pVT105U, a 2# plasmid (Vernet et al., 1987) , creating pCJR114.", "Oligonucleotides for mutagenesis were prepared by the University of Oregon Biotechnology Laboratory on an Applied Biosystems 380B DNA synthesizer (Foster City, CA) as described (Ito et al., 1982) . Tran35S-label and Zymolyase 100T were from ICN Biomedicals (Irvine, CA), Endo H was from Boehringer Marmheim (Indianapolis, IN), ultra-pure SDS was from BDH Biochemicals (San Francisco, CA), glusulase was from Dupont Pharmaceuticals (Wilmington, DE), and all antibodies (except anti-DPAP B, anti-DPAP A, anti-ALP, and anti-Vat2p antibodies) used for indirect immunofluorescence were from Jackson ImmunoResearch (West Grove, PA), Cappel Products (Malvern, PA), or Promega Biotech (Madison, WI). All other reagents were from Sigma Chemical Co. (St. Louis, MO). DPAP and invertase assays were performed as previously described (Gildstein and Lampen, 1975; Roberts et al., 1991) .", "For the simultaneous induction of the GAL/ promoter and the secl4 secretion defect, ceils were grown to log phase in minimal media plus raltinose and then harvested and resuspended in YEP-raitinose. After a 1-h incubation at 25~ galactose was added directly to the cultures and at the same time the cultures were shifted to 34~ After 2 h, the cells were fixed immediately and prepared for indirect immunofluorescence as described below." ] },{ "paper_id": "89122ac5b68dcc5252569b3be17c47f66385b7fb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8931fabdc25094445ab2450c3a5117dab632e868", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "CFTR. This could be explained by incomplete inhibition of proteasome activity and/or the involvement of other, presently unidentified proteolytic mechanisms.", "dence time at the cell surface. These in turn are responsible, at least in part, for the phenotypic manifestation of CF. We propose that the proteasome-ubiquitin pathway may be involved in the peripheral quality control of other, partially unfolded membrane proteins as well.", "We thank R. Haguenauer-Tsapis (Jacques Monod, University of Paris VII, Paris, France), J. Bonifacino (National Institutes of Health, Bethesda, MD), and M. Fukuda (The Burnham Institute, La Jolla, CA) for their generous gifts of cDNA. The authors are indebted to J. Brodsky ", "The influenza hemagglutinin (HA) epitope was attached to the NH 2 terminus ubiquitin using PCR mutagenesis and the cDNA of the yeast ubiquitin as template (provided by Dr. R. Haguenauer-Tsapis, Jacques Monod, University of Paris VII, Paris, France). To generate the Tac-Lamp1 chimera, the extracellular and transmembrane segment of the interleukin 2 receptor (Tac) was fused to the cytoplasmic tail of Lamp-1. The constructs were sequenced to verify that no errors had been introduced. The cDNA, encoding for the Tac and Tac-TCR \u2423 , were provided by Dr. J. Bonifacino (National Institutes of Health, Bethesda, MD). Tac, Tac-TCR \u2423 , and Tac-Lamp1 were stably transfected in BHK-21 cells using the pNUT expression cassette (Haardt et al., 1999) ." ] },{ "paper_id": "8946e4b778ae5312b4db84cd75b68848c39a3a93", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Of the 85 patients, 17 (20%) had contagious diseases and 37 (44%) were male. Most patients had fever (n = 64, 75%) and/or dyspnea (n = 66, 78%). Twenty-seven patients (32%) had septic shock, 33 (38%) had respiratory failure, 10 (12%) had heart failure, and 15 (18%) had an illness with an unknown cause.", "Samsung Medical Center is a modern 1,989-bed universityaffiliated tertiary hospital providing referral care in Korea and about 200 patients are seen in the ED each day. In ED for adult, there are 58 beds were spaced roughly 1.5-2.0 m apart with curtains or wall in between and ambulatory zone with 24 chairs for stable patients.", "The Institutional Review Board of the Samsung Medical Center approved this study and permitted the review and publication of patient records (IRB registration number 2016-08-166). The requirement for informed consent by individual patients was waived due to the retrospective design of the study." ] },{ "paper_id": "894e9a681490af51667a059d727a9cce8dddbf7f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00276-11/-/DCSupplemental. Figure S1 , TIF file, 0.3 MB. Figure S2 , TIF file, 0.4 MB. Figure S3 , TIF file, 0.6 MB.", "The views expressed are those of the authors and should not be construed as representing the positions of the U.S. Army or DoD." ] },{ "paper_id": "89767ba998659a73d2be1534cfaacdff2fbc0488", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "For all experiments, statistical analysis was performed using GraphPad Prism version 6.0.c (GraphPad Software, La Jolla, CA, USA). For all data obtained, we used the unpaired t-test to infer significance.", "All cells used in this study were maintained in RPMI-1640 medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS) (Biochrom). Primary B cells were isolated from human blood buffy coats by Ficoll (GE healthcare) density gradient centrifugation and positive selection using CD19 PanB Dynabeads (Life technologies) with corresponding DETACHaBEADs (Life Technologies). Primary B cells were cultured in medium supplemented with 20% FBS until LCLs were established. HEK 293 cells are human embryonic kidney cells generated by transformation with adenovirus (ATCC: CRL-1573). The HEK293-B240 are HEK 293 cells stably transfected with the recombinant M81 BACMID and have been described previously (9) . The HEK293-2089 producer cell lines have also been described previously (22) .", "All sequencing data are available under the following NCBI accession number: GSE81802.", "All human primary B cells used in the experiments were isolated from anonymous buffy-coats purchased from the Blood Bank of the University of Heidelberg for which no ethical approval is required." ] },{ "paper_id": "8977825a7fbaa1e4d672a361e7122b48785f93dd", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Bispecific and chemically-conjugated antibody reagents provide an alternative strategy to target multiple HIV-1 epitopes to control viral escape and engineer avidity." ] },{ "paper_id": "89cc80396595df1ebb851e602666945754ab0257", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To the best of the author's knowledge, this is the first clinical description of MM associated with a suspected phaeochromocytoma in a cat. Simultaneous neoplasms tend to be rare in feline patients, 13 and the information reported herein should alert veterinarians to being vigilant for multiple neoplastic processes in cats.", "This paper was handled and processed by the European Editorial Office (ISFM) for publication in JFMS Open Reports Case description A 12- year-old, male neutered domestic shorthair cat was admitted for polyuria and polydipsia of 2 months' duration, in addition to progressive blindness, weight loss, weakness and several episodes of open-mouth breathing. Initial physical examination findings included a temperature of 38.7\u00b0C, pale mucous membranes and a body condition score of 3/9 (according to World Small Animal Veterinary Association Global Nutrition Committee criteria).", "The patient was initially treated (day 0) with a combination of prednisolone (2 mg/kg q24h) and melphalan (0.1 mg/kg q48h) by mouth, plus amlodipine (0.18 mg/ kg) and spironolactone (2 mg/kg) by mouth for management of MM and systemic hypertension, respectively, but no improvement in clinical and biological condition was observed at days 10, 30 and 45. Therefore, a chemotherapy protocol with cyclophosphamide (200 mg/m\u00b2 every week) by mouth plus prednisolone (2 mg/kg q24h) was undertaken, but once again no improvement was observed at days 55, 85 and 90. The cat was euthanased 6 months later owing to persistent poor general condition. Autopsy was declined by the owner. " ] },{ "paper_id": "89d4bbbaafc5df5274e5ca4f2b21b3f27b50b216", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "89f214be6e76049510daa238a9182f8302cfdbbb", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Qualitative variables are expressed as counts and percentages and quantitative variables are expressed as means and standard deviations. The Student's t test for independent samples was used to perform comparisons between means whereas the Man-Whitney test was used in case variables did not meet the criteria of normality. The chisquare or Fisher's exact test were used for comparisons of proportions. A p value of less than 0.05 was considered significant. Data were analyzed using statistical software (SPSS, version 15.0; SPSS; Chicago, IL).", "Methods: Patients with chronic obstructive pulmonary disease (COPD) exacerbation were recruited and classified as elderly (>65 years) and non-elderly (\u2264 65 years). Sputum and oropharyngeal samples were assessed, PCR for respiratory viruses and cultures for common pathogens were performed." ] },{ "paper_id": "8a6809df45d5f80a822d68d3c305f7640e10234a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This article describes the development of the various genetic analysis components, and their validation using clinical samples. Accession numbers for 84 complete H1N1(2009) genomes generated are listed in Supplementary Data File 1.", "In addition, we evaluate the robustness and reproducibility of EvolSTAR by employing six pairs of replicate experiments consisting of one pair nasal swab and five pairs of cell culture isolates, belonging to the same patient sample 305 (Supplementary Data File 4) .", "Supplementary Data are available at NAR Online." ] },{ "paper_id": "8a8d2206e8fa15801497ee0d24618adb7e34b693", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Yu Liu https://orcid.org/0000-0002-5246-0290", "Commentary" ] },{ "paper_id": "8ab9e9b90aa057cdd59acac5cce30ec1a6784e71", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "All animal protocols for this study were reviewed and approved by the Animal Ethics Committee of the University of Miyazaki's Faculty of Agriculture. During the study, animal health was monitored by licensed veterinarians and the animals were not manipulated beyond what is required for diagnostic purposes." ] },{ "paper_id": "8ac886d6b20755b99f0d627f55536e4cc0d6107c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Likewise, the idea that physicians acting as clinical investigators should set aside their primary medical duty and their own therapeutic preferences is particularly daunting when Ebola infected patients die in high numbers. While clinicians would generally accept the idea to test an unproven intervention within the frame of a monitored trial, randomised designs make this situation even more problematic. Unless dictated by scarcity, randomisation was often perceived as a tragic choice for humanitarian workers who could not readily forfeit their therapeutic obligations and wished to maintain patients' trust in such difficult circumstances. The clustering of EVD inside households illustrates this kind of dilemma. When several members of a family attended an isolation facility, their random allocation to different regimens was emotionally difficult and felt as morally problematic [Annick Antierens, personal communication]. In addition, randomisation adds unnecessary burdens to the management of EVD patients, and additional risks of nosocomial accidents. 34 ", "One could deplore that none of the promising treatments used in Ebola field trials could so far be convincingly confirmed as curative. 52 Regardless, with their variable merits and shortcomings, those emergency clinical trials conducted in the course of a major epidemic could collectively contribute to building pragmatic foundations of disaster research ethics. This exercise would be more meaningful if ethicists and social scientists seized the opportunity to bring the voice of victims, investigators, clinicians and survivors into ethical debates that have too often been disembodied and rhetorical." ] },{ "paper_id": "8acd6f32fca98b572ad9c5cce743dd21d26b115e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Processed connexin polypeptides that were possibly generated under normal expression conditions in wild-type cells most likely escaped detection because of their low abundance (Fig. 3) .", "Construction of eucaryotic connexin expression vectors will be described in more detail in separate reports. Briefly, human/3t GJ protein was expressed in yeast cells (Saccharomyces cerevisiae) after the human/~1 GJ eDNA was cloned into the BamHI site of the yeast expression vector YEP G2 containing a polyadenylation signal, a 2-/~ plasmid origin of replication, and a galactose regulatable promoter.", "Microsome Sedimentation. Microsome sedimentation assays were principally performed as described by Gilmore and Blobel (1985) using the Beckman Airfuge (Beckman Instruments, Inc., Palo Alto, CA). After trans-lation, 15-/xl aliquots were adjusted to 50/~1 volume with buffer 1 consisting of 150 mM KOAc, 50 mM triethanolamine-acetic acid (pH 7.0), and 2.5 mM MgOAc. For alkali extractions, aliquots were adjusted to pH 11.5 with 1 M NaOH, and adjusted to 50 #1 volume. Samples were incubated on ice for 10 rain, overlayed onto a 100-/~1 cushion of 0.5 M sucrose in buffer 1 or a 100-/~1 cushion of 0.2 M sucrose in 30 mM Hepes adjusted to pH 11.5, 150 mM KOAc, 2.5 mM MgOAc, and fractionated into a supernatant (S) and pellet (P) fraction. Proteins in the superuatant fractions were then precipitated with \"I'CA and neutralized with saturated Tris base before processing for SDS-PAGE." ] },{ "paper_id": "8adc81255b4ba0eb48cbd7ddfe86f13959f39c7d", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The obtained MSAs were converted into Hidden Markov Model (HMM) profiles or position-specific scoring matrices (PSSM) and used as queries to search for homologs in three different types of databases composed of: individual sequences (nr database, including GenBank CDS translations, RefSeq proteins, SwissProt, PIR and PRF (67)), profiles (PFAM A (68)), and protein 3D structures (PDB (69)). For GenBank scanning, HMMER 3.1 software (57) was used with the E-value cutoff of 10. To search for homologs among protein profiles and 3D structures, HHsearch of HH-suite 2.0.15 software (62,63) and pGenTHREADER 8.9 software (70-72) were used, respectively.", "To assess the chemical nature of the nucleotide-protein bond, the pH was temporarily shifted after product formation. To this end, 1 l HCl or NaOH (both 1 M) was added before incubation at 95 \u2022 C for 4 min. Afterward the original pH was restored by addition of the complementary base or acid, and samples were separated and analyzed as described.", "Nucleotidylation assays were performed in a total volume of 10 l containing, unless specified otherwise, 50 mM Tris, pH 8.5, 6 mM MnCl 2 , 5 mM DTT, up to 2.5 M nsp9 and 0.17 M [\u2423-32 P]NTP (Perkin Elmer, 3000 Ci/mmol). Furthermore, 12.5% glycerol (v/v), 25 mM NaCl, 5 mM HEPES, pH 7.5, and 0.5 mM DTT were carried over from the protein storage buffer. In preliminary experiments magnesium (1-20 mM) did not support nucleotidylation activity and was consequently not pursued further. Samples were incubated for 30 min at 30 \u2022 C. Reactions were stopped by addition of 5 l gel loading buffer (62.5 mM Tris, pH 6.8, 100 mM dithiothreitol (DTT), 2.5% sodium dodecyl sulphate (SDS), 10% glycerol, 0.005% bromophenol blue) and denaturing of the proteins by heating at 95 \u2022 C for 5 min. 12% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) gels were run, stained with Coomassie G-250, and destained overnight. After drying, phosphorimager screens were exposed to gels for 5 h and scanned on a Typhoon variable mode scanner (GE healthcare), after which band intensities were analyzed with ImageQuant TL software (GE healthcare). The buffers used to find the pH optimum of the nu-cleotidylation reaction were MES (pH 5.5-6.5), MOPS (pH 7.0), Tris (pH 7.5-8.5) and CHES (pH 9.0-9.5) (20 mM).", "Nidoviruses are characterized by their distinct polycistronic genome organization, the conservation of key replicative enzymes, and a common genome expression and replication strategy (8) (Figure 1 ). Their distinctive transcription mechanism involves the synthesis of a variable set of subgenomic (sg) mRNAs, which are 3 coterminal with the viral genome (reviewed in (9, 10) ). In most nidoviruses, sg mRNAs and genome also share a common 5 leader sequence. The synthesis of sg mRNAs (transcription) and genome RNA (replication) is performed by a poorly characterized replication-transcription complex (RTC) that is comprised of multiple protein subunits (reviewed in (11, 12, 13) ) encoded in two large open reading frames (ORFs), ORF1a and ORF1b, which are translated from the nidoviral genomic RNA ( Figure 1A ). The two polyproteins (pp), pp1a and pp1ab, the latter resulting from ribosomal frameshifting during genome translation, are auto-catalytically processed by multiple cognate proteases, one of which (the 3C-like (3CL pro ) or main (M pro ) protease) is responsible for the large majority of cleavages (14) . Downstream of ORF1b, nidovirus genomes contain multiple smaller ORFs, known as the 3 ORFs (7), which are expressed from the sg mRNAs described above." ] },{ "paper_id": "8b39433dd865c0f71c7b2f333e1f506b73d722f1", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8b3f1411a204bf1cd829342b87e5fa88bb9f12ed", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Meningococcal vaccination is a visa requirement for international pilgrims, so the vaccine coverage is essentially 100% [36, 37] , however domestic pilgrims and " ] },{ "paper_id": "8b78861684f93b6c17ed9e9d18027cfc12c41644", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "No competing interests declared." ] },{ "paper_id": "8b965ccb656960174a81c75effed2a6f2315f0e7", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Our study has several limitations including the retrospective nature of data collection and small population. The results of well-designed and randomized, controlled ongoing clinical trials will prove the value of our findings.", "All patients with neurological symptoms were routinely evaluated by neurosurgeons and admitted to our neurointensive care unit or neurosurgical unit. This series of patients did not include those with hemorrhage due to intracranial aneurysms, arteriovenous malformation, arteriovenous fistula, cavernous malformation, moyamoya disease, or tumor bleeding. Most of these diseases could be excluded by taking CT angiography or enhanced CT at the same time during their first CT. When tumor bleeding was suspected, the patient's cancer history was confirmed and magnetic resonance images (MRI) were taken after 2 to 4 weeks. Cavernous malformation was excluded via MRI after the hematoma was absorbed.", "The target systolic BP was lower than 140 mmHg. This value was determined according to several ICH guidelines. 3, 14, 15, 30) BP was monitored continuously through the arterial line. Initial high BP was controlled by a diltiazem or nicardipine bolus intravenous injection, and to maintain systolic BP under 140 mmHg, continuous intravenous administration of nicardipine was used in the neurosurgical intensive care unit during the first 48 hours after admission. For better BP control, we made great efforts to reduce pain by using non-steroidal anti-inflammatory drugs and various analgesics (e.g., narcotic or patch type analgesics). The visual analog scale was utilized to quantify pain. Analgesics were used when the patient complained of pain, including headache. In unconscious patients, analgesics were used when BP was controlled but not controlled." ] },{ "paper_id": "8b9992937c24368f15eb03e7009ba85beadab1e2", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplementary materials are available at Clinical Infectious Diseases online (http://cid.oxfordjournals.org). Supplementary materials consist of data provided by the author that are published to benefit the reader. The posted materials are not copyedited. The contents of all supplementary data are the sole responsibility of the authors. Questions or messages regarding errors should be addressed to the author." ] },{ "paper_id": "8ba51fdaf2a9dc9a0b4defc7c07d360e0f9a3984", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Restriction endonucleases, T4 DNA polymerase, T4 DNA ligase, and Klenow fragment were purchased from either Bethesda Research Laboratories, (Gaithersburg, MD) or New England Biolabs (Beverly, MA), and were used as recommended by the suppliers. Unless otherwise stated, reagents used in these experiments were obtained from Sigma Chem. Co., St. Louis, MO.", "The various truncation mutations of KEX/were placed downstream from the GAL/promotor in plasmid pMB258 to create the following plasmids: pKX1-25WT, pKX1-25Hpa, pKX1-25Bcl, and pKX1-25Hinc." ] },{ "paper_id": "8bc2d0429d1c8168ddb3869ad0a81cebfe5fd8ac", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8bf17efaaca3885956b262ec027b83e86cc1711f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "CONFLICT OF INTEREST. The authors declare that they have no conflicts of interest." ] },{ "paper_id": "8c4233100da83790ea6544851b543977da15a4ca", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "c-myc is an immediate early gene that is expressed as cells gain competence to exit Go and progress into Gt (12) (13) (14) .", "CTL Assa?s. Mouse target ceils (L-929, BALB/c NIH 3T3, P815, YAC-1, and A20) were labded either with sodium Slchromate for a cytoplasmic label or with [SH]thymidine or [mI]iododeoxyuridine (12sI-IUDR.) for a DNA label and examined for the release of labels as specified in the figure legends. Where indicated, DNA was purified by guanidine HC1 denaturation in the absence of detergent and dectrophoresed in 1.5% agarose gels, as described (5).", "Effector Cells. In this investigation we used purified primary CD8 + spleen CTLs, induced by acute infection of adult C3H/ HeSnJ x C57BL/6J)F1 mice for 8 d with lymphocytic choriomeningitis virus (LCMV), strain Armstrong (5). The use of these primary CTL (LCMV-CTL) precludes artifactual problems associated with CTL lines. These LCMV-CTL contain azurophilic granules and specifically induce the lysis and DNA fragraentation of LCMV-infected targets in an MHC class I-restricted fashion (7). A Con A lectin-dependent killing assay was used to bypass the requirements for specific antigen, in order to compare the susceptibility of various target cells to CTL-induced apoptosis (5) ." ] },{ "paper_id": "8c8c5fb760997ded36fe4ae8fc77103ec66f9d14", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8c96d28abcf7aa309ce804e40c11c9caf88a7a62", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8cb5954efbc7ab4a0d43db196b9b58b3838945b0", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8cb96ebaf1320867609839df21072f96631e9015", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Korean J Pediatr 2016;59 (7):308-311", "In clinical practice where virology testing is not easily accessible, clinical features like palmar-plantar erythema and/or hyperferritinemia might be helpful to diagnose HPeV-3 infection. We recommend testing for ferritin in febrile neonatal patients with palmar-plantar erythema. However, additional studies will be necessary to demonstrate the diagnostic value of these features in HPeV-3 infection. If these findings are unique to HPeV-3 infection, pathogenic mechanisms should be studied.", "Human parechoviruses (HPeVs) are newly recognized single-stranded RNA viruses that were formerly classified in the Enterovirus genus 1) . Among 16 HPeV serotypes, HPeV-3 infection occurs most frequently among infants below the age of 3 months 2) . Since HPeV-3 was first isolated in Japan in 1999 1) , the HPeV serotype has been increasingly identified as an important pathogen of sepsis-like illness and central nervous system infections in neonates and young infants 3) . Life-threatening illnesses such as hemophagocytic lymphohistiocytosis have been reported in neonatal HPeV-3 infection 4) . However, the major clinical features displayed by patients with HPeV-3 infection are also common in those suffering from severe infectious diseases caused by other pathogens 5) . Thus, the diagnosis of HPeV-3 infection is difficult based only on clinical signs." ] },{ "paper_id": "8cd6d7c2eeb732eeecb6b7618d02eafe82aa62a4", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Immunofluorescence staining for confocal microscopy was performed on similarly prepared, cut, and fixed cryostat brain sections. Sections were blocked with Superblock (ScyTek, Logan, UT) and stained with primary antibodies; rat anti-mouse CD8, rat anti-mouse F4/80, and mouse anti-rat myelin basic protein (Boehringer Mannheim, Indianapolis, IN). Secondary fluorescent antibodies used were Texas red-labeled horse anti-mouse IgG and FITC-labeled rabbit anti-rat IgG (Vector Laboratories) and the slides were mounted in Vectashield (Vector Laboratories). Double-immunolabeled sections were examined with a BioRad (MRC 600) laser scanning confocal microscope equipped with an argon/krypton mixed gas laser.", "These results indicate that infection of mice by a virus that shares immune determinants with a protein expressed in oligodendrocytes can induce a chronic inflammatory disease of the CNS associated with clinical abnormalities.", "MBP-NP and -GP mice from all lines were observed for up to 1 yr of age. None of the mice studied showed any signs of clinical disease due to the consequences of brainspecific expression of these viral genes. Additionally, histological examinations of CNS tissue taken at various ages did not detect any abnormalities." ] },{ "paper_id": "8cfe567d42fa459cb4364e240ddfe29629d03f85", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The study was approved by the local Bioethics Committee, and all study subjects provided their informed consent." ] },{ "paper_id": "8cfedfcfe692d38a55444702e704325ad1163277", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "In this study, we document a case of phenobarbital-induced anticonvulsant hypersensitivity syndrome (AHS), which has been rarely reported in veterinary medicine. A 2-yearold, 5.4 kg, neutered male Russian Blue cat was diagnosed with idiopathic epilepsy and started on phenobarbital treatment. Eight days after initiation of phenobarbital treatment, the cat showed tachypnea and hyperthermia. CBC and serum biochemistry were unremarkable. However, the patient showed high serum amyloid A (SAA). On abdominal ultrasonography, generalized enlargement of abdominal lymph nodes and splenic multiple hypo-echoic nodules, which were consistent with reactive lymphadenopathy were found. The cat was diagnosed with AHS, and phenobarbital was discontinued. After 10 days of cessation, the patient had normal SAA, and clinical signs were resolved.", "Case reports of AHS in cats have been previously published. Baho et al. reported that a 4-year-old female shorthair cat had lymph node enlargement after four days of phenobarbital administration. Subsequently, the medication was changed from phenobarbital to levetiracetam, and the size of the lymph nodes were decreased after 10 days [1] . In another report, lymph node enlargement was observed after four weeks of phenobarbital administration in a 2-year-old female shorthair cat. Phenobarbital was replaced with levetiracetam, and no lymph node enlargement was observed after 10 days [8] . Although mild symptoms of AHS can be self-limiting, AHS in dogs or cats should be monitored carefully [1, 7] .", "After 8 days of phenobarbital use, no seizure symptoms were observed. Nevertheless, the patient was admitted into hospital due to high fever and lethargy. The body temperature at the time of admission was 40.1\u00b0C (reference range, 37.4-39.2\u00b0C). There was no specific finding on CBC, and no abnormal findings were found in serum chemistry analysis. SAA reached a high of 179 mg/l (reference range, 0-5 mg/l) and a small number of D\u00f6hle bodies in the white blood cells were observed on blood smear evaluation. Abdominal ultrasonography showed splenomegaly and enlargement of the abdominal (colic; 1.14 \u00d7 0.69 mm, ileocecal; 0.85 \u00d7 0.47 mm, pancreaticoduodenal; 11.37 \u00d7 6.98 mm) lymph nodes. Fine needle aspiration (FNA) was performed under ultrasound guidance, and a provisional diagnosis of reactive lymphadenopathy was made (Fig. 1) . Also, we could not find any evidence of infection or tumor by history taking, physical examination, blood analysis, and imaging. Although the serum concentration of phenobarbital was not measured at this time, through an evaluation of the clinical course, a diagnosis was made of hypersensitivity due to phenobarbital, the prescribed anticonvulsant drug." ] },{ "paper_id": "8d21989761b3a358d565559bade36a9b8654dd78", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Finally, several properties of LNA, including its good aqueous solubility, low toxicity, highly efficient binding to complementary nucleic acids, high biostability, and, improved mismatch discrimination relative to natural nucleic acid (47) make LNA a promising candidate for in vivo applications of antisense-induced frameshifting.", "RNA6: GCGCGC, RNA9: CCAGCGCGC, RNA12: C CUCCAGCGCGC, RNA15: UGGCCUCCAGCGCGC, RNA18: CCAUGGCCUCCAGCGCGC, 18RNA: GCG CGCUGGAGGCCAUGG, and RNA13: CCAAGGGG UUGAGG.", "Funding for open access charge: Leiden Institute of Chemistry, Leiden university.", "Small oligonucleotides have been used for several years to regulate gene expression by RNaseH-dependent RNA degradation (11) , blocking translation (12) , or re-directing splicing (13) . More recently, microRNAs (miRNAs) (14) and small interfering RNAs (siRNAs) have appeared on the scene of post-transcriptional gene regulation (15) . siRNAs may be effective in treatment of chronic hepatitis-B virus infection (16) , HIV infection (17) , cancer (18) and age-related macular degeneration (19) . Very few antisense oligonucleotides, for example against the bcl-2 oncogene have reached the stage of clinical trials (20) or have actually been approved by the FDA, for instance for the treatment of human cytomegalovirus retinitis (21) .", "Determination of the melting temperature of oligonucleotide duplexes RNA oligonucleotide 18RNA (5 0 GCGCGCUGGAGGC CAUGG3 0 , Dharmacon, USA) was mixed in a 1:1 molar ratio with RNA18, DNA18 or one of the various DNA/ LNA mix-mers, in UV-melting buffer (100 mM NaCl, 10 mM Cacodylate acid, pH 6.8). The analysis was performed on a Varian Cary 300 spectrophotometer using temperature ramps of 0.25 C /min during heating and cooling. The absorbance at 260 nm was recorded and normalized to the blank control." ] },{ "paper_id": "8d487139eb8085addba9850f90597f206531f3c9", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The number of vacuoles containing one, two, four, or eight parasites was visualized under a fluorescence microscope (100\u00d7). Means \u00b1 SD combined from three independent experiments, each performed in triplicate, were analyzed by two-way ANOVA. No significant difference was found among these three groups, hence these data clearly demonstrated that vimentin expression levels did not affect the proliferation of T. gondii.", "Mouse ( " ] },{ "paper_id": "8d4a2fb48616bae57771c62a5bcbaf86e08b8276", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Movement Reconstruction. After each flight, the movement observations were collated from the separate observation zones. Research assistants then aggregated, cleaned, and prepared the data for analysis of behaviors, movements, and ultimately time-delimited contact networks.", "Then how can we explain case reports documenting the over 40% of transmission of influenza and SARS to nontribe passengers? Some transmissions may have occurred while waiting in the airport, while boarding, or while deplaning. Alternatively, some passengers may have been infected by other sources before or after the flight. Three of the five flights in these case reports range from 9.5 to 14 h, providing many more opportunities for transmission. Other transmissions may have occurred via fomites. Flyers can protect themselves from fomite transmission by exercising careful hand hygiene. Finally, our model assumes that droplets are the main transmission route for influenza and SARS. This assumption is based on general public health agency guidance to health care providers, but it may not be true: significant transmission may also occur via smaller virus-laden particles (the smallest being aerosols), which have larger dispersion distances.", "Thus, there was no obvious virus shedding into the cabin. Furthermore, the airline's cabin-cleaning policy is to disinfect all hard surfaces whenever the plane \"overnights,\" and all surface samples were taken from hard surfaces. Not all flights were the first of the day for that plane. We chose to sample seat-belt buckles, believing that these would be the most likely items to be touched and the least likely to be thoroughly disinfected.", "Unlike droplets that fall to the ground quickly, aerosols could remain suspended in cabin air until they are breathed or drawn into the heating, ventilation, and air conditioning system and putatively trapped by high-efficiency particulate air filters. Transmission via aerosols could also occur during the period between when the cabin door closes and take-off. Our model is not applicable to other aerosol-transmitted diseases, such as tuberculosis (18) , varicella, and measles (19) . Our model assumes omnidirectional transmission and does not take into account seat backs as barriers. Thus, our simulation results may be overestimating risk of direct droplet-mediated transmission." ] },{ "paper_id": "8d5870809b9534c49bb0a3544de6a356b63d9a5a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8d612e0c4433db428f3e06657888d5296a43b653", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8d732d6fc180c5be5a7c49cd8d8cf49332d24b39", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "To account for intragroup correlation with children presenting multiple times, we used the clustered sandwich estimator. 21 Data cleaning was completed using IBM SPSS Statistics, V.24, with statistical analyses conducted in STATA V.14 and EpiBasic V. 3. 22 Patient and public involvement This is a total population-based study examining patient records retrospectively. A community reference group of parents and other members of the general public were consulted prior to project commencement to ensure broad project outcomes were a priority to the community.", "There are other limitations to our study and these data. Although the risk factor analysis was restricted to children aged less than 5 years, birth-level information, such as maternal postcode of residence at the time of her child's birth used to determine the socioeconomic index score, may not be relevant to children from older age groups. A further limitation is a lack of comorbidity information in the ED data to enable identification of children at higher risk of respiratory infections, such as those with immunocompromising conditions, chronic lung disease or neurological diseases who may experience different frequencies of ED presentations for ARI.", "The respiratory disease category had the highest presentation rates for Aboriginal children in each age group, far higher than any other category (185/1000 child-years overall; table 1). The highest rates overall were observed in children <12 months old. For most infections or symptoms affecting the lower respiratory system including pneumonia, bronchiolitis, pertussis, unspecified ALRI, bronchitis and wheeze/cough/crackles, rates in Aboriginal children were 2-3 times higher than in non-Aboriginal children under 12 months but similar in the older age groups.", "ED presentation for ARIs is common and has an enormous impact on the healthcare system. We have provided a comprehensive analysis of the ED burden across WA using population-based data linkage. These data from EDs across geographical areas provide essential information for ED planning, both within season and by site and to use when exploring the impact of specific interventions (eg, vaccination) or modifications to community health services (eg, establishing general practitioner after-hours clinics). Notwithstanding the limitations of clinical diagnostic accuracy, these data provide a more community-based level of the ARI burden of disease to complement previous studies assessing only hospitalisation and death at the tip of the burden of disease pyramid. There is a lack of primary healthcare data with diagnostic information in the community in general, and these ED data will be important for understanding where to target prevention strategies and form the baseline for evaluating policies. " ] },{ "paper_id": "8d811ab0308d0b39edc268e8b0dd87bd4c3eca26", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "There are many reports showing that virus infection can alter the cellular microRNAs (miRNAs) to affect virus replication, some of them oppose the function of host restriction factors to enhance virus proliferation [2, 3] . Nowadays, researchers are trying to design miRNAs against virus proteins to control virus replication.", "Although heavily mutagenic and responsible for deleterious gene disruptions, retroelements may have provided some beneficial genomic functions with potential evolutionary advantages.", "It is generally believed that cytoplasmic RNA viruses do not encode miRNAs, owing to inaccessible cellular miRNA processing machinery. In a genome-wide analysis and identification of miRNAs originating from hepatitis A virus (HAV), a typical cytoplasmic RNA virus [36] , two novel virally encoded miRNAs, hav-miR-1-5p and hav-miR-2-5p, were identified, generated from viral miRNA precursors (pre-miRNA)." ] },{ "paper_id": "8dc8c40ee8b61c5660b15c9e81e928eb3dc44ee5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "(" ] },{ "paper_id": "8dd1202c8cda0d3a3859c3346cfbc6647317b4f3", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ ". Use of highly pathogenic avian influenza A(H5N1) gain-of-function studies for molecular-based surveillance and pandemic preparedness. mBio 5(6):e02431-14.", "The findings and conclusions in this report are those of the authors and do not necessarily represent the views of the Centers for Disease Control and Prevention.", "Ongoing H5N1 circulation has appropriately resulted in a focus on sequencing viral genomes to understand the evolution of these viruses and the significance of observed genetic changes. Expanded laboratory capacity for high-throughput Sanger sequencing and recent technological advances, such as nextgeneration sequencing and parallel computing, have revolutionized the quantity, quality, and availability of gene sequences and our ability to quickly and accurately analyze these data (3) . Consequently, the number of animal and human influenza virus sequences available in publically accessible databases has dramatically increased over the years, as have the bioinformatics tools required for efficient investigation (4, 5) . These advances in laboratory and analytical methods provide strong incentives to utilize molecular data for pandemic risk assessment of zoonotic influenza viruses at the animal-human interface (6) .", "As coordination of international surveillance activities and global sharing of viruses improve (especially in the wake of the 2009 pandemic and emergence of H7N9 viruses in China), molecularly based surveillance has great potential for rapid risk assessment of samples collected as part of active and passive surveillance systems. Real-time feedback to investigators in the field or authorities making policy decisions related to poultry outbreak containment, clinical intervention, and diagnostic methodology, to cite a few examples, will remain critical in the future. In addition, as building laboratory capacity is prioritized in countries impacted the most by endemic H5N1 virus circulation and the higher incidence of human infection, the ability to screen viruses for amino acid markers or lineage-associated molecular determinants by sequencing, pyrosequencing, mass spectrometry, and real-time reverse transcription (RT)-PCR assays will become the reality for more and more laboratories." ] },{ "paper_id": "8de34443c38db9422b06a2f583416660f1dca670", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org/ lookup/suppl/doi:10.1128/mBio.00297-15/-/DCSupplemental. Figure S1 , TIF file, 3.8 MB. Figure S2 , TIF file, 4.4 MB. Figure S3 , TIF file, 1.8 MB." ] },{ "paper_id": "8e101b19cc15410540e85ce7f2e77208e3c411d5", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8e51b76492d9bb9fe3f64f80f5bdb3e29a8c5519", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8ee4731a0d1dabf9a61a177aed392c62ca6fb69b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8f05419fedcefa7d7f276b4ddebe1ad2fb363257", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8f0e032bd15bab3c9c9af33305a2578b525e224c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.01450-14/-/DCSupplemental. Figure S1 , PDF file, 1.3 MB. Figure S2 , PDF file, 0.1 MB.", "IMPORTANCE This work clearly highlights the importance of continuous surveillance and infection control measures to control the global public threat of MERS-CoV. While current MERS-CoV transmission appears to be limited, we advise minimal contact with camels, especially for immunocompromised individuals, and the use of appropriate health, safety, and infection prevention and control measures when dealing with infected patients. Also, detailed clinical histories of any MERS-CoV cases with epidemiological and laboratory investigations carried out for any animal exposure must be considered to identify any animal source." ] },{ "paper_id": "8f4348a9455035db6487252e4fb48c65708a1e1f", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The ability of saturated fatty acids to induce cell fusion without further treatment may also find application in certain situations.", "Fusion Protocol: PEG used for fusions was obtained from J. T. Baker Chemical Co. Phillipsburg, N J, and autoclaved before use. In this study all fusions were performed using PEG 1000 (average molecular weight 950-1,050). Unless otherwise indicated (as in Fig. 3 ), a 50% solution (wt/vol) was prepared in growth medium without serum. For some experiments, PEG was recrystallized from ethyl ether as described by Honda et al. (16, 17) , or passed over a hydrophobic column and lyophilized before use. In agreement with Smith et al. (39) , no substantial differences in ability to induce fusion were observed between these purified preparations and PEG used directly as supplied from the manufacturer.", "After treatment with PEG and the subsequent incubation period, cells were rinsed in isotonic saline solution, fixed in methanol, and stained in Giemsa stain (Fisher Scientific Co., Fair Lawn, N J). Coverslips from small petri dishes were mounted on glass slides with UVinert Aqueous Mountant (Gum Ltd.; distributed by Bio/medical Specialties, Santa Monica, CA}. For cells grown in larger dishes, a small amount of mountant was added directly to the dish, over which was laid a 50-ram diameter # 1 glass coverslip (Corning Glass Works, Coming, NY). Cells were observed with a Zeiss Photomieroscope III equipped with phase-contrast optics. Observations were recorded on Ilford Pan F film (ASA 50) by locating confluent regions at low power and photographing at higher magnification without further selection of field." ] },{ "paper_id": "8f64ab87b255d034c48a5a7c8a8a82a4ea81e67b", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The localization of proteins to late-Golgi", "To date, little direct evidence exists to discriminate between this sort of retrieval mechanism and a static retention mechanism where proteins would be excluded from vesicles leaving Golgi membranes and, consequently, have a longer residency period in the TGN.", "T he secretory pathway of eukaryotic cells is composed of a series of membrane-bound organelles, each with its own unique complement of components. Transport of components between these organelles is achieved by means of vesicular transport, which results in a flow of membrane traffic throughout the pathway (Rothman, 1994) . To maintain its identity, an organelle must ensure that its resident proteins do not get swept with those proteins passing through en route to other destinations in the cell. To achieve this localization, resident proteins can either be retrieved once they have exited the organelle, or they may be prevented from ever leaving that organelle in the first place . These two mechanisms need not be mutually exclusive, since efficient localization of a protein to an organelle could arise through a combination of both mechanisms." ] },{ "paper_id": "8f73d388e9ac6eedc6e60400d1fc7e3809814042", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Vaccination continues to have a major impact on the health of humans and animals. Furthermore, vaccination of animals is proving to be effective in reducing transmission to humans. Understanding linkages between innate and adaptive immunity are improving formulations of new, as well as existing, vaccines, making them more effective.", "Based on the recent advances in understanding immune responses and identifying antigens involved in inducing protection from a number of infectious agents combined with the willingness of regulatory agencies to begin licensing combination, adjuvants gives us confidence that we will be able to develop new vaccines to new agents and also improve existing vaccines that can even be safer than our vaccines used today. In this way, all members of society will benefit.", "Another big challenge to vaccination today is that most vaccines are delivered by needle injection. This often results in local mild reactions and these minor adverse events are being used as a reason to dissuade individuals not to vaccinate their children. Indeed, in our society, all forms of 'preventive medicine' are looked upon less favorably than therapies. Many of our therapeutic drugs cause significantly greater adverse reactions than vaccines. However, they are accepted because they are treatments. Anti-cancer drugs are one of the best examples, which may have many side effects. The reason for this dichotomy is that our society is much less accepting of preventative medicine versus therapeutic approaches to disease management. If the focus continues to favor expensive therapeutics over economic preventative medicine, escalating costs of health care will bankrupt society." ] },{ "paper_id": "8f810a6f1464d6871d6184e04cf3fb1417983abc", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The present study has certain limitations. Some samples contained viruses at low titers, hindering statistical analyses for certain viruses, such as PIV1 and PIV4, and could not reflect the entire range of seasonal variations in each viral infection.", "Since rapid reporting of viral diseases is critical, rapid PCR assays have been introduced, but these assays have limited throughput. However, according to our analysis, All16 can be performed twice per day without requiring more workers. Therefore, if many samples need to be run, All16 could be advantageous, especially compared with Any16.", "Detecting pathogens in respiratory infections is crucial for diagnosis, patient management, and to avoid improper antibiotic treatment and unnecessary laboratory testing. However, the goldstandard methods for detecting viral infections, non-molecular methods, have critical limitations such as the requirement of labor-intensive and complex procedures and time-consuming steps [1, 2] . Therefore, in many instances, cell culture is no longer considered the gold-standard method, and molecular assays have become the standard of care for diagnosis [1, 3] . Multiplex real-time PCR is useful for diagnosing respiratory viral infections because the process time is faster than that of viral culture, it detects multiple pathogenic viruses simultaneously, and it is reli-able [3] ." ] },{ "paper_id": "8fe6e12ec1f61c111c3ca33189fcc0ec90c03803", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "MINIREVIEWS", "In multivariate analysis, males (aOR = 1.9, 95%CI: 1.22.9, P < 0.01), heavy smokers (smoking more than 30 cigarettes per day) (aOR = 4.6, 95%CI: 2.68.0, P < 0.01) and postgraduate degree holders (aOR = 2.1,", "Multivariate analysis showed that being male (aOR = 4.8, 95%CI: 2.88.2, P < 0.01), heavy smoker (aOR = 4.5, 95%CI: 2.67.7, P < 0.01) and having a chronic disease (aOR = 4.8, 95%CI: 3.56.6, P < 0.01), especially chronic kidney disease (aOR = 6.3, 95%CI: 1.526.9, P < 0.01) significantly increased the likelihood of being vaccinated against pertussis (Table 4) ." ] },{ "paper_id": "8fec2036fb2e98cbb9d4f955ce1d5198d1a09b3c", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "8fefbc58375c244a64a82e3f88c4084076838b88", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Supplemental material for this article may be found at http://mbio.asm.org /lookup/suppl/doi:10.1128/mBio.00265-10/-/DCSupplemental. Figure S1 , TIF file, 3.902 MB. Figure S2 , TIF file, 5.443 MB. Figure S3 , TIF file, 5.300 MB. Figure S4 , TIF file, 3.468 MB. Table S1 , PDF file, 0.098 MB.", "Statistical analysis. Statistical differences between groups were determined using a two-tailed Student's t test. P values of \u03fd0.05 were considered significant. " ] },{ "paper_id": "8fefe8e70632ffdfd96f701facc6f2dcce16167a", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [] },{ "paper_id": "9033adf08248ec28fb49e61abe6c1209d7811843", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Dual luciferase assay was performed as described previously (27, 28) . Transfection efficiencies were normalized to a control plasmid expressing Renilla luciferase (pSV-RLuc from Promega).", "Real-time reverse transcription-PCR (RT-PCR) was performed as described (27, 30) . Normalization was made to glycerialdehyde-3-phosphate dehydrogenase (GAPDH) mRNA. Quantitation of target mRNA was achieved with the comparative Ct method. Relative expression level of target mRNA was calculated from 2 \u2212 Ct . Primers were listed in Supplementary Table S1 .", "HepG2 and HepG2.2.15 cells were transfected with 100 nM of siRNA using Lipofectamine 2000 (Invitrogen). RNA interference (RNAi) experiments were performed as described (27, 30) . siRNAs were listed in Supplementary Table S1 .", "Hepatitis B virus (HBV), a member in the family of Hepadnaviridae, has a DNA genome 3.2 kb in size which is partially double stranded. Over 350 million people are chronically infected with HBV worldwide, including \u223c10% of the population in Hong Kong and China, 15-40% of whom will terminally develop severe liver diseases including hepatocellular carcinoma (HCC) (1) . Although multiple factors are involved in the development of HCC in HBV carriers, high level of HBV DNA has been identified as a major risk (2) ." ] },{ "paper_id": "904d886a8a305e2bc1125fccad82741d78690fef", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "This study was approved by the Institutional Review Board (IRB) of Gachon University Gil Medical Center (IRB No. GBIRB2017-361).", "We retrospectively analyzed the medical records of patients with MP pneumonia aged \u2264 18 years old who were hospitalized at Gil Medical Center between January 2015 and April 2017.", "Side effects such as Cushing appearance and peptic ulcer for CST, tooth discoloration for DXC, and tendinopathy, arthritis for LFX were evaluated for one month after medication." ] },{ "paper_id": "905e2b35719215760ebed8f3e93fdf6ea8ec9bcf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "As previously mentioned, the detection of efflux will be possible if the light is shining brightly and directly onto the exposed spinal cord during the injection. Efflux is most likely to happen with 30 gauge needles (versus 33 gauge) and if the injection is done too rapidly. Though this protocol has given us good results, others have reported longer waiting periods (up to 5 minutes) before retracting the needle following injection 8, 9 . Also, smaller gauge needles are preferable, but we have observed that some cells are too easily lysed when passed through 33 gauge needles.", "Cell replacement therapies for the treatment of some CNS disorders are currently in clinical trials 10 .", "No conflicts of interest declared." ] },{ "paper_id": "90b31a2542e2275640ec9dc8264cdf1e975d807e", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "The phylogenetic tree was analyzed using MEGA6 with the neighbor-joining method, maximum composite likelihoodparameter distance matrix, and bootstrap values of 1,000 replicates.", "Infected hosts exhibit different clinical courses, ranging from asymptomatic to severe symptoms in their respiratory, digestive, and genital organs [1, 2] . There are 6 known coronaviruses that typically cause infection in humans. Among these, coronavirus 229E, OC43, NL63, and HKU1 generally cause mild cold-like symptoms, whereas severe acute respiratory syndrome-coronavirus (SARS-CoV) in 2003, and Middle East respiratory syndrome-coronavirus (MERS-CoV) in 2012, caused severe respiratory diseases such as pneumonia and death [5, 6] .", "Gene sequencing was performed using CLC Main Workbench 7.9.1. Alignment was conducted using human and animal coronavirus sequences registered in Global Initiative on Sharing All Influenza Data (GISAID) and NCBI GenBank.", "Coronavirus is an RNA virus consisting of positive-sense single-stranded RNA of approximately 27-32 kb. Coronavirus belong to the family Coronaviridae, which comprises of alpha, beta, delta, and gamma coronaviruses [1, 2] . As the name indicates, the spherical external spike protein displays a characteristic crown shape when observed under an electron microscope [3, 4] . The virus is known to infect a wide range of hosts including humans, other mammals, and birds." ] },{ "paper_id": "90cc93e5eac1e836f5cbce50fe92ded531045abf", "task": 0, "abstract": "WHAT IS KNOWN ABOUT TRANSMISSION, INCUBATION, AND ENVIRONMENTAL STABILITY?", "body_text": [ "Analysis of gene-specific mRNA cap structures. Regions corresponding to the first 300 to 500 nucleotides of the target messages were PCR amplified from cDNAs using the following oligonucleotides:", "RNA purification. Total RNA was prepared from mouse (C57BL/6) tissues using Trizol reagent (Invitrogen). The poly(A) RNA was purified twice using oligo(dT) cellulose (Fluka) followed by oligo(dT) magnetic beads (Invitrogen). All samples were quantified and assayed for poly(A) purity using an Agilent Bioanalyser.", "In order to get quick access to the required m 6 Am phosphoramidite building block for solid-phase oligoribonucleotide synthesis, we performed a selective one-step methylation of the commercially available 2'-OMe-Bz-A-CE phosphoramidite. Due to its high reactivity and sensitivity towards acids and bases, Aritomo's relatively mild phase transfer catalysis (PTC) method was used 30 . Under these conditions (iodomethane, sodium hydroxide, tetrabutylammonium bromide) the N 6 -methylated product was obtained as the major product in 56% yield, with the N 1 -methylated isomer being formed as a byproduct in 25% yield. Due to their different Rf values, the N 6 -and N 1 -methylated products were easily separated via column chromatography, and the purified m 6 Am phosphoramidite was used directly for RNA synthesis.", "Synthesis of oligoribonucleotides SK-524 and SK-526. Oligoribonucleotides SK-524(AmGGGCUGCU) and SK-526(m 6 AmGGGCUGCU) were synthesized on an ABI 394 DNA/RNA synthesizer and mass spectra were recorded using a Bruker Ultraflex III mass spectrometer via MALDI-TOF. Columns (SynBaseTM CPG 1000\u00c5 , RNA: 0.2 mmol), apart from the 2'-OMe-Bz-m 6 A-CE phosphoramidite, standard RNA-phosphoramidites and reagents for the synthesizer were purchased from Link Technologies Ltd., MeNH 2 solution (33 wt.% in ethanol) was obtained from Fluka, NEt 3 N3HF, N-methylpyrrolidinone (NMP), 3-hydroxypicolinic acid (HPA) and DowexTM 50WX8-200 were purchased from Aldrich, illustra Nap TM -10 columns were obtained from GE Healthcare Europe GmbH. Dichloromethane and acetonitrile were freshly distilled from CaH 2 before use on the synthesizer.", "An interaction of m 7 G capped transcripts with the nuclear cap-binding complex (CBC) is important for promoting correct splicing 14 and 3'end formation 15 . After export from the nucleus, translation of most mRNAs is initiated with the recognition of the m 7 G cap by eukaryotic translation initiation factor 4E (eIF4E) 16 . This cap binding step is usually rate-limiting for translation. The m 7 G cap also protects the message