[{ "paper_id": "000b7d1517ceebb34e1e3e817695b6de03e2fa78", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "00142f93c18b07350be89e96372d240372437ed9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "ACKNOwLeDGMeNTS JG, GN, and SA are supported by the CARIPLO foundation, SA is supported by the European Research Council, and the INGM is supported by the \"Romeo ed Enrica Invernizzi\" foundation.", "It is largely accepted that pDC-derived IFN-\u03b1 is important to contain human viral infections. Thus, stabilized pegylated IFN-\u03b1 is a widely used therapy for HCV patients. IFN-\u03bb appears to be similar effective, but is less toxic presumably because of the more restricted expression of its receptor (164) . Interestingly, the HCV glycoprotein E2 is a ligand for BDCA-2, which is specifically expressed on pDCs ( Table 1 ) and inhibits IFN-\u03b1 production (174, 175) . In this way, HCV might inhibit IFN-\u03b1 production to establish chronic infection. Finally, pDCs are also targeted by human immunodeficiency virus (HIV), but whether they play a protective or detrimental role is still unclear (176) .", "High numbers of human DCs can be generated in vitro by culturing monocytes with cytokines (41) , and the large majority of studies on human DCs have been done with these monocytederived DCs. They are primary cells and show many behaviors of in vivo occurring DCs, including cytokine production as well as stable and potent antigen presentation upon maturation with TLR ligands (125) . However, monocyte-derived DCs are not the appropriate model to study the role of specialized DC subsets in human immune responses." ] },{ "paper_id": "0022796bb2112abd2e6423ba2d57751db06049fb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nonclimatic factors include the epidemiology, ecology, and distribution of the vector, socioeconomic, and environmental factors; climatic factors include weather variability, climate change, and extreme events. These factors are discussed in detail in the following sections.", "Taiwan. Before 2009, the Taiwan Centers for Disease Control (TCDC) used only a clinical case definition for reporting dengue, which may have led to over-reporting. The TCDC's current dengue case definition, established in 2009 and in use since, requires laboratory confirmation for reported cases [189] . Dengue must be reported to TCDC within 24 hours [72] . A central command center was established to provide resources and personnel from various ministries (Education, Interior, National Defense) and agencies (department of health, environmental protection administration, government information office). The aim was to foster close cooperation with local government units and public education to reduce vector breeding. These efforts have been associated with reduced case numbers from 2010 to 2012 [70] . However, it is difficult to confirm this trend because of the short period.", "Singapore has in place community-based programs for the removal of potential breeding habitats [193] , which involve the community in mosquito control through environmental management, health education, and community ownership (\"bottom-up\" approach) (e.g., \"Do the Mozzie Wipeout\" Campaign, \"Do the 5-Step Mozzie Wipeout\") [194] . This is essential for avoiding community complacency. However, the community-based approach can be slow or demotivating and, as a consequence, unsustainable [195] . Bottom-up and top-down approaches should be combined [195] .", "Australian annual average daily mean temperatures have increased progressively by 0.9\u00b0C since 1910, and the frequency of extreme weather has changed, with more heat and fewer cool extremes [160] . Substantial warming has occurred in the three oceans (Pacific, Indian, Southern) surrounding Australia [161] . By 2070, Australian temperatures are projected to rise by 1-5\u00b0C, depending on global CO 2 emissions. Consequently, climate sensitive diseases are expected to increase in incidence [162] ." ] },{ "paper_id": "00326efcca0852dc6e39dc6b7786267e1bc4f194", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Organizational details of intensive care units vary considerably. The presence and utilization of PICUs, intermediate units, stepdown units, and specialty-specific units differ from country to country, state to state (18) . Composition of PICU team members has not been standardized and is often driven by the availability of resources in that institution. Most team members (physicians, nurses, respiratory therapists, pharmacists, dieticians, etc.) have completed some form of pediatric ICU-specific training.", "The need for excellence in clinical care does not end simply with the referral. In an urban population in Guinea-Bissau, 45% of children under 5 years were hospitalized, and the in-hospital mortality was 12% in 2007 (34), compared with an inpatient mortality of 0.84% in the US in 2009-2010 (35) . Challenges in presentation, triage, initial management, and admission to the hospital setting prompted guideline development and interventions for improved patient outcomes. Nolan et al. demonstrated that more than half of children were undertreated or inappropriately treated with antibiotics, fluids, or oxygen in 21 hospitals across seven countries in Asia and Africa (36) .", "With unacceptably high mortality rates in children highlighted both during times of epidemics and in times of relative steady state, the WHO and UNICEF strategies for reducing mortality in children under 5 years initially focused on outpatient management and primary care (29) . The first WHO guidelines, the Integrated Management of Childhood Illness (IMCI), are an evidence-based strategy for assessing and treating sick children in the ambulatory care setting. Even with the focus on primary care, these guidelines assume that sick children will be referred to a hospital for escalation of care if needed (29) . With appropriate IMCI use, 16-46% of children will require referral to a hospital (30) (31) (32) (33) .", "Recent historical examples include the severe acute respiratory syndrome (SARS) and H1N1 influenza epidemics. As of June 2015, the overall fiscal impact of the Ebola epidemic has been estimated to be upwards of $30 billion, while only $7.1 billion has been pledged thus far (7, 8) ." ] },{ "paper_id": "00352a58c8766861effed18a4b079d1683fec2ec", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MH, CLD and PJ wrote the manuscript and contributed to the Figure and Table. FUNDING This work was funded in part by grants from the National Science Foundation (IOS#135862) and National Institutes of Health (NS101534) to PJ and by the Synapse Neurobiology T32 Training Grant (NS61764) from the National Institutes of Health to MH.", "Ionotropic GABA A receptors mediate the majority of fast inhibitory transmission in the brain. GABA A receptors are comprised of hetero-pentamers and ubiquitination of specific subunits can regulate receptor trafficking and degradation in an activity-dependent manner (Saliba et al., 2007; Jacob et al., 2008; Arancibia-C\u00e1rcamo et al., 2009) .", "Frontiers in Synaptic Neuroscience | www.frontiersin.org" ] },{ "paper_id": "0043d044273b8eb1585d3a66061e9b4e03edc062", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The Ministry of Health of the People's Republic of China (PRC) estimates that 5 million people currently have active TB with 80% of cases in rural areas, particularly in the poorest provinces in north and north-western PRCincluding Ningxia Hui Autonomous Region (NHAR) [1] ." ] },{ "paper_id": "0049ba8861864506e1e8559e7815f4de8b03dbed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Human Immunodeficiency Virus type 1 (HIV-1) envelope spike is a trimeric complex consisting of three noncovalently linked heterodimers of gp120 and gp41. Gp120, an exterior glycoprotein, mediates cell attachment, receptor and co-receptor binding. Gp41, a transmembrane glycoprotein, mediates viral and cell membrane fusion, which is critical for viral core to enter target cells. Both gp120 and gp41 are derived by cleavage of a common precursor gp160.", "Drosophila Schneider 2 (S2) cells were purchased from Invitrogen Life Technologies and maintained in 75 cm flask (Corning) at the cell density between 0.2 to 2 \u00d7 10 6 cells per ml in the Express FIVE\u00ae SFM medium (Invitrogen Life Technologies) supplemented with 10% FBS, 100 U/ml penicillin, 100 U/ml streptomycin and 100 mg/L L-glutamine at 28\u00b0C without additional CO 2 ." ] },{ "paper_id": "00623bf2715e25d3acacb3f210d6888ed840e3cb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following antibodies were used in this study: phospho-EGF receptor rabbit mAb (CST, USA); anti-CAT1 (Abcam, UK); caveolin-1 antibody, phospho-PKC \u03b1 antibody, and \u03b2-tubulin antibody (EnoGene Biotech, USA). The next day, membranes were washed three times with TBST and incubated with HRP-conjugated secondary antibodies for 2 h at room temperature. The membranes were then washed with TBST for 5 min four times. Protein band detection was performed using ECL reagents (Thermo Scientific, USA).", "TGEV strain SHXB (GenBank: KP202848.1) was provided by the Jiangsu Academy of Agricultural Sciences (JAAS, Jiangsu Province, China) [29] . For experimental assays, cells were infected with TGEV at a multiplicity of infection (MOI) of 3 for 1 h at 37 \u00b0C in serum-free medium and washed with phosphate-buffered saline (PBS, pH 7.2) three times to remove unbound virus. Cells were then cultured in maintenance medium (DMEM containing 2% FBS).", "Protein was obtained from IPEC-J2 cells at the indicated time points post-infection using ice-cold radioimmunoprecipitation assay (RIPA) lysis buffer containing 10 mM phenylmethylsulfonyl fluoride (PMSF). Total protein concentrations were determined using a bicinchoninic acid (BCA) protein assay kit (Thermo Scientific, USA). Cell lysates that contained equal amounts of protein were denatured, subjected to 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, USA). Membranes were blocked with Tris-buffered saline (TBS) containing 5% nonfat dry milk for 2 h, and incubated with the indicated primary antibodies at 4 \u00b0C overnight." ] },{ "paper_id": "0072159e1ebecc889e9bcabb58bb45c47e18a403", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Screening of proline-rich motif reading array identifies BAG3 as an EBOV VP40 PPxY interactor", "As the major filovirus matrix protein, VP40 plays a central role in directing virion assembly and egress from infected cells. Three minimal functional domains of VP40 are required for efficient VLP egress, including a membrane (M) binding region, a self-interaction (I) domain, and one or more late (L) domain motifs. The L-domain motifs hijack or recruit specific host cell proteins that facilitate or promote efficient virus-cell separation [3, 4, 6, [48] [49] [50] [51] [52] [53] . Here, we" ] },{ "paper_id": "007618ad76a3548195ab5d11c1e2459931c91cd1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Author Contributions: E.N. and J.K. were involved in the conception, literature review and drafting the manuscript; J.K., I.L., and E.C. critically revised the manuscript for important intellectual content; E.N., J.K., and E.C. conceptualized the review, supervised all aspects of the study, and critically reviewed and revised the manuscript. All authors approved the final manuscript as submitted. All authors read and approved the final manuscript. ", "Accumulating evidence demonstrates that despite being a suboptimal replication system, monocytes/macrophages cannot escape viral attack. Pathogens attack a variety of cells and utilize diverse bypass mechanisms to enter, change cell machinery and impact the fate of cellular decisions in favour of their replication and propagation.", "Therefore, it has to be assumed that viruses manipulate the cell biology of monocytes/macrophages in order to utilize them as a repository for dissemination, to promote long-term persistence within infected tissues and for enabling virus replication under favourable conditions." ] },{ "paper_id": "007bf75961da42a7e0cc8e2855e5c208a5ec65c1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Hemagglutination assay was performed in V-shaped 96-well plates (Greiner Bio-One). Two-fold serial dilutions in 50 ml PBS, 0.1% BSA of HE 0 -Fc or of purified HE 0 ectodomains (starting amounts indicated in the text) were mixed with 50 ml of a rat erythrocyte suspension (Rattus norvegicus strain Wistar; 0.5% in PBS) and incubated for 2 hours on ice.", "Diffraction data of crystals of MHV-S HE and its complex ( Table 1) were collected at ESRF station ID-14-1 and ID-14-3, respectively. Diffraction data of native and ligand-soaked HE crystals were processed using XDS [38] and scaled using SCALA from the CCP4 suite [39] . Molecular replacement was performed using PHASER with BCoV-Mebus HE as template (PDB ID: 3CL5; [23] ). Models were built manually with Coot [40] and refinement was carried out using REFMAC [41] . Water molecules were added using ARP/WARP, graphics generated with PYMOL (http://pymol.sourceforge.net).", "The crystal structures of a number of 9-O-Ac-Sia-specific nidovirus HEs have been solved [23, 24] . Unlike the receptorbinding site (RBS) of influenza C virus HEF [28] , the RBSs of the corona-and torovirus HEs seem to be exceptionally plastic as they appear to have undergone significant changes and adaptations that altered their overall architecture in a relatively short evolutionary time span. Based on these observations, we anticipated and speculated [23] that this plasticity might have allowed for even more substantial adjustments in the RBS of the murine coronavirus HE as to produce an entirely novel binding site specific for 4-O-acetylated Sias." ] },{ "paper_id": "0080d3bd9fb92e022c27715c2d1249042aa998b8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Female or male 6-8 week old IFN a/b/c receptor deficient mice (AG129) were purchased from B&K Universal Limited with permission from Dr. M. Aguet (ISREC, School of Life Sciences Ecole Polytechnique F\u00e9d\u00e9rale (EPFL)). IFN a/b receptor deficient mice (IFNAR) on a C57BL/6 background were provided by Prof. Ulrich Kalinke [33] . All mice were bred and kept under specific pathogen-free conditions at the Biomedical Resource Centre, Singapore. For immunization, BHK-21 derived mutant and WT viruses were used. For challenge experiments DENV produced in C6/36 cells was used.", "Virus was isolated from mouse serum with Qiagen Viral RNA extraction Kit.", "Fifty ng of viral RNA were used to prepare cDNA libraries using the Illumina TruSeq RNA sample preparation kit according to manufacturer's protocol. The only protocol modification was the removal of the mRNA enrichment step. The cDNA libraries were sequenced as a multiplex in a single lane of an Illumina HiSeq2000 (Next Generation Sequencing Core facility, Genomic Institute of Singapore). One to 2 million 50 bp paired-end reads were generated for each virus.", "(TIF) ", "The mouse experiments were conducted according to the rules and guidelines of the Agri-Food and Veterinary Authority (AVA) and the National Advisory Committee for Laboratory Animal Research (NACLAR), Singapore. The experiments were reviewed and approved by the Institutional review board of Biological Resource Center, Singapore (IACUC protocols 90474 and 100536)." ] },{ "paper_id": "0089aa4b17549b9774f13a9e2e12a84fc827d60b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Far-UV CD spectra were recorded using a Jasco J-715 spectropolarimeter (Jasco, Gross-Umstadt, Germany) equipped with a PTC 343 Peltier element. Experiments were performed in quartz cuvettes with 0.1 cm path length at a protein concentration of 0.15 mg/ml and far-UV spectra were recorded from 190 to 260 nm in 10 mM potassium phosphate, pH 8.0 at 20 uC. 16 spectra were accumulated for each protein analyzed and subsequently baseline corrected. The composition of secondary structure elements was calculated using the CD spectra deconvolution software CDNN [23] . Thermal transition experiments were monitored at 208 nm with a heating rate of 20 uC per hour. Data were normalized by setting the signal of the native protein to 1.", "Variant Medium-Chain acyl-CoA Dehydrogenase. PLoS ONE 9(4): e93852.", "Right angle light scattering (RALS) experiments were performed on a Cary Eclipse fluorescence spectrophotometer equipped with a temperature-controlled Peltier multicell holder (Varian). Samples contained 0.08 mg/ml protein diluted in 20 mM HEPES buffer, pH 7.0 and 200 mM NaCl. The increase in turbidity was monitored in the temperature range from 25 uC to 65 uC at a heating rate of 1 uC/min (excitation at 330 nm, emission 335 nm; 5.0 nm slit widths). Turbidity curves were illustrated with GraphPad Prism 5.0." ] },{ "paper_id": "008c1ceaeffe7abc87b031af39fae2632fa72897", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "input to the next layer just by computing an identity function." ] },{ "paper_id": "008d980cbcc283a9b707de3d9a02573dde8528ac", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Dendrogram constructed using UPGMA, showed low genetic differences and high genetic similarities among three populations (Thally, Kharkoo and Astore). Shagarthang population exhibited one degree separation from the above three populations, while Basho population appeared as a separate clade (Fig. 6) . AMOVA suggested no significant variance among populations indicating no populations' differentiation among regions. Variance contributed by variability was 46% among individuals and that within individuals was 54%, while 0% was observed among populations (Fig. 7) . ", "The following information was supplied regarding data availability:", "Supplemental information for this article can be found online at http://dx.doi.org/10.7717/ peerj.7672#supplemental-information.", "Samreen Aruge performed the experiments, analyzed the data, prepared figures and/or tables. Hafsa Batool performed the experiments, prepared figures and/or tables. Fida M. Khan analyzed the data, contributed reagents/materials/analysis tools, prepared figures and/or tables, authored or reviewed drafts of the paper, approved the final draft, collected samples. Fakhar-i-Abbas conceived and designed the experiments, contributed reagents/ materials/analysis tools, prepared figures and/or tables, approved the final draft, collected samples. Safia Janjua conceived and designed the experiments, approved the final draft." ] },{ "paper_id": "009002e8a66b8c1df088cf04069629fd76b13bb9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0093f9ae0861afc0d29fff935ae6a3af898cea00", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "www.nature.com/scientificreports SCIENTIFIC REPORTS | 5 : 8850 | DOI: 10.1038/srep08850 S1). Other candidate viral genomes were not detected by metagenomic analysis.", "In addition, the gag region of proviral DNA was amplified by nested PCR using primers (Tga1, Tga2, Tga3, and Tga4) that specifically detected the gag region of the SRV/D-T (SRV-4) 12 .", "www.nature.com/scientificreports SCIENTIFIC REPORTS | 5 : 8850 | DOI: 10.1038/srep08850" ] },{ "paper_id": "0094b25e2500306fadbdfb41d520f2970bb086d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The author(s) declare that they have no competing interests." ] },{ "paper_id": "00951716e01c8e0cc341770389fc38d1b5455210", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This cross-sectional study, conducted during December 2010-February 2011, used both quantitative and qualitative data-collection techniques.", "Since our study area included 90 clusters, we used cluster-sampling methodology for data-collection. In total, 15 clusters were randomly selected for the KAP study. Approximately 200 households from each cluster were randomly selected from the household list prepared by the demographic surveillance maintained by the ICVB project. An adult from each household who could provide information regarding his/her family was purposively selected for interview.", "A semi structured questionnaire was used for collecting quantitative data (see Additional file 2). It comprised a series of questions developed through literature review [9, 32, 33] and revised to match with the cultural views. Multiple answers were recorded per question based on predefined categories but no probing of remaining unmentioned categories was done. The questionnaire was divided into the following three main sections:" ] },{ "paper_id": "009892e02bc1a4c9abf6f547b979e68ecbde8087", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nasopharyngeal samples were taken according to a recently described procedure using swabs (Sigma-Virocult\u00ae M40 compliant. MWE. Corsham Wiltshire, UK) after saline instillation [24] .", "Quantitative variables are reported as mean \u00b1 standard deviation. Quantitative variables were compared using a nonparametric statistical test (Wilcoxon signed rank for paired comparisons). Pearson's correlation coefficient (r) was used to assess relationships between two variables. Statistical analyses were performed using SAS v9.4 (SAS Institute, Cary, NC, USA) or GraphPad Prism V6.00 (GraphPad Software, La Jolla, CA, USA). The significance level was set at 0.05." ] },{ "paper_id": "00acd3fd31ed0cde8df286697caefc5298e54df1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "It will be important to further characterize these NIVs and determine whether their differences confer distinctive biological behaviours, such as unique growth properties, antiviral resistance and discrete clinical outcomes among infected individuals. Strainfocussed studies could also identify how many distinct HRVs circulate in a single respiratory season, how often a given strain recurs in a population and just how many HRV strains there are." ] },{ "paper_id": "00ae0041374cbbf28df0d2cbeb08c1396a4f7878", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The authors declare that they have no competing interests." ] },{ "paper_id": "00af80743cef9bd8c04c532d74e9c67f0c9312e4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "00b88130d2a7c8489e209742494303b6731d7544", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "AcMNPV and rBV were propagated in Sf9 cells cultured in TMN-FH medium (BD Biosciences) containing 100 \u03bcg/ml kanamycin and 10% FBS. Ac/CAG-FrC-OVA and AcMNPV were purified as described previously [39, 43, 44] . The viral titers were determined by a plaque assay.", "Supplementary information accompanies this paper at https://doi.org/10. 1186/s13036-019-0207-y. " ] },{ "paper_id": "00c19aff3efc6e6430f77d81580ac927990ad5a2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Bronchoscopy was performed using an Olympus BF-1 T160 (Olympus, Tokyo, Japan) bronchoscope that has an outer diameter of 6.0 mm with a 2.8 mm working channel. All procedures were performed under moderate sedation using a combination of fentanyl and midazolam. BAL was obtained from the bronchopulmonary segment corresponding to CT scan findings for focal infiltrates while the right middle lobe or lingular was preferred in the cases with diffuse infiltrates. BAL samples were sent for standardized investigations consisting of cytology and microbiological analysis.", "Trial registration: ClinicalTrials.gov identifier NCT01374542. Registered June 16, 2011." ] },{ "paper_id": "00c88aab2bfcca0db253c972382e5eee245d071e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Motivated by the recent outbreaks in the Americas, two studies from Arizona State University have described the production of Zika virus glycoprotein antigens in plants. The first successfully expressed a soluble E protein which retained native antigenicity based on the binding of a panel of monoclonal antibodies and elicited both cellular and humoral responses in immunized mice. Furthermore, the levels of neutralizing antibodies in immunized animals exceeded the threshold required for protective immunity (Yang et al., 2017b) . The same group has also developed a VLP vaccine comprised of the hepatitis B core antigen presenting the Zika virus E protein domain III, to circumvent potentially inducing antibody-dependent enhancement (ADE) of infection against dengue infection (Yang et al., 2017a) .", "Molecular farming is on the cusp of being accepted as a mainstream technology for the production of heterologous pharmaceuticals, with particular appeal for resource-limited regions. Recent years have borne witness to the licensure of the first plant-made pharmaceutical for use in humans-taliglucerase alpha-with several more presently advancing through clinical trials. Plant-made pharmaceuticals have proven to be highly scalable and safe in humans, despite unfounded concerns regarding the impact of plant-specific glycosylation. Limitations of expression yields have been addressed with improved expression vectors enabling high levels of expression of many pharmaceutically relevant proteins.", "Given the extended period of divergent evolution of mammals and plants, the low expression levels reported for many viral glycoproteins may be due to incompatibility with the endogenous plant chaperone machinery. In support of this, putative homologues of key chaperones known to interact with glycoproteins exhibit low-level sequence identity to their human counterparts. We are currently exploring the co-expression of human molecular chaperones in planta (patent application: PA167643/P) to improve the production of heterologous glycoproteins, based on the hypothesis that the endogenous plant chaperones may represent a critical bottleneck for high levels of expression." ] },{ "paper_id": "00cb1a95986171a256f5ef14701bd8f571221a28", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Tyrosine kinase WNV West Nile virus YFV Yellow fever virus", "TLRs have also been implicated in the activation of DCs by YF-17D [27] . DCs recovered from MyD88, TLR2, TLR7 and TLR9 -deficient mice all exhibited reduced levels of cytokine production in response to YF-17D. In addition, human fibroblasts stably transfected with TLR8 and an NF-\u03baB luciferase reporter responded more robustly to YF-17D, suggesting that this TLR8 is also capable of detecting the virus [27] .", "The role of the RLR system in controlling yellow fever virus (YFV) has yet to be examined. However, both RIG-I and MDA5 expression was upregulated in peripheral blood mononuclear cells (PBMCs) recovered from individuals vaccinated with YF-17D [15] , suggesting a possible role for both of these PRRs in responding to YFV in vivo. Combined, these studies indicate that RIG-I is involved in sensing all flavivirus infections; however, MDA5's role is virus-dependent." ] },{ "paper_id": "00ccc4ef2b6c6f238836b7feb5123bd6a822cc08", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Total RNA was isolated from LCM tissues, using the miRNeasy FFPE Kit (no. 217504, Qiagen), as described in the above section.", "In 2009, the swine-origin H1N1 influenza A virus (IAV) emerged and caused outbreaks of respiratory illness in humans around the world. After the 2009 pandemic, outbreaks of that strain have continued to cause serious illness and increased mortality, particularly in young adults and children [1] . The physiopathology of pandemic H1N1 (pH1N1) infection differs between individuals. Whilst most patients develop mild upper respiratory-tract infection [2], some patients progress to develop severe lower respiratory tract complications [3] . In addition, high rates of clinically unapparent infections have been reported by seroepidemiological studies [4, 5] . This evidence suggests that the severity of influenza is, at least, partially determined by host factors.", "Viral titration from lungs samples and nasal swabs was performed on control and infected animals, and determined by plaque forming units (PFU) as described previously [23] . A portion of around 0.2 g of the right caudal lung lobe and nasal swabs were placed in 0.5 mL of Dulbecco's Modified Eagle's Medium (DMEM) (Bio-Whittaker \u00ae , Lonza, Verviers, Belgium) with 600 \u00b5g/mL penicillin and streptomycin, and frozen at \u221280 \u00b0C until further processing.", "The human pH1N1 isolate A/CastillaLaMancha/ RR5911/2009 was used in the present study. The virus was isolated at the National Influenza Centre, Centro Nacional de Microbiolog\u00eda, Instituto de Salud Carlos III (CNM, ISCIII) from a respiratory sample sent by the Spanish Influenza Surveillance System for virological characterization. It was isolated from a 35-years old woman, without co-morbidities, who developed a severe disease and died. The viral isolate was passaged in Madin-Darby Canine kidney (MDCK) cell cultures four times and had a final titre of 10 6.02 TCID 50 /mL. Titre was determined using the Reed and Muench method [22] ." ] },{ "paper_id": "00cf719db65d07c0c7bdea9defaea448fc5f5786", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Experiments were performed in accordance with federal and cantonal guidelines (Tierschutzgesetz) under the permission numbers SG07/62 and SG07/63 granted by the Veterinary Office of the Canton of St. Gallen.", "The data on target cell persistence (C(t)) display kinetics which differs for some cell types or under certain conditions from the exponential (denoted by E) behavior C(t)~C(0) : e {d0C : t . It is rather consistent with the Gompertz kinetics (denoted by G) as described by equation", "Finally, the rate equation for the density of uninfected target cells reads" ] },{ "paper_id": "00dce8da5fcee849b30c9d7a7e358c5855b14ca9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "To summarize, the mechanisms by which herpesviruses trigger autoimmunity are variable. Both, molecular mimicry and bystander activation were reported in EBV-and HSV-induced autoimmunity. Not only that, EBV also has the ability to immortalize autoreactive infected B cells. In addition, as neurotropic viruses, herpesviruses can infect and kill CNS cells directly, leading to several AIDs.", "Bystander activation was also a suggested mechanism by which CVB4 induce or accelerate diabetes. Mouse studies have indicated that by evoking beta cells damage, CVB4 infection promotes the release of self-antigens, which are then presented by macrophages to autoreactive T cells [32] ." ] },{ "paper_id": "00f1ef126735474ccaf3a8d1cce9a4823d7f1228", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All of these results are in agreement with the participation of electrogenerated MQI in the Michael addition reaction with BS [28] [29] [30] [31] [32] [33] [34] . Fig. 1c is the cyclic voltammogram of BS which indicates that in the studied potential range, BS is not electroactive." ] },{ "paper_id": "00f7d667e3362066c08f7d6594d1d3b0cb16e08e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "00fcc6277c19f6b180232d7a6fe0b0abfafb21f7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Lowest leukocyte count -per mm 3 2,500 (600-11,500) 2,080 (810-13,000) 0.590", "Appendix S1. (DOC)" ] },{ "paper_id": "010ad052b58172981e089bc73b9ad16a732960f2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nonetheless, our results support a significant protective function for xbp-1 within the cells targeted by Cry5B.", "All experiments were performed a minimum of three times. LC 50 values were determined by PROBIT analysis [43] . The lethal concentration assays are represented graphically using nonlinear regression performed with the software GraphPad Prism. Statistical analysis between two values was compared with a paired t-test. Statistical analysis among three or more values was compared with matched one way ANOVA using the Tukey post test. Lifespan data was analyzed with Kaplan-Meier survival curves. Statistical significance was set at p,0.05.", "Found at: doi:10.1371/journal.ppat.1000176.s001 (0.03 MB DOC)" ] },{ "paper_id": "01110a24b6ce133ae80d21a36c7994e364ba296c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Table S11 Summary of the classification type random forest algorithms performed and overall prediction error. (DOCX)", "Emerging infectious diseases (EIDs) continue to represent a significant public health threat, as illustrated by the 2009 H1N1 influenza pandemic and the 2003 severe acute respiratory syndrome (SARS) epidemic. Of particular concern are the 60%+ of EIDs of zoonotic origin [1, 2] . In addition to influenza and SARS [3] , notable examples include hantaviruses [4] , Nipah and Hendra viruses [5] and HIV [6] .", "Text S1 Includes a more detailed description of the methods used throughout, as well as Figures S1, S2 , S3, S4, S5 and Tables S1, S2, S3, S4, S5, S6, S7, S8, S9, S10, S11. (DOCX)" ] },{ "paper_id": "0113b9a8d82039e8474e887038d643853b5fdfeb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Presentations were used to introduce the participants to each module, then they would work through case studies in group discussions which included exercises on using data collection and reporting tools.", "Supporting IDSR contributes to a strengthened healthcare system", "Not applicable." ] },{ "paper_id": "0116dea9b6d4c58748d1a38b69b4fe6e06868aa4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Surface staining reagents including Mouse anti Pig CD163: RPE (MCA2311PE, Bio-Rad). After staining, cells were fixed in 1% formaldehyde and analyzed on FACScan (Becton-Dickinson, Franklin Lakes, NJ, USA) upgraded with a red laser (Cytek Development, Fremont, CA, USA). Data analysis was conducted using FlowJo software (Tree Star, Inc., Ashland, OR, USA).", "Total RNA was prepared using Trizol reagent (Takara, China) based on the instruction by manufacture. Then, cDNA was synthesized by an oligo (dT)15 primer and SuperScript\u2122 II reverse transcriptase reagents (Takara, China). Quantitative real-time PCR was performed with the iTaq\u2122 Universal SYBR GREEN Supermix using a CFX96 Optics Module instrument (Bio-Rad, Hercules, CA, USA). The forward and reverse primer sequences were summarized in Table 1 .", "Each experiment was independently replicated on three individual pigs, and all experiments were replicated at least three times. Data were presented as mean\u00b1s.e.m. when indicated. Statistical analysis was conducted by t-test with a 95% confidence limit, and two-way ANOVA for multi-group comparisons by Prism 7.0 (GraphPad Software Inc., USA). Differences were considered significant at P<0.05. All data are representatives of at least three independent experiments." ] },{ "paper_id": "011b8a7002da6c0fae7ca76c127567a6462daf5d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Immediately following a 2-h incubation period, we returned the chamber to the BSC and removed the cell culture dish. We added 500 l of TSB to each well containing droplets, which we resuspended via pipetting and then placed into separate cryovials for each well's solution. We placed the vials in a \u03ea20\u00b0C freezer for 20 min before moving them to a \u03ea80\u00b0C freezer for long-term storage. Prior to assaying these samples, we thawed them at room temperature before sampling and refreezing.", "Samples for each experimental condition included negative-control cultures containing 500 l of Phi6 stock solution. We stored these controls in polyethylene tubes and did not spot them as droplets but otherwise incubated them in the RH chamber and stored and assayed them identically to the test cultures.", "Chamber to control RH and AH. To control humidity, we used a chamber as previously described (13) . We placed two polyethylene petri dishes filled with 10 to 20 ml of a saturated salt solution into the bottom of a glass desiccator. Saturated solutions of potassium acetate, magnesium chloride, potassium carbonate, magnesium nitrate, sodium chloride, potassium chloride, and potassium sulfate provided stable RH at 23%, 33%, 43%, 61%, 75%, 85%, and 98%, respectively. We also placed a battery-powered computer fan into the chamber to promote airflow and a more rapid establishment of an RH equilibrium." ] },{ "paper_id": "01234cee305e37a78cedea8148bf6177d47fe66b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Camel peripheral blood mononuclear cells (PBMC) were obtained from na\u00efve animals from a previous experiment 22 . Human PBMC were obtained from 3 healthy blood donors (Sanquin Bloodbank, Rotterdam, The Netherlands). The use of PBMCs for scientific research was approved by the Sanquin Bloodbank after informed consent was obtained from the blood donors.", "As an additional control, nasal turbinate of a non-infected dromedary (collected during routine necropsy at the Department of Pathology, University of Veterinary Medicine Hannover, Germany) was used. Euthanasia of the animal was performed due to non-respiratory disease." ] },{ "paper_id": "01285aff189f375f52b762256d8f419ccad3077c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background. Recent detections of circulating serotype 2 vaccine-derived poliovirus in northern Nigeria (Borno and Sokoto states) and Pakistan (Balochistan Province) and serotype 1 wild poliovirus in Pakistan, Afghanistan, and Nigeria (Borno) represent public health emergencies that require aggressive response.", "Conclusions. Eradication efforts for vaccine-preventable diseases need to create performance expectations for countries to immunize all people living within their borders and maintain high coverage with appropriate interventions.", "Eradication efforts for vaccine-preventable diseases need to create performance expectations for countries to identify and reach all people living within their borders with maintained high coverage with appropriate interventions. " ] },{ "paper_id": "012debf5a240a496518af146ddfc16c958339c2b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Some reflections on our methodological approach are due here. Perhaps the major advantage of our overall strategythe use of foreign, or otherwise external social scientists to conduct open-ended interviews with in-country expertswas that it provided the opportunity for the latter to reflect on their work in a way that can offer a fresh perspective on what may often seem self-evident to them as 'insiders' [51] .", "Not applicable." ] },{ "paper_id": "0132b8c2721692d9f53bd33a738fa94618bb4e91", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: Syphilis spirochete Treponema pallidum ssp. pallidum remains the enigmatic pathogen, since no virulence factors have been identified and the pathogenesis of the disease is poorly understood. Increasing rates of new syphilis cases per year have been observed recently.", "Finally, the stain solution was removed, and arrays were washed in non-stringent wash buffer followed by two 30 sec washes in 0.5 \u00d7 SSC and a 15 sec wash in 70% EtOH. Arrays were spun dry in a custom centrifuge and stored until scanning." ] },{ "paper_id": "013ff749a58f92db7e227f7acbe47d050175851c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The genome sequence reported in this study will promote a better understanding of the molecular pathogenesis and genetic diversity of PEDV.", "Accession number(s). The complete genome sequence of PEDV strain CH/GX/2015/ 750A has been deposited in GenBank under the accession no. KY793536.", "This work was supported by grants from the Science and Technology Projects of Fishery and Husbandry of Guangxi Province, China (grants 201633041, 201633044, and 201633034)." ] },{ "paper_id": "014336e4855d194c1833ba91c8ae3b302cbeafe2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The peripheral lymphocytes were separated from anticoagulant blood. The concentration was diluted to 1.0 \u00d7 10 6 cells/ml with PBS. For two-color staining, peripheral blood mononuclear cells were treated with a mixture of anti-CD3 monoclonal antibody (IgG2a) and anti-CD4 (IgG2b), CD8 (IgG2a) followed by incubation with a mixture of PE-conjugated anti-pig IgG2a (for anti-CD3) and either Alexa Flour 647 mouse anti-pig IgG2b (for anti-CD4), FITC anti-pig IgG2a (for anti-CD8), respectively [39, 40] . Then, flow cytometry analysis was performed on a BD FACSCaliburTM (BD Biosciences, USA). T cell subsets was represented as the percentages of CD3+, CD3+CD4+, CD3+CD8+ in peripheral blood.", "All methods and experimental protocols were conducted under the approved guidelines of Sichuan Agriculture University (Chengdu, China) and approved by the ethical committee of the Laboratory Animals Care (Chengdu, China).", "Diarrhea index \u00bc summary of diarrhea scores animal number in the group \u00c2 number of days of trials" ] },{ "paper_id": "014d7df59dc6c5ed456bf19b76b394e920d3a9dc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The protocol for capturing and sampling of bats was approved by the Chung Yuan Christian University Animal Care and Use committee and the agriculture bureau of regional government (No. 105024).", "Results" ] },{ "paper_id": "015729be3f439e9ef2033276a4ef14df8873dda9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "2.6. Statistical Analysis. The selectivity index (SI) was determined by the ratio of TC 50 to IC 50. All experiments were performed in triplicate, and three independent experiments were conducted. Data were presented as mean \u00b1 SD and ", "Herpes simplex virus type 1 (HSV-1) is an important pathogen for humans, and discovery of novel effective antiherpetic drugs without adverse effects is of great interest. The primary symptoms of herpes infection include a prodromal flu-like syndrome with fever, headache, malaise, diffuse myalgias, followed by local symptoms consisting of itching and painful papules. Gingivostomatitis and pharyngitis are the most frequent clinical manifestations of first episodes of HSV-1 infection. After establishing latency, HSV can reactivate, causing frequent recurrent infections in some patients, whereas most people experience few recurrences [1] . The clinical manifestation of the disease exhibits different severity in immunocompetent patients and in addition some patients always encounter recurrent attacks [2] . However in immunocompromised patients and neonates, herpetic infections can cause serious systemic illnesses. Recurrent herpes labialis is the most frequent clinical manifestation of reactivated HSV-1 infection.", "Grant from Iranian Ministry of Health (to A. Astani)." ] },{ "paper_id": "015a5be4701f244a51d6c244c2ba5b69ac68dd9d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Exosomes labeling and confocal imaging. Exosomes were loaded with 1X CellMask Deep Red Plasma Membrane stain for 10 minutes at 37\u00b0C. Exosomes were then washed with PBS and centrifuged at 100,000 x g for 70 minutes in TLA 100.3 rotor (Beckman Coulter) to pellet exosomes and resuspended in culture medium.", "Filovirus outbreaks occur sporadically, but with increasing frequency. With no current approved filovirus therapeutics, the 2014 Makona Ebola virus epidemic in Guinea, Sierra PLOS Pathogens |", "Loading of DsiRNA into exosomes. Dicer-substrate RNAs (DsiRNA) (IDT), 27mer duplex RNAs that have increased potency in RNA interference compared to tradition siRNAs [97] , were loaded into exosomes by electroporation as described [98] . Briefly, exosome pellets were resuspended in electroporation buffer for siRNA loading. The electroporation mixture was prepared by mixing exosomes and DsiRNA in 1:1 (wt/wt) in electroporation buffer. The final concentration of exosomes in the mixture was 250 ng/\u03bcL. The mixture was electroporated in a 400 \u03bcL volume using 0.4-mm cuvettes at 400 mV and 125 \u03bcF capacitance with pulse time of 10-15 ms. Exosomes were aliquoted and frozen at -20\u00b0C until use." ] },{ "paper_id": "015c335c8cb9e5eabb352e81c0f38bf6f781b202", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The study was conducted in a rural area of Rachuonyo South district, Nyanza Province in the western Kenyan highlands that spans about 300 km 2 .", "There is one main road that runs through the area and the landscape consists of rolling hills and several large rivers (Fig. 1) . The population mostly comprises people from the Luo ethnic group whose main occupation is subsistence agriculture. Compounds typically comprise extended families living in proximity to their fields or in multi-unit structures in the few, more urban, market centres [26] .", "The ideal geolocation approach in a rural setting will ultimately depend on the information available, the objectives, whether it be monitoring for epidemics or planning for disease control interventions, and the required spatial precision/accuracy. The geocoding approach requires that an accurate and up-to-date list of names of compound heads is available, which is unlikely to be the case outside areas of active community-based research. The geocoding approach also relies on names recorded being complete and recorded consistently; a difficult task in busy facilities. There may also be challenges in obtaining correct information from people who may want to remain anonymous. Moreover, a systematic bias is inevitable as compounds whose head has a common name or is the head of multiple compounds will never be matched unless other variables are also considered. However, in areas where a complete database is available, through land registries for example, or if overall accuracy is less important, geocoding could provide a useful geolocation approach.", "This study was approved by the ethics committees of the London School of Hygiene and Tropical Medicine (LSHTM 5956) and the Kenya Medical Research Institute (SSC 1589). Individual informed consent was sought from all participants of the health-facility survey by signature or thumbprint accompanied with the signature of an independent witness. As defined in the Kenya national guidelines, participants aged <18 years who were pregnant, married, or a parent were considered 'mature minors' and consented for themselves [31] .", "Across both surveys, 3034 people were enrolled of which 830 (27%) were able to be traced back to their compounds and included in the analysis. Those that could not be traced were mainly due to running out of time and inaccurate information provided at the facility. The participants that could not be traced were evenly distributed between years and facilities." ] },{ "paper_id": "0162b627476379a84d5a92480a881efdd3063f66", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "01669153236899edec9fff5fc4fb19a742c3dfef", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Our study had several limitations that could influence the results of analyses performed. False negative laboratory results may have been obtained due to the late referral of patients to clinics. Individual questionnaires were filled out during sampling and subsequent data regarding course of disease were not collected so we were unable to assess disease severity characteristics (developing pneumonia, need for ICU, etc.). For the same reason, we did not evaluate chronic conditions among non-fatal ILI/SARI cases to determine risk factors associated with any severe courses of disease.", "https://doi.org/10.1371/journal.pone.0201207.g005" ] },{ "paper_id": "0180abece22ace6548f4601591c98059808d0509", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Selective pressure analysis. The number of synonymous substitutions per synonymous site, d S , and non-synonymous substitutions per non-synonymous site, d N , in VP1 were calculated using Nei-Gojobori method (Jukes-Cantor) in MEGA5. Sites under positive selection were inferred using single-likelihood ancestor counting (SLAC) and fixed effects likelihood (FEL) methods as implemented in DataMonkey server (http://www.datamonkey.org). The overall \u03c9 (d N /d S ) value was calculated according to NJ trees under the TrN93 substitution model. Positive selection for a site was considered to be statistically significant if P-value was < 0.1. A mixed-effects model of evolution (MEME) was further used to identify positively selected sites under episodic diversifying selection in particular positions among different clades within a phylogenetic tree even when positive selection is not evident across the entire tree. The relative residue abundance within BC and DE-surface exposed loops were depicted using WebLogo.", "A bimodal age distribution was observed among the 30 patients (male: female = 19:11) with EV-D68 infections (Table 1) , which included 22 children (< 18 years), one 37-year-old adult and seven elderlies (> 60 years). Of the seven elderlies, two resided in elderly homes (patients 19 and 23). A 15-year-old adolescent (patient 6) and a 37-year-old adult (patient 13) were also institutionalized. Close contacts of three patients were noted to have recent respiratory illnesses, including siblings of patients 3 and 4, and domestic helper of patient 28. One elderly (patient 20) had recent travel history to mainland China. No epidemiological linkage was identified among the 30 patients.", "Scientific RepoRts | 6:25147 | DOI: 10.1038/srep25147" ] },{ "paper_id": "0181010a40e179c9b66d8b1f0eaac4fbf0ab6341", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "018269476cd191365d6b8bed046078aea07c8c01", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The parameters of the BHRP model were shown in Table 1 .", "Therefore, the BHRP model was simplified as RP model and is shown as follows:", "In the model, people and viruses have different dimensions. Based on our previous research [15] , we therefore used the following sets to perform the normalization:", "The R 0 of the normalized RP model is shown as follows:" ] },{ "paper_id": "01880ef487dfed3681dd6d296a0a82417b8f38a0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Poliovirus is found within the Human Enterovirus C species of the Picornaviridae family and can be classified into three distinct serotypes (1, 2 and 3). Most poliovirus infections cause an asymptomatic incubation period followed by a minor illness characterized by fever, headache and sore throat which mainly affects children. However, PV infections can lead to paralytic poliomyelitis which can result in death. Following the WHO 1988 polio eradication program, the number of poliomyelitis has been reduced by 99% worldwide but a small number of countries still have sporadic outbreaks of polio [22] .", "A previous study compared a DENV vaccine candidate strain, DENV-3 PGMK30FRhL3 (PGMK30), which produced acute febrile illnesses with another clinically safe DENV vaccine ", "Comparative sequence alignment of large and small plaque variants of CHIKV primary isolates from the Comoros Island showed two amino acid differences in the nsp2 protease and the nsp3 protein." ] },{ "paper_id": "0188acc1eba8c0a3adef55aeada7de552cf855be", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Bootscanning analyses were performed using the default settings of SimPlot software [20] . ChinaGD02 strain was used as the query sequence and was compared to those of other HCoV-NL63 subgenotype strains.", "The complete and partial genomes of human coronavirus NL63 identified in this study were deposited in GenBank under the accession numbers: MK334043-MK334047, MK342125-MK342133." ] },{ "paper_id": "018b618ea132d47ffb43b003a6c78cb9eeadc017", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cell lines originally purchased from American Tissue Culture Collection (ATCC), such as human embryonic kidney (HEK 293T, ATCC CRL-3216) and baby hamster kidney (BHK21, ATCC CCL-10) cells, were adhered to recommended ethics approvals and standards.", "antibodies from macaques infected with the third closely related isolate of CHIKV.", "(PDF)" ] },{ "paper_id": "01a462bf8cf2cd973d1651b991d27c9556d2ae3c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "https://doi.org/10.1371/journal.ppat.1006714.g004", "https://doi.org/10.1371/journal.ppat.1006714.g008", "The symptoms occurring during compatible infections (e.g. chlorotic symptoms) represent the final outcome of complex biochemical and physiological perturbations occurring upon replication and spread of the virus, and result from both the combination of virus demands, cellular stresses and host defense reactions [55] . Despite recent progress in deciphering plant/ virus interactions using systems biology approaches [56] [57] [58] [59] , the molecular mechanisms involved in disease symptoms still remain unclear.", "The structures were solved by molecular replacement using the PHENIX suite of programs [79] . Rebuilding was performed with Coot [80] . Refinement involved two TLS groups (one for each molecule). Initial noncrystallographic symmetry restraints were removed in later stages of refinement." ] },{ "paper_id": "01b5ae0cce289ca9cdcebc4079f960e833cfbd79", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Many betaretroviruses were investigated (JSRV to mIAP in Table 1 ). All of the viruses in this group rely on double frameshifting mechanism to express their pro and pol genes. ", "During the translation process, ribosomes are capable of performing some nonstandard decoding events which provided that appropriate signals are present in the mRNA being translated. These unusual events are referred to as \"recoding\" [1, 2] . Two of the major recoding mechanisms are programmed \u22121 ribosomal frameshifting (PRF) and stop codon readthrough. These mechanisms are utilized by retroviruses and some other RNA viruses to express their structural and enzymatic proteins at a defined ratio [1, [3] [4] [5] . Both \u22121 frameshifting and stop codon readthrough are site specific and occur at a defined frequency much higher than the background error rates of maintaining the reading frames.", "There are three primate (simian or human) lentiviruses: simian immunodeficiency viruses (SIV) and human immunodeficiency viruses type-1 and type-2 (HIV-1 and HIV-2) in the Recode database. The database gives only one representative sequence for each of these viruses. These are the particular sequences we investigate in this study. No potential pseudoknot was detected downstream from the gagpol frameshift site in SIV." ] },{ "paper_id": "01be6aef7ae6555eef2062bddb57f8643d1244e9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "To investigate the best order of EPSs' antiviral effects, three experimental procedures were used as follows:", "Statistical data processing was performed according to standard approaches for calculating statistical errors (standard deviation) using Microsoft Excel 2010. The results were expressed as mean \u00b1 S.D. for three independent experiments. The Student's t-test (unpaired, two-sided t-test) was used to evaluate the difference between the test sample and control. A p value of <0.05 was considered statistically significant.", "Therefore, the development of new antiviral drugs that would be effective against adenoviruses without adverse effects, for a wide range of patients, including long-term users, is very urgent." ] },{ "paper_id": "01bf19ea2cb2baab425377eaae3286190e9bf975", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical comparisons were performed using GraphPad Prism 5 (GraphPad Software Inc., USA). Results are presented as means \u00b1 SEM, and statistical significance was assessed at P < 0.05, 0.01, or 0.001.", "Cloning and Sequencing of the ev21 Element and ALV-J Genomes", "The full-length proviral ALV-J genomes were amplified with previously published primers ." ] },{ "paper_id": "01c25f9838ef8e005bf720c4f76e67a9f1038ff0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Three covariant matrices were constructed as:", "1 C = \u23a1 \u23a3 1 C 1,1 1 C 1,2 1 C 1,3 1 C 2,1 1 C 2,2 1 C 2,3 1 C 3,1 1 C 3,2 1 C 3,3 \u23a4 \u23a6 ", "Here, expansion of D 2 yielded three equations:" ] },{ "paper_id": "01c6c44650ad5466cdb134a28d0b14700fa3906d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The variables Z and h are unobserved, and the goal is to infer their joint posterior distribution,", "Assuming all non-synonymous mutations at a given gene have the same selection coefficient and all synonymous mutations are neutral, population genetic theory says that v should be given by [70, 90] :", "Cytokine/chemokine C-C motif: CCL1 (P = 5.2610 24 ), CCL20 (P = 7.6610 24 );", "The prior probability of a history Z i is simply a product of the prior and the relevant switching probabilities:", "where U 0 represents the selective state at the root. The switching model effectively defines a prior distribution over histories, which tends to favor simpler histories over more complex ones (typically h nbe ,0.5). The prior probability for each element of h is defined by a (conjugate) Beta distribution with parameters a and b (here, a = 1, b = 9). Because these elements are independent in the prior," ] },{ "paper_id": "01c6ed4b3dee404e4d908af40ab93183b573e9ec", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Patient allocation will follow a concealed process using sealed, fully opaque, numbered envelopes.", "Frequency and duration of follow-up", "Not applicable." ] },{ "paper_id": "01cadfe2bb23b6989e57fce2ba744691557faa93", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The reported perceptions of risk in this study are low. However, the actual risks are also likely to be low for a well-trained and experienced volunteer. Thus, we believe that the perceived risks represent the actual risks.", "We used our descriptive analysis of the data and a linear regression to study the relation between the sum score of each domain versus the age group and country where the volunteer worked. We calculated the sum scores by adding up the scores within each domain.", "Koopmans, Chantal Reusken, Aura Timen.", "Of the 251 volunteers, 162 (65%) volunteered to go to Sierra Leone, 76 (30%) went to Guinea, and 13 (5%) went to Liberia. The first 70 participants (28%) volunteered in 2014, and the remaining 180 (72%) volunteered in 2015. Most volunteers (45%) were 26 to 35 years old and 27% were 36 to 45 years old." ] },{ "paper_id": "01cff21366d475b5bc294c90da89a521b510234a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "01e22956c79df3220a67bce71cf22de95d29b723", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "ELISA plates were coated with 50 ng of purified virus or 100 ng of rE in carbonate buffer at pH 9.6 for 2 hrs at room temperature and incubated with blocking buffer (0.05% TBS-T containing 3% skim milk or 3% normal goat serum) at 37 o C for 1 hr. Human immune sera or hMAbs serially diluted in blocking buffer were added for 1 hr at 37uC followed by alkaline phosphataseconjugated goat anti-human IgG (Sigma) for 1 hr at 37uC. Finally, p-nitrophenyl phosphate substrate (Sigma) was added to each well and the reaction was allowed to develop for 15 minutes before recording optical density at 405 nm on a spectrophotometer.", "DENV neutralizing antibodies was measured by a focus reduction neutralization test (FRNT) with Vero cells or using a flow cytometry-based neutralization assay with the U937 human monocytic cell line stably transfected with DC-SIGN as previously described [31] .", "Human Antibody Response to Dengue Infection www.plosntds.org or the A strand regions that have previously been described as targets of mouse MAbs [23] ( Figure 4C )." ] },{ "paper_id": "02049ffbdb20997055c4def3516af0e6e40dd427", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following source data is available for figure 3:", "The following source data is available for figure 6:", "mRNA quantification by quantitative reverse transcriptase-PCR (qRT-PCR)" ] },{ "paper_id": "021144f6c1945b9bff9ea9e4b04b24dcf53330b4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "PEDV belongs to the Alphacoronavirus genus and can cause an acute and highly contagious enteric disease. Its clinical symptoms include watery diarrhea, severe enteritis, vomiting, and weight loss; the mortality rate can reach 50%-90% in suckling piglets [8] [9] [10] . In 1977, Pensaert isolated a new coronavirus-like particle associated with diarrhea from Belgian swine breeding farms. This virus was different from TGEV and was designated CV777 [11] . Subsequently, the disease was reported in the United . Since 2010, massive PED outbreaks have been reported in Asia. In April 2013, there was a sudden occurrence of PED disease that rapidly spread across the United States, causing high rates of death among piglets [8] . Currently, PED is considered a pandemic disease that causes substantial economic losses to pork producers all over the world.", "Insect cells were cultured in Sf-900 II SFM (Invitrogen, Life Technologies, Carlsbad, CA, USA) at 27 \u00b0C. HEK-293T cells were grown in RPMI 1640 medium (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum at 37 \u00b0C with 5% CO2. CV777 is a PEDV prototype strain [11] , and CHGD-01 is a PEDV variant field isolate that was isolated in China in 2011 [21] .", "Insect cells were cultured in Sf-900 II SFM (Invitrogen, Life Technologies, Carlsbad, CA, USA) at 27\u02ddC. HEK-293T cells were grown in RPMI 1640 medium (Gibco, Waltham, MA, USA) supplemented with 10% fetal bovine serum at 37\u02ddC with 5% CO 2 . CV777 is a PEDV prototype strain [11] , and CHGD-01 is a PEDV variant field isolate that was isolated in China in 2011 [21] ." ] },{ "paper_id": "021af77daa9633d212e816cdbaf9f89240bfa3a0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All animal experiments were approved by the Animal Care and Use Committee of the Fourth Military Medical University.", "The neuroblast cell line Neuro2a was bought from ATCC and kept in DMEM (Gibco, Grand Island, NY, USA) containing 10% fetal bovine serum (FBS, Gibco, Grand Island, NY, USA).", "All statistical analyses used GraphPad Prism version 6.01 software. Statistical differences were determined using the Student's t-test. P-values < 0.05 were considered significant ( * P < 0.05, * * P < 0.01, and * * * P < 0.001)." ] },{ "paper_id": "021fba0f252408868fa29b65686dedb3b3d6bf02", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Global pesticide production should be highly effective, confer low toxicity and high safety coefficient, and exhibit satisfactory selectivity and environmental compatibility. Botanical pesticides have been widely investigated and applied because of their desirable properties [1] . New natural biological active compounds must also be discovered to promote the development of environmentally friendly pesticides [2] . As such, the use of biological active ingredients [3] or action targets [4] as guides is an important aspect in research and development of botanical pesticides." ] },{ "paper_id": "02276a07ed2aa49afe07d97e7d7286b2b6fea532", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MDA5 is also subject to several types of activation that resemble those that activate RIG-I. Indeed, PP1\u03b1/\u03b3, USP3, RNF123, and TRIM40 target RIG-I and LGP2 and viral evasion", "Over the past decade, our understanding of intracellular sensor-mediated antiviral responses has expanded, and we know much more about the molecular mechanisms by which they are regulated via host and viral factors. This knowledge not only allows us to understand viral pathogenesis but also reveals how intracellular sensors are activated and regulated. Extensive knowledge of these mechanisms will allow for research and development of novel anti-inflammatory agents, immunostimulatory agents, new vaccines, and antiviral agents that target cellular regulators or specific viral proteins. Regardless, further work is needed to identify other cytosolic sensors (such as novel sensors of nucleic acids), other positive or negative regulatory molecules and related pathways, and novel escape mechanisms utilized by new viruses or variants.", "Taken together, results to date show that viruses express specific proteins that interfere with RIG-I " ] },{ "paper_id": "022efb5d64e88419546d697b6a5a96e6bc8a9fab", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "LGP2 activation supports MDA5-dependent signalling while inhibiting both RIG-I and Dicer. 82, 83 TLR and RLR activation stimulates IFN-I expression, which activates JAK-STAT signalling to modulate expression of hundreds of IFN-stimulated genes, thereby placing infected cells and local tissues in an antiviral state. 8 stimulation, 84 the IFN and RNAi systems compete in a manner detrimental to the efficacy of RNAi-based therapeutics.", "Viral infection often induces cytoskeletal remodelling, resulting in cytopathic morphologies including syncytia and tumor-like aggregates. Cells treated with actin depolymerising agents such as cytochalasin D show drastic reductions in production of numerous viruses, 38 Figure 2 ). Vimentin is reported to play a key role in replication complex assembly and modulating viral protein expression levels in DenV and HCV infection, respectively. 39, 40 Withaferin D targets the soluble form of vimentin 41 (Table 2) and has anticancer properties, although the effects of vimentin-targeting drugs in the context of infection have yet to be extensively studied.", "LGP2 recognises RNA as short as 12 nt irrespective of phosphorylation or hydroxylation at the 5 0 end.", "RNA virus evolution attempts to resolve this information economy paradox by extensively employing functional genomic secondary structures and noncoding regions, genome segmentation, compression (e.g. RNA editing, overprinting and frameshift reading) and gene product pleiotropy or multifunctionality (e.g. intrinsically disordered proteins). 17, [19] [20] [21] Yet another way is to manipulate host cell factors that are themselves multi-interacting or multifunctional 'hubs' of cellular activity, 22 whereby a single viral gene product subverts a single host factor to achieve net favorable control over numerous cellular processes. This can enable the virus to extract maximum utility from its informationally limited genome at minimal informational cost. Multiplying this effect across several viral and/or host gene products may enable the virus to extract a substantial 'return on investment' in terms of replicative fitness.", "To address production costs, RNAi and CRISPR/ Cas9 have recently been applied in attempts to engineer cells that produce greater viral yields. Using a genome-wide RNAi screen in HEp-2C cells and validation in the Vero cell line approved for vaccine development, van der Sanden et al. identified several gene knockdowns that drastically increased yields of multiple PV, enterovirus and rotavirus strains. However, these effects on viral replication were not recapitulated on follow-up. 105 As the reasons for these discrepant results remain unclear, challenges evidently remain in engineering cell lines that support greater viral yields for vaccine deployment." ] },{ "paper_id": "0234207cba8165f1e1852b92ae0fa0d9e2f870fb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Scientific RepoRts | 7:44122 | DOI: 10.1038/srep44122" ] },{ "paper_id": "023858d3191988a37587ab951db561a3db3ae2cd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Samples were not collected from patients with chronic respiratory ailments; non-consenting caregivers, with history of hospitalization in the preceding 14 days, not admitted in hospital and children aged > 5 years." ] },{ "paper_id": "023af2216525c16fa52a75b99cc91ebb03e93107", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "interactions with Val530 and Pro531 of RBD, while light chain residues Asn30 and Asp92 form hydrogen bonds with main chain atoms of RBD residues Val527 and Ser532, respectively (Fig. 3C ).", "Neutralization assays were performed by incubating 100TCID50 (median tissue culture infectious dose) of pseudoviruses with 16 serial 1:3 dilutions of purified antibody at 37 \u00b0C for 1 hour. Huh7 cells (about 1.5 \u00d7 10 4 per well) were then added to the antibody and virus mixture. Infectivity was quantified by the luciferase activity 48 hours after infection. IC50s were calculated using the dose-response inhibition model in GraphPad Prism (GraphPad Software Inc.).", "route of transmission to humans could result from direct or indirect contact with this reservoir or with another intermediate. The prevalence of MERS-CoV-neutralizing antibodies in camels and the recent isolation of MERS-CoV from dromedary camels suggest that camels could be one of the intermediate hosts [15] [16] [17] ." ] },{ "paper_id": "023b805a96c852619186f55af4bbbdd5f9fa8156", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Fecal and intestinal samples were collected from the Animal Disease", "Supplementary Materials: The following are available online at http://www.mdpi.com/2073-4425/9/12/591/s1, Table S1 : Oligonucleotides used for this study. ", "Materials and Methods" ] },{ "paper_id": "023dff96542ca1e77e3a1d08a2f3893ca1ebc057", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "c.", "e.", "Figure S1" ] },{ "paper_id": "0241ada1b12eaacadc56a59586bc1728a580583d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are presented as the means \u00b1 standard deviation (SD). Significant differences were determined by oneway analysis of variance (ANOVA) followed by Tukey's post hoc t test (GraphPad Prism \u00a9 Software).", "Cells were resuspended in 150 \u03bcl of FACS buffer (1 \u00d7 PBS containing 2% (v/v) FBS, 0.3% (w/v) NaN 3 and 1 mM EDTA) and incubated for 60 min at 4\u00b0C with a 1:100 dilution of antibodies specific for CD81 (AbD Serotec) or SR-BI (BD BioSciences) Following three rinses with FACS buffer, bound antibodies were detected by incubation for 1 h at 4\u00b0C with an phycoerythrin (PE)conjugated anti-mouse (BD Pharmingen) antibody at a dilution of 1:200. Cells stained with an irrelevant mouse immunoglobulin G (IgG) antibody and respective PEconjugated secondary antibody served as negative controls. Cells were washed three times, fixed in FACS buffer containing 4% (w/v) PFA, and analyzed by flow cytometry using the DakoCytomation CyAn system (Dako, Carpinteria, CA) and Summit Software v4.3 (Dako).", "Worldwide, between 130 and 170 million individuals are chronically infected with hepatitis C virus (HCV), a positive-strand RNA virus that infects the liver [1, 2] . Although acute infection is typically asymptomatic, 80% of patients fail to clear the virus resulting in a chronic infection associated with the development of significant liver disease, such as fibrosis, cirrhosis, steatosis, insulin resistance and hepatocellular carcinoma (HCC) [3] . In fact, HCV-related HCC accounts for over 50% of HCC cases and over 30% of liver transplants in the United States. Despite this obvious public health burden, there is no vaccine to prevent infection and current interferon-based treatment options have toxic side effects and limited efficacy." ] },{ "paper_id": "02480623218229a12cdbc4800defc262f7cc175c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "IL-6 and IL-8 concentrations in HTR-8/Vneo supernatant exposed to LPS, ssRNA, or VEH for 12 h were determined using a human IL-6/8 ELISA Development Kit (Invitrogen by Thermo Scientific, Wilmington, NC, USA) according to the manufacturer's instructions (minimum detection limit, 2 pg/mL; intra-assay variation, 4.94%).", "Explant tissues attached to Matrigel were collected by cutting the membrane from the transwell inserts, were washed once with PBS (1x), and were fixed with paraformaldehyde (4%, 1 h). The tissues were dehydrated in ascending grades of ethanol, cleared in xylene, and embedded in paraffin. Sections (5 \u00b5m) were mounted on slides for Immunohistochemistry.", "Sequence Reference " ] },{ "paper_id": "024d0bef5417a110fb52607e85ec80eb4d7d92a3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Semi-thin sections of 1 \u03bcm were obtained using an ultramicrotome (Ultracut E, Leica-Reichert Jung, Wetzlar, Germany) and stained with toluidine blue for correlative light microscopy. Ultrathin sections were cut at 70 nm, collected on copper grids (200 meshes) and stained with uranyl acetate and lead citrate. Images were examined in a Hitachi H-7100 electron microscope equipped with a Gatan 832 digital camera (Gatan, Inc.)." ] },{ "paper_id": "025509677d6507aaf63c46fc8efbe60b6d63a820", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We collected blood samples (in sterile EDTA tubes with vacutainer blood-sampling system (BD)) from mothers at 53-54 and 112 gestation days (at 0 and 59 days post-fetal inoculation), on the day of parturition, and 14 and 21 days after parturition. After blood centrifugation (2,000g, 20 min, +4\u02daC) plasma was aliquoted and immediately frozen (-80\u02daC). Colostrum was collected at delivery day, centrifuged (2,000g, 20 min, +4\u02daC), and immediately frozen at -80\u02daC.", "RNA was isolated using TRIzol (Thermo Fisher Scientific) lysis and extraction, and then cleaned using Total RNA Purification Kit (Norgen Biotek). RNA was assessed on a Bioanalyzer and all samples had RNA Integrity above 8.5. Complementary DNA (cDNA) libraries for sequencing were prepared using NEBNext Ultra II Directional RNA Library Prep Kit for Illumina with rRNA depletion (New England Biolabs). Libraries were sequenced on a NovaSeq as paired-end reads using the 150 base read kit. Over the whole experiment, there was an average of 26 million paired-end reads per sample. Sequencing data were mapped and quantified using the pseudo alignment method of Kallisto [132] . A sequence database of coding and non-coding transcripts was generated from ENSEMBL Sus scrofa 11.1. The count table was assembled using tximport in R and normalized using EdgeR then converted into a normal distribution using the voom function and differential expression was calculated using linear and Bayes models as part of the R package limma. Gene set enrichment was done using human annotation of Gene Ontology using the R function camera.", "We used low-passage, contemporary, Asian-lineage Zika virus (ZIKV) strain PRVABC59 [GenBank: KU501215.1] isolated from human serum specimen (Puerto Rico, 2015) [120] . After two passages on C6/36 cells, cell culture media containing ZIKV was centrifuged (12,000g, 20 min, +4\u02daC), and the supernatant was collected. Media from virus-negative C6/36 cells was used for mock-inoculation. The absence of mycoplasma contamination in all inoculums and cell cultures was confirmed using LookOut Mycoplasma PCR Detection Kit (Sigma-Aldrich).", "The set enrichment results from camera were graphed in Cytoscape using the Enrichment-Map plugin. All networks were generated using a Jaccard + Overlap with a cutoff of 0.375 and a Combined Constant of 0.5. Sub-networks were discovered using GLay cluster and annotated using the WordCloud plugin of the top 4 words with a bonus of 8 for word co-occurrence. Gene expression data are provided in S2 Table. An accession number for RNA-seq data is PRJNA573521 in NCBI BioProject." ] },{ "paper_id": "0257dffb6a2cc8bdf6d252c400a38419ef256505", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(a) S1", "(b) S2 ", "The phylogenetic tree constructed with the Neighbor-joining method and Maximum-likelihood method had very similar topography, so only the Neighbor-joining trees are shown in the present study; the Maximum-likelihood trees are included as supplementary material (Supplementary Figures S1a-f )." ] },{ "paper_id": "0257e6797e12beb91a4a4fcd7130f90d84260718", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "authors contributed equally to this work. Citation details: Yusim,K., Yoon,H., Foley,B. et al. Integrated sequence and immunology filovirus database at Los Alamos.", "Database URL: www.hfv.lanl.gov", "This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited.", "Since their discovery in 1967 (1) , viruses in the family " ] },{ "paper_id": "0263ef539a1344a642b1f4ff11aee6bc6ca84a34", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(1) to highlight diversity and excellence of Canadian virology research;", "(2) to mobilize Canadian virus researchers across different disciplines (basic, clinical, social and epidemiological) to create a broader base of research expertise committed to tackling new challenges. ", "Viruses 2017, 9, 54 6 of 9" ] },{ "paper_id": "026447f6e8f25d774926c5f38f8c8ae1f62aa54d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A number of recent reports have underlined the relevance of astrovirus infections also in livestock populations. Although summarizing all available data on astrovirus detection in mammalian livestock would by far exceed the scope of this review article, we here give a short overview on the current state of knowledge regarding bovine, ovine and porcine astroviruses (BoAstV, OvAstV, PoAstV). These species are highlighted because of the recent detection of novel BoAstV and OvAstV strains causing encephalitis [43] [44] [45] [46] [47] [48] , and the sequence similarities observed when comparing PoAstV strains with other mammalian strains including human astroviruses [49, 50] . These animal species live in close contact to humans and might therefore play a role in the transmission of astroviruses that are not strictly species-specific.", "Novel astroviruses have been identified by metagenomics approaches whenever diseases of unknown etiology have occurred e.g., in humans, cattle or sheep [18, 45, 47, 48] . Metagenomics have been widely used as an unbiased system to obtain potentially causative viral sequences in case standard procedures such as PCR fail to reveal the causative agent. Furthermore, it can be utilized to obtain more sequence information or even full-length sequences. With regards to the lack of bat astrovirus isolates, metagenomics might be a suitable alternative to gain more detailed sequence information for further analyses. Nonetheless, small sample sizes and low virus titers in the samples might also impede these approaches.", "There is strong evidence that multiple astrovirus sero-and subtypes may infect pigs. However, the clinical significance of this finding is still doubtful, since various samples were collected from healthy pigs [13, 56] . However, multiple studies from South Africa [57] , Canada [13, 49] , USA [50, 58] , Colombia [59] , China [60] , Croatia [56, 61] , Czech Republic [62] , Germany [63] and Hungary [12] have described several novel astroviruses to be circulating in the pig population. Astrovirus partial and full-length sequences were detected in fecal and extraintestinal samples such as serum [12, 13, 49, [56] [57] [58] 62] . There is a remarkably high fecal prevalence of astroviruses in pigs combined with a broad genetic diversity [13, 56, 59, 61] . At least five lineages (PoAstV1-5) were identified to circulate in the investigated area of the USA with generally low sequence similarities [50] . Frequent co-infections of individual pigs with multiple astrovirus strains were found that might favor recombination events [50] . Phylogenetic links to astroviruses linked to other animal species were observed that could imply past cross-species transmission and recombination events, which might have included cattle, roe deer, mink, cats, humans and potentially other species [13, 50, 56, 59, 61] . Although the clinical significance for pigs remains to be investigated, these recent findings underline the importance of pigs as a porcine astrovirus reservoir." ] },{ "paper_id": "02652961663ca435c195fb0ed3e43642e04cfab3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0266337807a2aab25e7dc43967cba01860fe5d86", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Research ethics. This study obtained ethical clearance from the National Health Research Ethics Committee of the National Institute for Medical Research (NIMR/HQ/R.8a/Vol. IX/1735) in Tanzania.", "Clinical assessment. After screening and assent, a clinical officer or assistant medical officer then sought a detailed clinical history, followed by a physical examination. The attending officer entered all clinical data in a standardized electronic clinical case report form on the tablets using ODK Collect.", "Statistical analysis. Statistical analyses were performed using SAS version 9.3 software (SAS Inc., Cary, NC). Descriptive statistics was presented as medians, ranges, and interquartile ranges for continuous variables and as proportions for categorical variables.", "The lack of consistency in methodological approaches to AFI surveillance in low-resource areas has resulted in an Figure 2 is not to scale. This figure appears in color at www.ajtmh.org." ] },{ "paper_id": "026c59766e222f22b416a6525ae3194a140b5faa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Identified viral fragments were used as a template for primer design (sequences available on request) to obtain the nearly complete genome sequences. Sequencing was performed employing Big Dye terminator chemistry (BigDyeH Terminator v1.1 Cycle Sequencing Kit, Applied Biosystems, Nieuwerkerk aan de IJssel, The Netherlands).", "Absolute quantification of viral DNA (copies/ml of serum or whole blood, copies/g of tissue) was achieved by real-time qPCR using plasmid-based standards and primers and probes listed in table 1 (HotstarTaq Plus Master Mix Kit, Qiagen, Hilden, Germany).", "Primer and MID (Multiplex Identifier) sequences were trimmed from every read. Sequences were then assembled with Codon-Code Aligner software version 3.5.6. Contigs and unassembled sequences were compared to known nucleotide and protein sequences contained in GenBank database using different BLAST tools (blastn, blastx and tblastx) [25] .", "No other reads with clear identity to any known viruses were detected in any of the samples." ] },{ "paper_id": "02753048c4dc699d155288935b9dc6517a79f279", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Future studies will test NIPARAB protection in an animal model susceptible to NiV, such as Syrian golden hamsters, and will also establish the minimum protective dose and capacity to reduce NiV disease severity and/or mortality. Furthermore, protection against HeV challenge will be assessed since there is wide evidence for sera cross reactivity between these two henipaviruses. [52] [53] [54] ", "npj Vaccines (2019) 4:15 ; https://doi." ] },{ "paper_id": "02766b20eeb39ff051a2f110def2e4bf8b9b010b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The combined peptide mixtures were separated by reversed phase high-performance liquid chromatography (HPLC) (Ekspert ultraLC 100, AB Sciex, USA) on a Durashell-C18 reverse phase column (4.6 mm 6 250 mm, 5 mm 100 \u00c5 , Agela). The mobile phases used were composed of 20 mM ammonium formate (pH 10) in water (labeled mobile phase A) and 20 mM ammonium formate (pH 10) in acetonitrile(ACN) (mobile phase B). The flow rate was 0.8 mL/min, and the elutant was collected into 48 centrifuge tubes at each minute after the first 5 min. Each aliquot was then dried by vacuum freezing.", "After introducing TGEV into the ST cells, we observed the induction of typical CPEs, including cell rounding, swelling, granular degeneration of the cytoplasm, cell detachment, and severely diseased cell morphology, from 40 to 64 h after inoculation ( ", "The peptides were then analyzed with a nanoflow reversedphase liquid chromatography-tandem mass spectrometry (nano-RPLC-MS/MS) system (TripleTOF 5600, AB Sciex, USA). The above 48 tubes were merged into 10 components dissolved in 2% ACN and 0.1% formic acid (FA), then centrifuged at 12,000 6 g for 10 min. The supernatant (8 ml) was used for loading at a rate of 2 ml/min, with a separation rate of 0.3 ml/min. The mobile phase A used in this analysis was composed of 2% ACN and 0.2% FA, while mobile phase B was composed of 98% ACN and 0.1% FA. The following MS parameters were utilized: source gas parameters (ion spray voltage: 2. ", "Western blot confirmation of altered expression for three of the differentially expressed proteins" ] },{ "paper_id": "02783b0989ab6a54fd4af139d787b69b9d9d009e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "1. Extraction of total nucleic acid; reverse transcription to convert target RNA sequences to cDNA -1 hour 2. Multiplexed amplification of targeted gene sequences by thermal cycling -2.5 hour 3. Pooling, purification and fragmentation of amplification products -0.5 hour 4. End-labeling (biotinylation) of amplification products -0.5 hour 5. Hybridization of labeled products to microarrays -4 hour to 16 hour (overnight preferred) 6. Washing and staining arrays -1.5 hour 7. Scanning arrays for data acquisition -0.15 hour", "The Naval Health Research Center (NHRC) collects, analyzes, and archives throat-swab specimens from human subjects as part of respiratory infection surveillance at US basic military training facilities. Research use of donated specimens is permitted under the local Institutional Review Board's approved protocol-compliant informed consent (see Acknowledgments). Throat swabs are suspended in stabilizing transport media and archived frozen at 280uC. Viral culture and PCR-based testing protocols are used at the NHRC diagnostic laboratory to determine the presence or absence of influenza virus, and these assays are accredited by the College of American Pathologists as compliant with the Clinical Laboratory Improvement Amendments of 1988, and the Department of Defense Clinical Laboratory Improvement Program of 1994.", "This is an open-access article distributed under the terms of the Creative Commons Public Domain declaration which stipulates that, once placed in the public domain, this work may be freely reproduced, distributed, transmitted, modified, built upon, or otherwise used by anyone for any lawful purpose." ] },{ "paper_id": "027f86c44365e0ba6a6c26e24134c4c3e98a72ef", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Taken together, proteomic analyses are boosting our knowledge of viral replication and disease etiology and are allowing the identification of new cellular targets that might be suitable for drug development.", "These approaches are complementary and allow the exploration of different interaction search spaces. Other methods have also been developed to be amenable to a high-throughput format. Among them, MAPPIT is a cytokine-based mammalian PPI trap assay [45] and LUMIER is a tag-precipitation assay coupled to renilla luciferase [46] . To our knowledge, none of these methods has yet been applied in a high-throughput VH PPI study.", "Antiviral small molecules that inhibit cellular functions or VH PPIs have been reported in the literature, but currently no database has been developed to reference them. Below, we review a selection of host-oriented molecules with antiviral activity in vitro or in vivo against two major viruses infecting humans, influenza and HCVs." ] },{ "paper_id": "028382edbe67a35f1e099fa0607fa9a4922a45d1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supplemental material for this article may be found at https://doi.org/10.1128/ mBio.00229-17. ", "Female C57BL/6 or P2X7 receptor knockout mice (8 to 10 weeks old) purchased from Jackson Laboratories (Bar Harbor, ME) were used for all experiments. For virus challenges, mice were anesthetized by intraperitoneal injection of a mixture of ketamine (100 mg/kg of body weight) and xylazine (5 mg/kg) before intranasal administration of a lethal dose of influenza virus PR/8 or NL/09 in a volume of 30 l. Animals were monitored daily for clinical signs of illness, and body weights were recorded daily for 14 days. Upon reaching 75% of initial body weight, animals were humanely euthanized." ] },{ "paper_id": "02843e9be924677d6541e0221a26501ce2111aaa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Histological examination. Porcine tracheae and bronchi were obtained from a local slaughterhouse and fixed in 10% paraformaldehyde (PFA), processed routinely, embedded in paraffin, sectioned at 5 \u03bc m, and stained with hematoxylin and eosin (H&E).", "Data are shown as means \u00b1 SEM. All statistical analyses were done by using Prism 5 software (GraphPad Software)." ] },{ "paper_id": "0293ec2b1cf8097392297cffd06854d2f37348f4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For both patient groups, traditional standard-of-care laboratory diagnostic tests for respiratory infections were performed according to the requests of physicians, including smears, cultures, and serological tests. The serological test in our study was the PNEUMOSLIDE IgM (Vircell) commercial kit based on indirect immunofluorescence.", "The prospective cohort was enrolled in Shanghai, China, between ", "Yiyi Qian https://orcid.org/0000-0002-0714-3894" ] },{ "paper_id": "02974b9466bf593193d05ada669d7ff0567bb657", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "02998402c64a65e3ea2fd0fdd8f688aeebda6192", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This work was supported by the Ministry of Agriculture and Rural Development of Vietnam (726/2017/H\u00d0-KHCN-CNSH) and the Ministry of Agriculture, Forestry and Fisheries of Japan.", "Data availability. The genome sequence of the XTND/2018 strain has been deposited in DDBJ/ENA/GenBank (accession number LC493088). The raw sequence reads were deposited in the DDBJ Sequence Read Archive (DRA) under the BioProject and DRA accession numbers PRJDB8629 and DRA008757, respectively.", "Sapelovirus A (SV-A) is currently spreading as an enteric pathogen of pigs worldwide. We isolated SV-A strain XTND/2018 from the small intestine of a dead pig with severe diarrhea in the north of Vietnam and determined the genomic sequence. This is the first report of the genomic sequence of SV-A circulating in Vietnam." ] },{ "paper_id": "02a009e42054081b441d0f4b203679c4b0cae38d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The marmoset study requires a sample size of 3 for adequate power to determine if the incidence of seroconversion is significantly greater than that which would be expected in the population. This sample size will allow the experimenter to detect seroconversion in at least 2 of 3 animals (66%) versus the expected population constant of <1% at a 95% confidence level using a one-tailed binomial test for proportions.", "Hantaviruses are negative-sense RNA viruses transmitted to humans from small animal hosts. Different viral species are associated with one of two disease syndromes: hemorrhagic fever with renal syndrome (HFRS), or hantavirus pulmonary syndrome (HPS) [1] . Hantaan virus a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 (HTNV), primarily found in Asia, is among the most prevalent HFRS-causing hantaviruses with a case fatality rate of between 1-15% [2] . Puumala virus (PUUV) causes most HFRS cases in Europe, though its case fatality rate is lower at <1% [3, 4] . There are currently no FDA licensed vaccines or therapeutics for either HFRS or HPS [5] .", "Urine was expressed from anesthetized ferrets and analyzed by urinalysis regent strips (VWR, Radnor, PA)." ] },{ "paper_id": "02a29bd2f39ecdbbb5e51a003c0bc7818029f384", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Influenza is a respiratory communicable disease caused by influenza viruses (IVs), which are classified antigenically based on the distinctions of the nucleoprotein (NP) into four genera: Influenza-A viruses (IAV), influenza-B viruses (IBV), influenza-C viruses (ICV), and influenza-D viruses (IDV) [10] . IVs have single-stranded, segmented, viral RNA genome (vRNA). Both IAV and IBV contain eight segments, while ICV and IDV contain only seven segments [11] . The genomic eight segments of IAV translate to more than 10 viral proteins [12] .", "Mice showing a weight loss more than 30% of the initial body weight were euthanized and documented as dead. Body weight was monitored daily for 2 wpi.", "The animal trial in our study was conducted in accordance with the guidelines of the Egyptian animal welfare regulations and legislation. The ethics committee of the NRC, Egypt, approved the animal trial with number (16-247) and the regulations of Animal Welfare Assurance with identification number (A5939-01). All experiments were performed in a biosafety level 2 (BSL2) containment laboratory approved for such use by the local authorities (NRC, Egypt). For MERS-CoV neutralization assays, Class III Biological Safety Cabinet SEA-III BSC (Germfree, Ormond Beach, FL, USA) was used.", "All mice infected with H1N1pdm09 wild type in the control group had more than 30% decrease in weight from day 4 to 6 days pi leading to euthanasia ( Figure 5A ). The mortality rate in the control mice started at 4 days pi with 29% and increased gradually up to 85% at 5 days pi and 100% at 6 days pi ( Figure 5B ). These results pointed out that vaccination with either of the H1N1 viruses protected all mice from influenza-induced mortality. " ] },{ "paper_id": "02a9fd5f564cb3a5b6b1fdbcd9df585b8e24a2de", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study protocol was reviewed and approved by the Ethics Committee of Huazhong University of Science and Technology (permit number S240). Written informed consent was obtained from all human participants on or before each study.", "The grave threat posed either by the highly pathogenic avian influenza virus or by another emerging virus like the 2009 pandemic H1N1 (pH1N1) requires rapid laboratory detection of the first cases or clusters of influenza infection [1] . PCR-based nucleic acid (NA) assays are the first-choice techniques for flu surveillance and diagnosis due to their rapidity, sensitivity and specificity, although virus isolation is still critical for antigenic analysis and characterization of influenza virus (flu-v) [1, 2] .", "Throat swabs. A total of 49 throat swabs were retrospectively selected for this study. These samples had been characterized by PCR as positive (strong, medium or weak) for pH1N1, seasonal flu A/H1, H3, or flu B virus.", "To ensure that all the samples could be handled safely within containment level 2 facilities, a pH1N1 isolate A/Zhongshan/ SWL02/2009(H1N1) (pH1N1SWL02) was used as a representative human/avian flu-v for investigation of sample pretreatment, mock-infected sample preparation and evaluation assays. This virus was propagated and titrated in Madin-Darby canine kidney cells to contain 10 5.7 50% tissue culture infective doses (TCID 50 ) per ml. After serial 10-fold dilution of the virus culture supernatant with viral transport medium (VTM), aliquots of the virus were stored at -70uC prior to use to avoid multiple freeze-thaw cycles." ] },{ "paper_id": "02aabb0b8eb8a3f3692e162442bbed19c5f915b6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data accessibility. The list of samples, the Illumina reads of the 16S bacterial sequence data and the OTU tables have been deposited in Dryad (http://dx.doi.org/10.5061/dryad.54f1jc2) [58] . Genetic sequences generated for Leptospira, herpesvirus and adenoviruses, using specific primers, are available on GenBank under accession numbers MG680317-MG608402.", "The microbiota is a fundamental and dynamic dimension of individuals, shaped by physiological, dietary and social factors [1] , and can in turn affect host development, metabolism and susceptibility to pathogens [2, 3] . Host-microbiota interactions are, thus, an important factor in vertebrate ecology and evolution [4] . However, in contrast with numerous studies on humans and laboratory animals, few studies have investigated the causes and consequences of microbiota variation in wild vertebrates, and studies based on longitudinal sampling of the same populations are especially rare [5] [6] [7] [8] .", "Biology (whole organism) Subject Areas: ecology/health and disease and epidemiology/molecular biology" ] },{ "paper_id": "02b20ad26d6b2f05b38712292186edbf3aa05862", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "\u2022 Third, as a way to understand this better, one would like to do the same study using Stochastic difference equations. It will allow one to better understand the effect of network structure.", "We have carefully edited to captions to improve their utility when interpreting our results.", "Comparing the results with results produced by an SIR based network model is good but as they stand need more work. Specifically, one needs to understand the joint interaction of network and transmission probability p.", "We added a section in the SI with an improved the description of how the networks were constructed and the simulations performed." ] },{ "paper_id": "02b8dea56378d11fe92d6a60ff37a34b0d6ea63e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All values are expressed as the mean \u00b1 standard deviation. Statistical analyses were performed with Student's t test using SPSS software, and P < 0.05 was considered significant.", "The sequences of the upstream and downstream primers were respectively as follows: 5'-ATGGGGCTGGAGCACTC-CCAAG-3' and 5'-TGTGGCAGCACCAGGGCAGC-3' for MMP-2 (1,070 bp); 5'-GGTCCCCCCACTGCTGGCCCT-TCTACGGC-3' and 5'-CACCTCCACTCCTCCCTTTCC-3' for MMP-9 (750 bp); 5'-ACATCAACGAGGGGGAGACG-3' and 5'-GGCTTCAGACAGGCAGGACA-3' for CD147 (492 bp); and 5'-CTGAACGGGAAGCT CACTGG-3' and 5'-TGAGGTCCACCACCCTGTTG-3' for glyceraldehyde phosphate dehydrogenase (313 bp). PCR analysis was performed under the following conditions: denaturation at 94\u00b0C for 2 minutes and then 25-30 cycles of denaturation for 30 seconds at 94\u00b0C; renaturation for 60 seconds at 56\u00b0C for MMP-2, at 58\u00b0C for MMP-9 and at 57\u00b0C for CD147 and glyceraldehyde phosphate dehydrogenase; and extension for 90 seconds at 72\u00b0C. The amplified products were analyzed by agarose gel electrophoresis using 1% gel, followed by ethidium bromide staining.", "(page number not for citation purposes)" ] },{ "paper_id": "02bfb4c09489a5f48c23e8441e37b055bf7228ee", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "and is proteolytically cleaved into 4 individual mature proteins by the virus-encoded nsP2 protease in a specific manner while the structural proteins are subsequently translated from a subgenomic mRNA 7 .", "next study. The current study clearly demonstrates properties that the protease domain possesses which implies that these properties may also be expressed in vivo and this is the obvious justification for all recombinant protein characterization studies.", "Stability test. Thermal stability of the nsP2 protease was determined as previously described 31 ." ] },{ "paper_id": "02c4e304d5e063e9bd66d293a8c1472a5865c173", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "02c9b77cb2898b1597278dbf32a0c61be93d1983", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Vector construction, plant transformation and characterization via PCR, Southern blot, northern blot and western blot", "1862" ] },{ "paper_id": "02d808df510466b74102dd922486bf922a5ed947", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The ethanol extracts and subfractions were analyzed by ultraperformance liquid chromatography-photodiode array-quadrupoletime of flight-mass spectrometry (UPLC-PDA-Q-TOF-MS).", "ARTICLE HISTORY" ] },{ "paper_id": "02da3b3b4a31f4e15f06a0f076524bea9ab0f92a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "L.Z. and D.Y. conceived and designed the research; D.Z. and M.L. performed the experimental work and wrote the manuscript; Y.C. performed the docking study; Y.Z., S.B., J.Z., F.W. and K.C.R. participated in the experimental work, analyzed the data and discussed the results. All the authors read and approved the final manuscript.", "The biological assays were performed following a previously reported procedure [23] . The Huh7.5.1 cell line and the HCV infectious virus J399EM were kindly provided by Xin-Wen Chen, Wuhan Institute of Virology, Chinese Academy of Sciences. Huh7.5.1 cells were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% (v/v) fetal bovine serum, 0.5 mg/mL G418, 100 IU/mL penicillin, and 100 mg/mL streptomycin.", "Supplementary materials can be accessed at: http://www.mdpi.com/1420-3049/20/04/6978/s1.", "After the EGFP signal was read, cell viability was measured in the same plate by the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich, St. Louis, MO, USA] method. Briefly, MTT (1 mg/mL) was dissolved in PBS. Cell culture supernatants were removed and replaced with MTT and further cultured for 4 h; cells were then lysed with 10% sodium dodecyl sulfate (SDS), 50% N,N-dimethylformamide, pH 7.2. OD570 values were read. The percentage of cell death was calculated against the control well without compounds." ] },{ "paper_id": "02e34b2fe0968cb8a46313fe767858da7e2691b1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Overlapping genes (whereby the same nucleotide sequence codes for two or more proteins in different reading frames) are particularly common in RNA viruses, where they may serve as mechanisms to optimize the coding potential of compact genomes, regulate gene expression, or circumvent the host cell's canonical -though not ubiquitous -rule of 'one functional protein per mRNA'. However, such genes can be difficult to detect using conventional gene-finding software.", "Over the past few years we have engaged in a systematic survey of viral genomes for previously undetected overlapping genes. While many of these merit detailed analysis and experimental follow-up (either because they are in important and well-studied viruses or because they involve novel non-canonical translation mechanisms), there remain a miscellany of promising candidate new overlapping genes that we are not currently in a position to follow up experimentally but, nonetheless, may be of interest to the community. The purpose of this article is to communicate five of these candidates.", "Bat coronaviruses 1A, 1B, HKU8" ] },{ "paper_id": "02fdaf97dd0af539eada2af2f1563e0d77a28f92", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ebolaviruses, members of the family Filoviridae, cause severe hemorrhagic fever in humans and nonhuman primates, with human case fatality rates of up to 90% 1,2 . As proven by the latest epidemic of Ebola virus disease (EVD) in West Africa, ebolaviruses pose a significant public health concern. However, no effective prophylaxis or treatment for EVD is as yet commercially available. Five distinct species are known in the genus Ebolavirus, Zaire ebolavirus, Sudan ebolavirus, Ta\u00ef forest ebolavirus, Bundibugyo ebolavirus, and Reston ebolavirus, represented by Ebola virus (EBOV), Sudan virus (SUDV), Ta\u00ef forest virus (TAFV), Bundibugyo virus (BDBV), and Reston virus (RESTV), respectively 3 . Of these, EBOV, SUDV, and BDBV have caused EVD outbreaks with increased frequency in Central and West Africa in the last decade 1,2,4 .", "Ebolaviruses express a single transmembrane glycoprotein (GP) that is responsible for both receptor binding and membrane fusion, and thus the only known target of neutralizing antibodies. GP undergoes proteolytic cleavage by host proteases such as furin, resulting in the two subunits, GP1 and GP2, which are linked by a disulfide bond 5,6 . The GP1 subunit (amino acids 33-501) contains the core of the glycoprotein, receptor binding domain (RBD), a glycan cap, and a large mucin-like domain which extends around the RBD 7 . The GP2 (amino acids 502-676) subunit contains the internal fusion loop (IFL), heptad repeats 1 and 2 (HR1 and HR2), the transmembrane region (TM), and the cytoplasmic tail (CT) 8 . During the transport of ebolavirus particles to late endosomes, low pH leads to proteolytic processing of GPs by host cysteine proteases such as cathepsins 9 , and the exposed receptor binding site of the proteolytically digested GP is thought to interact with a host receptor, Niemann Pick C1, followed by membrane fusion 8, 10, 11 .", "Scientific RepoRts | 6:20514 | DOI: 10 .1038/srep20514 BDBV) has not been demonstrated due to antigenic differences among the species 21 . Since SUDV and BDBV have also shown their potential to cause public health emergencies during several outbreaks in Central Africa, it is difficult to determine the priority for development of countermeasure against those ebolaviruses." ] },{ "paper_id": "02fe68e2ba45e7f0c6f746d4b3db36f8f99ae4f5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0304ed96b29c38014a17bacefcc294a02c04d0a0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Expression was performed in E. coli BL 21 codonplus using a pET-22b vector system with a pelB-leader sequence for export to the periplasm of E.coli. After transformation cells were cultivated at 180 rpm and 30\u00b0C in shaking flasks in 400 mL LB-medium. After the OD600 had ", "Expression and purification of para-nitrobenzyl-esterase 13 (pNB-Est 13)", "We tested each hydrolase in combination with each ester to determine which hydrolases are the most active ones and which substrates have the highest accessibility (Fig 4) ." ] },{ "paper_id": "03148d1ba3c986ec7306ab2a90bcd6082c512f49", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Between Table S1 .", "Lihong Yuan and Jinping Chen conceived and designed the experiments. Lihong Yuan, Min Li, Linmiao Li and Xiaolin Mei carried out the lab work. Lihong Yuan and Min Li participated in data analysis. Lihong Yuan, Jinping Chen, Corina Monagin, Aleksei Chmura, Bradley S. Schneider, Jonathan H. Epstein, Zhengli Shi and Peter Daszak wrote the paper." ] },{ "paper_id": "031fd47b33af0e00eeb5e76c0d010df92df6bef6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Anecdotally, these authors are aware of a resident who developed an anterior cruciate ligament tear following a fall while running to a code. As mentioned above, one author developed acute neck pain following multiple rounds of vigorous CPR during an overnight code. He ultimately developed neurological symptoms with tingling in his fingers and was found to have a cervical epidural hematoma that was managed conservatively with improvement in symptoms. There is also a news media story of a paramedic developing a myocardial infarction (MI) while performing CPR on a patient experiencing an MI [42] .", "Jackson and Sturrock describe a case of \"resuscitation shoulder\" or the partial tear of a rotator cuff experienced by a resident physician after performing repetitive and prolonged chest compressions on several patients over three consecutive nights while on call [41] . Similar injuries have been described following repetitive athletic pursuits.", "The effect of rescuer fatigue during prolonged codes has also been discussed with decreased compression depth achieved [43] . It can be hypothesized that as resuscitators develop fatigue, they may develop altered posture and increase the risk of musculoskeletal strain or sprain.", "Background \"Code blue\" events are cardiopulmonary resuscitation efforts that occur in hospital settings. A dedicated multidisciplinary resuscitation team rapidly convenes at the bedside, initiates cardiopulmonary resuscitation (CPR), and performs an assessment of the situation. Cardiac defibrillation, establishment of intravenous (IV) access, placement of an advanced airway, blood draws, and medication administration, among other tasks, are integrated into these code situations. Multiple hospital staff are frequently present including physicians at all training levels, medical students, nurses, critical care staff, laboratory technicians, social workers, and clergy; increasingly, patient family members are also at the bedside.", "The act of performing chest compressions is a strenuous task for even the fittest of healthcare workers. There are multiple potential injuries that can be sustained from shoulder to neck to back injuries. Musculoskeletal strain may not be apparent at first, tempered by the rush of adrenaline during a code situation but may become more evident in the days following a resuscitation effort." ] },{ "paper_id": "03203ab50eb64271a9e825f94a1b1a6c46ea14b3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Production of viral particles and co-inoculation. To generate the parental virus particles, plasmids pCa37 and pMark-S were mechanically inoculated into individual plants as previously described [33] . All plants were turnips (B. rapa cv, ''Just Right'') grown under glasshouse conditions at 23 8C with a 16/8 (light/dark) photoperiod.", "Interestingly, this recombination rate does not vary throughout the genome (Kruskal-Wallis test, p = 0.16).", "Thirty days post-inoculation, all symptomatic leaves were harvested and viral particles were purified as described earlier [45] .", "Inspection of Table 2 also shows that first-order interference coefficients were in general negative, indicating that a crossing over in one genomic segment increases the probability that a crossing over will occur in another genomic segment, while the second-order coefficient parameter had an average value close to zero with a large variance. The mechanism leading to these results will be discussed in the following section." ] },{ "paper_id": "0326bf875d2a22d7c4a4328dcd34c2d801fd110e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "N Global health priorities are many and varied; however, unlike high profile diseases such as HIV/AIDS, malaria, and H5N1 avian influenza, the neglected tropical diseases have historically been ''forgotten'' in terms of funding and collective action for control.", "N Five of the eight neglected zoonotic diseases-cysticercosis, rabies, echinococcus, human African trypanosomiasis, and leishmaniasis-are included in the list of NTDs identified by Resolution WHA66.12. However, anthrax, bovine tuberculosis, and brucellosis are still lacking the high-level advocacy required to mobilise political support for their control in endemic countries. ", "Control of zoonotic disease requires integrated action from both human and animal health sectors alongside support and consultation from other sectors or industries. The rapid response to recent zoonoses outbreaks, such as those of West Nile virus and monkeypox in the United States, Hendra virus in Australia, Nipah virus in Malaysia and Singapore, severe acute respiratory syndrome (SARS) in China and Canada, and highly pathogenic avian influenza (HPAI), demonstrates how the mobilisation of considerable political and financial support for the control of emerging diseases is possible on a regional-if not global-scale. These emerging and reemerging zoonoses would appear to be far from ''neglected;'' the Food and Agriculture Organisation of the United Nations (FAO)'s ''Global Programme for Avian Influenza Control and Eradication'' received a projected budget of US$882 million in 2006 [1] . HPAI in particular continues to attract a substantial amount of support [2] , largely driven by ''fearful'' policy narratives concerning global health securitisation and pandemic preparedness [3] ." ] },{ "paper_id": "0330ede445d96dd0a27f474f945d6ce2e7085f15", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "CRISPR Cas9 knockdown of GBF1. Three different targets for human GBF1 were selected and cloned into pSpCas9(BB)-2A-GFP (PX458) (Addgene number 48138) using the protocol established by F. Zhang (66) . The primer sequences were as follows: TBE 434F, CRISPR Cas9 GBF1.1 (CACCGATGGATTAC GTCAATCCCCG); TBE 435R, CRISPR Cas9 GBF1.1 (AAACCGGGGATTGACGTAATCCATC); TBE 436F, CRISPR Cas9 GBF1.2 (CACCGACACGACCGCCATAACTCAG); TBE 437R, CRISPR Cas9 GBF1.2 (AAACCTGAGTTATGG CGGTCGTGTC); TBE 438F, CRISPR Cas9 GBF1.3 (CACCGACAGTGATTGACAGCACCG); and TBE 439R, CRISPR Cas9 GBF1.3 (AAACCGGTGCTGTCAATCACTGTC). All three target plasmids were cotransfected at a ratio of 1:1:1; at 48 h posttransfection, the cells were reseeded and used for experiments.", "Supplemental material for this article may be found at https://doi.org/10.1128/JVI .01751-17.", "SUPPLEMENTAL FILE 1, XLSX file, 0.1 MB." ] },{ "paper_id": "033321dcd825a79a8ba380ba3d52d4ea71f45c81", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study was supported by the Leibniz graduate school Emerging Infectious Diseases (EIDIS) and the DEWIN program of Hannover Medical School. Sebastian Bolduan and Michael Schindler were supported by the Else Kr\u00f6ner-Fresenius Stiftung. Michael Schindler and Stefan P\u00f6hlmann were supported by DFG (SCHI1073/4-1, PO 716/8-1). ", "(C) Transduction of target cells by wt and mutant GPs was determined as described for Figure 1B . The average \u00b1 standard error of the mean (SEM) of at least three separate experiments is shown. Signals measured for wt GPs were set as 100%." ] },{ "paper_id": "033460fbe61491f8505732ee22a5cb3387f3e4a3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The positive rate (%) www.nature.com/scientificreports www.nature.com/scientificreports/ with all known VP1 genes of GIII.2 strains (including the strains of this study), and 75.9-76.5% nt identity (81.1-82.2% aa identity) with the VP1 gene of the single possible GIII.3 strain.", "BnoV detection and co-infections. 20 .4% (43/211) of the diarrheic samples were detected as BNoVpositive by RT-PCR, and 14 of the 25 farms sampled in five provinces were positive for BNoV (Fig. 1) . Of the 43 BNoV-positive diarrheic samples, 38 were co-infected with bovine rotavirus (BRV), Bovine coronavirus (BCoV), and/or Bovine viral diarrhea virus (BVDV) ( Table 1 ). The co-infected of distinct BNoV genotype in each region was shown in Supplementary Table 3 .", "Recombination events were predicted with SimPlot and Recombination Detection Program (RDP) 4.0 with RDP, GeneConv, Chimaera, MaxChi, SiScan, and BootScan (recombinant score: 0.548). A recombination breakpoint was predicted at nt 5034 in the genome. The putative major parental strain was Bo/Adam/2006/No (GenBank accession number JX145650), but the minor parental strain was not found. However, using SimPlot, recombination breakpoint was predicted at 5055 bp in genome (Fig. 5) . Although the recombination breakpoints predicted by RDP 4.0 and SimPlot differ, both programs showed that the recombination breakpoint was located at the ORF1-ORF2 overlap. A phylogenetic tree based on the sequences upstream and downstream from the predicted recombination breakpoint supported a recombination event (data not shown)." ] },{ "paper_id": "033b167546d99b583a32a437dc71c73bdad6e83d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "As a measure of genetic differentiation we estimated F ST between all the virus lineages based on the heterozygosity (H) of the SNPs we called [62] :", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "(PDF)" ] },{ "paper_id": "034cab326c750ea98f621e9c65371b8f139fbfb4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This review focuses on the numerous influenza A virus (IAV) omics-related studies of host responses that have been published over the last two decades. While vaccination strategies exist to combat the seasonal spread of IAV, these viruses can mutate and undergo genetic reassortment that can evade vaccines and other therapeutics. Of particular concern is that not just humans, but wild and domesticated birds can spread IAV, including recent highly pathogenic bird flu isolates of H7 and H5 designation that cause high mortality rates in infected humans. Additionally, IAV is also endemic in pigs, with the 2009 H1N1 global pandemic caused from a swine-to-human spillover event.", "Swine influenza viruses (SIV) have the zoonotic potential to cause global pandemics in humans, such as the 2009 H1N1 pandemic (pH1N1) that spread across the globe [6] . Swine are considered a mixing vessel for novel influenza reassortment, as pigs have the capacity to support influenza strains of human, swine, and avian origin. While swine influenza is a public health concern, compared to humans, we have a limited understanding as to swine host responses to influenza infection at the -omics level [7, 8] ." ] },{ "paper_id": "035dfb6e2398c95bbf6b65db97b443908a43e093", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "RIEMS and all necessary applications are installed locally on a server equipped with four Intel Xeon E7450 processors (each 6 cores with a frequency of 2400 MHz) and 64 GB PC2-5300 (DDR2-667 MHz) ECC RAM. The server is linked with 2 \u00d7 4 Gbit/s ports to the storage area network. The operating system is CentOS release 5.10 with Linux kernel release 2.6.18-371.1.2.e15." ] },{ "paper_id": "035f1d6b6c461d045fd19d69e4e9c1de221f4a0d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Steps to predict drug targets in silico", "Are these targets really druggable?", "Using DNA sequences, couples of non synonymous (A-A) and couples of synonymous mutations (S-S) were determined. A D' coefficient were then computed from these data as explained in [13, 14] . " ] },{ "paper_id": "036bbd8c099c5721274abb4067872f2a68b6193a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "S ince its first appearance in 2012, Middle East respiratory syndrome (MERS) has affected more than 25 countries in 4 continents, with more than 2,400 cases and an extremely high fatality rate of more than 30%. The total number of mortalities due to MERS is already greater than that due to severe acute respiratory syndrome. MERS coronavirus (MERS-CoV), a betacoronavirus from subgenus Merbecovirus, has been confirmed to be the etiological agent (1) . Human dipeptidyl peptidase 4 was found to be the cellular receptor for MERS-CoV (2) . Subsequent detection of MERS-CoV and its antibodies in dromedary, or one-humped, camels (Camelus dromedarius) in various countries in the Middle East and North Africa have suggested that these animals are probably the reservoir for MERS-CoV (3) (4) (5) . Other betacoronaviruses in bats from the subgenus Merbecovirus (e.g., Tylonycteris bat CoV HKU4, Pipistrellus bat CoV HKU5, Hypsugo bat CoV HKU25), and hedgehogs were found to be closely related to MERS-CoV (6) (7) (8) (9) .", "A total of 29 and 11 serum samples, respectively, were collected from 29 Bactrian camels and 11 hybrid camels from a private collection in Dubai (April to May 2019) ( Table 1) , and 92 serum samples were collected from Bactrian camels on a camel farm in Xinjiang (November 2012) (16) . Antibodies against the S protein of MERS-CoV were tested using microplates precoated with purified (His) 6 -tagged recombinant receptorbinding domain of S (RBD-S) of MERS-CoV and detected with 1:8,000 diluted horseradish peroxidase-conjugated goat anti-llama IgG (Life Technologies, Carlsbad, CA, USA) conjugate (S-ELISA) (17) . The cutoff of the ELISA was defined as three standard deviations above the mean absorbance value of 10 dromedary serum samples that tested negative with the neutralization antibody test. The neutralization antibody test was performed by incubating serially diluted camel sera with 100 50% tissue culture infective dose (TCID 50 ) MERS-CoV for 2 hours before infecting the Vero cells for 1 hour. The cytopathic effect (CPE) was observed for 5 days, and the sera were regarded as positive for neutralizing antibody if no CPE was observed in the infected cells (18) . All tests were performed in triplicate.", "In addition to the dromedaries, there are two additional surviving Old World camels, the Bactrian, or two-humped, camels (Camelus bactrianus) and the wild Bactrian camels (Camelus ferus), both inhabitants of Central Asia. Moreover, a dromedary and a Bactrian camel can mate and result in a hybrid camel offspring. Previous published serological studies showed that sera of Bactrian camels were all negative for MERS-CoV antibodies, suggesting that Bactrian camels may not be a reservoir of MERS-CoV ( Fig. 1 ) (10) (11) (12) (13) (14) . However, a recent study revealed that direct inoculation of Bactrian camels intranasally with MERS-CoV can lead to infection with abundant virus shedding and seroconversion (15) . Therefore, we hypothesize that those Bactrian camels, and even the hybrid camels, that reside in countries where there are dromedaries can be infected with MERS-CoV. To test this hypothesis, we examined the presence of MERS-CoV antibodies in Bactrian and hybrid camels in Dubai, the United Arab Emirates (where dromedaries are also present), and Bactrian camels in Xinjiang, China (where dromedaries are absent), using a MERS-CoV spike (S) protein-based enzyme-linked immunosorbent assay (ELISA) and neutralization antibody test." ] },{ "paper_id": "03774b269b5de5338590b1960b6468881604a3dc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "03797126b6e6689cc02878e641e5271d3b9a5d3b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ticks such as Haemaphysalis longicornis and Rhipicephalus microplus are implicated as the prominent vectors for transmitting SFTSV [7] . With regards to SFTSV hosts, various vertebrate species are considered to have been infected, as evidenced by high SFTSV seroprevalence in domestic animals in SFTS endemic regions [8, 9] . Additionally, reported cases of human-tohuman transmission through contact with blood or body fluid, including infections in healthcare workers from patients, pose a further threat to the public [10, 11] . Furthermore, the discovery of H. longicornis tick in the United States indicates the possibility that SFTSV could spread to other continents, highlighting the need to prevent disease transmission [12] .", "In order to produce histidine tagged SFTSV Gn glycoprotein, a ligand for surface plasmon resonance analysis, a Gn-C\u03ba with six carboxy-terminal poly-histidine residues was designed and produced as described above.", "In the delayed treatment model, the antibody treatment started from 1, 3, 4, or 5 d.p.i. and continued for 4 consecutive days (Fig 3A) . At a 2 PFU viral dose, all mice survived when treatments with Ab10 were delayed until 3 d.p.i., and 80% survived when the treatments were delayed until 4 or 5 d.p.i. (Fig 3B and 3C ). Mice not treated until 4 d.p.i. had significant weight loss. At a 20 PFU viral dose, delaying Ab10 antibody treatment until 1 or 3 d.p.i. protected all or 80% of mice, respectively. Mice with treatment delayed until 1 d.p.i. did not lose weight, whereas mice with treatment delayed until 3 d.p.i. lost 8% of their body weight. When treatment was delayed until 4 d.p.i. or later, all the mice died.", "Antibodies play a pivotal role in preventing viral entry into cells and can induce lysis of infected cells through antibody-dependent cellular cytotoxicity or complement-dependent cytotoxicity [33] [34] [35] . Polysera from recovered patients or from vaccinated donors have been used as prophylactic agents for various viral diseases, including hepatitis B and rabies [36] . As an alternative approach, virus-directed monoclonal antibodies have also been developed and tested as therapies or as prophylaxis for viral diseases. Palivizumab (Synagis) was marketapproved for the prophylaxis of RSV in 1998. In addition, antibodies against HIV [37] [38] [39] , RSV [40] , Ebola virus [41] and influenza virus [42, 43] demonstrated potent efficacy in animal models. Antibodies targeting emerging or re-emerging viruses including MERS-CoV [44] [45] [46] and Zika virus [47] [48] [49] were also developed and are being tested in clinical trials. In the past several decades, antibodies have become one of the major therapeutic agents for cancer and autoimmune disease with indications that have rapidly broadened in recent years. Recent technical improvements in the discovery and manufacturing steps of therapeutic antibody production have also allowed rapid and successful antibody development to combat emerging infectious diseases [50] ." ] },{ "paper_id": "0391c13dbb9949494913c209424ed61d3a652753", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supplementary information accompanies this paper at https ://doi. org/10.1186/s1295 1-019-0569-9." ] },{ "paper_id": "0396bc111213d601eeb67ae191530309bdbb6220", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical significance was determined using the Student's t-test or one-way analysis of variance. Results were regarded as significant if two-tailed p values were <0.05. All data are expressed as mean \u00b1 standard error of the mean. ", "Exploiting host signal pathway(s) is an effective virulence strategy employed by a number of viral hemorrhagic fever pathogens. Cyclic adenosine monophosphate (cAMP) is a common secondary ubiquitous messenger involved in several cellular processes; cAMP translates environmental signals into downstream effects at multiple cellular levels [25] [26] [27] . Many pathogens have developed strategies to modulate cAMP levels within host cells, including the vascular endothelium [28] , by hijacking the host cell machinery for their own benefit during various stages of their life cycle, including entry, internalization, fusion, replication, and release [28] [29] [30] [31] [32] . However, it is not known if filoviruses employ similar strategies.", "The mouse experiments performed for this study were carried out in accordance with National Institutes of Health, United States Dept. of Agriculture, and UAMS Division of Laboratory Animal Medicine and Institutional Animal Care and Use Committee (IACUC) guidelines. The protocol supporting this study was approved by the UTMB IACUC (1506030).", "Filoviruses seem to target both the immune system [15] [16] [17] and vascular endothelia [18] [19] [20] [21] , causing the most severe form of viral hemorrhagic fever (VHF). Filoviral infection initiates diffuse vascular endothelium dysfunction marked by bleeding, fluid distribution disorders, and disseminated intravascular coagulation (DIC), leading to organ failure in the latter stages of disease [17, 19, [22] [23] [24] . The vascular endothelium is a monolayer of cells lining blood vessels. Under physiological conditions, the endothelium plays a pivotal role in providing the proper hemostatic balance. Dysregulation of the barrier formed by the endothelium can increase vascular permeability and cause hypotensive shock syndrome; it is seen in many fatal diseases, including VHF cases [18, 19] . However, the mechanism(s) triggering endothelium disruption during EBOV infection is still not fully understood." ] },{ "paper_id": "039ca136c69c998e9a2677259d9de2941a13304a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "U p until now (6/11/2013) , H7N9 IAVs infected 133 and killed 39 people in China, although only few cases have been reported since the beginning of May 2013. The new human H7N9 virus is a reassortant virus that acquired its hemagglutinin (HA) subtype 7 (H7) and neuraminidase (NA) subtype 9 (N9) gene segments as well as the other gene segments from (different) avian IAVs [1] [2] [3] . Analysis of the gene sequences indicates that the novel H7N9 viruses may be better adapted to infect humans than other avian influenza A viruses. H7N9 viruses isolated from human possess for instance the E627K substitution in the PB2 RNA polymerase subunit, which has been shown to facilitate RNA replication in mammalian cells [4] [5] [6] and transmission between ferrets 7 .", "Introduction of the Q226L mutation in the teal H7 protein resulted in decreased binding to a2-3 sialosides and increased binding to a2-6/a2-8 sialosides, resembling, apart from some quantitative differences, the patterns observed for the human H7 protein.", "NA activity assays. Activity of the NA proteins expressed in HEK293T cells was analyzed using a previously described fetuin-based assay 25 . In brief, fetuin-coated 96well plates, were incubated with limiting dilutions of recombinant soluble NA protein for 2 hour at 37uC. After washing, the plates were incubated with biotinylated peanut agglutinin (PNA, 2.5 mg/ml; Galab Technologies). Binding of PNA correlates with the amount of SIA released from galactose. The specificity of the NA proteins was determined by measuring the binding of biotinylated SNA or MAL I (both from Galab Technologies) after incubation of fetuin with NA. The binding of PNA, SNA and MAL-I was detected using horseradish peroxidase-labeled streptavidin. NA activity assays were performed at least twice in triplicate. The mean values of at least two independent experiments are shown. The amount of NA protein required for half maximum PNA binding (EC50) was determined using the GraphPad Prism software." ] },{ "paper_id": "039ca723ee32358eb70a084eaee19e1b6adc3033", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "03a158fb5fcbfccd841b4a9638e840a0302b9459", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Scientific RepoRts | 6:39730 | DOI: 10.1038/srep39730 structural relationship. These data imply that in the absence of available L1 crystal structures, homology models have utility as surrogate structures for the prediction of structural differences between L1 proteins.", "Oncogenic human papillomavirus (HPV) genotypes are the causative infectious agents of approximately 5% of all human cancers worldwide 1 . Infection with an oncogenic HPV genotype plays a fundamental role in the development of cervical carcinoma, one of the leading causes of cancer death in women and it is also an identified risk factor associated with the development of other anogenital cancers and head and neck cancers 2 . The oncogenic genotypes HPV16 and HPV18 account for ca. 70% of cervical cancer cases worldwide 3 and the majority of the oncogenic HPV genotypes are closely related to either HPV16 or HPV18 within the Alpha-9 or Alpha-7 species groups, respectively.", "Scientific RepoRts | 6:39730 | DOI: 10.1038/srep39730" ] },{ "paper_id": "03ae4b61aa2d9641f38287806612fc16f58d4299", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Bacteriology. Blood cultures were taken from 593/600 patients, with 3% (17/593) positives; 4/17 positives were diagnosed with typhoid fever. Pathogens identified in blood cultures are given in Table 3 (a). Analyses of pus from two patients requiring abscess drainage revealed S. aureus in one and K. pneumoniae in the other. Bacteria from urine and stool samples are depicted in Table 3 (b,c), respectively. Cerebro-spinal fluid (CSF) cultures were performed in two participants; both were negative after 48 hours of culture. 504 (NA = 96) EDTA blood samples subjected to PCR-screening for Brucella spp., Leptospira spp., Bartonella spp., Borrelia spp., Coxiella burnetii and Rickettsia spp. were found negative. We also screened for Chlamydiae, Haemophilus influenzae, and Mycoplasma pneumoniae in pharyngeal swabs by PCR. Only H. influenzae was found in 16% (31/191 ) patients (Fig. 1) .", "Virology. Hepatitis B serology (HBsAg determination) was performed in seven patients presenting with an at least five-fold increase in alanine aminotransferase (ALT \u2265 225 UI/L); all were HBsAg negative.", "A subset of 89/108 samples that tested negative for all pathogens represented in the initial standard panel (Supplementary Table S1 ) were screened, by PCR, for cytomegalovirus (CMV), Epstein Barr virus (EBV), human herpesvirus 6 (HHV6). Nineteen samples were not tested for technical reasons. Those three targeted herpesviruses were positive in 25% (22/89), 30% (27/89) and 33% (29/89) patients, respectively (Fig. 1) . Co-infections of www.nature.com/scientificreports www.nature.com/scientificreports/ EBV and HHV6 were present in 13 patients. One child was co-infected by three viruses (Table 4(a)). Screening for dengue viruses 1-4 (DENV 1-4), West Nile virus (WNV), yellow fever virus (YFV) and chikungunya virus (CHIKV) was negative (Fig. 1) ." ] },{ "paper_id": "03b35e72b8abfe6c88da27e72b5ecc8e77211dd2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Analysis of the sequencing results was conducted using Mothur software (v1.35) [52] . Paired-end reads were aligned ", "Lastly, it is unknown whether the organisms identified using next generation sequencing methods are functionally or metabolically active. Future computational studies are needed to specifically examine the metabolomics of the bacteria identified." ] },{ "paper_id": "03b9acce84a4799d4be1152a36abfaf52fb3b523", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Respondents were well distributed over all geographic regions and across different urbanization levels (about 13.6% rural and 86.4% urban) that matched the distributions of the total population. The household size averaged 4.5. For those over 18 years old (adults), 56.4% were married, and 37.6% received at least college education. About 37.9% of adults were service-sector workers, and 23.8% were manual workers; others were either students (5.5%) or not working (32.8%).", "After two-and-a-half months of fieldwork, we completed 1,954 successful interviews. The respondents (or their parents or guardians) provided 1,943 contact diaries that recorded every person with whom they had contacted during the past 24 hours (up to a maximum of 40 persons, a cutoff set to limit time and space). The ''crude'' (or ''minimum'') response rate was about 46.4% (or 51.3% after excluding ineligible cases such as wrong addresses, etc.)(The response rates are calculated by international standards, cf. [21] [22] .", "The most active age group of all is schoolchildren (ages 5-14), who average around 16-18 contacts. These super spreaders of influenza viruses make 2-3 times as many contacts as the least active age groups [3, 8, 12] . Furthermore, about half of these children's contacts involve a touch or other kind of physical contact.", "Many policy implementations for disease control rely on modeling how infectious diseases spread. To increase the effectiveness of such modeling, one of the most comprehensive efforts seeks to collect empirical data by means of large-scale probability surveys and infers the findings to the population upon which a policy is to be implemented. Such a task becomes more urgent for densely populated societies that may be more susceptible to a pandemic outbreak.", "Under the influence of the Chinese culture that overly stresses guanxi (or relationship) [16] [17] , Taiwan's residents tend to make contact with others often in their everyday lives. Asking questions about interpersonal contacts thus turns out to be significant not only for research on disease infections but also for more general social issues [18] . Under such circumstances, Taiwan offers an opportunity for exploring how rigorous diary-approach surveys may further facilitate researchers' and policy makers' understanding of how infectious diseases spread." ] },{ "paper_id": "03bb746ba6fb4c250b5f8f9ff0e5013b2c49b8f7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Hepatitis B virus (HBV) infection continues to be a serious clinical challenge, which induces the development of liver cirrhosis and hepatocellular carcinoma, even leading to mortality, in many areas of the world [1, 2] . Currently, the utility of first-line antiviral agents or immune system modulators recommended by the World Health Organization can only help to reduce and control the viral load and minimize liver damage, but cannot effectively clear the infection and seldom achieve a cure [3, 4] . Thus, these current therapies remain far from satisfactory. In particular, the wide spread of multidrug-resistant HBV strains is increasingly threatening the efficacy of currently available antiviral drugs [5, 6] . Therefore, there is an urgent need to actively develop and test promising novel therapies to target HBV." ] },{ "paper_id": "03ca47766e6f3e8d5d71fa25d86803f82d690b38", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Targets Predicted by Discovery Studio 4.5", "G-bS, J-xY, and X-bS conducted the study. MW designed the detailed experiments, performed the study, and collected and analyzed data. Y-yD, YT, PL, and X-sL took part in the cell experiments in this study. All Authors commented the study and approved the final manuscript. ", "The results are expressed as the means \u00b1 standard deviation. Comparisons were performed using Student's t-test or one-way ANOVA followed by Tukey's multiple comparison test using Prism 5.00 software. Statistical significance was set at p < 0.05. All data are the result of at least three independent experiments." ] },{ "paper_id": "03d32bf9da6495150f5016a0bf2d4b7647620c7d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "03d40dcd5d29728439528bd955afcba42bc0c2b9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Highly pathogenic avian influenza (HPAI) H5N1 viruses continue to spread among poultry and have frequently broken the species barrier and transmitted to humans. As of February 2012, there were 583 confirmed human H5N1 infections from 15 countries, with a fatality rate of .59% (344), alarming that the consequences of a H5N1 pandemic could be catastrophic. Therefore, many efforts have focused on the development of effective therapeutics and vaccines in preparedness. Of them the neutralizing antibody-based strategies have been particularly explored.", "To determine the effect of disulfide bond reduction on the binding of anti-HA mAbs, an ELISA plate was coated with recombinant HK06-HA at a concentration of 1 mg/ml and then treated with dithiothreitol (DTT) at a concentration of 10 mM for 1 h at 37uC, followed by washes. The plate wells were then treated with 50 mM iodoacetamide for 1 h at 37uC. After washes, a standard ELISA was performed as described above.", "Therefore, three discontinuous sites, designated site I (I116, I117, P118), site II (W122, S123), and site III (Y164, T167) are likely involved in the AVFluIgG01 epitope. In the 3D structure, the epitope residues are adjacent to each other at the tip of the membrane-distal globular domain of HA monomer, in close proximity to the receptor-binding domain (Fig. 4) . Importantly, these amino acids are highly conserved among diverse H5N1 clades and subclades [12] [13] 17] , underlying the broad-spectrum H5N1-neutralizing activity by AVFluIgG01." ] },{ "paper_id": "03d7c96afa37141562c3ac9297882dbe59d2e0e4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "03dce266594748330a10d2d11dbe611bf42aa42d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Contributed directly to the writing and drafting, editing, and final approval of the article before submission CS, JN, and MM.", "Development of a vaccine for rhinovirus remains a universal hope of the public health and scientific communities. For over a half century, the prospect of developing an HRV vaccine has remained bleak. There remain many technical, logistical, and fundamental biological challenges to developing a successful vaccine for HRV. Mice and cottons rats are important models for testing of efficacy of vaccines to elicit neutralizing antibodies, however, they are not fully permissive to infection and can only resemble some aspects of HRV pathogenesis in humans (Bartlett et al., 2008; Blanco et al., 2014a) . Recent advances in producing mice that are transgenic for human ICAM-1 have made them an improved model for study of HRV infection (Bartlett et al., 2008 ). Yet, any vaccine preparation would likely have to be studied directly in humans.", "This work was supported by funding from a Holcomb Awards Committee (HAC) Faculty Research Grant (CS), the Butler University Department of Biological Sciences, and faculty startup funding (CS) from Butler University." ] },{ "paper_id": "03e779f9defa0b9cb6a9943947e41b9c1532e3d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "03e9a22249dd6e201e347bb87cf96a931120f5c5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "293 T (human kidney epithelial) and Vero (African green monkey kidney) cells were grown in Dulbecco's modified Eagle's medium (DMEM; Mediatech-Cellgro) supplemented with 10% fetal bovine serum and antibiotics at 37uC in 5% CO 2 .", "The genes encoding influenza HA 1918, Nipah G and F were commercially synthesized and then cloned into pCAGGS vector. Junin and Lujo GPC in pCAGGS from Dr. Thomas Briese.", "We envisage this pseudotyped MCR assay as a platform technology that will enable the preparation and storage of a specific sets of assay reagents for a wide range of viral pathogens, at low cost, in advance of any actual outbreak of the corresponding viral disease. This could form the basis for an efficacious and timely outbreak response, immediately following the identification of dangerous new viruses." ] },{ "paper_id": "03f315449023c980e42af7eb150d0cd9cab57f5a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All statistical analyses were performed using SPSS version 16 for windows. The association between MERS-CoV prevalence in camels and the study variables (sampling site, origin, age, and sex) were analyzed by Pearson Chi-square test of independence. Statistical significance was considered at p-value less than 0.05.", "Serum micro-neutralization assay was conducted as described by Perera et al. (2013) [13] , using Vero-E6 cell monolayers. Briefly, serial two-fold dilutions of 200 \u00b5L heat-inactivated sera (56 \u2022 C Viruses 2019, 11, 717 4 of 16 for 30 min) were made, starting with a dilution of 1:10. The serum dilutions were mixed with equal volumes of 200 tissue culture infectious dose (TCID 50 ) of dromedary MERS-CoV Egypt NRCE-HKU270. After 1h of incubation at 37 \u2022 C, 35 \u00b5L of the virus-serum mixture was added in quadruplicate to Vero-E6 cell monolayers in 96-well microtiter plates. After 1 h of adsorption, an additional 150 \u00b5L of culture medium was added to each well. The plates were then incubated for three more days at 37 \u2022 C in 5% CO 2 in a humidified incubator. A virus back-titration was performed without immune serum to assess input virus dose. Cytopathic effect (CPE) was read at three days post infection. The highest serum dilution that completely protected the cells from CPE in at least half of the wells was considered as the neutralizing antibody titer and was estimated using the Reed-Muench method. Positive cut off points were set at values greater or equal to 1:20 serum dilution points.", "This study was carried out in accordance with the principles of the Animal Welfare Act of the United States of America. The protocol was approved by the Institutional Animal Care and Use Committee at St. Jude Children's Research Hospital. Also, the ethics committee of the National Research Centre, Egypt, approved the animal sampling protocol (Approval code: 17-070).", "Real-time reverse transcription polymerase chain reaction (rtRT-PCR) targeting upstream of E gene of MERS-CoV was used for screening [19] . Confirmation was made using assays targeting the Open Reading Frame (ORF) 1a or N gene based on WHO recommendations for MERS-CoV diagnosis [20] . A partial 701 bp fragment of the spike gene containing the RBD was amplified using pre-RBD-MERS-F (GAATCTGGAGTTTATTCAGTTTCGT) and pre-RBD-MERS-R (ACGGCCCGA AACACCATAG) primers in the first round using one step RT-PCR kit (QIAGEN, Germany). The PCR products were then subjected to a second PCR round with RBD-MERS-F: (CGAAGCAAAACCTTCTGGCT) and RBD-MERS-R: (ATATTCCACGCA ATTGCCTA) primers and using Phusion High Fidelity PCR Master Mix Kit (Thermo Scientific, Waltham, MA, USA). The final PCR product was gel purified then sequenced with the same primers at the Macrogen sequencing facility (Macrogen, Seoul, South Korea). The phylogenetic tree was constructed using MEGA6 program by applying the neighbor-joining method with Kimura's two-parameter distance model and 1000 bootstrap replicates." ] },{ "paper_id": "03fa4232b3fbc44b6029d52c3120f4e82fdc49c0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Homology modelling of the OC43 3CL pro", "Assessing the binding conformation and free energy of binding of 16R", "During coronavirus replication the large open reading frame (ORF) 1a/1ab genes, located at the 5' end of the genome, are responsible for expressing two large replicase polyproteins (pp). These are co-or post-translationally cleaved by the virally encoded 3CL pro and Papain-like protease to yield 16 non-structural proteins responsible for viral replication [9] . The 3CL pro is also termed the main protease as it cleaves a total of 11 cleavage sites within pp1a and pp1ab [10] , in comparison to only three cleavage sites predicted for the papain-like protease [11] ." ] },{ "paper_id": "03fd3a4ec79ffea2a049338b2818457e98496df6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "To determine the statistically significant difference between the VN titers generated after inoculation with the three FCoVs, the unpaired two-tailed Student T test with equal variances was applied. The p value under 0.05 was considered as a statistically significant difference.", "High copy number (.10 3 ) genomic qRT-PCR results were confirmed with subgenomic qRT-PCR assay not only from organs but all fecal and blood samples (data not shown).", "One of the two aa substitutions affecting nsp3 was found in papain-like protease 2 responsible for proteolytic processing of nsp1 and nsp2 [26] , proteins with functions of host gene expression inhibition [27] and cellular signaling disruption [28] .", "Serum samples were taken using VacuetteH tube (Greiner Bio-One, Germany) at days 0, 7, 14, 21, 28, 35 and 42 p.i. For antibody ELISA tests, the FCoV EIA Kit, (BV European Veterinary Laboratory, The Netherlands) was used according to the recommendations of the manufacturer.", "Feline coronaviruses (FCoVs), members of the Alphacoronavirus genus within the Coronaviridae family, are major pathogens of Felidae with worldwide distribution [1] . FCoV occurs in two pathotypes; feline enteric coronavirus (FECV) primarily replicates in the lower portion of intestinal tract, spreads by fecal-oral route, and its clinical appearance is characterized by mild or unapparent enteritis [2, 3] . In contrast, feline infectious peritonitis virus (FIPV) efficiently replicates in macrophages/monocytes, and can lead to feline infectious peritonitis (FIP), a highly lethal systemic granulomatous disease, [4] [5] [6] [7] [8] ." ] },{ "paper_id": "0401a5bebe76fc07dde0f103a248118ce30facda", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Rift Valley Fever (RVF) is a mosquito-borne viral zoonosis, which periodically causes disease outbreaks in humans and livestock. Infection by RVF virus (RVFV) causes abortion or resorption of the fetus in pregnant domestic ruminants, with newborn mortality approaching 100%. Transmission of RVFV to humans, either through contact with bodily fluids of infected animals or through mosquito bites, may result in mild to moderate influenza-like symptoms and severe retinitis, encephalitis and hemorrhagic fever [1, 2] .", "RVFV was first described in Kenya in 1931 [3] . Major outbreaks of RVF have been reported in Egypt in 1977 , Kenya in 1997 -1998 , Saudi Arabia in 2000 -2001 , Yemen in 2000 -2001 , and South Africa in 1951 ,1974 -1976 [1, [4] [5] [6] [7] [8] . The recent outbreak of RVF in Kenya in November 2006 through March 2007, where several hundred human cases were confirmed in 6 of 8 provinces had a devastatingly high case-fatality rate for hospitalized patients while there were up to 180,000 infected mildly ill or asymptomatic people within the highly affected areas [9] [10] [11] . Sero-surveys suggested an attack rate up to 13% of residents in heavily affected areas; livestock deaths and abortions were also noted during the outbreak [9, 11] .", "RVFV belongs to the order of Bunyavirales, family Phenuiviridae, genus Phlebovirus. The members of this family carry a tri-segmented single stranded RNA genome. The M (medium) and L (large) segments are of negative orientation, whereas the S (small) segment has an ambisense polarity. The L segment encodes the RNA-dependent RNA-polymerase while the M segment encodes the two glycoproteins Gn and Gc and also the non-structural protein NSm. The small segment encodes the nucleocapsid (N) protein and a non-structural protein NSs using an ambisense coding strategy [1, 2] . The N protein is highly conserved and it is one of the most immunodominant viral proteins among members of the Phenuiviridae family [12] [13] [14] ." ] },{ "paper_id": "04034022f265da392051b3e3fcef2e580247d6c4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For the neutralization assay, two-fold serial dilutions ranging from 1:10 to 1:5120 were prepared in quadruplicate.", "Background: Marburg virus (MARV) causes severe haemorrhagic fever in humans and nonhuman primates and has a high mortality rate. However, effective drugs or licensed vaccines are not currently available to control the outbreak and spread of this disease." ] },{ "paper_id": "040c9714be80e4a337f6737d17e94171c25cc076", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ebola and marburgviruses are enveloped, negative single-strand RNA viruses of the Filoviridae family [1] . Since the discovery of Marburg virus (MARV) in 1967 [2] and Ebola virus (EBOV) in 1976 [3] , the US Centre of Disease Control has reported several epidemic outbreaks in humans and nonhuman primates [4, 5] . Despite intense world-wide research efforts, no antiviral treatments or vaccines have yet been licensed. In addition to primates, filoviruses infect pigs, dogs, duikers, and fruit bats in nature, and rodents and ferrets can be infected experimentally [6] [7] [8] [9] [10] [11] [12] .", "Luciferase-based GP-driven entry was measured as previously described [48] . ", "Remnant cells were scraped from the wells into 1% SDS/PBS for immunoblot analysis. 3% lysates were run through an SDS/PAGE gel and transferred onto a nitrocellulose membrane. NP or tubulin protein detection was carried out by the same goat EBOV and MARV antisera as used for IF and a tubulin specific mab, respectively, followed by antigoat IRDye680-conjugated secondary ab incubation. Immuno-labelled proteins were detected with and odyssey infrared-imaging system (LI-COR).", "Surrogate HIV-based pseudovirion packaging plasmid HIV Gag-pol, transfer plasmids CSLucW2 (Firefly luciferase expression) or CSGW (hrGFP), and envelope plasmid for VSV-G protein and its backbone plasmid pcDNA3.1 have been described previously [43] . The pWPI-mCherry-BSD bicistronic expression vector was generated by introduction of the mCherry DNA sequence into a pWPI-BSD empty vector [44] . Both plasmids were digested with restriction enzymes BamHI and SpeI. The mCherry encoding fragment was gel isolated, purified and ligated into the new lentivirus expressing vector. mCherry expression was confirmed by pseudovirion generation and fluorescence-activated cell sorting (FACS) analysis. Lenti-X TM Tet-On \u00ae inducible expression system plasmids pLVX-Tet3G and pLVX-TRE3G-ZsGreen1 were purchased from Takara Bio. (Mountain View, CA, USA).", "Cells were grown to about 90% confluency on 10 cm dishes prior to extraction. Total RNA was extracted as instructed in the RNeasy Midi kit (Qiagen, Hilden, Germany) guidelines." ] },{ "paper_id": "0414c8763c6ec295be60d86698ec3a76e981e54f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Since these approaches use available sugar (e.g. from sugar cane or corn), they do not depend on expensive technology to obtain sugar from lignocellulose or for direct light conversion (e.g. photobioreactors). At the same time, they allow to synthesize drop-in fuels (see above).", "Several pathway engineering approaches aim to synthesize biofuels from lignocellulosic polysaccharides (cellulose, hemicellulose), making available non-edible plant parts. For example, a pathway to produce isobutanol was constructed in a native cellulose-degrading bacterium using various genes from different organisms [78] . Similarly, genes to make use of cellulose or hemicellulose were transferred into different microorganisms, some of them containing one or several exogenous genes, in order to synthesize butanol, biodiesel or hydrocarbons [77, 79, 80] .", "The author(s) confirm that this article content has no conflicts of interest.", "More recently the function to seek and degrade a pollutant was generated by coupling in E. coli a synthetic aptamer riboswitch that recognizes the herbizide atrazine to the translation of the mRNA for the protein (CheZ) controlling E. coli motility. Additionally, these cells were equipped with an atrazine chlorohydrolase gene (atzA) for atrazine degradation, derived from Pseudomonas sp. soil bacteria [53] ( Fig. 2B) ." ] },{ "paper_id": "04299cd1ecb45c984de64da12daf3ccc1fe2abe2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(3) mediators released by the gut immune response.", "The intestinal microbiota is a collection of microorganisms that live within the gastrointestinal tract, with concentrations of up to 10 11 -10 12 cells/g luminal contents.", "SCFAs: short-chain fatty acids; IBS-C: constipation predominant-irritable bowel syndrome; MMC: migrating myoelectric complex; 5-HT: 5-hydroxytryptamine; SUS: starch utilization system; SIBO: small intestinal bacterial overgrowth; TGF-\u03b2: transforming growth factor-\u03b2; TNF-\u03b1: tumor necrosis factor \u03b1; FMT: fecal microbiota transplantation; STC: slow transit constipation.", "Collectively, the altered intestinal microbiota may play an essential role in the pathogenesis of chronic constipation." ] },{ "paper_id": "042a57ce54d353b67f9faff39f7829c45dc7b101", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Objetivo: Relatar o caso de um lactente que necessitou de intuba\u00e7\u00e3o traqueal no setor de emerg\u00eancia pedi\u00e1trica por conta de laringite aguda grave e que, ap\u00f3s a extuba\u00e7\u00e3o traqueal programada, fez uso, com sucesso, da c\u00e2nula nasal de alto fluxo, a qual, possivelmente, evitou a falha da extuba\u00e7\u00e3o traqueal. " ] },{ "paper_id": "042c9d15e000e5ea7b91612b4c10175e88112278", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Spike protein sequences, easily obtained by Sanger sequencing, are widely used to speculate about vaccine protection (7), but as the immunity for IBV is not based only on the humoral response to this protein (8, 9) , the availability of full genomes for vaccine strains is core to accurately predicting protection markers.", "The D274 genome is 27,599 nucleotides (nt) long [poly(A) tail included] and annotated in the order 5= UTR and leader RNA (nt 1 to 528), ORF1a (nt 529 to 12327), and ORF1ab (nt 529 to 20360) with a ribosomal frameshift, followed by the spike S (nt 20311 to 23802), 3a (nt 23802 to 23975), 3b (nt 23975 to 24169), envelope E (nt 24150 to 24473), membrane M (nt 24442 to 25122), 5a (nt 25481 to 25678), 5b (nt 25675 to 25923), and nucleocapsid N (nt 25866 to 27095) genes and a 3= UTR (nt 27096 to 27599).", "This work was funded by CNPq (Brazilian National Board for Scientific and Technological Development) grant numbers 307291/2017-0 and 400604/2016-7.", "A plethora of types of avian infectious bronchitis virus (IBV) (Nidovirales: Coronaviridae: Coronavirinae: Gammacoronavirus: Avian coronavirus [AvCoV]) strains are used in live and inactivated vaccine formulations worldwide to prevent infection with or lessen the symptoms caused by the diverse number of field strains of the virus in chickens (1) ." ] },{ "paper_id": "0435b8c5081db34e2c6c62b8f7b998927fa28776", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Breast Enhanced proliferation and migration", "Nrf2 upregulates Notch1 and HES-1(proliferation) via G6PD/HIF-1 and regulates EMT (migration) [44] Increased glucose uptake and NADPH production Histone deacetylase inhibitor reprograms metabolism by upregulating G6PD", "[32]" ] },{ "paper_id": "044b6504465e3d1b00fcc328c6731bcd034b1691", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Aliquots of sample lysates were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), followed by transferring proteins to polyvinylidene difluoride (PVDF) membrane. The membrane was blocked with 5% (w/v) skim milk in Tris-buffered saline (TBS), containing 0.05% Tween-20 (TBST), at 37 \u2022 C for 2 h, followed by washing three times with TBST. Then the membrane was incubated overnight at 4 \u2022 C with mouse polyclonal antibody against \u03b2-actin (ABclonal, Wuhan, China), rabbit polyclonal antibodies against HSP90B1, ANXN4, APN (ABclonal), or MX1, (Protein-Tech, Wuhan, China). After washing three times with PBST, the membrane was incubated with Horseradish peroxidase (HRP)-conjugated goat anti-mouse/rabbit IgG (ABclonal) at 37 \u2022 C for 2 h. Finally, the protein bands were visualized using the Clarity\u2122 Western ECL Blotting Substrate (Bio-Rad, Hercules, CA, USA).", "A total of 100 mg of jejunum homogenates were suspended in 500 \u00b5L PBS, freeze-thawed three times at \u221280 \u2022 C, and centrifuged at 12,000\u00d7 g, for 10 min, at 4 \u2022 C. Next, 200 \u00b5L of clarified supernatant was transferred into a separate sterile tube for total RNA extraction by using Tripure Isolation Reagent (Roche, Indianapolis, USA) according to the manufacturer's instructions. The cDNA was obtained by RT-PCR using the PrimescriptTM RT Master Mix (TakaRa, Tokyo, Japan). The real-time RT-PCR assay used the following primer and probe sequences: PEDV forward primer: 5 -CGTACAGGTAAGTCAATTAC-3 , PEDV reverse primer: 5 -GATGAAGCATTGACTGAA-3 , and PEDV Taq-Man \u00ae probe: FAM-TTCGTCACAGTCGCCAAGG-TAMRA. The PCR was performed using the following parameters: 50 \u2022 C for 2 min, 95 \u2022 C for 10 min, 40 cycles with 95 \u2022 C for 15 s, 56 \u2022 C for 30 s and 72 \u2022 C for 31 s.", "These iTRAQ labeled peptide samples were then redissolved in 200 \u00b5L buffer A solution (20 mM HCOONH4, 2 M NaOH, pH 10). The dissolved sample (100 \u00b5L) was passed through high-performance liquid chromatography (HPLC) on Phenomenex columns (Gemini-NX 3u C18 110 A; 150*2.00 mm). Before HPLC, Phenomenex columns were balanced with 95% buffer A and 5% buffer B (20 mM HCOONH4, 2 M NaOH, 80% acrylonitrile [CAN], pH 10), for 30 min. Peptides were separated by a linear gradient formed from buffer A and buffer B, from 5% to 50% of buffer B at a flow rate of 0.2 mL/min. The ultraviolet (UV) detector was set at 214 nm and a total of 24 fractions were collected. and mobile phase B (0.1% FA, 95% ACN), from 5% to 40% of mobile phase B for 70 min, at a flow rate of 300 nL/min. For MS analysis, a TripleTOF 5600 system (AB SCIEX, Foster City, CA, USA) was used in Information Dependent Mode. MS spectra were acquired across the range of 400-1250 m/z in high resolution mode (>30,000), using 250 ms accumulation time per spectrum. A maximum of 20 precursors per cycle were chosen for fragmentation from each MS spectrum with 100 ms minimum accumulation time for each precursor and dynamic exclusion for 20 s. Tandem mass spectra were recorded in high sensitivity mode (resolution > 15,000), with turned on rolling collision and iTRAQ reagent collision energy adjustment." ] },{ "paper_id": "0450e1d435d63e69e1867c2eba65c0c08af70038", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "L-\u03b1-phosphatidyl-L-serine was obtained as a 10 mg/ml solution in chloroform:methanol (95:5) (Sigma, St Louis, MO). To generate liposomes, phospholipid was dried in a glass tube under nitrogen, and resuspended in PBS to a final concentration of 5 mM. This solution was sonicated on ice 3 times for 5 min each, using a W-385 sonicator with a microtip on output level 3 (Heat Systems Ultrasonics). The liposomes were filtered through a 0.2 \u00b5m pore-size syringe filter and were used immediately unless otherwise described." ] },{ "paper_id": "04510f144938a17bf2c2a9683ce3479ff0246b94", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All statistical analyses were performed using the SPSS 13.0 computer software program (SPSS, Inc., Chicago, IL). Survival was analyzed using the log-rank (Mantel-Cox) method. The significance of variability among the experimental groups was determined by the Mann-Whitney U test. All differences were considered statistically significant at p < 0.05.", "Abbreviations CVB3: coxsackievirus group B type3; miRNA: microRNA; MAPK: mitogen-activated protein kinase; HSP27: heat shock protein; MOI: multiplicity of infection; siRNA: small interference RNA; UTR : untranslated regions; VP1: viral protein 1.", "Cells were pooled, pelleted by centrifugation, washed once with ice-cold PBS, and resuspended in binding buffer (10 mM HEPES-NaOH [pH 7.4], 140 mM NaCl, 2.5 mM CaCl 2 ) to a concentration of 10 6 /ml. 0.1 ml of cell suspension was transferred to a 5-ml tube and incubated with 5 \u03bcl of Annexin-V and 5 \u03bcl of PI for 15 min at 25 \u00b0C in the dark. Samples were analyzed by flow cytometry within 1 h on a FACScan flow cytometer (BD Biosciences). Results are presented as the percentage of early apoptotic (Annexin-V + PI \u2212 ) and late apoptotic (Annexin-V + PI + )." ] },{ "paper_id": "045b111f0f2584890e9271399aa93c917a496662", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "x Excluded a priori because of assumed collinearity with urea." ] },{ "paper_id": "04603867552ffafcaeff68fe8bf7f190ebb08a78", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "which translates mathematically into" ] },{ "paper_id": "0469d052ac583aa5b739be7fedecec5307548d49", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The higher reported concerns for cancers, unemployment and meningitis, reported also by other French studies [7] may be due to their higher prevalence and strong mediatisation in France." ] },{ "paper_id": "046a56d635edc933ed8f30ccf1ae9fd488dfe645", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The above-mentioned data was statistically analyzed by the SPSS software (version 21.0, SPSS, USA, http:// spss.en.softonic.com/) in groups compare using Student's ttest with significant differences defined at p < 0.05, while p < 0.01 represents a highly significant difference.", "Protein concentration was measured using the BCA protein assay reagent (Thermo Fisher Scientific Inc., USA) and equal mass (~35 \u03bcg) samples were fractionated by electrophoresis through 15% polyacrylamide gels. The gels were stained by Coomassie brilliant blue R-250 (Bio-Rad Laboratories, Inc., USA) and de-stained with a de-staining solution (10% acetic acid + 30% ethanol + 60% ddH 2 O). The images were gathered by Lane 1D image shooting software (Beijing SAGE Creation Science Co., Ltd, China).", "The bacterial strains BL21 (E. coli B Fdcm ompT hsdS (r B m B -) gal \u03bb) (DE3), the plasmids pET22b(+)-hLSECtin-CRD and pGEX-6P-hLSECtin-CRD were prepared in our laboratory. The plasmids pET28b and pET28b-Tat were provided by Dr. Chenggang Zhang from our institute. The plasmid pCDNA3.1amyc-his-hLSECtin was provided by Dr. Li Tang from our institute." ] },{ "paper_id": "04799a6c57e1d3f9488b24a4fc2580bbb3818665", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Using the anti-VP6 antibody, we established a differentiating ELISA for PRV. These experiments provided basis for determination of PRV.", "The obtained VP6 sequence was deposited in GenBank database and compared with reference PRV VP6 sequences using DNASTAR software. The name, GenBank accession number and virus isolation location of these genes are shown in Table 1 . At the same time, a phylogenetic tree was constructed by neighbor-joining method base on these VP6 amino acid sequences using the DNASTAR program [25] [26] [27] . The bootstrap probabilities of each node were calculated using 1,000 replicates.", "Generation of polyclonal antiserum to Pro-VP6 was processed according to references with modifications [17] [18] [19] 28] . A New Zealand rabbit was immunized with 2 mL of gel-purified Pro-VP6 (1 mg/mL) emulsified with equal amounts of Freund's complete adjuvant via subcutaneous injection. After ten days, 2 mL of the same antigen mixed with Freund's incomplete adjuvant were injected into the rabbit weekly at two intervals. Antiserum was collected from the peripheral blood of the rabbit." ] },{ "paper_id": "047a76d5e047a00728847bcdd162cb925486d0ab", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Each biomedical image technique is appropriate for certain diagnostics. For example, MRI enables the spatial localisation required for cross-sectional imaging whereas ultrasound images allow physicians the visualisation of soft tissues and have revolutionised obstetric care [7] . However, digital radiology is still the backbone of diagnostic bioimaging, mainly due to three reasons: (1) its capability to detect unsuspected pathologies; (2) being not invasive; and (3) having a low radiation dose and low cost [8] .", "In particular, the Bhattacharyya distance [42] is used to provide a measure of the similarity of two histograms. Considering two histograms 1 and 2 , this distance is defined by", "\u2212 min \u2208pathologic ( ( ) , ( )) ," ] },{ "paper_id": "0480084eefee6333df832a821af8945ea7ab379a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "professional visits were less likely in summer compared to spring and autumn.", "Additional file 1: The contact log (in English) is available in as an additional file.", "Data was entered and stored in Microsoft Office Access 2007 (Microsoft Co., Redmond, Washington, USA), and analysed using Stata Statistical Software: Release 11.2 (StataCorp. 2009, College Station, Texas, USA)." ] },{ "paper_id": "048b240dcabbd623a6cda8c4236ea50d7961315c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Conclusion/Significance: While there has been an increase in imports of amphibian and reptiles into Thailand, erratic patterns in proportions of captive-bred specimens and volumes suggests either capricious markets or errors in reporting. Large discrepancies with respect to origin point to misreporting or possible violations of the rules and intentions of CITES.", "The import of live reptiles into Thailand via Macao is restricted to the year 2006 when 102 individuals of 9 species were reexported from Macao. While Macao reported the re-export of these animals, for 78 individuals (76%) of 7 species there are no corresponding records of the animals ever being imported into Macao (Table 2) ." ] },{ "paper_id": "0491da5ae5c2fa38824350bde5462ed82ebc24e7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The blot was probed with polyclonal gp120 antibody.", "Subtype C (96ZM651 strain)", "Nabs: Neutralizing antibodies CHO: Chinese hamster ovary" ] },{ "paper_id": "049294a884d39102b06a634ba0f4bd3185fcc478", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The klassevirus 1 contig had a genomic organization similar to other picornaviruses ( Figure 1A -C). Conserved Pfam [26] motifs characteristic of picornaviruses were present including two picornavirus capsid proteins, RNA helicase, 3C cysteine protease, and RNA dependent RNA polymerase.", "5'-GGAAACCCAACCACGCTGTA-3') and", "Publish with Bio Med Central and every scientist can read your work free of charge " ] },{ "paper_id": "049d68aa5279d807e4125c33a3d563f6df987cb4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical Analysis. For analysis of two unpaired samples, the nonparametric Mann-Whitney U test was used. A significant difference was defined as P < .05. All values were represented as the means \u00b1 SEM.", "Morphometric Evaluation. The percentages of the distribution area of the cells immunoreactive for thrombomodulin among those immunoreactive for CD34 were estimated from 30 randomly selected color images at a magnification of 400 in each case using a digital image analysis system (Lumina Vision, Mitani Corporation, Fukui, Japan).", "High mobility group protein B1 (HMGB1) was originally identified as a nuclear nonhistone protein with DNA-binding domains and implicated as an important endogenous danger signaling molecule [3] as well as a late mediator of systemic inflammation in septic shock [4, 5] , thus having a putative role in the pathogenesis of acute lung injury [6, 7] ." ] },{ "paper_id": "04a02b2f24ba9cf14a860a98b25f65ef2afd73fd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "z L as the MLE of the parameter vector.", "Hern\u00e1 n Makse", "The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication. ", "s\u00f0fx t;prior g n ; fo t;prior g n \u00de s 2 t;prior \u00f0o i t;post \u00c0 o i t;prior \u00de:" ] },{ "paper_id": "04a0ec4b6cb5eeb0d2cbf2c8ea8829b5c476b1b9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Week after installation " ] },{ "paper_id": "04a253fd34bd82b3cf7868fca967469c66e392ab", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "poly I:C was purchased from invivogen. RO 90-7501, chloroquin, SB202190 and U0126 were purchased from Sigma. LY294002 and SP600125 were from Cell Signaling. IKK-2 inhibitor IV was purchased from Santa Cruz Technology.", "RO 90-7501 enhances the antiviral response induced by poly I:C", "RO 90-7501 enhances poly I:C-induced activation of IFNb promoter, but does not change the activation kinetics" ] },{ "paper_id": "04abbb8d91bd1a15a6c70ce3c0bd339f92468265", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "04b5f15cca91a7b810216682780f8ea6e1ab3046", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Camels have been associated with human civilization for thousands of years as a form of transportation of people and goods, a source of meat, milk and wool, and a player in recreational a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "The data generated in this study is available online. Illumina ", "To minimize the issue of contamination, we have run sample processing, pre-amplification, library preparation, and sequencing in a contained hood in separate rooms. Each RNA sample was reverse-transcribed and amplified with a modified random amplification (Round AB) protocol as described previously [32] . PCR amplicons obtained from the pre-amplification were purified with Agencourt AmPure XP (Beckman Coulter) and subsequently fragmented by sonication using a Covaris LE220 focused-ultrasonicator (Covaris) in order to achieve efficient library generation. Library construction for Illumina sequencing was carried out for each sample individually using NEB Ultra II DNA Library Prep Kit (New England Biolabs) with dual index barcoding according to the manufacturer's instructions. Library construction was done either manually or on an automated NGS workstation, Zephyr G3 NGS Workstation (Perki-nElmer). Quality of the libraries generated was evaluated using a 2200 TapeStation Nucleic Acid System (Agilent Technologies) and library DNA concentrations were measured using Qubit 2.0 fluorometer (Thermo Fisher Scientific). The libraries were then normalized, pooled, and sequenced on an Illumina HiSeq 2500 (2x125) or MiSeq (2x300) instrument, aiming for 5-10 million pair-end reads per sample following the company's standard protocols." ] },{ "paper_id": "04b9001d61d666e065f28a9e628991f4d76d71bc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The nature of this general Internet-based survey amongst healthy volunteers from the general population does not require formal medical ethical approval according to the Dutch law [29] .", "Timing of the three surveys related to the course of the Influenza A (H1N1) outbreak", "Demographic characteristics of respondents are listed in Table 1 . Overall, there were no significant differences between surveys. Focusing on survey 3, mean age was 51 years (range 19-89 years) and most respondents (92%) were of Dutch origin. Thirty-eight percent had a lower education (i.e. primary education, lower general or lower vocational education or less), 36% an intermediate (i.e. secondary general or vocational education), and 26% a higher education (i.e. higher professional education or university). The majority of respondents were employed. About three quarters were married or cohabitating and in 27% of the households there were one or more children under 18 years. Compared to the general Dutch population (Table 1) , the respondents were older, more often of Dutch origin, and more often unemployed/ retired." ] },{ "paper_id": "04bc03c90437934a75fc6fdc228817234ef84c3a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "animals BALB/c and C57BL/6 male mice (6-8 weeks old, male) were obtained from Guangdong Medical laboratory Animal Center (Guangdong, China) while Rag1 \u2212/\u2212 mice (B6 background) were purchased from Jackson Laboratory (Bar Harbor, ME, USA). All mice were housed under a specific pathogen-free condition. ", "immunohistochemistry Allografts were fixed with 4% paraformaldehyde for 24 h and then embedded in paraffin. Tissues were cut into 3-\u03bcm thick sections and placed on slides. The sections were then used for H&E and immunohistochemistry staining. For immunohistochemistry, slides with sections were incubated with primary anti-CD3 antibody (1:100, Abcam) at 4\u00b0C overnight, then secondary antibody HRP-anti-Rabbit IgG (Maxim), followed by diaminobenzidine color development. For quantitative analyses, slides were imaged at a magnification of 200\u00d7. The area of inflammation/infiltration and integrated optical density (IOD) of CD3 were measured using ImagePro plus 6 software.", "Comparisons of the means were performed using Student's t-test and one-way ANOVA. Data were presented as the mean \u00b1 SD and analyzed through GraphPad Prism 6 (GraphPad Software, La Jolla, CA, USA). The analysis of graft survival was conducted using Kaplan-Meier method (log-rank test). A value of P < 0.05 was considered statistically significant.", "This study was carried out in accordance with the recommendations of the \"Chinese national guidelines for the Care and Use of Laboratory Animals\" and the protocol was approved by \"the Institutional Animal Care and Use Committee of Guangdong Provincial Academy of Chinese Medical Sciences. \" aUThOr cOnTriBUTiOns FQ designed and performed experiments; HL and C-LL conducted partial experiments; GN provided idea and edited the manuscript; and ZD designed experiments and wrote the paper. " ] },{ "paper_id": "04be45dba1c24d640d5da8298c5f01e3165d84c4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Between 1980 and 2008, the number of people with type 2 diabetes (T2D) worldwide increased from approximately 150 million to 350 million 1 . According to the World Health Organization, the global economic burden of T2D is tremendous, consuming 2.5-15% of countries' primary healthcare budgets 2 . Till now, the use of oral antidiabetic drugs (OADs) remains the preferred pharmacological therapy due to many patients' fear of insulin administration and its adverse effects, such as hypoglycemia and weight gain 3,4 .", "Several classes of OAD are available on the market, including biguanide (metformin), sulfonylureas, alpha-glucosidase inhibitors, meglitinides, thiazolidinediones (TZDs), dipeptidyl peptidase-4 (DPP-4) inhibitors, and newer sodium-glucose cotransporter 2 (SGLT2) inhibitors. In addition to mediating", "Statistical analysis. The baseline demographic characteristics of the cohort were analyzed using descriptive statistics. We conducted conditional logistic regression with adjustment for potential confounding factors, including OAD use, insulin use, and all other predefined comorbidities associated with the risk of sepsis (Table 1) . ORs were computed to compare OAD exposure of cases and controls. The Microsoft SQL Server 2012 (Microsoft Corp., Redmond, Washington, USA) was used for data linkage, processing, and sampling. All analyses were performed using STATA statistical software (version 13.0; StataCorp., College Station, Texas, USA). Statistical significance was defined as P < 0.05." ] },{ "paper_id": "04c1c40f4464bc035e57d0ecf2f8a033e4e7f466", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Abbreviations LRTI: Lower Respiratory Tract Infection; RSV: Respiratory Syncytial Virus.", "Competing interests YS has no competing interests or conflicts of interest to disclose." ] },{ "paper_id": "04c221e49d8355ce52360d5e37dc583f6502cc92", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Porcine mycoplasmas medium, Middlebrook 7H9 broth base medium, Mycoplasma gallisepticum medium and Yeast Peptone Dextrose (YPD) medium were purchased from Qingdao Hope Bio-Technology Co., Ltd (Qingdao, Shandong, China). 1640 medium and horse serum were bought from Gibco (GrandIsland, NY, USA). DMEM (Hyclone, Beijing, China) supplemented with 10 % or 2 % heat-inactivated fetal calf serum (FCS; Hyclone, USA), 100 IU/ml penicillin G and 100 \u03bcg/mL streptomycin was used for cell growth or maintenance medium. A 0.25 % trypsin (Hyclone, Beijing, China) was prepared in pH 7.2 phosphate buffer saline (PBS). A 0.5 % 3-(4,5-dimethyithiazol-2-yl)-2,5-diphenyltetrazolium bromide (Biosharp, Hefei, Anhui, China) was prepared in PBS. These solutions were sterilized through a 0.22 \u03bcm Millipore membrane filter. Dimethyl sulfoxide (DMSO) was purchased from Sigma (St Louis, MO, USA).", "Extraction Kit were the products of TIANGEN biotech Co., Ltd (Beijing, China). Trizol Regent was purchased from Ambion (Shanghai, China). All other chemicals and reagents commercially available were of the highest analytical grade.", "pMD18-T vector, M-MLV Rtase, Rnasin, Trans1-T1 competent cell, SYBR Premix Ex TaqTM II (Tli RNaseH Plus) were purchased from TaKaRa (Dalian, Liaoning, China).", "To determine the reproducibility of the real-time PCR, the standard plasmid was diluted to 3.74 \u00d7 10 4 , 3.74 \u00d7 10 5 and 3.74 \u00d7 10 6 copies/\u03bcL respectively in DEPC treated water. To evaluate intra-assay variability, each dilution was analyzed in triplicate. To measure inter-assay variability, each dilution was analyzed in three different runs performed by two different operators on different days. Coefficients of variation for cycle threshold (Ct) values within each block and among blocks (using the mean values from each block) were determined." ] },{ "paper_id": "04c80346278c76be38e11fba9ee1a0fccc13c57f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All data are expressed as mean \u00b1 standard error. Differences between the two groups were analyzed using the Mann-Whitney U test, Wilcoxon's test, and the Fisher's exact test. Differences were judged significant for p <0.05 (two-tailed). Adjusted odds ratios were calculated using logistic regression analysis. All statistical analyses were conducted using JMP Version 6 (SAS Institute, Cary, NC, USA). The level of statistical significance was defined as 0.05." ] },{ "paper_id": "04cf308cfa2f72131ecbb07bacb894bab15aa66e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Rift Valley fever (RVF) is a disease of major public health and economic concern, affecting humans and livestock throughout Africa [1] [2] [3] [4] [5] [6] and the Arabian Peninsula [7] . The etiological agent of this zoonosis, Rift Valley fever virus (RVFV), is an arbovirus belonging to the Phlebovirus genus in the family Bunyaviridae. RVFV infection is severe in animals, especially sheep, cattle, and goats, resulting in high mortality rates in newborns and near 100% abortion rates in pregnant animals. In humans, infection is usually self-limiting, but a small percent of cases (1-2%) can progress to severe hepatitis with hemorrhagic manifestations. In addition, retinal inflammation can lead to permanent vision loss in about 1-10% of infected patients [6] .", "Design of membrane-interacting peptides RVFV Gc amino acid sequence was analyzed to identify regions of the predicted protein having a positive Wimley-White interfacial hydrophobicity score (WWIHS), indicating a potential to interact with lipid bilayers [25] . Five non-transmembrane domain regions within RVFV Gc were found with significant WWIHS values, and peptides analogous to these five regions were synthesized (RVFV-1, -2, -3, -4, -5; Table 1 ).", "To rule out the possibility that the decreased virus infectivity was due to peptide toxicity on the Vero E6 cells, we performed a MTT toxicity assay as described in Materials and Methods. Neither RVFV-6 nor RVFV-6sc reduced Vero E6 cell viability at peptide concentrations up to 50 mM ( Figure 2D )." ] },{ "paper_id": "04d02a37dcbb17916d2a5c03288cb9b59000ebba", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "04d638b3c1d8b8fcd771e569e439b364d4ac2c1a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(0) Comments agreements between both methods [mean (range): 0.91 (0.83-1.00)] were found for 10/15 viral agents.", "No competing interests were disclosed." ] },{ "paper_id": "04d774680876efd10e478ed5f2ef7a7a2e860acf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "An Observational, Analytical, Cross-Sectional Study Was Performed.", "Genotype determination was performed on 55 samples (64%). Sequenced viruses in RSV-A clustered with reference viruses in genotypes GA2 (n = 6) and ON (n = 17) (Supplementary Figure S1 ). All RSV-B viruses clustered with reference viruses in genotype BA (n = 32), as shown in Supplementary Figure S2 . We found no difference in disease severity between GA2, ON, and BA genotype ( Figure 1C ", "This FONCECYT study N \u2022 11121536 was approved by the Local Ethics Committee of the North Metropolitan Health Service (25 October 2012) and the Faculty of Medicine, Universidad de Chile (28 June 2012). Informed consent was signed by the parents of all study participants." ] },{ "paper_id": "04d9df812fd77e1231263d42ab45e570cd94d956", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A protocol for the systematic review was written a priori.", "Grey literature (literature that is not commercially published) was identified by searching the websites of health technology assessment and related agencies, professional associations, and other specialized databases. Google and other Internet search engines were used to search for additional information. These searches were supplemented by hand searching the bibliographies and abstracts of key papers, and through contacts with appropriate experts and agencies.", "The search included all languages and was limited to articles published between Jan 1, 1990 and Oct 22, 2010. Conference abstracts were excluded from the search results. Regular alerts were established on EMBASE, MEDLINE, CINAHL and PubMed, and information retrieved via alerts was current to Jan 15, 2011." ] },{ "paper_id": "04dc7b970967766934f12292c0a007ebabe22652", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The study was approved by the local ethics committee and carried out in accordance with the Declaration of Helsinki. The parents provided written informed consent to publish the report and the picture appearing in Figure 1 .", "KG first drafted the manuscript. CS and UF contributed to WES analysis. AB, FB, FS, GK, and RM cared for the child. JD-D and DW performed cytogenetic analysis. AB cared for the child and critically revised the manuscript for important intellectual content. MK cared for the child, designed, and supervised the project and critically reviewed and revised the manuscript for important intellectual content. All authors approved the final manuscript as submitted.", "The authors thank their patients and their family." ] },{ "paper_id": "04e314a46a06814267d29c2e6dfc00bf4121cc94", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. ", "Another group of investigators proposed a mechanistic model for this pathway [56] . Receptor interacting protein kinase-3 (RIP3), which is an essential kinase for necroptotic cell death signaling, was identified by high-throughput siRNA screening as a positive regulator of CVB3 replication [56] . Depletion of RIP3 diminishes CVB3 propagation by inhibiting autophagosome formation before it is fused to the lysosome. Interestingly, in the later stage of infection, the viral protease 3Cpro targets RIP3 and abrogates RIP3-mediated necrotic signaling [56] . These results suggest that autophagy induction, which could be beneficial for viruses, is a temporal event and that this system is targeted by viral proteases during the later stage of infection in order to prevent cell death.", "Recently, reticulon (RTN) family proteins were identified as host factors that interact with NS4B of HCV and negatively regulate HCV genome replication [34] . Reticulons are a highly conserved eukaryotic family of proteins that contain two short hairpin transmembrane domains (TMDs) that predominantly occupy the membrane bilayer outer leaflet [35] . Since the short hairpin TMDs of reticulon are able to expand the area of the cytoplasmic outer leaflet relative to the luminal inner leaflet of the bilayer, they generate positive membrane curvature, which is an architectural feature seen in ER tubules [35] . In mammalian cells, the reticulon family of proteins consists of four members, RTN1-RTN4, but the functional differences among the four members are currently poorly understood.", "In this review, we introduce results from recent studies that focused on ER function and viral replication organelle formation in the cells infected with flaviviruses. In addition, we discuss other ssRNA(+) viruses that are considered to replicate in similar ways to flaviviruses, focusing on the role of host factors in the process of conventional organelle biogenesis." ] },{ "paper_id": "04ed44ad0aed30771e1ba0f38e4aa00101d1b8c3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data availability. Primary data that support the findings of this study are available from the corresponding author on request.", "Here, we show that polyvalent inactivated HRV vaccines generate broad nAb responses in a BALB/c mouse model (up to 25-valent) as well as a rhesus macaque (RM) model (up to 50-valent). Immunogenicity of polyvalent inactivated HRV vaccines is not affected by increasing valency, and it relates to antigen dose. A highly polyvalent strategy may facilitate practical HRV vaccine development.", "In this study, we demonstrate that polyvalent inactivated HRV vaccine expanded to a 50-valent composition, with alum adjuvant, is immunogenic against approximately one-third of circulating HRV types. Although fifty HRV types is a minority, these data provide proof of principle for a highly polyvalent vaccine approach. Forty years ago, the prospects for a polyvalent HRV vaccine were dour for good reasons 17 . However, progress in technology 34 and advancement of more complex vaccines renders impediments to a polyvalent HRV vaccine manageable. Scale-up of HRV vaccines may be facilitated by related vaccine production processes and new cost-saving manufacturing technologies [35] [36] [37] . Inactivated HRV has a positive history of clinical efficacy 6, 8, 9 .", "Vaccination. Before immunization, all HRV types were inactivated by addition of 0.025% formalin followed by incubation with stirring for 72 h at 37\u00b0C, as previously described for HRV vaccine 33 . Complete inactivation of infectivity was confirmed by end point TCID 50 titration in H1-HeLa cells. Formalin inactivation by this method resulted in greater immunogenicity in mice than alternative inactivation by b-propiolactone, suggesting formalin inactivation preserved antigenic determinants. Mice were vaccinated i.m. with inactivated HRV strains mixed with 100 mg of Alhydrogel adjuvant 2% (aluminium hydroxide wet gel suspension, alum; Sigma catalog A8222 or Invivogen catalog vac-alu) according to instructions of the manufacturers. The total volume per mouse was 100 ml, administered in 50 ml per thigh. Mice were given a second identical vaccination (boost) at the time indicated in figure legends. RMs were vaccinated i.m. with inactivated HRV strains mixed with 500 mg of Alhydrogel adjuvant 2%. The total volume per RM was 1 ml, administered in one leg. RMs were boosted with an identical vaccination at four weeks." ] },{ "paper_id": "04f4cff6c1a32e0edb50bdb8daf00f82708a5142", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Despite the important reduction in reported malaria incidence during the last decade in a number of countries worldwide, malaria infection still represents one of the major global public health threats. The World Health Organization (WHO) estimated an annual global burden of 207 million malaria cases and 627,000 deaths in 2012 [1] .", "Spectra of peptides were recorded on a JASCO J-810 spectrometer (JASCO corporation, Tokyo, Japan) equipped with a temperature controller and a 0.1 cm path length cuvette. The measurements were made in water at pH 7.3 and 22uC and at a peptide concentration of 0.15 mg/mL.", "Circular dichroism (CD) studies of 16 randomly selected peptides indicate that they assume a total or partial a-helical conformation in water. Peptides 40-43, 55, 60 and 65 exhibit a CD pattern characteristic of a high a-helical content as indicate for PvPep40 ( Figure 1A " ] },{ "paper_id": "04fa24d6f02d6b2fd44a0cb7aa2a7e7149e6cacc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Based on the fact that SA is HA receptor, SA-based inhibitors can be exploited as potential anti-HA agents. Because one influenza virion usually contains about 350-400 HA trimers on its surface [9] , monovalent SA analogs ( Figure 3 ) would be unable to compete with the highly multivalent interactions between viruses and their host cells. Therefore, inhibitors of the bivalent, tetravalent and even polyvalent sialosides afford an enhanced inhibitory activity over monovalent ligands [20] . The polyvalent sialosides show high potency in vitro [20] . It is currently acknowledged that recognition of \u03b1-2,6 SAs is indispensable for the influenza viruses to gain their efficient transmissibility in human.", "Russia approved an anti-influenza drug, Arbidol, in 1993, which acted by increasing influenza virus HA stability and preventing low pH-induced HA transition to its fusogenic state [53] . However, this potent broad-spectrum antiviral drug is only well-known in Russia and China. A recent study exploiting the characteristics of arbidol-resistant mutants of influenza virus has confirmed its inhibitory mechanism [54] .", "Most of the founded small molecules are more potent in inhibiting group 1 IAV than group 2 IAVs. Vanderlinden et al. reported a new series of N-(1-thia-4-azaspiro [4.5] decan-4-yl)carboxamide inhibitors which show marked antiviral activity against group 2 influenza A/H3N2 viruses [68] . The lead compound 4c has an IC50 of 9.6 \u03bcM and a selectivity index of 10. This compound has specific activity against the H3 subtype, but not the H1, H5 and H7 subtypes.", "Chloroquine is an inexpensive and widely available anti-malaria drug. Recently, in vitro assays suggest that chloroquine may have utility in the treatment of several viral infections including influenza. Vigerust et al. tested the in vivo effectiveness in ferret models. The results showed that clinical signs and viral replication in the nose of ferrets were not altered by treatment [66] . Just recently, a finished randomised, double-blind, placebo controlled trial showed that chloroquine does not prevent infection with influenza [67] . More cases in the chloroquine group are found catching laboratory-confirmed influenza infection, although generally well tolerated by a healthy community population. This dampens the enthusiasm for potential utility of the drug for humans with influenza." ] },{ "paper_id": "050e73f86cfa4ab3f3fc84b0cb55ac779fb9abc2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Histopathological changes were not observed in respiratory nasal epithelium or muscles of the upper rear limb.", "C6/36 cells (Aedes albopictus mosquito larvae) were maintained in Earle's MEM supplemented with 10% fetal bovine serum (HyClone), 2 mM L-glutamine (Invitrogen), and 1 mM non-essential amino acids. Vero cells (African green monkey kidney) were maintained in Opti-PRO\u2122SFM medium (Invitrogen) supplemented with 4 mM L-glutamine (Invitrogen)." ] },{ "paper_id": "0511ed1c3e91902ab662c81f8fc20c83a840e8d0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Written informed consent was obtained from the study participants. This study was reviewed and approved by the Singapore military's Joint Medical Committee for Research, and the National University of Singapore's ethics review committee. ", "Abbreviations FRI: Febrile respiratory illness; AOR: Adjusted odds ratio; CI: Confidence interval; SAF: Singapore Armed Forces; MVI: Mono-viral infection.", "Smoking has been shown to increase risk of upper respiratory infection among recruits [36] , Hajj medical mission personnel [59] , infants and children exposed to parental smoking [60] . Hence, it is not surprising to observe smoking as a risk factor of FRI in our study. There are some studies that had shown that cigarette smoking impairs oral and respiratory tract immunity [61] [62] [63] . This may have predispose smokers to a higher chance of viral infection resulting in FRI. However, further study is warranted to investigate mechanism behind this observation." ] },{ "paper_id": "05186884eb6aed574507e7f0f9316375ffbc6494", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05192151667b1bb4e3405de11f6e4ae2f844e7c5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Genus ", "Length of nucleotides 29,727 30,119", "Antigenic components inducing the immune system without introducing viral particles, whole or otherwise." ] },{ "paper_id": "051cf89045450e5eff3fc9ba4fdc518fe1d623b8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05252b1035b0647c566b72ef0ef269f3fc385c90", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05257a2230897ea006b3f68dbf0d71e1e7216f55", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Each year about 200-250 autologous and 100-120 allogeneic transplantations are performed. The majority of allogeneic transplant patients receive peripheral blood stem cells after a reduced conditioning regimen.", "The Heidelberg University Hospital is a tertiary referral center. The department of hematology comprises four inpatient wards for adult patients-two wards for normal and high-dose chemotherapy, one intermediate care unit and one transplant unit-as well as several outpatient clinics and a day hospital where chemotherapy on an outpatient basis is administered. Most of the patients treated suffer from malignant lymphoma, multiple myeloma, and acute leukemia.", "We used Stata version 11 (Stata Corp., College Station, TX, USA) for all statistical analyses. Fisher's exact test was applied for univariate analyses, logistic regression models were used for multivariate analyses." ] },{ "paper_id": "0529ed2074b15413b032e82de1fcce37efde51a2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The Dunnett's test was conducted by using GraphPad Prism v4.0. Data are presented as means \u00b1 S.D, and P < 0.05 were calculated by using Student's t-test and considered as significant differences as described .", "Electronic supplementary material The online version of this article (" ] },{ "paper_id": "052a16d442ede77ed4bdeaa05037270f251dedc4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "An analysis of variance and Student's t-test were used to evaluate potential differences among the different groups with regard to the humoral immune responses, viral burdens, and body weights. Differences between groups were considered significant at P < 0.05.", "Six-week-old BALB/c female mice were purchased from Southern Medicine University, Guangzhou, China, and were housed, fed in microisolator units according to the Veterinary guidelines of South China Agricultural University and all animal experiments were approved by the South China Agricultural University Institutional Animal Care and Use Committee.", "The hemagglutination inhibition (HI) assay and virus neutralization (VN) assay were performed as described previously [23] ." ] },{ "paper_id": "0537823ee7ac420f3f6e1a1261afa425dd4cd1a6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Porcine deltacoronavirus (PDCoV) strain CHN-GD16-03 and swine acute diarrhea syndrome coronavirus (SADS-CoV) were provided by Professor Jing-Yun Ma, who works at the College of Animal Science, South China Agricultural University, Guangzhou, China. Porcine reproductive respiratory syndrome virus (PRRSV) strain JXA1 was purchased from China Animal Disease Control Center, Beijing, China. Pseudorabies virus (PRV) strain HB-98, classical swine fever virus (CSFV) strain C attenuate vaccine, porcine circovirus type 2 (PCV2) killed vaccine, transmissible gastroenteritis virus of swine (TGEV) attenuate vaccine, porcine epidemic diarrhea virus (PEDV) CV777 attenuate vaccine, porcine rotavirus (RV) NX attenuate vaccine, porcine parvovirus (PPV) CP-99 killed vaccine, and pig foot-and-mouth disease virus (FMDV) killed vaccine were purchased from commercial vaccine companies. Swine influenza virus (SIV) was isolated and preserved in our laboratory.", "The data used to support the findings of this study are available from the corresponding author upon request.", "Coronaviruses (CoVs) belong to the family Coronaviridae; they can infect a variety of hosts and cause various illnesses, including respiratory infections and enteric diseases [1] [2] [3] [4] [5] . Based on phylogenetic analysis, we can classify CoVs into four major genera: alpha-CoV, beta-CoV, gamma-CoV, and delta-CoV [5, 6] . Porcine deltacoronavirus, which belongs to delta-CoV, was first reported in an epidemiology investigation in Hong Kong [5] . Thereafter, PDCoV was detected and isolated across the world [7] [8] [9] [10] [11] [12] [13] . The PDCoV genome is approximately 25-kb long, containing a 5 \u8020 untranslated coding region (UTR), replication-associated genes (1a, 1b), a spike (s) gene, an envelope (e) gene, a matrix (m) gene, a nucleocapsid (n) gene, two nonstructural genes (ns6, ns7), and a 3 \u8020 UTR gene." ] },{ "paper_id": "0539cdf9c5215f7d1f53d1cb7af556ba1f799937", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The special phi29 DNA polymerase and polymerase chain reaction (PCR) reagents were obtained from TakaRa Company. T4 DNA ligase was purchased from New England Biolabs. 3`-Amino-modified fluorescence probes and other oligonucleotides used in this study were synthesized by Shanghai Invitrogen Inc. (China). 3-Aminopropyltriethoxysilane (APTES, 99% ) was purchased from Aldrich. Microscope slides (DAKO, Catalog no.S3003) were used as PCR reaction containers. The instruments used in this experiment were: PCR thermocycler (PTC-200, MJ Research), real-time PCR (Peltier thermal cycler, Eastwin), microarray scanner (LS-300, Tecan), and microarray spotter (PRXSYS 5500, Cartesian)", "Molecules 2010, 15 620" ] },{ "paper_id": "053aa0c7280e2bb41a033cb0ae7c0d6bd07afc40", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The source and genotypes of yeast strains used in this study are listed in Table 1 . E. coli strain used was DH5\u03b1 (Bethesda Research Laboratories). Yeast transformation (38) , media and genetic procedures have been described previously (39) .", "For the overexpression of the Lys-tRNA encoded by the tK(UUU)L gene, we first introduced SphI and NheI restriction sites to plasmids pMB38-9mer (FF and WT) carrying the 'CUU-AAA-C' sequence by PCR oligonucleotide directed mutagenesis. Oligonucleotides used were 5 -GGTGTCGGGGCGCATGCATGACCCAGTCAC-3 and 5 -AGAGTGCACCATATGCGGTGTGAGCT AGCGCACAGATGCG-3 . The tK(UUU)L gene was amplified from strain UMY2067 by using oligonucleotides 5 AAAAGCATGCCGGTAGAGTCTCTT-CTTGGTC-3 and 5 AAAAGCTAGCCGGTA-AGAGAGAAACCTCCA-3 and cloned between SphI and NheI sites of these plasmids.", "Supplementary Data are available at NAR Online." ] },{ "paper_id": "0542a6ae26f57a5ffa35dcfebdec5004ff45688c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Of note, Ortiz and colleagues raised the concern that there is a lack of clinical studies in the setting of a public health emergency [such as the A(H1N1)pdm09 pandemic] to inform clinical care, particularly in low-resource settings [44] .", "By utilizing an already existing clinical study infrastructure through the INSIGHT network, we were able to rapidly develop a system for studying the emergence of a novel influenza A virus and clinical outcomes of infection in an international setting. We have maintained this system to continue observational cohort studies to assess clinical outcomes of seasonal influenza across diverse geographic areas and patient populations, and to serve as a platform for treatment studies. Further, the INSIGHT FLU network is currently being adapted to include other emerging respiratory viruses of global public health importance [e.g. MERS-CoV, avian influenza A(H7N9) virus]." ] },{ "paper_id": "05445d95af0648219e8eb051ab3015b2a4615027", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "P-values and 95% CIs were constructed using 2-tailed tests. Pvalues ,0.05 were considered statistically significant. Statistical analyses were performed using R, version 3.0.2 [34] ." ] },{ "paper_id": "054e3e247ad11de2be71be7215e30a44222271ab", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nonetheless, such an oligomerization behavior may be relevant to RNP packaging.", "The solution structure (PDB ID: 2JW8) and crystal structure (PDB ID: 2CJB) of the CTD spanning residues 248-365 were obtained from the Protein Data Bank (www.rcsb.org). All structure images were prepared with PyMOL (www.pymol.org).", "Disulfide trapping samples were boiled for 2 min at 94uC in the presence and absence of b-mercaptoethanol. The boiling time was kept short (2 min) to avoid protein aggregation. The samples were then loaded on a NuPage 4-12% Bis-Tris gel (Invitrogen, CA) and run at room temperature according to manufacturer's instructions. The gel was digitized on a UVP BioDoc-It equipped with a fluorescent plate (UVP, CA). Quantification of the disulfide-linked and unlinked bands was achieved through the ImageJ software (National Institutes of Health, MA)." ] },{ "paper_id": "05513568bb7b58bb7df33023160838ac885a6144", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05513da119ba8f48c1c468a8a40a591b731c4479", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We obtained written informed consent from all study participants. If these were less than 18 years of age we asked their parents or legal guardians to provide proxy written consent, with additional written consent from those participants aged 14 to 18 years of age. Children were defined as persons aged less than 14 years, adults were at least 14 years old.", "In general, we believe that our data for adherence and tolerability would support a recommendation to use non-pharmaceutical interventions in a pandemic." ] },{ "paper_id": "055bc4fbdbbe262da7684e89ea4cfcc154a42291", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Peptides were obtained from Bio-Synthesis (Lewisville, TX, USA) and included M 133-147 (GTVYVRPIIEDYHT), MOG (MEVGWYRSPFSRVVHLYRNGK), and MBP 60-80 (SHHAARTTHYGSLPQKSQR)." ] },{ "paper_id": "055df119df20e08c2830c0b300173e343a760d38", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "\u2022 All those (dead or alive) presenting with fever and any three of the following symptoms: ", "Further research is needed to understand why the likelihood of death is different for different age groups and to investigate the effect of the different routes of transmission of the virus on interventions such as vaccination.", "When calculating the proportion of confirmed and probable cases that presented with EVD symptoms, we assumed that patients for whom the presence or absence of at least one symptom was reported did not display any additional symptoms unless those were also reported." ] },{ "paper_id": "055ed1f10bcc96eacefe967b946a0b8c1674e197", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Vero cells were maintained in minimal essential medium (GIBCO, USA) supplemented with 5% heat-inactived Fetal Bovine Serum and antibiotics in 5% CO 2 at 37\u00b0C. These cells were used for multiplication and titration of the virus.", "Data are shown as mean \u00b1 SEM. The Kaplan-Meier test was employed to compare survival rates. One-way ANOVA with Tukey's correction was used for multiple comparisons. Statistical significance was set at p < 0.05.", "The supernatants of brain extraction, at a 1:3 dilution in the 1% BSA in PBS, were assayed in an ELISA set-up using commercially available antibodies and the concentrations according to procedures supplied by manufacturer (R&D Systems, Minneapolis, MN and Pharmingen, USA)." ] },{ "paper_id": "05620ea699e7dcf77f750bbb52911ea18b005d8f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05774f9508a8c3399ffb20e758f933ffadc40fbd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The closer the value of Levenshstein distance to zero, the closer are the species names.", "To share the information beyond our MySQL (v5.6.33) DBMS (Database Management System), we built a website using HTML, CSS, JavaScript and PHP (v5. 6 ", "No potential conflicts of interest were disclosed.", "Here, 'x' and 'y' are 2 strings and d(x,y) is the distance between 'x' and 'y' put as minimal cost of operations to transform 'x' to 'y'. The complexity of the algorithm is O(m \u00c3 n), where n and m are the lengths of 2 strings. 83 We used Perl extension for approximate matching (Search.cpan. org, (2016). String-Approx-3.27. Retrieved from: http://search.cpan.org/ CPAN/authors/id/J/JH/JHI/String-Approx-3.27.tar.gz)", "The 'Search' menu allows the user to look in the database for a specific protein or virus order, family, subfamily, genus, species or common name. Uniprot identifiers can also be used in the search function." ] },{ "paper_id": "0577bfc182ea9062ae7d4e4c419a84777b734a4c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The primary outcome was in-hospital mortality. The secondary outcomes were the length of stay in the intensive care unit (ICU) and total length of hospitalization.", "We defined ARDS according to the Berlin definition in 2012 [13, 14] .", "Pneumonia was diagnosed as an acute illness with fever, cough, or dyspnea/tachypnea, and at least one new focal chest sign that was supported by a finding of lung shadowing on a chest radiograph and without other noninfectious causes." ] },{ "paper_id": "057a931d8bfabff534eddd75a96af84a1b6b3deb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "https://doi.org/10.1371/journal.ppat.1007836.g004" ] },{ "paper_id": "0586c9a5cbb333e62fb7e18d5239eae3be34d42a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The potential N-glycosylation sites were predicted within the S1, E, M, and N proteins. The analysis was performed using NetNGlyc server 1.0 software available at http://www.cbs.dtu.dk/services/ NetNGlyc [38] .", "Aligned nucleotide sequences of S1, E, M, and N genes were subjected to the Recombination Detection Program (RDP 4 Version 4.95) to detect potential recombination events by seven algorithms (RDP, GENECONV, Bootscan, MaxChi, Chimera, SiScan and 3Seq) in RDP 4.95 [4] . The detection of recombination breakpoints by at least four of these methods were considered as confirmation of any putative recombination event. The potential recombination events and breakpoints were further verified by similarity plots (SimPlots) analysis in SimPlot version 3.5.1 [7, 14] .", "HPD, highest probability density.", "Infectious bronchitis (IB) is one of the major viral diseases affecting the poultry industry globally. The causative agent avian infectious bronchitis virus (IBV) is a member of the genus Gammacoronaviruses, subfamily Coronavirinae, family Coronaviridae and is prone to mutate. There are multiple genotypes and serotypes of IBV isolates identified worldwide and limited cross-protection confers between serotypes of IBVs [1] [2] [3] [4] [5] [6] , which poses great challenge to the control of IB by vaccination." ] },{ "paper_id": "058b0cc7cecd43d80ed47196cb5376fa10efb58a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Competing Interests: The authors have the following interests. Edward Sumner and Colin Fink are employed by Micropathology Ltd. There are no patents, products in development or marketed products to declare. This does not alter the authors' adherence to all the PLOS ONE policies on sharing data and materials, as detailed online in the guide for authors.", "Multiple viruses are often detected in children with respiratory infection but the significance of co-infection in pathogenesis, severity and outcome is unclear.", "Several studies had shown that viruses can be found in children with no respiratory infections [6, 35] , and further research is needed to understand the natural history of respiratory viral carriage and infection. However, our findings were consistent in both independent cohorts very different between them, so this makes the outcomes more robust.", "All investigators were trained in the study protocol for patient recruitment, sample processing and sample storage. The study was performed according to Good Clinical Practice. Written informed consent was obtained from a parent or legal guardian for each subject before study inclusion. " ] },{ "paper_id": "058c0fc94ded8fa4e7a302081c3ea738d16a4b1a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Where \u03c9 is a weighting factor (default \u03c9 = 0.1). ", "Antifreeze proteins (AFPs) are functional proteins in a cell. With special antifreeze activity, AFPs make the organisms less sensitive to cold temperatures. AFPs bind to small ice crystals to inhibit growth and recrystallization of ice that would otherwise be fatal [1] . By contributing to both freeze resistance and freeze tolerance, AFPs have helped to increase species diversity in some of the harshest and most inhospitable environments. Freeze resistance involves the inactivation or removal of ice-nucleating agents in freeze-avoiding species, whereas freeze tolerance involves the activation or synthesis of ice-nucleating agents in winter in freeze-tolerant species [2, 3] .", "PROTEIN A R N \u2237 V T -4 -1 0 \u2237 0 V -1 -3 -3 \u2237 4 V 0 -3 -3 \u2237 4 F -2 -3 -3 \u2237 -1 C 0 -4 -3 \u2237 -1 G 0 -3 0 \u2237 -3 K -1 5 0 \u2237 -3 L -2 -3 -4 \u2237 -1 S 1 -1 1 \u2237 -2 G -1 -3 0 \u2237 -3 K -1 2 0 \u2237 -3 P -1 -2 -2 \u2237 -3 \u2237 \u2237 \u2237 \u2237 \u2237 \u2237 R -2 6 -1 \u2237 -3" ] },{ "paper_id": "058f046fec5eee31c9ed0bdacd37aa22ba485993", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The drugs that have been tested in humans included Interferon (alpha and beta), antiviral nucleoside analogues (Ribavirin), serine protease inhibitors (Camostat), immunosuppressant (cyclosporine, mycophenolate mofetil), monoclonal antibodies, and broad-spectrum antivirals (Nitazoxanide) [14] . In one study, multiple regimens were tested including mycophenolate mofetil, Interferon alpha and beta with or without ribavirin combination, and hydrocortisone [15] . Similarly, the efficacy of Interferon-beta with lopinavir-ritonavir has been the focus of an on-going clinical trial [16] . The most widely tested regimen, however, has been Ribavirin in combination with Interferon. This regimen has been found effective in reducing the virus replication 'in vitro' [17] . It has also modulated the host response and improved the clinical outcome in animal experiments [18] .", "We used the medical records of Buraidah Central Hospital (BCH) in the Al-Qassim region and adopted a retrospective cohort design for this study. BCH is the main centre in the region for the treatment of MERS-CoV infections; patients are referred here from neighbouring secondary hospitals (e.g., King Saud Hospital in Unaizah, Sulaiman Al Habib in Buraidah, and hospitals in ArRass, AlMuthnab, and Bukayriah) and tertiary hospitals (e.g., King Fahad Specialist hospital and Prince Sultan Cancer Centre in Buraidah).", "The Regional Ethical Committee of Al-Qassim and the administration of the BCH approved this study. The ethical committee did not require that we obtain informed consent from the patients since we examined archived medical records, had no direct contact with the patients, and ensured that the data collectors abstracted and recorded the patient data anonymously." ] },{ "paper_id": "05916d82efe1f937ee48f09df4e5d7c6fede83d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Scientific RepoRts | 5:10840 | DOi: 10.1038/srep10840" ] },{ "paper_id": "0596a285261bc529af5a4bea0447bc838f45866f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Levels of data: Epidemiological distribution of disease during outbreaks of viral infection [4, 22] no obvious association with virus infection [2, 9, 32] [132] found, that measles-mumps-rubella vaccination may trigger autoimmunity: neither the prevalence nor the levels of antibodies changed 3 months after vaccination [51] ." ] },{ "paper_id": "0597b458ac250cffe02827f4448a2bfd4e5e05f3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Our research returned 287 English articles and 305 Chinese articles after removing duplicates. After screening the titles and abstracts, 509 of these articles were excluded. The full texts of 83 articles were assessed, amongst which studies were excluded for the following reasons: the control group did not receive steroid therapy (26); reviews (8);", "We used the meta-analysis of observational studies in epidemiology guidelines in the present study [9] .", "non-SNP-related studies (5); basic studies (3); studies without frequencies or effect size results (2); non-steroid-related ONFH studies (2); case reports (2); microRNA-related studies (2); duplicated reports (2); and heredity SONFH study (1) . Ultimately, we included 30 studies that assessed a total of 7553 patients in our meta-analysis (Figure 1 , Table 1 )." ] },{ "paper_id": "0599be2719a0557e53ffb238765c811578a0cc9f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "However, SD RDT did not detect five patients with Ct values of 22-35. Although PCR showed a high performance in diagnosing RSV, it is still limited by its complexity and high cost [30] . Furthermore, upper respiratory infection is common in the winter months, indicating that acute and prior infection with these pathogens cannot be distinguished by PCR [31] .", "Therefore, simple, rapid antigen-detection tests offer potential advantages that are associated with point-of-care testing (POCT) over PCR, and our FICT method can improve the performance of POCT.", "RSV A (strain KUMC-41) and influenza A virus H1N1 (strain KUMC-76) were obtained from the Korea National Research Resource Center." ] },{ "paper_id": "059d5acb8af8bd2bedab06b5dcc0510691fe0f1e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05a3101918abeee449871529fb0b788dd90df479", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "05a52fe28de83b331a2625473d6eabe95af62cc7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Whereas for the P42-segment of IDV (KF425664.1) the forward 5 -ATGCTGAAACTGTGGAAGAATTTTG-3 , reverse 5 -GGTCTTCCATTTATGATTGTCAACAA-3 and probe 5 -FAM-AAGGTTTATGTCCATTGTTTCA-BHQ1-3 were used. A standard curve of the P42-segment of Influenza C or D virus, cloned in pHW2000 plasmid, was included to interpolate the amount of genomic equivalents [30] . Measurements and analysis were performed using an ABI7500 instrument and software package (Applied Biosystems, Foster City, CA, USA).", "The Madin-Darby Bovine Kidney (MDBK) cells were maintained in Eagle's minimum essential medium (EMEM; (Gibco, Gaithersburg, MD, USA) supplemented with 7% heat-inactivated fetal bovine serum (FBS, Gibco), 2 mmol/L Glutamax (Gibco), 100 \u00b5g/mL Streptomycin and 100 IU/mL Penicillin (Gibco). Human rectal tumor 18G (HRT-18G) cells (ATCC, Manassas, VA, USA) were maintained in Dulbecco's minimum essential medium (DMEM; Gibco) supplemented with 5% heat-inactivated FBS, 100 \u00b5g/mL Streptomycin and 100 IU/mL Penicillin (Gibco). Both cell lines were propagated at 37 \u2022 C in a humidified incubator with 5% CO 2 .", "Primary human bronchial cells were isolated from patients (>18 years old) undergoing bronchoscopy or pulmonary resection at the Cantonal Hospital in St. Gallen, Switzerland, in accordance with our ethical approval (EKSG 11/044, EKSG 11/103 and KEK-BE 302/2015). Isolation and culturing of primary human bronchial epithelial cells was performed as previously described [26, 27] , with the minor modification of supplementing the BEGM with 10 \u00b5mol/L Rho associated protein kinase inhibitor (Y-27632, Abcam, Cambridge, UK)." ] },{ "paper_id": "05a94d5f5083ff58320c659cd519536d3e6aa4a3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Three microliter of purified sample virus was adsorbed to a carbon-coated film (200 mesh grids). The grids with adsorbed virus were floated onto a solution of the negative stain (1% solution of uranyl acetate). The film was picked up by a copper EM grid and then air-dried. Specimens were examined under a HITACHI H7650 electron microscope operating at 80 kV and images were further processed using ImageJ software.", "At least in vitro, Ad infects cells by first attaching to primary receptors, including CAR, CD46 and sialic acid, via the fiber protein [22] . In some cells endocytosis of Ad may be triggered by penton base-mediated signaling through alpha(v) integrins [23] [24] [25] .", "siRNAs were purchased as duplexes from EuroGentec (only the reverse strand is shown): Scramble (59-CGCAAUUCGAUGUCCC-GUGdTdT), Nedd4.1 (59-AAACAACCCAGCCAGGCUCdTdA), Nedd4.2 (59-CUGUGACUUUGUGUUGUGGdTdA), were previously described by Segura-Morales et al. (2005) , AIP4/Itch siRNAs (59-UCAUCAUUCUGAGAAGCACdTdT, [54] , and WWP1 siRNA (59-CUUCUACGAUCAUCAACUCdTdT) was previously described by Chen et al. (2005) . The WWP2 siRNA was a Smartpool from Dharmacon." ] },{ "paper_id": "05ab8bd6ff732bea31fa673b450d37b58da78c46", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and overall accuracy ", "Sensitivity, specificity, PPV, NPV, and overall accuracy are shown in Table 8 .", "All samples collected ante-mortem were originally obtained for diagnostic and, in the case of effusion, also for therapeutic purposes." ] },{ "paper_id": "05aeae1608e74b17f7c92bc7661e98742e0b3fb6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Scientific RepoRts | 7:40292 | DOI: 10 .1038/srep40292", "Scientific RepoRts | 7:40292 | DOI: 10.1038/srep40292" ] },{ "paper_id": "05b8deee7f76cda7511eb605e2ba84a8f46bc10f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "CypA is a ubiquitously distributed intracellular protein found in all tissues in mammals, and it possesses peptidyl-prolyl cis-trans isomerase activity [20] . CypA has chaperon-like activity and takes part in protein-folding processes [21] . Further, CypA is the major intracellular receptor for the immunosuppressive drug cyclosporin A (CsA), and the CsA-CypA complex interacts with and inhibits calcineurin, a calcium-calmodulin-activated serine/threonine-specific protein phosphatase [22] , which in turn suppresses T-cell activation. In addition to its intracellular functions, CypA can be secreted into the extracellular environment [23, 24] . Extracellular CypA acts as a growth factor in several cell types. Furthermore, CypA is also involved in the pathogenesis of several diseases, including viral infection, cardiovascular disease and cancer. The extracellular functions of CypA are mediated by CD147, which is expressed on a wide variety of cells, including hematopoietic, epithelial and endothelial cells [25] [26] [27] [28] [29] . CD147 is a widely expressed type I integral membrane protein that is implicated in many physiological and pathological activities. Drugs targeting either CD147 or Cyps demonstrate a significant anti-inflammatory effect in animal models of acute or chronic lung diseases, suggesting a therapeutic pathway for some diseases.", "Accumulating evidence indicates that CypA is an important host factor for successful viral infection. CypA is involved in the lifecycle of several viruses, such as human immunodeficiency virus type 1 (HIV-1), influenza virus, hepatitis C virus (HCV), hepatitis B virus (HBV), vesicular stomatitis virus (VSV), vaccinia virus (VV), severe acute respiratory syndrome coronavirus (SARS-CoV) and Rotavirus (RV) [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] 30, 31] . CypA is also incorporated into several enveloped virus particles, such as HIV-1, influenza virus, VV and VSV [9, 14, 15, 32, 33] . However, the function of CypA in virus particles is still unclear.", "As was reported, CypA is also incorporated into influenza virions [9, 32] . However, the function of virion-associated CypA is still unclear. Recently, we found that the presence of CypA in the virions aids the infectivity of influenza virus particles, and CypA affects the ratio of M1/NP in the influenza virions (unpublished data). These results suggest that CypA may take part in the assembly of influenza virus and the uncoating process of the virus particles ( Figure 1 ). However, how CypA is incorporated into the virions and how CypA assists in the infection of the virion requires further studies. " ] },{ "paper_id": "05ba033423b8fcd8ca26cf0cf1611e128048f9db", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cholera toxin and SV40 can also be internalized via raft microdomains into GPI-anchored protein-enriched endosomes. Mechanisms regulating this internalization pathway are unclear as of yet." ] },{ "paper_id": "05bdc3cf6dad125ad6539580352cb341eeaec2b1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The cell fraction from the BALF were prepared on a slide by cytospin and differential cell counts were performed in a blinded manner, with a total of 300 cells counted per sample.", "All animal use procedures were conducted according to the guideline set by the Canadian Council on Animal Care. The Animal Care Committee at the Hospital for Sick Children, approved all protocols developed for this work. ", "The criteria for assessing mouse lung pathology score. (DOC)", "The mouse lung sections were prepared from the whole lung samples fixed in 4% buffered formaldehyde. The sections were stained with hematoxylin and eosin and the severity of pathological features were assessed according to the criteria described in the Supplementary Material (Table S1 )." ] },{ "paper_id": "05c54da3a4bd3e92c4d0e5286e331e333408c9a9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "Sections of formalin fixed tissue were cut and stained with haematoxylin and eosin, Giemsa and Periodic acid-Schiff stains using standard methods and examined by light microscopy.", "A conventional RT-PCR was run to produce template for in situ hybridisation (ISH) probe production. PCR template was created using conventional PCR primers targeting the gene encoding a putative viral membrane protein (M). Primer details were as follows: BRVMP forward: 5' ATGGAGTCCACCTCGA 3', BRVMP reverse: 5' TTATGGTAGGATG GCTGTT 3'." ] },{ "paper_id": "05ce1f7ae3a2051067e57e5e52f9cdad0e26a187", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "[ 35 S]-cysteine/methionine labeling mix was obtained from New England Nuclear (Massachusetts, USA).", "In vitro protein expression \u03b2TRCP protein was expressed in-vitro using pCDNA-\u03b2TRCP expression construct in a coupled transcriptiontranslation reaction (TNT kit, Promega Corp., Wisconsin, USA) following manufacturers protocol." ] },{ "paper_id": "05da888d78a628666b186a2f0773d8d4839a994e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Poultry pens are made of concrete or dirt floors, chicken-wire or wire mesh for fencing, galvanized metal roof, and tarp, roll-up side curtains for ventilation. Poultry pen bedding material is made out of wood shavings and is changed after each production cycle. Currently, there is no policy that prohibits the use of poultry litter as fertilizer on agricultural fields.", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "Conceptualization: Jorge A. Hernandez. " ] },{ "paper_id": "05e4c2f6b0affdeef1b7d99d5b481bee1c244a7f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Currently, it appears that all age groups can be affected by HBoV, although severe infections and infections requiring hospitalization occur primarily in patients with an underlying disease [76] [77] [78] [79] [80] [81] [82] [83] . Severe clinical cases have been described in children [76, 77] , adults with cancer [76] and other risk groups [84] .", "The seroprevalence of HBoV is strongly dependent on the age of the investigated patient cohort and ranges from ~40% in children between 18 and 23 months of age up to virtually 100% in children older than two years, with an average of 76.6% in children and 96% in adults [55, 56] . The seroprevalence is lowest for HBoV-4 (0.8-5%), followed by HBoV-3 (10-38.7%), HBoV-2 (34-49.3%), and HBoV-1 (66.9-96%) [55, 57] .", "These tools are a prerequisite for the search for answers to open questions, including questions regarding effective antivirals and disinfectants and the molecular pathogenesis of HBoV. These tools will also help to determine whether HBoV is in fact a serious pathogen and not simply part of the harmless microbiome of its hosts.", "It appears likely that HBoV either persists or uses additional or alternative mechanisms of replication, which remains a matter of speculation. An alternative replication model could be a helper virus-dependent initiation of rolling circle replication. In a recent case report (below), we identified herpesvirus 6 co-infection in an HBoVinfected patient. Surprisingly, during cidofovir therapy, HHV-6 viremia decreased, and HBoV was eliminated, even though the patient had an underlying immunodeficiency and could not produce neutralizing antibodies [14] . Considering that herpesviruses are able to initiate rolling circle replication [15] and replication that is characterized by head-to-tail sequences in cis and in trans [16] , and given that another subfamily of parvoviruses, the dependoviruses, replicate exclusively in the presence of helper viruses, such as herpesviruses [17] , this replication model is worth being discussed and investigated further." ] },{ "paper_id": "05e6e7a72d16a7294079af8e96f5d6b42d8ce51f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ethics statement. Written informed consent for using the clinical specimens was obtained from all patients ", "Step 1 (Primary invasive reaction): A target DNA is firstly hybridized with an upstream probe (Up) and a downstream probe (Dp), forming a one-base overlapping structure at the 3\u2032 -end of the Up. The blue arrow indicates the site of cleavage.", "Step 2 (Secondary invasive reaction): The cleaved flaps from the target-specific primary invasive reaction are used to drive a secondary invasive reaction. Then the hairpin probe (Hp) is cleaved by AfuFEN.", "Simultaneous detection of multiple pathogens in one tube is without doubt cost-and time-saving. However, the differentiation of the ladder-like LAMP amplicons derived from multiple targets is still challengeable to date, although previous studies have described several methods for multiplex LAMP detection. These multiplex LAMP methods either used end point analysis, through gel electrophoresis 24 or pyrosequencing 25 , or used real-time detection, through annealing curve analysis 26 , DARQ 27 or MERT-LAMP technique 28 . However, these techniques all require complicated and specialized instrumentations, which diminish the point-of-care testing capability of multiplex LAMP." ] },{ "paper_id": "05e9af5c04c17b89fd8d65d62a381eb22e8316ed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Difference between two categorical values was compared by Student's t-test. Statistical significance was set at < 0.05. The experiments were repeated at least three times.", "HepG2.2.15 cells with integrated full-length HBV genome were kindly provided by Professor Bo Qin (Chongqing Medical University, China), as previously described [17] , and were cultured in Dulbecco's Modified Eagle's Medium (DMEM) (Gibco, USA), supplemented with 10% heat-inactivated fetal bovine serum (Gibco, USA), 100 IU mL \u22121 penicillin (Gibco, USA), 100 IU mL \u22121 streptomycin (Gibco, USA), and 1 mg mL \u22121 G418 (Invitrogen, USA) in 5% CO 2 at 37 \u2218 C.", "Though mature form of ISG15 conjugation to target proteins was shown to be essential for ISG15-dependent antiviral effects, both free ISG15 (intracellular or extracellular) and" ] },{ "paper_id": "05eae269e7bd3b7b841a84c02b1c13a670faf012", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Early passage of HUVEC were obtained from Clonetics, Lonza and maintained in complete EBM-2 culture media (Allendale, NJ). KSHV-infected BCP-1 cells established from the peripheral blood mononuclear cells of a PEL patient [51] were maintained in culture in RPMI1640 containing 10% fetal bovine serum (FBS). Doxycycline-inducible iSLK cells, provided by Dr. Jae Jung at the University of Southern California, were maintained in DMEM supplemented with 10% FBS, 250 mg/ml of G418, 1,200 mg/ml of hygromycin, 1 mg/ml of puromycin, and 1% penicillin-streptomycin solution.", "Ubiquitination has been linked to diverse cellular functions including directing protein recycling [1, 2] . Addition of four or more ubiquitin moieties (polyubiquitination) provides the necessary signal for targeting protein for proteasomal degradation. Ubiquitination of target cell surface membrane proteins triggers its internalization and endocytic sorting in addition to proteasomal degradation. For examples, monoubiquitination, the addition of single ubiquitin moieties, of epidermal growth factor receptor (EGFR) cytoplasmic tail induces its internalization and transport to the lysosome for degradation [3] [4] [5] while ubiquitination of membrane receptors b2 adrenergic receptor and interleukin 2 receptor b chain is required for their correct internalization and processing [6] [7] [8] .", "Secondary antibodies AlexaFluor 568 goat-anti-mouse IgG1 and IgG2a, AlexaFluor 647 goat anti-mouse IgG1, AlexaFluor 488 goat anti-rabbit, and AlexaFluor 568 goat-anti-rat were from Molecular Probes, Invitrogen (Carlsbad, CA). DAPI was from BioChemika Ultra, Sigma." ] },{ "paper_id": "05f1c02ecdb1798e85e750ddfa81ede861f94cf6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Zika virus (ZIKV) was first isolated in monkeys in Uganda in 1947, and then detected in Aedes africanus mosquitoes in 1948. ZIKV belongs to a mosquito-borne flavivirus of the family Flavivirus, which spread from Africa to south-eastern Asia through transmission by Aedes mosquitoes, such as A.", "All data from 3 independent experiments were analyzed using Student's t-tests or \u03c7 2 tests. Statistical significance for each assay was judged at p < 0.05.", "TE671 (human, rhabdomyosarcoma/muscle), SF268 (human brain, glioblastoma/astrocytoma), and ARPE-19 (human, retinal pigmented epithelium) cells were cultured in minimum essential medium containing 10% fetal bovine serum, 2 mM glutamine, 1 mM pyruvate, and 1\u00d7 penicillin-streptomycin at 37 \u2022 C with 5% CO 2 ." ] },{ "paper_id": "05f2d4c337413ae496e31e2259020f3e328dcfa1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Dengue virus (DENV) is a mosquito-transmitted virus that causes mild ((dengue fever (DF)) to severe disease ((dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS)) in humans [1] . DENV consists of four serotypes (DENV1-4) each comprising multiple genotypes and belongs to the genus Flavivirus of the family Flaviviridae [2] .", "Before 1970 DENV outbreaks were reported in nine countries but has since expanded to more than 100 countries, with an estimated 96 million apparent and 294 million unapparent cases in 2010 [3] . Two and a half billion people are at risk of infection worldwide [4] . Since specific treatment or a vaccine are currently not available [5] , early detection plays a key role for initiation of control and preventive measures in dengue endemic regions such as mosquito control and social mobilization [6] ." ] },{ "paper_id": "060201d43460ac305a26ac4b0acca66cd41c151a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "060833389f07819960d34c91e0dfdc92e053f6ac", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Viruses 2015, 7, page-page amino acids could abolish the NendoU activity [32] . Furthermore, the active sites of PRRSV NendoU should be His-129, His-144 and Lys-173 for BJ-4 PRRSV after aligning the sequences of the proteins SARS-CoV nsp15, EAV nsp11 and BJ-4 PRRSV nsp11 [31] .", "Porcine alveolar macrophages (PAMs) from the lavaged lungs of six-week-old PRRSV-negative pigs were kept in a medium of RPMI 1640 plus 10% FBS and 1% penicillin/streptomycin. PRRSV strain BJ-4, as a gift, was kindly obtained from Yang Hanchun of China Agricultural University." ] },{ "paper_id": "06094b031f02c0307da315a1428394c2c075ff2a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nucleotide sequence accession number. The complete genome sequence of the MERS-CoV/KOR/KNIH/002_05_2015 isolate was deposited in GenBank under the accession number KT029139.", "The full genome sequence of a Middle East respiratory syndrome coronavirus (MERS-CoV) was identified from cultured and isolated in Vero cells. The viral genome sequence has high similarity to 53 human MERS-CoVs, ranging from 99.5% to 99.8% at the nucleotide level.", "is the first betacoronavirus lineage C member isolated from humans. It has been assumed that MERS-CoV was transmitted from bats and spread to humans through intermediate hosts (1) . The genome structure is a single-stranded RNA (ssRNA) encoding 10 proteins; two replicase polyproteins (open reading frames [ORFs] 1ab and 1a), three structural proteins (E, N, and M), a surface (spike) glycoprotein (S), and five nonstructural proteins (ORFs 3, 4a, 4b, and 5) (2)." ] },{ "paper_id": "06190bfcbc53a5d5d17e0a60a3a0f6488d8ae1db", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Favipiravir Suppress viral RNA polymerase.", "Immune evasion by the glycoproteins of the Ebola virus: implications on passive immunization and vaccine development", "(2) Favipiravir (T-705; 6-fluoro-3-hydroxy-2pyrazinecarboxamide)", "Additional file 1: Multilingual abstracts in the six official working languages of the United Nations.", "The authors declare that they have no competing interests." ] },{ "paper_id": "061e49a521b8ea0acbd7c3a61360cc8e0b07e3ca", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Sample pretreatments and NA isolation. Prior to nucleic acid (NA) isolation, 100 l of clinical sample was treated with 2 U/l of Turbo DNase (Ambion, Life Technology, Carlsbad, CA, USA) and 0.4 U/l RNase I (Ambion) at 37\u00b0C for 30 min. Viral NA was then isolated from nuclease-treated materials using a QIAamp viral RNA kit (Qiagen GmbH, Hilden, Germany) and was recovered in 50 l of elution buffer.", "SUPPLEMENTAL FILE 1, PDF file, 0.9 MB.", "The " ] },{ "paper_id": "061eb24a1462aba7b53e6c099fe5d4bd046dd56a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "-Cationic porphyrin -Metabolic regulator nitrate assimilation." ] },{ "paper_id": "06249faa885cabbce6eccdf1e40ffe2f43fb5092", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "062a18fe6bcaad19bd60d8b47d3287079a915545", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Objective: The present study aimed to analyze clinical features and factors associated with treatment outcomes of H7N9 influenza A virus infection.", "Overall, few cases of H7 virus transmission to mammals have ever been reported in Asia and N9 virus infections in human have never been documented anywhere in the world [8] except H7N9 [7] . The H7N9 variants currently in circulation most likely evolved through a combination of genes from viruses in Beijing bramblings, Zhejiang ducks, and Korean wild birds according to report by Chinese scientists. Human infections with highly pathogenic H7 viruses generally resulted in conjunctivitis or uncomplicated influenza [3, 8] " ] },{ "paper_id": "062d0779c4b304f4188666a3989152d9f9557340", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Automated image acquisition was performed using an Opera confocal reader (model 5025-Quadruple Excitation High Sensitivity [QEHS], PerkinElmer, Waltham, MA, USA). Images were acquired as 2 exposures using a 10\u00d7 air objective and a bin factor of 1. The first exposure used the 488-nm and 640-nm lasers to excite the viral and cell body fluorophores, respectively, and was directed to the sample with a 405/488/640-nm triple dichroic. The emission light was split by a 580-nm SP dichroic mirror and collected on separate cameras through 562/40-nm and 690/70-nm band-pass filters. The second exposure used the 405-nm and 561-nm lasers to excite the nuclear and Alexa Fluor \u00ae 568 respectively, and was directed to the sample with a 405/561/640-nm triple dichroic.", "Viruses 2012, 4 1866" ] },{ "paper_id": "0638a299934da797243f6f35a516e172a38466a4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "6 Pulmonary Medicine", "In cellular type of NSIP, chronic interstitial inflammatory cells involves alveolar walls, fibrotic form may include more advanced fibrosis. The histology is usually uniform. In AE of NSIP also DAD is present.", "Controlled prospective studies on the treatment of AIP are not available, not surprising since AIP is so uncommon and it is generally a very acute lung manifestation displaying some overlapping features with ARDS. " ] },{ "paper_id": "063f48cf2d9b53b075433f3bd1a63566feb240db", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "If the sample points are presented as a discrete distribution, then the formula is:", "(e) (f)" ] },{ "paper_id": "06485dd45c17460af629f7c74234bef914fbbabe", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This work was supported by grants from the National Natural Science Foundation of China (grant no. 31670899 and 31070796) and the Natural Science Foundation of Chongqing (grant no. CSTC, 2011BB5029).", "JY collecting literatures and drafting manuscript. JW design of the work, collecting literatures, drafting, and revising manuscript. YW discussing literatures, design of the work, and revising manuscript.", "Plasma vRNA, another common agonist for NLRP3, may bind with NLRP3 and act to subsequently activate it. Although NLRP3 contains a nucleotide-binding domain (54), RNA-sensing molecules have been reported to participate in the process by which vRNA activates the NLRP3 inflammasome; these include the DExD/H-box helicase (DHX) family members (14, 41, 55, 56) and the 2\u2032,5\u2032-oligoadenylate synthetase (OAS, or 2-5A)/RNase L system (30) . However, some debate exists as to the exact role of DHX33, in particular, in VSV-induced NLRP3 inflammasome activation (29) ." ] },{ "paper_id": "06525dbe27937be0f8263a0e8ec743f68d9f1795", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following software has been developed by the Global Names team, and is freely available (see globalnames.org)." ] },{ "paper_id": "06589343cb2fcc62a39c587071c8a9e76836f993", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The paper is organised as follows. The next section outlines the research methods. Then the simulation results and analysis are presented, followed by a section that discusses the merits and limitations of our approach. The last section draws conclusions regarding the application of ISTAM and remaining research issues." ] },{ "paper_id": "0660d9281c1607ca1ca9cb62dfa00b56f49ddee1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Stable transformation has its own advantages such as reliable harvest of target proteins over multiple generations and optimized protocols for delivery of foreign genes into various plant species.", "[59] demonstrate the application of the classical Nicotiana benthamiana/A. tumefaciens transient expression system to accelerate the development of a malaria vaccine candidate, with screens for expression, solubility, and stability using fluorescent fusion proteins. In Marin Viegas et al.", "HBV is a hepatotropic DNA virus that replicates by reverse transcription. The human HBV is a small circular DNA molecule of 3.2 kb [2] . Its genome consists of four partially overlapping open reading frames (ORFs), namely the envelope gene (pre-surface/surface (pre-S/S)), the core gene (pre-core/core (pre-C/C)), the polymerase gene (pol) and the transactivating protein X (X). The ORF pre-S/S encodes pre-S1, pre-S2 and surface (S) proteins that form the surface antigen (HBsAg), and HBsAg protein is the main antigen to elicit virus-neutralizing and protective antibodies by the immune system [3, 4] . Understanding the HBV genome and structure is an essential prerequisite for preventive or therapeutic vaccination against HepB." ] },{ "paper_id": "06624de6d8b09e5db9ba01c4cc721583331a40b5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(1). Coinfections may induce more severe inflammation in the arthritic joint during the acute phase of disease, and/or.", "(2). They may prolong the self-limiting phase of the disease, and/or.", "The comprehensive research program outlined here is a prerequisite to understand the clinical implication of chlamydial coinfections in arthritis and SpA, and to develop therapeutic strategies directed against multiple persistently-infecting organisms.", "(3). They may cause relapse of the disease, and/or. (4) . They may support the chronic disease course because one or several of the coinfecting bacteria are not eliminated." ] },{ "paper_id": "066619641442d9c3f6a547301849bef0b8b12f2f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Enhanced communicable disease surveillance in hospital/ workplace environments", "Additional data and comments were collected, using Likert scales and free text responses. On completion of each round, participants' Likert scores were tabulated and free text answers analysed qualitatively, as described. The final stage of analysis during preparation of this report drew on the knowledge and professional experience of the research team, which includes expertise in health social science, bioethics, Australian health law, infectious diseases, microbiological laboratory and data sciences, and health protection. This study was approved by the University of Sydney Human Research Ethics Committee (#2016/819)." ] },{ "paper_id": "0666ca679df1885492aa1420fd995790d363b8a5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following Env clones were obtained from the NIH AIDS Reagent Program, Division of AIDS, NIAID, NIH: Env clones from early infection (QF495. 23M [3, 14, 50 ,51]) were gifts from Dr. Beatrice Hahn. We amplified the Rev-Env cassettes from these by PCR, TA-cloned them into pCR8 (Clontech), and then used Gateway cloning to move them into a gateway converted pCDNA3.1 (Invitrogen) mammalian expression vector. Further description of these Env clones, and those used in the fusion assay screens, are described in S1 Table. Nucleotide changes producing S375Y/W/H and A281V were introduced into BG505.W6M.B1 by site directed mutagenesis using overlapping PCR primers containing the mutation of interest, following standard methods.", "Introduction compatibility with primate CD4 receptors might be dynamic, given that CD4 is highly diverged in its protein sequence at the interaction interface with HIV-1 Env (Fig 1A) .", "https://doi.org/10.1371/journal.pbio.3000304.g006" ] },{ "paper_id": "06753b3e708ad76787b100b9009ccec622f267ae", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nasopharyngeal carcinoma (NPC) is a squamous cell carcinoma rising at the post nasal cavity, which is prevalent in southern China, southeastern Asia, and Taiwan. Worldwide, approximately 80,000 cases of NPC are reported each year, 0.7% of all cancers [1] . In general, the 5-year survival rate of NPC is 60%. When treatment begins at an early stage, the 5-year survival rate can reach 80-95%; however, it is poor at a later stage of NPC [2] . Radiotherapy is the primary and effective treatment for NPC. The combination of radiotherapy with neoadjuvant chemotherapy is another pivotal treatment for NPC patients and increases the survival rate significantly [3] [4] [5] . Although the therapeutic efficiency of NPC management has largely been improved, how to avoid NPC metastasis is still an urgent unmet need. ", "Results" ] },{ "paper_id": "06795e24716acde6e56c25d7845c92a97fa0268c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The second moment is given as:", "Where \u03c1, the redundancy, is define to be equal to N\u03b1", "The standard deviation is then:" ] },{ "paper_id": "06989a9659f1b9b10abc5b92a90ecff38a778d55", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cell culture maintenance and growth conditions African green monkey epithelial kidney cells (Vero E6) obtained from ATCC were maintained in Dulbecco Modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) at 37\u00b0C with 5% CO 2 . Madin-Darby canine kidney (MDCK) cells were routinely maintained in Eagle's Minimum Essential medium (EMEM) supplemented with 10% FBS and incubated at 37\u00b0C with 5% CO 2 .", "Pteropus giganteus field samples were obtained as a diagnostic submission. No live animal work was performed during this study.", "Although work has progressed toward understanding Afipia, it is unclear as to what niche these bacteria inhabit. Previous work has detected Afipia spp. in hospital and drinking water.", "doi:10.1371/journal.pone.0121274.g002 electron micrographs. In general, the overall cell structure and shape matches well with other members of the Afipia species [10, 12, 21, 22] .", "Moreover, it was shown Afipia were able to infect amoebae [24, 31, 32] . These data suggest Afipia may generally survive in water networks as free living organisms. In light of this, case files from acquired human infections suggest Afipia may also be an opportunistic human pathogen [23, 24, 32] . The MvirDB database for A. pteropus identified many genes that may contribute to pathogenesis. Further, like A. felis, intracellular entry is coordinated in a similar fashion to Legionella [9, 10, 22] . Unidentified infections can often mimic many agents as outlined by Lo et al. making treatment very difficult [11, 12] . The expanded use of NGS will continue to aid in the identification and treatment of future infections ultimately providing better surveillance and care. Pure bacterial cultures were grown on TY agar petri plates at 30\u00b0C for 10 days. Images were obtained using an Olympus CKX41 inverted microscope equipped with a DP71 Olympus camera. (TIF) S1 " ] },{ "paper_id": "069a3aebc920d5da476fef73fd5d47566c780885", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For 30 years it was thought the alphavirus 6K gene encoded a single 6 kDa protein.", "arthropod and mammalian host cells. Studies on 6K can now be facilitated by using mutants in the frameshift slip site which do not produce TF. ", "Viruses 2017, 9, 228 2 of 21 As arboviruses, alphaviruses are generally transmitted in the environment via an arthropod vector (typically a mosquito) to vertebrate hosts which can include birds, humans, and other mammals [3] . In the laboratory, alphaviruses can replicate efficiently in small animal models and various host-derived cell lines. Most animals experience a high-morbidity, low-mortality infection, but this varies by alphavirus species. At the cellular level, arthropod host cells typically experience a persistent infection, while vertebrate cells expire after an acute infection [4] ." ] },{ "paper_id": "069b422b624f7d6bb46b8381030550a88a3b30dd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Bats are the source of multiple zoonotic viruses including severe acute respiratory syndrome (SARS) coronavirus [1] , Hendra virus [2] , Nipah virus [3] , and Marburg virus [4] . In fact, evidence suggests that bats host a greater proportion of zoonotic viruses than any other mammalian order [5] , highlighting the importance of identifying novel viruses in bats. Australian pteropid bats are becoming more urbanized and fewer bats are migrating, resulting in a greater chance of contact between bats and humans or domestic animals [6, 7] . This increased potential for exposure of non-reservoir hosts to bat-borne viruses leads to the increased probability of infection spillovers occurring [8, 9] .", "All procedures were approved by the CSIRO Australian Animal Health Laboratory Animal Ethics Committee. Study 1, project number 1814, was approved in August 2016. Study 2, project number 1865, was approved in June 2017.", "AlsPV" ] },{ "paper_id": "069bf4da8f0f4f540b9f6a16021e007442e7e027", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "Ankle and spleen tissues were dissected and homogenized in TRIzol Reagent (Life Technologies) for RNA analysis with a MagNA Lyser (Roche). Viral RNA in tissues was quantified by RT-qPCR as previously described [23] ." ] },{ "paper_id": "069d6ce905dc7992f5bc8692218ca3969ab3e227", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http:// creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.", "Thus, at present, the critical role of IFITM3 in antimicrobial defense appears to be limited to virus infections, though this remains an open question." ] },{ "paper_id": "06ad398fdbe5c8c55aafb34013ff47b35f0cee35", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Timber and plants are estimated to comprise nearly 70% of the known (broadly defined) wildlife global trade value, leaving non-aquaculture fisheries products responsible for 28% and ornamental fish, mammals, herpetofauna and other species responsible for roughly 2% (US $5.27 billion) (Engler and Parry-Jones 2007; Ahlenius 2008) .", "CITES maintains a database of reported trade of CITESlisted species only. The database is managed by the United Nations Environment Programme-World Conservation Management Center (UNEP-WCMC) and currently holds 7 million records of trade involving 50,000 scientific names of taxa listed by CITES. Currently, more than 500,000 trade records are reported annually (http://www.cites.org/eng/re sources/trade.shtml)." ] },{ "paper_id": "06b07a6407734edcb3af57da5fe2898ba61d1df8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Each participant trialed both gowns, using a different gown for the 2 scenarios.", "Overall, this work is part of a broader human factors initiative of introducing a sociotechnical perspective into infection prevention and control. Such models have been described in more detail in other places; however, there is clear benefit from adopting such perspective and analyzing the use of equipment in the specific context of its use [17, 18] ." ] },{ "paper_id": "06b3f93a98def37bdbfa4487060cd836fdf1070d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "06c0371d82953f5c35ee8bff3e5165d5aa1516de", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Paraffin-embedded tissue blocks were cut into 5 mm slices which were mounted on polylysine-charged glass slides. Endogenous peroxidase activity was blocked by exposure to 3.0% H 2 O 2 for 15 min. Antigen retrieval was performed in a citrate buffer ", "The serum FGL2 level from mice infected with or without MHV-3 was detected by using the mouse FGL2 ELISA Kit (Cat: E90512Mu; Uscn Life Science Inc., Wuhan, China) and following the manufacturer's instructions.", "All experiments were approved by and conducted in accordance with the guidelines of the Animal Care and Use Committee of the Third Military Medical University. All efforts were made to minimize animals' suffering." ] },{ "paper_id": "06c172a11ee30931ac537dfb70ce020dced50918", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Paleovirology is the study of ancient viruses.", "Outbreaks of ''new'' viruses are real causes of concern for human and animal health. But where do they come from? The vast majority of emerging viruses in the human population originate from other animals [1] . In fact, when a new virus appears, it is often a virus that already exists in one species, but then becomes established in another. For example, the transmission of a coronavirus (CoV) from bats to palm civets and raccoon dogs and ultimately to humans led to the emergence of severe acute respiratory syndrome (SARS-CoV), which created an epidemic in 2003, with 8,000 people infected and 700 deaths before it was finally eliminated in humans [2] . Another example is the transmission of influenza virus from birds to mammals (pigs and humans) in 1918 that was responsible for over 100 million deaths worldwide [3] , and many of the genes from this virus continue to circulate in human influenza to this day.", "While the main text describes the origins of the reticuloendotheliosis virus (REV) and its close relatives as pathogens, the study of these retroviruses has also contributed to several areas of basic science and basic virology. The original description of REV was from a tumor taken from a turkey that contained two viruses. One, REV-A, was replication-competent, and the other, REV-T, was defective, but carried an oncogene called Rel that allowed it to transform cells [23, 24] . Rel, it turns out, is a key component in the innate immune signaling pathway [25] , as a component of the NF-kB transcription factor [26] . The late Howard Temin adopted REV and related viruses as model systems to describe, among many other phenomena, the kinetics of retroviral infections [27] , the derivation of cell lines for making gene therapy vectors [28] , and retrovirus mutation and recombination rates [29, 30] ." ] },{ "paper_id": "06cf324e3d0f793e5c722894c6ea6949655b1f10", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Several species of this family are pathogenic to humans and are recognized as potential biological warfare agent (BWA) [5] . VEEV is classified as Bioterrorism Agent Category B by the center of Disease Control (CDC). Alphaviruses do not only have the potential for illness and transmission, but they can also be produced in large quantities and are moderately easy to disseminate. Furthermore, these virus species have the capacity to cause human epidemics [6] [7] [8] [9] [10] [11] . VEEV causes disease symptoms ranging from mild febrile reactions to fatal encephalitic zoonoses. Outcomes are significantly worse for young and elderly patients, with case fatalities ranging from 4 to 35% [12, 13] . These viruses are highly infectious as aerosols [14, 15] and an intentional release of sufficient quantities as inhalable small-particle aerosol is expected to infect a high percentage of individuals within an area of a least 10,000 km 2 [16] . They can replicate in cell culture to very high titers and are relatively stable to environmental influences [17] .", "A possible neutralisation activity of the selected scFvs has to be assessed in further studies. Normally, the protective immunity to Alphaviruses is associated with an antibody reactivity to the virion glycoproteins E2 and so far, six conformationally stable epitopes were identified as critical for virus neutralization [36] [37] [38] [39] [40] . Furthermore our antibodies are fully human and therefore better suited for applications like as passive vaccination than murine antibodies.", "Microtitre plate wells containing 200 \u03bcL 2xTY + 100 mM glucose + 100 \u03bcg/mL ampicillin (2xTY-GA) were inoculated with single E. coli colonies from the phage titration of the panning and incubated overnight at 37\u00b0C and with constant shaking at 1200 rpm. 200 \u03bcL 2xTY-GA was inoculated with 10 \u03bcL of the overnight culture and grown at 37\u00b0C and 1200 rpm for 2 h. Bacteria were harvested by centrifugation for 10 min at 3220 \u00d7 g. The pellets were resuspended in 200 \u03bcl 2xTY + 100 \u03bcg/mL Ampicillin + 50 \u03bcM isopropyl-beta-D-thiogalacto-pyranoside (IPTG), a substance that induces the prokaryotic lacZ promotor in E. coli, and incubated at 30\u00b0C and 1200 rpm overnight. Cells were removed from the scFv containing supernatant by centrifugation for 10 min at 3220 \u00d7 g and 4\u00b0C." ] },{ "paper_id": "06d210540bbdfe3b898f2ffbc4d1f9fb74a5a4d8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "06d734de60efb9ac8c98cd02be9f667d0c535fb0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Comparisons between men and women of particle concentration and airflow were made using permutation tests (based on the Wicoxon rank sum statistic) rather than t-tests owing to the small numbers (4 men and 4 women).", "A further factor is the environment in which they are used; open situations with a strong draft or breeze will serve to rapidly dilute the aerosols produced but transmission risks may be considerably higher in enclosed arenas. A further risk factor for disease transmission will be the density of vuvuzela players and the prevalence of respiratory infections in the population.", "Coughing, sneezing, singing and talking can all produce aerosols capable of transmitting airborne respiratory diseases [17, 18, 30, 32] . Reports from earlier investigators suggest that coughs may produce up to 5,000 droplet nuclei and a sneeze may generate as many as 900,000 particles [21, 33] . The data we present suggests that blowing the vuvuzela for even a short time period has the potential to create more droplet particles than either coughing or sneezing." ] },{ "paper_id": "06e2a26a1925334deaf6621d3b2763924de55b14", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "These advances can help address the following key questions that are of concern to the infectious disease epidemiologist (see Box 2):", "Abbreviations GWAS: genome-wide association study; HCV: hepatitis C virus; MERS-CoV: Middle East respiratory syndrome coronavirus; MLST: multilocus sequence typing; MRCA: most recent common ancestor; MRSA: methicillin-resistant Staphylococcus aureus; PFGE: pulsed-field gel electrophoresis.", "Marc Lipsitch declares grants from PATH Vaccine Solutions and Pfizer (ongoing), and consulting income from AIR Worldwide (last 3 years; past). Yonatan Grad declares no competing interests." ] },{ "paper_id": "06e89cafce095f075c8a197fbdfb78c259133a8b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "LASV was first isolated in 1969 from a missionary nurse who worked in a clinic in a small town, Lassa, in northeastern Nigeria [34] . The nurse presumably acquired infection from an obstetrical patient residing in Lassa. She died approximately one week after the onset of symptoms. Subsequently, two more nurses that attended the first patient contracted the disease, which was later named Lassa fever and caused the death of one of them. Infectious virus was isolated from all three cases [35] .", "Additionally, multifocal adrenocortical cellular necrosis was detected that was most prominent in the zona fasciculata and was often associated with focal inflammatory reaction. However, in all examined cases adrenal necrosis was mild and \u2265 90% of the cells of adrenal cortex appeared viable [59] .", "Lassa fever is not considered to be associated with coagulation dysfunction, e.g., neither decrease in the coagulation factors nor disseminated intravascular coagulation (DIC) has been observed in infected patients. However, moderate thrombocytopenia with significantly impaired functionality of thrombocytes is detected in patients with severe Lassa fever [68] ." ] },{ "paper_id": "06ebe6e32a2e7241e23d3fb51c4dffeed389861d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The database search retrieved 2461 unique papers ( Figure 1 ). After screening the titles and abstracts, 302 papers met the inclusion criteria and were thus eligible for full text evaluation. Review of the full text publications resulted in the inclusion of 94 relevant papers based on our selection criteria. An additional two papers were identified via reference screening [11, 12] .", "A model in which random (stochastic) processes can affect whether certain events or processes occur (e.g. the rate at which individuals are infected can vary by chance) [61] .", "A model in which the population is divided into subgroups (i.e. compartments), which represent the average values of individuals in a particular state (e.g. susceptible, infectious or recovered). Within each compartment, all individuals are homogenous [9] ." ] },{ "paper_id": "06f33aa8d51ad1c6081cd855c8d274d47e1ee74e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nucleo-cytoplasmic transport of PTB is known to be regulated by the cAMPdependent Protein kinase A (PKA) through direct phosphorylation of PTB [41] .", "The Flavivirus genus of the Flaviviridae family of animal viruses contains more than 70 viruses including medically important dengue virus (DENV), tick-borne encephalitis virus (TBEV), West Nile virus (WNV), Yellow fever virus (YFV) and Japanese encephalitis virus (JEV). JEV is responsible for frequent epidemics of encephalitis in humans in most parts of Southeast Asia, China, Korea, Japan, and India. It is a neurotropic virus accounting for ,50,000 cases of encephalitis annually of which ,30% result in mortality and another ,30% in long lasting neuropsychiatric complications [1] . The treatment strategies upon diagnosis of JEV infections are mostly supportive and symptomatic as no specific therapeutic treatment is presently available. Greater understanding of the molecular mechanisms controlling JEV replication could help in designing novel interventions.", "Purified recombinant PTB was incubated in binding buffer (14 mM HEPES pH 7.5, 6 mM Tris-HCl pH 7.5, 1 mM EDTA, 1 mM DTT, 60 mM KCl) with 500 ng yeast t-RNA and 1 U RNasin in a 20 ml reaction for 10 min at 30\u02daC followed by the addition of 1 ng 32 P-labelled RNA and incubation for 30 min at 30\u02daC. The RNA-protein complexes were resolved by non-denaturing 6% polyacrylamide gel (PAGE) (acrylamide: bisacrylamide 50: 1) containing 2.5% glycerol in 0.5X TBE buffer (45 mM Tris-borate, 1 mM EDTA) at 4\u02daC. The gels were autoradiographed after drying." ] },{ "paper_id": "06f8316b5b1cd5f0737d5ada43c3dd9ebce27a91", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The estimated sample for the interview was 15 as they met inclusion criteria and 10 participants agreed and consented to participate, and data saturation was reached with six participants. Interviews were terminated when data saturation was reached, that was when information was repeated and when the researcher probed, rephrased questions, and requested clarity but the information kept repeating itself.", "Meanings were organized into themes, and themes evolved into theme clusters and eventually into theme categories." ] },{ "paper_id": "0700c01d64e50ef5ae5943328bd734718cf614f4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In summary, the amounts of fluid expelled during a single expiratory event based on V 20 for breathing, coughing, or sneezing were 1.247610 28 ml, 2.04610 27 ml, and 5.27610 25 ml, respectively.", "The potential for international airline passengers to transport infectious diseases into the United States is a serious concern. In 2003, the severe acute respiratory syndrome (SARS) virus was largely spread by air travelers and became a global epidemic; at least 18 countries on 5 continents were affected, resulting in over 8,000 cases and 774 fatalities [1] . One conservative estimate of the economic damage to Asian countries was calculated as $11 billion [2] . Influenza viruses that can be spread by air travelers have the potential to cause far greater harm [3, 4, 5] . Deliberate infection of passengers by terrorists is also a possible threat [6] . A potentially powerful tool to mitigate disease threats would be rapid and accurate detection of a variety of airborne infectious pathogens onboard commercial aircraft before passengers and crew deplane.", "Table S1 Compilation of cough statistics. Notes: Chronic cough can include asthma, gastrooesophageal reflux, eosinophilic bronchitis, chronic obstructive pulmonary disease and chronic bronchitis. 1 Italics represent cases where median values are reported by primary literature. { Study reports cough frequency in cough seconds per hour. In this table, 1 cough second is assumed to be the equivalent of one cough. NR denotes not reported. Found at: doi:10.1371/journal.pone.0014520.s001 (0.59 MB TIF) content or accuracy of these views. Approved for Public Release; Distribution Unlimited. Case Numbers 10-4599, 09-0950, 09-0888, 09-0890, 08-0656, 08-1668. GMH thanks L. Morawska and G. Johnson for furnishing raw data on particles concentrations from human exhalations, and T. Korves for a critical reading of this manuscript." ] },{ "paper_id": "0706374e8a8a5eaf3bff4d2555c0f0db11294755", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are expressed as mean\u02d8standard deviation (SD). Statistical analyses were performed using one-way analysis of variance. Dunnett range post-hoc comparisons were used to determine the source of significant differences, where appropriate. The SigmaPlot (Version 12.0) (Systat Software, San Jose, CA) program was used for statistical analysis. Values of p < 0.05 were considered statistically significant.", "Blood samples were centrifuged at 2000\u02c6g for 10 min at 4\u02ddC. The plasma was removed and placed into aliquots for analyses. Diagnostic kits for determining plasma levels of total cholesterol (TC; Cat. # 10007640) and triglycerides (TG; Cat. # 10010303) were purchased from Cayman Chemical Company (Ann Arbor, MI, USA). Kits for determination of plasma alanine aminotransferase (ALT; EC 2.6.1.2; Cat. No. A524-780TM) and aspartate aminotransferase (AST; EC 2.6.1.1; Cat. No. A559-780TM) concentrations were purchased from Teco Diagnostics (Anaheim, CA, USA). All experimental assays were carried out according to the manufacturers' instruction; all samples were analyzed in triplicate.", "Hepatic lipid content was determined from fresh liver samples. Liver (1.25 g) was homogenized with chloroform/methanol (1:2, 3.75 mL) and mixed well with chloroform (1.25 mL) and distilled water (1.25 mL). After centrifuging for 10 min at 1500\u02c6g, the lower clear organic phase was transferred into a new glass tube and then lyophilized. The lyophilized powder was dissolved in chloroform/methanol (1:2) and stored at\u00b420\u02ddC for less than three days [16] . Hepatic cholesterol and TG levels in the lipid extracts were analyzed using the same diagnostic kits used for plasma analysis.", "The flowering aerial parts of L. japonica were collected from Ligang Township (Pingtung County, Taiwan) in November 2014. Macroscopic and microscopic examinations, thin-layer chromatography, and high-performance liquid chromatography (HPLC) were used to confirm the authenticity of the plant material provided (this analysis was performed by Dr. Tang-Yao Hong, Department of Biotechnology, Collage of Pharmacy and Health Care, Tajen University). The voucher specimen (Lot No. LJ 20141121) has been preserved in our laboratory for future reference. The flowering aerial parts of L. japonica were air-dried, pulverized to a coarse powder in a mechanical grinder, and passed through a 40-mesh sieve to get powdered samples. Powdered samples (5 kg) were extracted at room temperature thrice with 10 L of 95% ethanol for 48 h on an orbital shaker to make the ethanol extracts. The L. japonica ethanol extract (LJEE) was evaporated to dryness under reduced pressure to completely eliminate alcohol and lyophilized, yielding approximately 582 g of dry residue (w/w yield: 11.3%). LJEE was stored at\u00b420\u02ddC until use and was suspended in distilled water. The content of chlorogenic acid in the samples was then analyzed using the Agilent 1100 HPLC system (Agilent Technologies, Inc., Santa Clara, CA, USA). The calibration equation of peak area against the concentration of chlorogenic acid was y = 6832.3\u02c6+ 117.2 (R 2 = 0.9998). The chlorogenic acid content in LJEE was 68.2\u02d80.3 \u00b5g/g of the dry extract." ] },{ "paper_id": "0712e5735c51991b7e0ce4bd5e63882703863459", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "D.M.E. is supported in part by CDC contract 200-2016-92313, and A.C. is supported in part by NIH grants 5R01AI052733 and 5R01HL059842.", "The mechanisms of pathogen geographic movement and dispersal are of great interest to ecologists, epidemiologists, medical historians, and others who seek to understand the causes of infectious disease emergences. These mechanisms can be natural or anthropogenic and can include anything from displacement or migration of reservoirs to the landscape, geophysical change, and climate changes to occurrences of natural disasters (as proposed here) ( Table 1) .", "(ii) Environmental evidence. (a) Trees and soils. The early environmental analyses of VGIIa in British Columbia identified that most C. gattii-positive environmental collections (soils and trees) were in the coastal Douglas fir forests and in coastal western hemlock forests bordering the coastal Douglas fir forest (16) (Fig. 1 ). While these studies were limited in geographical space, the identified contaminated landscapes did encompass the known locations of human and animal cases. Additionally, further ecological analyses have identified higher levels of soil and tree contamination at low-lying elevations close to sea level (25) . This is the expected pattern of a tsunami-caused dispersal from contaminated coastal waters." ] },{ "paper_id": "0715fd9f3fec7a2b86f3344c3c3a56611bcea4aa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Immunohistochemistry and confocal microscopy. Intestinal tissues of mice were embedded in a frozen section compound (Surgipath FSC22, Leica Microsystems, Wetzlar, Germany). Thin sections (10 \u00b5m) were fixed in 4% paraformaldehyde, blocked in 1% BSA in PBS, and incubated for 2 h at room temperature with an anti-TLR4 mouse monoclonal antibody or an anti-villin rabbit polyclonal antibody with gentle rocking. After washing 3 times with PBS, appropriate fluorescent-conjugated secondary antibodies were used for visualizing the antigen. Nuclei were visualized by staining with 1 \u03bcM 4\u2032,6\u2032-diaamidino-2-phenylindole (DAPI) in PBS for 10 min. Confocal images were acquired on a ZEISS LSM 880 confocal laser scanning microscope (Carl Zeiss, Oberkochen, Germany). For z-stack analysis, images were obtained along the z-axis at 0.3-\u03bcm intervals and subjected to three-dimensional analysis using ZEN software (Blue edition, 2.3, Carl Zeiss).", "The authors declare that all other relevant data are available from the authors upon request.", "Cell culture. The murine macrophage cell line RAW264.7 and human embryonic kidney 293 T (HEK293T) cell line were purchased from American Type Culture Collection (ATCC; Rockville, MD, USA) and cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and 100 \u00b5g/mL streptomycin. The HG23 cell line stably harboring a HuNoV (Norwalk virus) replicon 17 was cultured in DMEM supplemented with 10% FBS, 2 mM l-glutamine, 100 U/ml penicillin, 100 \u00b5g/ml streptomycin, and 0.1 mM nonessential amino acids in the presence of 1 mg/ml neomycin (G418 sulfate). Cells were maintained at 37 \u00b0C in a 5% CO 2 humidified incubator." ] },{ "paper_id": "07177128e49e7d7440cebca1eb70294a3fc27cbb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This was a prospective study conducted from October 15, 2016 to May 14, 2017 at the Federico G\u00f3mez Children's Hospital of Mexico, a tertiary referral hospital in Mexico City providing care to the uninsured population. It has 349 beds, 2 ICUs, one neonatal ICU and registers more than 7,000 hospitalizations per year.", "The study protocol was approved by the ethical committee of Federico Gomez Children's Hospital of Mexico with registration number HIM 2016-082.", "All datasets generated for this study are included in the manuscript and/or the supplementary files." ] },{ "paper_id": "0727980b80bddd2728174a65e08275cf73000f7f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Funding: This research received no external funding." ] },{ "paper_id": "07330c35eb8beda0a4b515b8a0edce5d42662417", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "07396bda4a37d13aaf15fdf67d61971549f4162c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "1) fever (axillary temperature$37.2); 2) cough, sore throat, wheeze, expectoration, chest pain; 3) moist/dry rales; 4) X-ray examination of lung inflammation showed punctate, patchy or uniform density shadow.", "Clinical information including demographic characteristics, symptoms, signs treatments, duration of hospitalization, clinical diagnosis were documented in case report forms (CRFs).", "The count data adopted constituted the ratio and frequency table description, and a non-normal distribution of measurement data using the median to describe the central tendency and percentiles to describe the discrete tendency. The group ratios were compared using Pearson's x2 test, with an inspection level a of 0.05." ] },{ "paper_id": "073bf7a5962595098cf9d08109b0db9ea1cb3303", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "https://doi.org/10.1371/journal.ppat.1007860.g003" ] },{ "paper_id": "073cdd46009615f49f9c9c074e55ecebe8305d32", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "N-terminal sequencing. The thrombin-cleaved MERS S protein was separated by SDS-PAGE and subsequently electroblotted to polyvinylidene fluoride membrane with CAPS buffer (10 mM CAPS, pH 11, 10% methanol) at 200 mA for 1.5 h. The polyvinylidene fluoride membrane was stained with freshly prepared Coomassie Blue R250 (0.1% Coomassie Blue R250, 1% acetic acid, 40% methanol) for 50 s and destained with 50% methanol until bands were visible and the background was clear. Then the membrane was dried and the target bands were cut for the N-terminal sequencing with the Edman degradation method by using PPSQ-31A (Shimadzu Corporation, Japan).", "The data of SARS-CoV S was processed in the same way as mentioned above, and the shiny particles in class one and two were used to calculate a 3.2 \u00c5 with three-fold symmetry imposed and a 3.7 \u00c5 map without imposing any symmetry.", "Cryo-electron microscopy data collection and processing. Purified S protein (3 ml) with a concentration of B0.4 mg ml \u00c0 1 for MERS-CoV S or B0.3 mg ml \u00c0 1 for SARS-CoV S was placed on a glow-discharged holy carbon grid (GIG, 1.0 mm hole size, 400 mesh). After 4 s blotting with filter paper, the grid was flash plunged in liquid ethane using an automatic plunge device (Leica EM GP) with 10\u00b0C temperature and 99% humidity. Cryo-EM single particle data collection was performed using a 300 kV Titan Krios microscope equipped with K2 camera. Using the super resolution mode, each image was exposed of 11 s at a calibrated magnification of 38461 and an electron dose rate of B8 e per pixel per s, resulting in a total dose of B50 e \u00c5 \u00c0 2 that was fractionated into 32 movie frames. The images were binned before data processing, yielding a final pixel size of 1.3 \u00c5." ] },{ "paper_id": "073d6557ccb048fe248c2d4c09a21c33f8632371", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The human spleen and the classical pathway are integral for protection against infection by S. pneumoniae 39, [62] [63] [64] [65] .", "Human cadaveric spleens were donated from the Department of Anatomy, School of Medicine, Konkuk University (Seoul, Korea).", "Cells on coverslips or 10 \u03bcm OCT (Tissue-Tek) frozen spleen sections were fixed with 100% acetone (10 min, room temperature) and stained, where indicated, with DAPI (4\u2032,6-diamidino-2-phenylindole) (blue) or FITC-, PE-, AMCA-, or Alexa Fluor-conjugated donkey antichicken IgY, goat anti-hamster IgG, donkey anti-rabbit IgG, goat anti-rat IgG, and streptavidin as secondary reagents (purchased from Abcam, Jackson ImmunoResearch Laboratories, or Molecular Probes). Cells and spleen sections were examined for fluorescence with a deconvolution fluorescence BX61-32FDIC microscope (Olympus Corp., Tokyo, Japan). Images were acquired with a Coolsnap EZ system (Roper Scientific, Inc., AZ, USA).", "Lipid rafts (LRs) are small (10-200 nM) , highly dynamic, detergent-resistant membrane fractions enriched in cholesterol and glycosphingolipid content on the plasma membranes of eukaryotic cells 1, 2 . Although LRs comprise only a small percentage of the cell surface area 3 , their sizes can increase by coalescence with other raft units 4, 5 , providing spatiotemporal platforms for many molecular entities 6 . LRs play crucial roles in complex physiological processes, such as phagocytosis, receptor-receptor associations, receptor-pathogen associations, and signal transduction in many pathological situations 1,2,7-9 , modulating innate and acquired immune responses 10 ." ] },{ "paper_id": "073d9b195e4d3e325a8ec7cd30b9ec23bb0a00a7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Other nonserious adverse events reported in more than 1% of the total population were in the OZ, O, and Z arms, respectively, nausea and/or vomiting (in 13, 4, and 5 patients), diarrhoea (in 2, 1, and 5 patients), and rash (in 1, 2, and 2 patients).", "Table S1 Proportion of false positive and false negative results for various viral load thresholds compared to viral isolation in the sample of GROG patients. " ] },{ "paper_id": "0741533a3a9c97880fb1d7f184d569a6e5191ef1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Age-and sex-matched controls were recruited among healthy patients undergoing elective surgery. Cases and controls were also matched according to procedure date (HSCT and elective surgery, respectively) \u00b1 1 week.", "The total cell count per sample was determined. T cell (CD45+, CD3+ CD56\u2212) and Natural killer (NK) cell (CD45+, CD56+, CD3\u2212) populations were identified using the following labelled antibodies: CD45-FITC/ APCCy7 (clone 2D1, BD Pharmingen), CD56-APC (clone NCAM16.2, BD Pharmingen) and CD3-PECy7 (clone UCHT1, Biolegend). Fluorescent cell viability dye 7-AAD (BD Pharmingen) was used to exclude dead cells. FlowJo v10.0.7 software (TreeStar) was used for data analysis.", "All HSCT were allogenic. Twenty-five patients underwent HSCT for the first time (93%) and two received their second HSCT (7%)." ] },{ "paper_id": "07420d39191900a262a4c5afff61e0ef80eac575", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ribosomal RNAs snoRNP:", "S-Adenosylmethionine SAH:", "S-Adenosylhomocysteine scaRNAs: Small Cajal body-specific RNAs snRNAs:" ] },{ "paper_id": "0749cab30d660b29d52b5346b02773a3f36fda0d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Monoclonal mouse antibodies against CD9 (clone M-L13), CD63 (clone H5C6), and CD81 (clone JS-81) were obtained from BD Pharmingen. Rabbit anti-FLAG was obtained from Sigma Aldrich. Mouse anti-rhodopsin antibodies were obtained from Millipore. Rabbit anti-CD13 (APN) antibodies were obtained from Abcam. Mouse anti-CD26 (clone M-A261) was obtained from BD Biosciences. Rabbit anti-TMPRSS2 (clone EPR3681) was obtained from Abcam. Secondary antibodies were purchased from Invitrogen and include goat-anti-rabbit-AlexaFluor 488, goat-anti-mouse-AlexaFluor 488, and goat-anti-mouse-AlexaFluor 568. Donkey-anti-goat, goat-anti-mouse, and goat anti-rabbit HRP conjugated antibodies were purchased from Thermo Scientific.", "Quantitative reverse transcriptase-PCR Cellular RNA was isolated using the RNeasy Mini Kit (Qiagen) and 100 or 500 ng was reverse transcribed using an iScript cDNA synthesis kit (Bio-Rad). Quantitative PCR was performed using Power SYBR Green (Thermo Fisher) and primers specific to human CD9, DPP4, TMPRSS2, or HPRT.", "Statistical comparisons were made by two-tailed Student's t-test. Error bars in the figures indicate the standard error of the data. Non-linear regression analysis was used to fit a curve to the entry kinetics data and obtain the time of 50% infection. This analysis was performed using Minitab 17 software. " ] },{ "paper_id": "074a37594f93652c9db7cef967b21eaa5b70f731", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "HIV [56, [89] [90] [91] has been a discussion topic in the microvesicle field for many years. Not only has it been hypothesized that HIV itself may have microvesicle features, but microvesicles also have been described to have immune modulatory functions on HIV-infected cells and to expand the infectivity of HIV.", "Being the first human tumor virus identified, EBV is in many aspects an extraordinarily benign pathogen and is best known as the causative agent of \"kissing disease\" or infectious mononucleosis. It is estimated that over 90% of the world population is persistently infected with EBV. The EBV life cycle begins by exchange through saliva and EBV virions that seem to preferentially infect na\u00efve resting B cells in secondary lymphoid organs, such as the tonsils. Occasionally isolated epithelial cells also become infected and presumably sustain lytic replication [72] , which is required for viral shedding into the saliva for transmission to new hosts [73] .", "Complexing of gB-DR effectively hijacks the cellular antigen presenting machinery, preventing further peptide loading and, in addition, increasing microvesicle production [37, 53] . This final step releases additional gB-DR complexes into the host immune microenvironment, promoting resistance of viruses to immune attack, and in some cases producing bystander T-cell tolergenicity or anergy [37, 53] . In the case of HIV, microvesicle packaging and spread of the virusencoded Nef protein impairs proper endocytosis of the immature MHCII/invariant chain, antibody class switching, and lysosomal degradation of viral peptides allowing HIV virus to evade immune recognition [37, 38] . EBV, human cytomegalovirus (CMV) and hepatitis C virus (HCV) have also found means to evade immune responses by exploiting microvesicles, as discussed below." ] },{ "paper_id": "074b685a347c109752be7efe757c3985190ec6c4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A case was excluded if 1) it didn't meet the ILI case definition, 2) testing was performed more than five days after disease onset, 3) testing was performed within seven days after previous testing, 4) the clinical sample was lost, or 5) it presented before the week of the first PCR-confirmed influenza case.", "All patients who visited the outpatient department, presented with ILI, and had been administered the rapid influenza diagnostic test (RIDT) were eligible for the study. We modified the original case definition for ILI used in EU countries adapting to local context [11] ; a case was defined as ILI if the patient showed a sudden onset of fever and at least one of the following symptoms: cough, runny nose, sore throat, headache, myalgia, or fatigue. We aimed to recruit all age groups, but the number of child cases was limited because the hospital did not have a paediatric department.", "The phylogenetic tree was constructed using the Neighbor-Joining method. HA1 sequences from reference strains used in the phylogenetic analysis were obtained from the EpiFlu database of the Global Initiative on Sharing Avian Influenza Data (GISAID)." ] },{ "paper_id": "075fc26a9bf29767e3e3e29e22121ce3980fcbf2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Library construction and TruSeq Illumina sequencing. The cDNA amounts in both samples were determined by a Qubit Fluorometer (Life Technologies, Thermo Fisher, Waltham, MA, USA). The two cDNA preparations were used to individually construct two libraries according to the manufacturer's instructions (TruSeq RNA Sample Preparation Kit, Illumina, San Diego, CA, USA). Briefly, the nucleic acids were ultrasonicated to generate fragments of less than 500-bp in length. The DNA fragments were end-repaired using T4 polynucleotide kinase, followed by adaptor ligation and loading onto the HiSeq 4000 (Illumina) for sequencing.", "Ethics statement. In Sample collection. In the Sichuan province of China in 2016, 26 nursery piglets aged 1 to 2 months were collected from 11 intensive commercial farms where acute respiratory disease had broken out. Animals that exhibited the clinical signs of acute respiratory disease (i.e., fever, rhinorrhoea, cough, laboured breathing, depression and ocular discharge) were considered to be PRDC cases after assessment by a veterinarian. The piglets were adequately sedated with azaperone (Melone Biotechnology, Dalian, China) to avoid distress. The pathological alterations observed during necropsy in the lungs included diffuse bleeding, cyanotic appearance, interstitial thickening, swelling, and hyperemia. Prior to testing, the nasal swab samples from the piglets were placed into viral transport medium (VTM) at \u221280 \u00b0C. Serum and lung samples were stored at \u221280 \u00b0C before they were tested.", "Metagenomic data assembly and phylogenetic analysis. The Illumina-generated raw sequence reads were trimmed to remove the adaptor-related reads, duplicate reads, and porcine genomic sequences, and a 150 bp minimum length was selected. Reads that passed the data processing procedure were considered useful sequences, and these were aligned with the sequences in the NCBI nonredundant nucleic acid and protein databases using BLASTn and BLASTx, respectively. The taxonomies of the sequences with the best BLAST values were selected and used for further grouping analyses. The viral abundances were scanned by SOAP aligner software. In parallel, all useful sequence reads were subjected to de novo contig assembly using SOAP assembly software (http://soap.genomics.org.cn/) with the criterion of a 90% minimum overlap identity. Individual viral contigs from both pools were reassembled into a larger contig or genome sequence using high-level sequence identity criteria. The assembled viral nucleotide sequences and open reading frame-translated peptides were aligned against the nonredundant database with BLASTN and BLASTP algorithms to calculate their percentage identities. The global multiple nucleic acid sequence alignments were constructed for the full or near-full length viral genomic sequences using MUSCLE v3.7. Pairwise identity values and phylogenetic analyses were carried out using MEGA 7.0 software (https://www.megasoftware.net/). Phylogenetic trees were constructed using the maximum-likelihood method and the tree topology evaluation was based on 1000 bootstrap replicates." ] },{ "paper_id": "0768babd4f340cc1b5eb49540be3decfc480eb8b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(c) Base composition. The frequency of A, T, G, C, and GC at first, second, and third positions of synonymously variable sense codons which can potentially vary from 0 to 1 was calculated. The variation of GC3s among genes was characterized by its standard deviation.", "The genetic code uses 64 codons to represent the 20 standard amino acids and the translation termination signal. Each codon is recognized by a subset of a cell's transfer ribonucleotide acid molecules (tRNAs), and with the exception of a few codons that have been reassigned in some lineages [1, 2] the genetic code is remarkably conserved, although it is still in a state of evolution [3] .", "Bacteriophages generally use the translational machinery of their hosts to synthesize both their structural and regulatory proteins. This indicates that the amount of codon usage in the protein coding genes in the phages and their bacterial hosts should be similar." ] },{ "paper_id": "076d18c2ee294256a400299b5c4631aac187d47a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The research presented here was approved by the Stanford University Non-Medical Human Subjects Institutional Review Board on 28 April 2009 (Protocol #16782).", "A concern regarding the relationship of people's self-reported anxiety and their protective behavior is that some people might generally be more anxious regarding health. We probed general anxiety by asking about respondents' anxiety with regard to a number of infectious, chronic, and violent threats to health. We asked a series of questions probing respondents' perceived subjective risk on a 5-point scale for a variety of health threats, including other infectious diseases (A(H5N1) ''bird flu'', seasonal flu, HIV/AIDS), chronic diseases (heart disease, diabetes, cancer), and violence (unintentional accidents, terrorism). We calculated the correlation matrix for answers to these threat questions and used Principal Components Analysis (PCA) to explore potential structure in the responses to different categories of threat [20] .", "We begin by presenting descriptive results of the survey and follow with our primary analytical questions from the survey, namely, testing the hypothesis that respondents' affective state mediates their protective action.", "An ongoing outbreak of novel influenza A(H1N1), colloquially referred to as ''swine flu,'' has caused over 200,000 confirmed cases (as of 28 August 2009 [1] ). Because of under-reporting, the actual number of people infected is substantially larger, particularly considering that many countries have ceased testing for A(H1N1) [1] . As human-to-human transmission became widespread in at least one region of the world, WHO rapidly declared the outbreak an imminent pandemic [2] and with widespread human infection, WHO declared a phase 6 pandemic on 11 June 2009, where it remains at the time of submission [3] . The virus appears to have a higher reproduction number and somewhat higher case fatality ratio than recent seasonal influenza viruses [4, 5] , and has certainly caused great concern in the population, fueled by both extensive media coverage and an initially high level of uncertainty about mortality rates and transmissibility of the virus." ] },{ "paper_id": "0771924722e625f8b49b2686a41e899954a962d0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All results are presented as mean value 6 SEM unless otherwise specified. Significance of difference between any two groups was determined by two-sided Student t test, and a final value of p , .05 was considered significant.", "We thank Dr. Agnese Po and Dr. Giuseppina Catanzaro for technical assistance in confocal microscopy, and \"Fondazione Roma\" for continuous support. This project was supported by La Sapienza University funding to G.B.-Z. and G.F.", "I.C.: conception and design, collection and/or assembly of data, data analysis and interpretation, manuscript writing, final approval of manuscript; F.P. and G.M.: collection and/or assembly of data, data analysis and interpretation; F.A., C.S., and V.P.: collection and/or assembly of data; E.D.F.: data analysis and interpretation, manuscript writing; M.P. and R.C.: data analysis and interpretation; M.I.: provision of study material; G.B.-Z.: financial support, data analysis and interpretation; E.M.: conception and design, manuscript writing; G.F.: conception and design, financial support, provision of study material, manuscript writing, final approval of manuscript." ] },{ "paper_id": "07899a6af647ba443bf04599aa35d111d0d08cb3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "3.2.6. Mitoxantrone (Novantrone \u00ae , Immunex/Amgen, Thousand Oaks, CA, USA)", "Dalfampridine (Ampyra/Fampyra \u00ae , Acorda Therapeutics)" ] },{ "paper_id": "078abb148599f16b6a3f8cfcf2599994dd9155f7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "e results showed that about half of cases (629 (45.6%)) were linked to at least one place of exposure where 321 (23.3%) of them were linked to hospital outbreaks (Table 1) .", "e variables considered in this study were age, gender, patient type (whether the patient is a healthcare worker (HCW) or nonhealthcare worker), health outcome (dead or alive) as at the last day of follow-up, patient comorbidity status, types of exposure to known risk factors (animal contact and camel contact indirectly or directly or through consumption of camel products), and place of infection (classified as hospital, community, and household/ family). e data set was cross validated with information from WHO disease outbreak news and Saudi Arabia MOH MERS command and control website.", "e authors declare no conflicts of interest.", "To answer the questions about the relationships among the network centrality metrics, the results suggest that patient's degree centrality explains 90.2% of the variation in patient's closeness centrality, while 14% and 9.3% of the variation in closeness centrality were explained by eigenvector and betweenness centrality, respectively.", "is study is based on case-by-case list of clinical-confirmed MERS cases provided by Dr. Rambaut [20] . e focus is on the 1379 MERS cases reported in the Kingdom of Saudi Arabia between June 2012 and September 2016." ] },{ "paper_id": "078b6935fa30cd20a00da6c6182e85b41ab4d9c5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following reagents were solubilized in sterile distilled H 2 O, stored at -20\u00b0C, and thawed immediately before use: adenosine (ADO, Abcam Biochemicals, Cambridge, UK), erythro-9-(2-Hydroxy-3-nonyl)-adenine hydrochloride (EHNA, Sigma-Aldrich), adenosine-5-triphosphate disodium salt (ATP, Sigma-Aldrich), apyrase (Sigma-Aldrich), adenosine-3',5'-cyclic monophosphate (cAMP, Sigma-Aldrich), 8-Bromo-cAMP (8BrcAMP, Abcam Biochemicals).", "doi:10.1371/journal.pone.0134943.g005", "doi:10.1371/journal.pone.0134943.g010" ] },{ "paper_id": "0792384d074cef963c808eacf3c63e3654776a2a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "SN, RW, and MK contributed to the conception, writing, and final edits of this manuscript.", "Interventions for either virus can be separated into primary prevention of infection, typically through vaccination, and reduction of infectious burden once transmission has already taken place.", "This work was funded by the National Institutes of Health (NICHD 5K12HD047349 and 5K08HL119359-02) to MK. " ] },{ "paper_id": "07ac15697a17a271224c7477de061f4ca6fc62aa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "LNs were fixed overnight at 4\u00b0C in freshly prepared 4% paraformaldehyde (Merck-Millipore) under agitation and subsequently washed in PBS for one additional day. Fixed tissues were embedded in 4% low melting agarose (Invitrogen) in PBS and sectioned with a vibratome (VT-1200; Leica). Forty \u03bcm sections were blocked in PBS containing 10% FCS, 1 mg/ml anti-FcR\u03b3 (BD), and 0.1% Triton X-100 (Sigma-Aldrich). Sections were incubated overnight at 4\u00b0C with the following antibodies: anti-gp38/PDPN, anti-B220 (Biolegend), and anti-YFP (Clontech). Unconjugated antibodies were detected using Alexa-fluor labelled secondary antibodies (Jackson Immunotools). To visualize nuclei, sections were stained with 4 0 ,6-diamidin-2-phenylindol (DAPI) (Sigma-Aldrich). Microscopic analysis was performed using a confocal microscope (LSM-710; Carl Zeiss), and the datasets were processed with ZEN 2010 software (Carl Zeiss).", "Results", "Overall, we anticipate that implementation of graph theory-based approaches in the investigation of those cellular elements that determine LN structure and functionality will fill the gaps in the understanding of critical immune processes. Moreover, generating improved mathematical models that permit prediction of complex system behavior will promote the development of rationally designed immune therapies and impinge on therapeutic intervention in diseases with involvement of immune system components." ] },{ "paper_id": "07bf7b392feb438d436be66e2bdfe7513320231b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The total population size is denoted by N(t):" ] },{ "paper_id": "07ca288609eac312987db5e4e69de3c5a8b21e2a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Epidemiological data including age, sex, symptoms, date of onset, and date of sampling were collected and entered into Excel worksheets. Descriptive analysis, frequencies and percentages were calculated using SPSS vr. 20 statistical software.", "Supporting information S1 Table. ", "The emergence of the Middle" ] },{ "paper_id": "07ddf570a1c38269ac3d1826cd8d013faeb6a339", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "07fc7bb8cbdb82bd4b17681aa92a6fc06d5fcf82", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Isolation of viral RNA. Two different procedures were used to obtain viral RNA for RT-PCR and sequencing. Virions were purified from ;3 3 10 8 17Cl-1 cells that had been infected at a MOI of ;10 pfu/cell and incubated in low pH DMEM at 30-33 8C. The medium from the infected cells (;225 ml) was collected at 24 hpi and clarified at 4,000 rpm for 30 min. The virions were pelleted by centrifugation at 24,000 rpm for 3 h at 4 8C. The virus pellet was allowed to suspend overnight on ice in 0.4 ml/tube of 0.15M NaCl and 20 mM HEPES (pH 6.6). The suspended virus from six tubes was pooled and layered over one SW28 tube containing a linear gradient of 40% potassium tartrate (bottom) and 20% glycerol (top), in 0.0.2 M HEPES (pH 7.4).", "For most mutants, the revertant virus obtained from plaques formed at the non-permissive temperature had properties identical to wt MHV-A59. One exception was Alb ts17, which produced equal numbers of revertant viruses causing A59-sized plaques and revertant viruses with noticeably smaller plaques ( Figure S1 ). We isolated revertant viruses from a large (A59-sized) plaque (Alb 17R L ) and a small plaque (Alb 17R S ) for sequence analysis (see below). Some of the ts mutants did not produce revertant viruses (e.g., LA ts3, Alb ts19) or produced revertant viruses that were markedly different from the parental MHV-A59 virus.", "The cis-acting RNA elements involved in the different phases of MHV RNA synthesis have been studied quite extensively. It has been shown that 59-and 39-UTR, as well as [45] . The hatched box represents the common 59 leader sequence and the hatched circle represents the programmed (\u00c01) frameshifting element. The translation products of the genome and sub-genomic mRNAs are depicted and the autoproteolytic processing of the ORF1a and ORF1a/ORF1b polyproteins into non-structural proteins nsp1 to nsp16 is shown. A number of confirmed and putative functional domains in the non-structural proteins are also indicated: 3CL, 3C-like cysteine proteinase; ExoN, exonuclease; HEL, superfamily 1 helicase; MT, S-adenosylmethioninedependent 29-O-methyl transferase; NeU, endoribonuclease; PL1, papain-like protease 1; PL2, papain-like protease 2; POL, RNA-dependent RNA polymerase; X, adenosine diphosphate-ribose 19- " ] },{ "paper_id": "0807d06a6db06216d0b9399f4658a4ffb581db03", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Spectrum analysis was carried out by selecting mutants (Can ) on selective minimum media drop-out plates containing canavanine [29] . Chromosomal DNA was isolated from the mutants and the relevant region of CAN1 was amplified by PCR and sequenced [30] . Sequence was carried out at MCLAB (San Francisco, CA, USA). Sequence analysis was carried out using Sequencher (Gene Codes, Ann Arbor, MI, USA).", "Yeast extract/ peptone/dextrose (YPD, 1% yeast extract, 2% peptone, 2% dextrose, 2% agar) and synthetic complete (SC, 0.67% yeast nitrogen base without amino acid, 0.087% amino acid mixture, 2% dextrose, 2% agar) media or the corresponding drop-out media were as described in [28, 29] . Homozygous haploid deletion strains library (Parental strain BY4741: MATa his3\u03941 leu2\u03940 met15\u03940 ura3\u03940) was obtained from Thermo Scientific (Pittsburgh, PA, USA).", "Adrienne P. Stephenson and Tryphon K. Mazu shared equally in this work." ] },{ "paper_id": "08174b668145c88e0e719dac2a03b30fb68f5de5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ethical clearance for retrospective use of anonymized patient sera for test development and quality control was obtained from the ethical committee (Ethikkommission beider Basel)." ] },{ "paper_id": "082892d44934e61adfef5cd6d5867439e30b183b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "083d4f33c62061390ac7dafcc4e9a4e44518df3f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "08467794d024d78c7981f7c39743a9faaa1adecb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are shown as the mean \u00b1 standard errors of three replicates per test in a single experiment repeated three times. Tukey's multiple comparison tests were used to analyze differences between groups. A p value less than 0.05 was considered statistically significant, and a p value less than 0.01 was considered highly significant." ] },{ "paper_id": "084df43c5fc9b52ac507f090c6d892b69e5b0999", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "PID values for DNA and predicted protein sequences were calculated using the software package MatGAT (Matrix Global Alignment Tool) version 2.02 [78] .", "Nucleic acid extraction from blood, fecal, and tissue samples Total nucleic acids (TNA) were extracted from 200 ml of EDTA-blood, serosanguineous fluid, or fecal samples using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics, Rotkreuz, Switzerland), or from tissues collected upon necropsy using DNeasy and/or RNeasy Tissue kits (Qiagen, Hombrechtikon, Switzerland) according to the manufacturer's instructions.", "Phylogenetic trees were constructed using MEGA3 [73] . Bootstrap support (1000 replicates) was calculated by the neighbor-joining/minimum evolution/MP methods and considered significant when .70% [76] . MP trees were obtained using the Close-Neighbour-Interchange algorithm [77] with search level 3 [76] , in which initial trees were obtained by random addition of sequences (10 replicates). All alignment gaps were treated as missing data. Branch lengths were calculated using the average pathway method [77] .", "Endogenous FeLV (enFeLV) detection and quantification. The enFeLV DNA loads were determined as described using three different systems (enU3-1, enU3-2, and enEnv) [51] that detect enFeLV sequences present in the recently annotated cat genome [74] . A feline glyceraldehyde-3-phosphate dehydrogenase (fGAPDH) pseudogene, of which one copy is present in the genomic DNA of feline cells [64] , was quantified by real-time TaqMan PCR assay [75] . Copy numbers of enFeLV were divided by fGAPDH copy numbers to calculate the number of copies per cell." ] },{ "paper_id": "084f1464fd6c0885f64af9c09c1460ef50dddd01", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The above examples demonstrate that single-molecule spectroscopy can straightforwardly access physical quantities that seem to better correlate with pseudoknot-stimulated \u22121 PRF efficiencies, thereby providing unprecedented mechanochemical details for the underlying mechanisms [16, 31, 32] .", "Despite \u22121 PRF's ubiquity among infectious viruses, and its promising role for serving as an antiviral target [3, 4, 6, 27] , the precise molecular mechanism remains elusive. This paper aims to address how recent developments in biophysical tools, specifically single-molecule techniques and computational modeling, can help to elucidate the mechanochemical basis for \u22121 PRF.", "(\u0394G Stem 1, theory = \u221267.4 kJ/mol, 55% \u22121 PRF) actually stimulates \u22121 PRF more efficiently than that with a 13 bp Stem 1 (\u0394G Stem 1,theory = \u221280.0 kJ/mol, 47% \u22121 PRF) [49] ." ] },{ "paper_id": "085522850a68603e453f67deacac2be1293a483f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "https://doi.org/10.1371/journal.pntd.0007231.g001", "https://doi.org/10.1371/journal.pntd.0007231.g002" ] },{ "paper_id": "085c71736d6b79717bb03aec375310d9e536f851", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Several cellular proteins bind to the 39UTR of HAstV-8 RNA", "The secondary structure modeling of the full-length 39UTR sequences of HAstV-1 to 28 (Accession Nos. Z25771, AF141381, AY720891, DQ028633, Y08632, and AF260508) were carried out with the RNA Mfold software release (version 3.2) [27] . The targets for the putative binding sites for cell factors were predicted utilizing the ESEfinder 3.0 [28, 29] , the ESRsearch [30, 31] , and the EBI-EMBL ASD-Alternative splicing search engines.", "Monolayers of CaCo2 cells (human adenocarcinoma HTB-37, ATCC) were grown at 37uC, 5% CO 2 in Advanced-Dulbecco's modified Eagle's medium (DMEM) (Invitrogen) supplemented with 5% fetal calf serum (FCS) (Biowest, France Labs), antibiotics (penicillin and streptomycin) and 2 mM L-Glutamine (Invitrogen). CaCo2 cells were infected with HAstV-8 strain Yuc 8 (kindly provided by E. Mendez, IBT, UNAM, M\u00e9xico). The Infections and the virus were obtained as previously described [20] ." ] },{ "paper_id": "085d2f0a23b102cb7492350434746878eb834785", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "The viral respiratory panel covered by the multiplex real-time PCR (qPCR) developed in our laboratory consists of coronavirus 229E, coronavirus HKU1, coronavirus NL63, coronavirus OC43, influenza A, influenza B, human metapneumovirus, parainfluenza 1-4 (differentiation with probes), respiratory syncytial virus, and rhinovirus [19] .", "Total nucleic acids (NA) were extracted directly from 200 \u03bcl clinical sample, using the Total Nucleic Acid extraction kit on the MagnaPure LC system (Roche Diagnostics, Almere, the Netherlands) with 100 \u03bcL output eluate. Nucleic acid amplification and detection by real-time PCR was performed on a BioRad CFX96 thermocycler, using primers, probes and conditions as described previously [19] . Cq values were normalized using a fixed baseline fluorescence threshold." ] },{ "paper_id": "0867cf1922a634eefb3a3ad07f4dc6c9c94828ea", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The raw data from the HTS assay were subjected to statistical analysis using cellHTS2 [52, 54] , a software package designed for the analysis of HTS data as part of the Bioconductor project for statistical computing [55] . Raw data were normalized using the plate median method [52, 56] . Next, a z-score transformation was applied to center and scale the data across the experiment. Replicates for a given compound at a given dose (N = 2 for each dose/compound combination) were then mean summarized. A zscore threshold of $2 was chosen to identify potential hits.", "The assay was automated in a 96-well format with a customized and fully integrated robotic system. The system equipment included: a Caliper Sciclone ALH 3000 workstation (Perkin Elmer) and a EL406 washer (BioTek) for liquid handling, an automated Liconic incubator (Thermo Scientific) for cold storage of plates, an automated Cytomat incubator (Thermo Scientific) for cell culture environment, a separate hotel for storage of plates at room temperature, a Synergy 4 plate reader, a Flexiseal plate heat sealer (K Biosciences, Beverly, MA), a Caliper Twister II, and a Beckman Sagian Orca robotic arm on a linear rail (Beckman Coulter, Fullerton, CA). Construction allowed for transfer of plates, reagents, and plasticware between all instruments, so that there was no need for any manual interference during screening assays. This entire system was enclosed in a custom-made laminar flow hood to allow for HTS screening capability under BSL2 sterile conditions. After the system demonstrated satisfactory performance in a 96-well format, the assay was miniaturized to a 384-well format and re-tested for reproducibility and stability under IFN-b and vehicle (1% DMSO) treatment conditions.", "To optimize the luciferase light reaction, we tested a series of flash and glow luminescent substrate systems in both lysed and live 2fTGH-ISRE-CBG99 and HEK293T-ISRE-CBG99 cells, including D-luciferin (Fisher Scientific, Pittsburgh, PA), the Chroma-Glo Luciferase assay system from Promega and the steadylite plus reporter gene assay system from Perkin Elmer (Waltham, MA) under a range of incubation conditions. The steadylite plus system was selected based on kinetic profile. Effects of IFN-b concentra-tion and treatment time were assessed with all other variables constant." ] },{ "paper_id": "08741b63c08d63c1a86dd3ef3ce3d1bfd39e560b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "in Dulbecco's modified Eagle's medium (DMEM, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Gibco, Carlsbad, CA, USA), 100 U/ml penicillin, and 100 \u03bcg/ml streptomycin at 37 \u00b0C in a 5% CO 2 humidified atmosphere. BTV1 strain SZ97/1 (GenBank accession numbers JN848759 to JN848768) was propagated in BSR cells.", "Statistical Analysis. Data were presented as the mean \u00b1 standard deviation (SD) from three independent experiments. All statistical tests were performed using GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA). Statistical comparisons were performed using Student's t test or ANOVA where appropriate. A P value of < 0.05 was considered statistically significant.", "to promote viral replication 14 . However, subsequent corresponding mechanisms underlying these observations have not yet been elucidated." ] },{ "paper_id": "0877aadd2c55095b8a663597fbb39150614f335e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Mean values \u00b1 standard deviation (SD). No significant difference between the two methods of collection.", "The findings relating to the specimens collected by the parents and pediatricians were compared using SAS ver- The categorical data were compared between groups using the \u03c7 2 test or Fisher's test; the other between-group comparisons were made using Wilcoxon's signed-rank test, a non-parametric test for paired samples. P values of 0.05 or less were considered statistically significant.", "List of abbreviations CT: cycle threshold; CI: confidence interval; PDV: phocine distemper virus; PCR: polymerase chain reaction; SD: standard deviation." ] },{ "paper_id": "088207699688d96fe973df88c1add87ac8339645", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Pidotimod follows a first order pharmacokinetic when administrated through oral route, while parenteral route follows second order pharmacokinetics, with a half-life of 4 h with and an oral bio-availability of 42-44%. It is eliminated through the kidneys without being metabolized. Plasma clearance is 5 l \u00d7 hE-1 with apparent distribution volume 30 l. Severeal types of oral route of the drug are available (tablets, sachets and vials) which are all bioequivalent [55] .", "Acute respiratory infections (ARIs) are still pandemics despite the introduction of new antibiotics and vaccines which contribute to reduce the risk of mortality and morbidity and they remain widespread and affect both young and elder people [1] . Furthermore, the socio-economic burden of ARIs remains high, considering the cost of symptomatic drugs, antibiotics, hospitalization and the indirect cost of absence from work or loss of school days [57] .", "In Europe, approximately 23% of the population is affected by allergic rhinitis (AR) [99] that is frequently accompanied by allergic asthma (AA), the prevalence of which increases from less than 2% in individuals without AR to 10-40% in those with AR; this combination of upper and lower respiratory symptoms increases the overall impact on the patient. There is now considerable evidence that the symptoms of AR and AA negatively affect patients' health related quality of life [100] [101] [102] .", "Allergen immunotherapy (AIT) is nowadays the only treatment specifically targeting the allergic inflammatory pathways and it represents a prototype of personalized medicine approach to respiratory disease patients [88] . AIT is highly effective and may induce long-term remission of symptoms. However, ongoing problems include the duration of treatment, the safety of immunotherapy, its cost and accessibility [103] .", "Adjuvants have the potential to modify the pharmacological and immunological effects of allergen vaccines. They may modulate allergen delivery, act as a depot, stimulate immune responses or limit antibody responses in order to reduce unwanted side effects." ] },{ "paper_id": "088571fa032ef5eb915d17b62e106a698a301f2c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All animal experiments described in this paper were carried out in the BSL3 facilities of the Erasmus Medical Center in accordance with the Dutch guidelines for animal experimentation. A Dutch Government-approved and independent animal experimentation ethical review committee (Stichting DEC Consult) approved the animal studies (permit nr. EMC2838/122-12-29).", "Chikungunya virus (CHIKV) re-emerged in 2004 and has caused unprecedented outbreaks in Asia and Africa since 2005. The estimated number of cases exceeds 2 million and over a thousand infected travelers have returned to Europe and the USA since 2006 [1, 2] . CHIKV generally causes a fever that resolves within several days, a maculopapular rash, and a characteristic arthralgia that can be extremely painful and may persist for months. During the recent outbreaks also more severe clinical manifestations have been reported occasionally, such as neurological complications and even deaths, usually in the elderly, patients with underlying conditions, and newborns [3, 4] . A licensed vaccine or specific antiviral therapy are currently not available.", "Total protein samples were prepared by lysing 7610 5 cells in 0.5 ml of 46 Laemmli sample buffer (100 mM Tris-HCl, pH 6.8, 40% glycerol, 8% SDS, 40 mM DTT, 0,04 mg/ml bromophenol blue). Proteins were separated by SDS-PAGE in 12% polyacrylamide gels and were transferred to Hybond-LFP membranes (GE Healthcare) by semi-dry blotting. After blocking with 1% casein (Sigma) in PBS with 0.1% Tween-20 (PBST), membranes were incubated overnight with rabbit antisera against CHIKV nsP1 (raised using the peptide EVEPRQVTPNDHAN), nsP4 (raised using the peptide ASSRSNFEKLRGPV) or E2 [30] in PBST with 0.5% casein. Mouse monoclonal antibodies against b-actin (Sigma), or the transferrin receptor (Zymed) were used for detection of loading controls. Biotin-conjugated swine-a-rabbit (DAKO) or goat-a-mouse (DAKO), and Cy3-conjugated mousea-biotin (Jackson) were used for fluorescent detection of the primary antibodies with a Typhoon-9410 scanner (GE Healthcare)." ] },{ "paper_id": "08885e2da682c5d027e986aacc166975e01fc60c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Avian-origin influenza A (H7N9) virus was confirmed from nasopharyngeal aspirate, throat swab, and pleural ", "Our objectives are to describe lung ultrasound findings in two patients with severe respiratory failure from avian influenza A (H7N9) infection, provide clinical pathologic correlation, and to discuss the implications for viral pandemic preparedness.", "Serial lung ultrasound (Esaote MyLabFive) with an 11-to 3-MHz linear array transducer was performed on day 16, day 21, and day 24 of case 1's hospital stay. They were performed on hospital days 3 and 4 for case 2. A six-zone scanning protocol [4] was used to image the lungs in perpendicular planes (transverse and coronal or parasagittal) for the anterior, lateral, and posterior lung area \"AT the\" midclavicular line, midaxillary line and parasaggital line medial to the scapulae. A modified protocol scanning along the midclavicular line, anterior-axillary, and posterioraxillary lines described by Lichtenstein and Meziere was used in case 2 due to critical illness [8] . Lung ultrasound examinations were compared and correlated to the chest radiograph done that day for both patients (Figures 1 and 2) ." ] },{ "paper_id": "0892e16c218542d3a099d7b10aec24cab4bfce55", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The statistical significance of the data was evaluated using ANOVA and Tukey post test using the IBM SPSS Statistics software version 20. P < 0.05 was considered significant.", "G.J.F and W.A.M have patents in the PD-1/ PD-L1 field. The other authors declare that they have no competing interests.", "have led to improved progression-free survival of many patients; however the therapies are toxic, rarely achieve durable long-term complete responses and are not curative." ] },{ "paper_id": "0899b0f8df5f20c6a46ba1dc7675c85858b59a68", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Vaccines 2019, 7, x 4 of 14 secondary antibodies (at the dilution of 1:5000) (Sigma, Ronkonkoma, NY, USA) at 4 \u00b0C for 30 min. Protein expression was visualized using a chemiluminescent substrate reagent (Thermo Scientific, Durham, NC, USA) according to the manufacturer's instructions.", "All data are presented as mean \u00b1 standard deviation (SD). The samples from each group (6 rabbits) were pooled and then analyzed as one sample in triplicate. Data were analyzed using two-way ANOVA with multiple comparison (LSD) test in SPSS. Different letters (a vs. b, a vs. c, b vs. c) indicate significant differences (p < 0.01) at the same time point.", "Rabbit hemorrhagic disease (RHD) is a comparatively new and economically important viral disease that affects adult rabbits [38] . It is important to develop effective strategies for preventing and controlling the spread of RHDV. However, because there is no efficient in-vitro system for propagating RHDV, it is difficult to produce this virus as a source of vaccine antigens [39] . At present, most commercial vaccines are produced using viral preparations obtained from the livers of experimentally infected rabbits [40] . This strategy raises numerous concerns with respect to animal welfare and biological safety [2] . To address these issues, and to develop an effective, safe, and convenient oral vaccine against RHDV, we constructed a recombinant L. casei expressing the RHDV VP60(VP1) protein." ] },{ "paper_id": "0899d745009fa75954f75b381c040aebd927832a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Recently, scholars have placed the classic transition within an expanded evolutionary framework. This recognizes a 'first' transition coincident with the Neolithic period and the agricultural revolution and a 'third' transition of emerging and reemerging infectious diseases occurring in the modern era (1) . In this expanded framework, Omran's classic transition becomes the 'second epidemiologic transition', as it is referred to here.", "Multiple modifications have been made to Omran's original theory. Omran (2) , attempting to accommodate variations from the theory, initially characterized three models for the progress of the transition. The 'classical model', featuring slow progression from high to low mortality and fertility, occurred in Western Europe, and was driven by economic development and advances in sanitation, public health, and medical knowledge. The 'accelerated model', seen in Japan, features more rapid progress, purportedly driven by the same factors. The 'contemporary model' applies to LMICs, wherein mortality has declined but fertility remains high and NCDs do not yet constitute the primary epidemiologic burden. Beyond the expansions suggested by Barrett and colleagues (1), Olshansky and colleagues have added a fourth stage, the 'Age of Delayed Degenerative Diseases', which recognizes a shift in NCDs to the elderly even as life expectancy increases, and a fifth, encompassing morbidity and mortality from HIV/AIDS and other emerging infectious diseases (22, 23) . Graziano (24) has proposed an alternative fifth stage, the 'Age of Obesity and Inactivity', in which increasing levels of weight gain and obesity alter the pattern of NCDs among the elderly (represented by Olshansky and Ault's fourth stage).", "Citation: Glob Health Action 2014, 7: 23303http://dx.doi.org/10.3402/gha.v7.23303" ] },{ "paper_id": "089acb4677633e0cf2d35fd728e686c8aa887bc0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "https://doi.org/10.1371/journal.pone.0219312.g005", "https://doi.org/10.1371/journal.pone.0219312.g006" ] },{ "paper_id": "08ac78608c5be04ef1cff3fba52a3c7648bfa21a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "AI initiated and planned the research. SI and MR collected the samples. MR and SA carried out the laboratory work. MKR and JF did a literature review, data analysis, and prepared the draft. SI, MMR, MAH, MMH, and AI made the necessary corrections over the entire manuscript. All authors read and approved the final manuscript." ] },{ "paper_id": "08b862f9103eb1590d60bd0312f750729b3f2c7d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The severity of each respiratory episode was ranked as follows: 1) physician criteria (mild, moderate or severe); 2) Wood-Downes scale (0 to 10 points; mild < 3, moderate 4-7, severe > 8); and 3) a newly developed scale -named GENVIP score-(0 to 20 points) that assesses food tolerance, degree of medical intervention needed, respiratory distress, respiratory frequency, apnea, malaise and fever (article in preparation; data in S1 Table [10] )." ] },{ "paper_id": "08beca0f49f6c33cf0ea4544f6dfe34b5932214d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "08c1093aa1c393ee5364089d26278781dc3a3405", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The revised coding sequence annotations are available on-line at http://www.firthlab.path.cam.ac.uk/virad.html. More than two hundred of these revisions (restricting to, but not exhausting, ones with experimental support in at least one species) have already been submitted to and incorporated into GenBank.", "permissive approaches such as false discovery rate can be used to select a larger set of conserved regions.", "the results of applying synplot2 to each of the three alignments. All three alignments produced similar results, indicating that the plots are not greatly affected by the phylogenetic tree, nor, for large alignments, the exact choice of sequences." ] },{ "paper_id": "08d0057eaad519e3d6ef88ffbbc2187b2c11f126", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Phylogenetic analyses of either the complete sequence ( Fig. 1) a: determined by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) with the following primers/probe: ZIKV1086, ZIKV1162c and ZIKV1107-FAM. (10) b: sequence generated from P3. c: sequence generated directly from patient sera which is identical to P3 sequence. d: sequence generated from P0 which is identical to P3 sequence." ] },{ "paper_id": "08d822c186460651ee5f3a44d365b0701aff56e3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The KSHV-positive B cell line bearing a doxycycline-inducible version of the major lytic transactivator RTA (TREX-BCBL-1) [55] was maintained in RPMI medium (Invitrogen) supplemented with 10% fetal bovine serum (FBS; Invitrogen), 200 \u03bcM L-glutamine (Invitrogen), 100 U/ml penicillin/streptomycin (Invitrogen), and 50 \u03bcg/ml hygromycin B (Omega Scientific). ", "Lysates were resolved by SDS-PAGE and western blotted with the following antibodies at 1:1000 in TBST (Tris-buffered saline, 0.1% Tween 20): rabbit anti-EST1A/SMG6 (Abcam), rabbit anti-NCL (Abcam), rabbit anti-HuR (Millipore), rabbit anti-actin (Abcam), rabbit anti-IGF2BP1 (Abcam), rabbit anti-YTHDC2 (Abcam), rabbit anti-hnRNPU (Abcam), rabbit anti-ZC3HAV1 (Abcam), rabbit anti-hnRNPD (Abcam), rabbit anti-STAU1 (Pierce), mouse anti-NPM1 (Abcam), rabbit anti-GADD45 (Abcam), mouse anti-GAPDH (Abcam), mouse anti-ORF59 (Adv biotechnologies), or rabbit anti-K8.1 (PRF&L, inc). Primary antibody incubations were followed by HRP-conjugated goat anti-mouse or goat anti-rabbit secondary antibodies (Southern Biotechnology, 1:5000).", "The GADD45B and IL-6 SREs assemble a partially overlapping ribonucleoprotein complex" ] },{ "paper_id": "08dd1169c7aa45621e5f48bf6246b049e071e445", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The Ethical Review Board of the Sheba Medical Center, Tel Hashomer approved this study (SMC-8859). The samples and results were stripped of all links to personal details pertaining to, or which could be used to identify individual patients. All data were analyzed anonymously. The Ethical Review Board exempted this study from a requirement for obtaining informed consent.", "Small portions of fecal matter were vortexed for 15 seconds in stool suspension buffer, 2 ml 0.9% saline with glass beads (samples 1 to 93) or 5 ml of M199 containing 15.6 mg of dihydrostreptomycin, 15,625 U of Penicillin G, and 156 U of Mycostatin and 0.1 volume (v/v) of chloroform (samples 101-192). Suspensions were clarified by centrifugation at 2,5006g for 10 min and stored at 220uC until use.", "One of the trends in pathogen identification is the increasing reliance on molecular methods to achieve high throughput, high sensitivity and specificity of results in clinically relevant times [2, 16] . However, low pathogen copy number, inefficient extraction and the incomplete removal of inhibitors, reduce the sensitivity and specificity of the molecular assays. Among clinical samples, stool suspensions contain a wide range of materials that have the potential to inhibit RT and/or PCR chemistries [4, 6, 8, 9, 10, 11] . Thus, it is important to develop a reliable method to determine whether inhibitors are present in nucleic acid prepared directly from stool suspensions. An appropriate internal control does not exist because of wide differences in eukaryotic and prokaryotic composition in fecal material between patients." ] },{ "paper_id": "08e6541bee1b67eab1918bcbbe6f90463ecb651a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Agarose gel electrophoresis. The PCR products were electrophoresed on 2% agarose gel and visualized by staining with 0.50 \u03bcg mL -1 ethidium bromide by UV transilluminator (M-15; UVP, Upland, USA).", "PCR product purification. The PCR products were purified using PCR purification Kit (Roche, Mannheim, Germany) according to kit's manufacture instructions.", "RNA extraction Viral RNA was extracted from the directly pooled tracheal swabs in RLT buffer (Qiagen, Hilden, Germany) and 10 \u03bcL 2-mercaptoethanol (Merck, Darmstadt, Germany) per 1 mL buffer using RNeasy Mini Kit (Qiagen), according to the manufacturer's protocol." ] },{ "paper_id": "08e6a1b558bcb3962378851963c2e67681dabad6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "My-BatCoV-HKU6 7 0", "Miniopterus pusillus Mi-BatCoV-HKU8 8 0", "Rousettus leschenaultii Ro-BatCoV-HKU9 9 0" ] },{ "paper_id": "08e78c0222e84457195ccefb2e371f1847670436", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All animal work was conducted under conditions and with permits approved by animal ethics committees of the Australian Animal Health Laboratory and the Queensland Department of Primary Industries and Fisheries. ", "In all cases, cell medium was removed after 3-5 days and replaced with fresh medium supplemented with 10% BCS." ] },{ "paper_id": "08ee65d70ad0dae18dd402eb531103c2dfbbeffb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0910e151cd1fb8d455e54cd4e97f867627f934c8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "is the spatial weights matrix which considers three nearest neighbours ( is 1 if area and are within a distance of three nearest neighbours and zero if otherwise). The Moran's test was applied using the spdep package of statistical software [23] .", "Each Canadian FSA was assigned to the respective county and state based on the postal code conversion file (PCCF) available from StatCan.", "Currently, there are no solutions to fully overcome the effects of MAUP and related methodological issues have not yet been adequately addressed. Recommendations have been made to minimize MAUP effects in statistical inference by analyzing the aggregated covariates in hierarchical levels of areal units from the finest spatial resolution possible to a coarser resolution, verifying consistent model results across different scales, avoiding ecological fallacy, collecting data at the scale at which inferences is to be made, and using scale invariant statistics to make inferences [17, [44] [45] [46] .", "The presence of overdispersion in (nonspatial) Poisson regression models was evaluated by testing the model deviance against degrees of freedom using a 2 distribution and a 5% significance level [35] . Multicollinearity was tested among the covariates in the multivariable model by estimating the variance inflation factor (VIF), and all variables with a VIF value of 10 or above were considered collinear [36] . All statistical modeling was done using statistical software [37] ." ] },{ "paper_id": "092193fe026d59729062786d8f576b553e11a97d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Here r is 2 that means the (r \u00d7 n) matrix X lists points in 2-dimensional Euclidean space. We have applied the cost function \u03c3 to measures the squared differences between ideal (m-dimensional) distances and actual distances in r-dimensional space as follows:", "Our method presents a ripe opportunity to use data-driven approaches for advancing our current knowledge on disease mechanism and predicting disease comorbidities in a quantitative way.", "We suppose that what is happening for the comorbidities we investigate is similar to what found for prions [71, 72] . Similar to most infectious agents, prion causes inflammatory responses by activating innate immunity through glial cells in the brain." ] },{ "paper_id": "09242b23825a9c7e09660df99494b673e5abea3e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "first micro second of up to \u223c 0.70 (Fig. 6b) . For Vpu-DD the sequence is reversed by assembly via TMDs of up to \u223c 0.50 oligomerization followed by cytoplasmic assembly which remains a ratio of \u223c 0.05 (Fig. 6c) .", "bilayer supported the experimental data in demonstrating that, in addition to a previously known role in downregulation of host factors, the phosphorylation sites of Vpu also modulate oligomerization.", "The thrombin enzyme cleaves the strep-His8 fusion tag from Vpu-WT and the mutants ( Fig. 2a lanes 2 , 4, 8 and 10 and Supplementary Fig. S1 ). The pattern mentioned for uncleaved Vpu does not seem to be affected by thrombin treatment." ] },{ "paper_id": "09340528717039c904847d959dd4ff0adcc308ed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "International Journal of Cell Biology 7", "International Journal of Cell Biology that specific proteins, organelles, and invading bacteria are specifically degraded by autophagy (Figure 3 ).", "AgRP:" ] },{ "paper_id": "0938d2fb07611897abf38cea727ddbeea77b73d9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Regarding the real-time forecasting, we employed the so-called Richards model, an analogue to the generalized logistic model [4, 5] :", "where E(.) represents the expected value. As for fs, it is known that the mean and standard deviation are 5.0 and 3.0 days, respectively, best fitted by lognormal distribution [3] . Employing a step function, the incidence of infection was statistically estimated via a maximum likelihood method. The estimation was implemented independently by the history of contact and type of membership.", "The author declares no conflict of interest.", "We estimate the number of cases by time of infection, it. Using the probability mass function of the incubation period of length s, fs, the incidence of infection is known to satisfy" ] },{ "paper_id": "09403dce0f0c10723150a14e1ea2f00b11dc05fb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In addition to the techniques included in the taxonomy [5] , session 2 included a core message intended to induce mild 'disgust' towards dirty hands in order to motivate hand-washing [8] . The page showed a photograph of a dirty hand and suggested that hands could be covered with 'dirty' viruses that were not visible.", "and previous experience of web-based intervention development, the first author identified likely key determinants of behavior and effective web-based methods of addressing these. The first and second author then drafted the webpages. An informal mapping process was employed to check that each of the relevant factors identified from theory and literature had been addressed (there was insufficient time to carry out an exhaustive, systematic reviewing and intervention mapping process). To check that the intervention was effectively addressing the right behaviors and determinants we also carried out four empirical studies, as follows:", "Following Green and Kreuter's 'PRECEDE-PROCEED' model [2] , we asked infection experts on our team to identify the behaviors most likely to be efficacious. We then carried out a qualitative study (N = 31) to determine which of these were also viewed as feasible and acceptable by our target population, and what factors would influence their adherence to the behaviors. Participants were invited to discuss their perceptions of infection transmission and likely adherence to infection control measures in both non-pandemic and pandemic contexts. Infection control measures discussed included handwashing, social distancing and cough hygiene (e.g. covering mouth, disposing of tissues immediately etc.). Thematic analysis revealed that handwashing was regarded by our participants as more feasible than cough and sneeze hygiene and more acceptable than social distancing, and identified a number of factors that were potential barriers to carrying out infection control behaviors." ] },{ "paper_id": "09417d5a567e93e35a80a241b9459f2b84ef0b0d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cell viability, cytotoxicity and enzyme activity assay on DOX/ GL-ALG NGPs", "At the time of sacrifice, tumor, liver, and heart were removed and fixed in 10% neutral formalin. The fixed tissue was dehydrated, embedded in paraffin, sectioned, and stained with hematoxylin and eosin (H&E). The stained sections of each test sample were examined using light microscopy (OLYMPUS, Japan). Slides of the tumor were deparaffinized and rehydrated then immunofluorescence-stained using PCNA, Ki67 antibody and Immunofluorescence Detection Kit (Sangon Biotech, Co., Ltd., Shanghai, China) and TUNEL assay kit (Beyotime Biotech, Shanghai, China) according to the manufacturer's instruction.", "The protein expressions of Bax, Bcl-2, and Bcl-xL were analyzed by western blotting. HepG2 cells were collected by centrifugation and resuspended in extraction buffer of mammalian protein extraction kit (Sangon, China). Cell debris was removed by centrifugation, and the supernatant was collected to detect the protein concentration by BCA method (Pierce, USA). An amount of 40 mg cellular protein was electro-blotted onto a PVDF membrane following separation on a 10 % SDS-polyacrylamide gel electrophoresis. The PVDF membrane was transferred to incubate with blocking solution (5% skim milk) for 2 hours at room temperature, and then incubated overnight with a 1:1000 dilution of anti-Bax, anti-Bcl-2, anti-Bcl-xL, anti-\u03b2-actin antibody at 4 \u00b0C. Blots were washed five times with Tween 20/Tris-buffered saline (TTBS) and then incubated with a 1:1000 dilution of horseradish peroxidase-conjugated secondary antibody for 1 h at room temperature. Blots were washed five times with TTBS again and then developed by Horseradish peroxidase substrate (Millipore Corporation, USA) and data were captured by exposure to Kodak BioMax Light films." ] },{ "paper_id": "0943374130f5f8474d6d480d4d038615a0e36de3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Plasma HCV-RNA levels were assayed by Abbott RealTi-meHCV assay (Abbott Laboratories. Abbott Park, Illinois, U.S.A.). Moreover, HCV genotype was determined by Abbott RealTime HCV Genotype II Amplification Reagent kit.", "This study was approved by the Ethics Committee of the National Institute for Infectious Diseases ''L.Spallanzani'', and all enrolled individuals provided written informed consent.", "All experiments on monkeys were performed in accordance with the recommendations of the Weatherall report, and were previously approved by the regional ethical committee ( ", "We thankfully dedicate this work to the memory of Fabrizio Poccia, a prominent researcher in the field of innate immunity and cd T cells, and an enthusiastic visionary on innate cell based immunotherapy for infectious diseases treatment, who died at the age of 39. " ] },{ "paper_id": "0951f5ec3710990a5c181e04fa8fdf7d9a0376e5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data were analyzed by performing two-tailed non-parametric Mann-Whitney test using GraphPad Prism version 4.00. P-values#0.05 were considered significant." ] },{ "paper_id": "09525027db30dc3a6945da255f80b2099e239c48", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "https://doi.org/10.1371/journal.ppat.1006314.g001" ] },{ "paper_id": "0953fa36903063f60627e07f7b4e07f0aec3c4d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "After data extraction using Imagene 5.6 Software (BioDiscovery), Lowess normalization [57] was performed on mean spot-intensities in order to correct for dye and printtip biases [58] . The microarray data was analysed using ANOVA (R version 2.2.1/MAANOVA version 0.98-7) http://www.r-project.org [59] . Briefly, in a fixed effect analysis, sample, array and dye effects were modelled. Pvalues were determined by a permutation F2-test, in which residuals were shuffled 5,000 times globally. Genes with P < 0.05 after family wise error correction were considered significantly changed. Cluster analysis (standard correlation) was performed with GeneSpring GX 7.2 software (Silicon Genetics). When indicated, the confidence level was increased by applying a fold change cut-off. The resulting genelists were subjected to Genespring 7.2 software for further analysis.", "Cytokines are key regulators that dictate many aspects of innate and adaptive immunity. Induction of type I interferons (IFNs), a well-known subset of cytokines with antiviral activity, is triggered by a selection of cellular pattern recognition receptors, including TLRs (Toll-like receptors), RIG-I (retinoic acid-inducible gene I), and MDA5 (melanoma differentiation-associated protein 5). These receptors are activated in response to a range of pathogenspecific factors, which includes double-stranded RNA produced during virus infection [1, 2] . Secreted type I IFNs (i.e. IFN-\u03b1 and IFN-\u03b2), subsequently induce an antiviral transcription program in the infected cell as well as in adjacent cells, thereby magnifying the \"danger\" signal and protecting against the infection." ] },{ "paper_id": "095424c03a6e78279e47488552d961bc328f9c84", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "https://doi.org/10.1371/journal.pone.0227104.t005", "Supporting information S1 Table ", "\u00bd1 \u00c0 \u00f0luciferase activity in the presence of inhibitor \ufffd luciferase activity in the absence of inhibitor\u00de\ufffd x 100" ] },{ "paper_id": "09561ed721369a7a9e077f7bea9022499c12b13d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Many studies have attempted to measure the spatial dynamics of influenza spread, often in an effort to create better control strategies and predict the occurrence of specific strains in coming influenza seasons [6] [7] [8] . Implicit in this work is the reality that influenza transmission dynamics are not spatially uniform, though details of how transmission may vary spatially are lacking.", "The similarity measure can depend on geographical proximity and/or demographic proximity, and can also be informed by observed data on travel or contact patterns. The similarity matrix does not necessarily contain probabilities, but represents the relative similarity between two locations and/or demographic features. Additionally by similarity we are describing the potential for an infective event. Alternatively, we can also entertain a Bayesian formulation and attach a prior to the parameters of the distance measure. Below, we investigate some different measures." ] },{ "paper_id": "095cf0472e7f23349f22a1f538eb2c8d590d33e1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nasopharyngeal (NP) and oropharyngeal (OP) swabs for detecting viruses and blood cultures for detecting bacteria were taken from eligible patients on admission using operating procedures described by the WHO [12] . Specimens were taken an average of 7 days after illness onset (range: 1-66 days).", "For influenza vaccination history; 832/1,075 (77.4%) cases did not receive the vaccine within the 12 months prior to hospital admission, while 243/1,075 (22.6%) were reported as unknown for an influenza vaccination status. Table 1 details these results.", "Fifty-three percent of patients had at least one underlying medical condition. These comorbidities included chronic respiratory disorders (asthma, COPD, bronchiectasis, and immotile cilia syndrome), cardiac disorders (heart failure congenital heart diseases, and cardiomyopathy), neuromuscular disorders (epilepsy, cerebral palsy, and myopathies), hematological disorders (thalassemia), endocrine disorders (diabetes mellitus, hypothyroidism, and morbid obesity), renal disorders (end-stage renal disease), and liver disorders (liver cirrhosis and hepatic failure).", "Prior to study initiation, the study protocol was reviewed and approved by Institutional Review Board at the NAMRU-3, as well as the ethical committee of CUH, in compliance with all applicable federal U.S. regulations governing the protection of human subjects. An informed written consent was obtained from the patients (in the case of adult patients) or patients' parent/legal guardian (in the case of pediatric patients)." ] },{ "paper_id": "0969d53ac7a447d43b431dbe9744e416de26df38", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "There appears to be a genetic influence in exhibiting KD. Incidence is higher in some genetic backgrounds and consistently appears in males greater than females within those backgrounds [16] . By age five in the United States, 1 in 1000 African-American children and 1 in 2000 Caucasian children will have been affected [17] [18] [19] . In general, Asians have a much higher rate of KD, this is especially evident in Japanese children, whose lifetime incidence rate is near 1% [20] . This predisposition holds even for those persons of Japanese heritage raised in foreign lands, such as the United States [16] .", "In a recent network and pathway analysis, responses were consistent with global activation of the immune response [54] . Although genome wide searches and similar techniques have not been definitive, genes involved with B cell activation, such as CD40 and the B lymphocyte kinase (BLK), have been identified [55, 56] . There is a growing body of literature implicating specific B cell responses in the pathogenesis [57] . In this review we will focus on the literature surrounding these recent reports of antibody reactive cellular inclusions and B cell involvement.", "In addition to protein, the ICIs observed in the limited bronchial epithelial samples were also partially composed of RNA. While the RNA could be of viral origin it is important to note that many of the host-derived intracellular protein aggregates previously noted also contain host mRNA [113, 114, 116, 117] . It is reasonable to conclude that if the ICIs observed in KD patients were related to one of these structures, they would positively stain for RNA." ] },{ "paper_id": "096d707e74acc27426416dacf89d5d134a0b9866", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Allergic dermatitis APC:", "Antigen-presenting cells CHS:", "Contact hypersensitivity DNP: Dinitrophenyl ELISA: Enzyme-linked immunosorbent assay HRP: Horseradish peroxidase IFN:" ] },{ "paper_id": "0977f51bf118077aae3d344adbe019c40622beb4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "097b9b4ada3e89942ea196c59226e95da1b7969f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Serum samples were collected as reported previously [27] and submitted to the Diagnostic Center for Population and Animal Health (Michigan State University, Lansing, MI, USA) for quantitative VA concentrations by HPLC.", "Enumeration of total IgSCs and PEDV-specific ASCs was performed as described previously [16, 39] . Counts were averaged from duplicate wells and expressed relative to 5 \u00d7 10 5 MNC.", "Supplementary information accompanies this paper at https ://doi. org/10.1186/s1356 7-019-0719-y. ", "A PEDV whole virus Ab ELISA was performed as described previously [16] . The ELISA Ab titer was expressed as the reciprocal of the highest dilution that had a corrected A 450 value (sample absorbance in the virus-coated well minus sample absorbance in the mock antigen-coated well) greater than the cut-off value (mean corrected A 450 value of negative controls plus 3 standard deviations). Samples negative at a dilution of 1:4 were assigned a titer of 1:2 for the calculation of GMTs." ] },{ "paper_id": "09b0945d4963d363bb670d75070c19a328fbfce6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supplementary Materials: The following are available online at http://www.mdpi.com/2414-6366/4/3/99/s1, Table S1 : Bats collected and tested in this study. ", "Paramyxoviruses are negative-sense single-stranded RNA viruses capable of infecting a diverse host range including mammals, birds, reptiles and fishes [28] . The taxonomic classification of viruses in the Paramyxoviridae family has recently undergone several changes [29] . In an attempt to accommodate the rapidly growing number of paramyxoviruses described, the previously known Avulavirus and Rubulavirus genera were elevated to the sub-family level (Avula-and Rubulavirinae) each with two new genera. In addition, several unclassified rodent-borne viruses were classified to newly established genera (Narmovirus and Jeilongvirus) in the sub-family Orthoparamyxovirinae to which the Henipa-, Morbilliand Respirovirus genera belong.", "Sequencing was performed as previously described for molecular host species identification. Sequences were viewed, edited and a consensus generated using the BioEdit sequence alignment editor software version 7.2.5 [43] . CIPRES was used for ClustalX alignments, determining the best DNA substitution model for nucleotide sequence analysis using the jModelTest software and for constructing Bayesian phylogenies using the BEAST version 1.8 software [44] [45] [46] . Bayesian MCMC chains were set to 20 million iterations, sampling every 2000 steps for optimal ESS scores. Output files were visually inspected to check for convergence using the Tracer software version 1.7 [47] . The final phylogenies were constructed in TreeAnnotator with a burn-in value of 10%. For visualization and manipulation of the phylogenetic tree, the FigTree version 1.4.2 software was used. Pairwise similarities between sequences were analysed in MEGA X with complete deletion [48] ." ] },{ "paper_id": "09cba4ea15eda3c3bd33243487c9bd32928d9635", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Real-time polymerase chain reaction (qPCR) was performed using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and the primers listed in Table 1 . Expression levels were determined through 2(-Delta Delta C(T)) method (DDCt) [34] , normalized using rp49 gene expression [35] , yielding the relative expression value. Statistical analyses were done using GraphPad Prism software, version 5.04 (GraphPad Software, Inc., San Diego, CA, USA). For comparison of the transfected and mock samples at different times after transfection, an unpaired two-tailed Student's t test was performed. * p \u2264 0.05, ** p \u2264 0.01, *** p \u2264 0.001. Table 1 . List of primers used for qPCR.", "Hemocytin", "Basic transcription factor 3 BTF3-F 5 AGTGCATAAGCAGGCAACACCA3 BTF3-R 5 TACGTCGCCACCGAAATGAGTT3", "Juvenile hormone-inducible protein JHIP-F 5 CCTTGCTGAGCTCCTTGAGAAACT3 JHIP-R 5 TACACATGGCCATTCCCATCTTCC3" ] },{ "paper_id": "09ccb3b9fece55e72c3acb85c4259de62a9c9e0c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All serum samples were tested for BHV-1 antibodies using a commercial BHV-1 gB ELISA test kit, Herd-Chek* (IDEXX, Switzerland) having 100% sensitivity and 99.8% specificity. Suspect antibody test results (samples with blocking % greater than or equal to 45% but less than 55%) were considered as positive in the data analysis.", "Newly purchased animals can be the source of BRSV infection, which was confirmed in a Swedish study in which outbreaks of BRSV occurred most often after the introduction of purchased animals [7] .", "In each of the selected herds, serum samples from a representative number of randomly selected cows, and youngstock older than six months, were analyzed. In total, 9,637 serum samples were collected. A precise description about the selection of herds, and animals within herds, has been reported in Raaperi et al. [16] ." ] },{ "paper_id": "09d2a697632210efee7bf9fe6ee07b66bb7248f2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Resorcyclic acid lactones, namely radicicol (49, Figure 22) pochonin B (50, Figure 22 ) and C (51, Figure 22 ) isolated from H. fuscoatra exhibited a 92-98% reactivation efficiency of the latent HIV-1 ", "Marine organisms are well-established sources of natural alkaloids. Although the term 'alkaloid' seems puzzling and is prone to scientific controversy, alkaloids are generally defined as nitrogencontaining compounds derived from plants and animals. Relatively few alkaloids from marine sources have been found to possess antiretroviral properties and, so far, none have found their clinical use.", "Marine organisms are well-established sources of natural alkaloids. Although the term 'alkaloid' seems puzzling and is prone to scientific controversy, alkaloids are generally defined as nitrogen-containing compounds derived from plants and animals. Relatively few alkaloids from marine sources have been found to possess antiretroviral properties and, so far, none have found their clinical use.", "So far, the main anti-infectious activities documented for the fucose-containing SP are those against viruses [54] . More importantly, these polysaccharides are selective inhibitors of various enveloped viruses, including HIV [54] [55] [56] . FCSP acts during the early phase of infection by blocking the virus attachment and entry into the host cells, but may also inhibit subsequent replication stages in vitro [57] ." ] },{ "paper_id": "09db5b9c6d7c4f5d804c532939fb4f824c409bb6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "[B]", "[C]", "[D]" ] },{ "paper_id": "09de57e5401565a1e80361d32b09ce66b3a988c8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A.A.Q); m.mckay@ust.hk (M.R.M.) \u2020 These authors contributed equally to this work.", "All sequence and immunological data, and all scripts (written in R) for reproducing the results are available online [33] ." ] },{ "paper_id": "09e25e413faba97b87efc701d1ab8d2a18386efb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "09e56ff472829444bd7a1670f61fb696fac7ba2c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "09e8d6985e74029c794e543bde68fba0d07133a4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "09f23fe560ba923e5960707d0b4451df85253b36", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study was carried out in strict accordance with the recommendations by Public Health Service Policy, United States Department of Agriculture Regulations, the National Research Council's Guide for the Care and Use of Laboratory Animals, and the Federation of Animal Science Societies' Guide for the Care and Use of Agricultural Animals in Agricultural Research and Teaching. All the relevant institutional, state and federal regulations and policies were followed regarding care and use of animals at the Ohio State.", "All data were expressed as the mean value of 4 or 5 pigs \u00b1 SEM. Statistical analyses were performed using the GraphPad Prism 6 software by applying one way ANOVA followed by the Tukey's t-test. The statistical significance was considered at P < 0.05.", "Mycobacterium vaccae (ATCC#23027) was grown in endotoxin free 7H9 medium at 37 \u00b0C in accordance with ATCC instructions, and the whole cell lysate (WCL) was prepared as previously described [28] . CpG ODN 2007 (TCGTCGTTGTCGTTTTGTCGTT) in phosphorothioate backbone was custom prepared (Integrated DNA Technologies, IA, USA). Five conserved T cell peptides of PRRSV, nsp10 (aa 2578-2628) CPGKNSFLDEAAYC-NHL and (aa 2554-2604) VRILAGGWCPGKNSFLD; Nsp9 (aa 442-492) VRGNPERVKGVLQNTRF [29] ; GP5 (aa 445-489) KGRLYRWRSPVIIEK [30] ; and N (aa 187-213) VRHHFTPSE [31] were custom synthesized (Thermofisher Scientific, NY, USA)." ] },{ "paper_id": "09f32524e7d13409a47b77c3f7af60251df282f6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The International Atomic Energy Agency (IAEA) standard soil 7 was equally pressed in similar manner as samples and these were used for quality assurance.", "Hospital wastes are generated as a result of patients' diagnosis and/or treatment or immunization of human beings or animals. Hospital wastes are a universal set having subsets like infectious and hazardous wastes.", "Soil is a very specific component of the biosphere because it is not only a geochemical sink for contaminants, but also acts as natural buffer controlling the transport of chemical elements and substances to the atmosphere, hydrosphere and biota. However, the most important role of soil is its productivity, which is the basis for the survival humans (Kabata-Pendias and Pendias 2001)." ] },{ "paper_id": "0a00a6df208e068e7aa369fb94641434ea0e6070", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "As such, BCG-Prague is a natural phoP mutant.", "The mycobacterial strains used in this study were: ", "ASL, VT, ZW, and XY performed the experiments and participated in data analysis. DCA participated in data analysis and co-authored the manuscript. GFG oversaw the experiments. BZ oversaw the experiments and participated in data analysis. JL oversaw the experiments, analyzed the data, and wrote the manuscript." ] },{ "paper_id": "0a01f5cf1c5cdc2711bcef74315dc54a6e143df0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supporting information S1 Table. SELDI-TOF " ] },{ "paper_id": "0a037565ead5cb2ee8dbdd7f6a0e381dd4b7ad83", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Tissues sections from a total of 10 juvenile and 10 adult LBBs were subjected to lectin histochemistry for the detection of influenza virus receptors. No differences in SA receptor distribution between the juvenile and adult LBBs were found.", "Bats act as natural reservoirs for a variety of zoonotic viruses and they coexist with viruses through several mechanisms including elevated metabolism and body temperature 24 . It is believed that this unique feature of bats leads to the selection of viruses that adapt better at higher body temperature, and hence are more virulent to humans 24 . Bats carry a number of RNA and DNA viruses asymptomatically, and the detection rate of new viruses or virus sequences seems to be much higher in bats than any other mammals 25 . The perfect equilibrium between various zoonotic viruses and bats have been studied extensively in the past two decades 7, 26 .", "Published: xx xx xxxx OPEN www.nature.com/scientificreports/ 2 Scientific RepoRts | 7: 660 |", "The prospects for bats contributing to IAV epidemiology came to light after the identification of two novel influenza-like viruses in fruit bats by next generation sequencing 10 . These two viruses are genetically distinct from all previously known IAVs and hence are designated as novel subtypes, namely H17N10 and H18N11. These novel IAVs have been recently recovered in cell culture using synthetic DNA 11 . However, these HA and NA subtypes have not been identified in birds serologically or virologically. Consequently, the reservoir(s) of these novel IAV subtypes is still undefined. Phylogenetic studies raised a possibility that bats have the capacity to harbor more influenza virus genetic diversity than all the other mammalian and avian species combined 10 . In addition, it was demonstrated that little yellow-shouldered bats in Central America could constitute a potential sylvatic mammalian reservoir of influenza 12 . Susceptibility of bats to IAVs has been confirmed by recent serological evidence of AIV H9 subtype in about 30% of frugivorous bats from Africa 13 . It is worth noting that detection of antibodies against one AIV subtype in 30% of the bats tested is very significant." ] },{ "paper_id": "0a05a7b95ce42f0b53c86a24842ecc9845a7d023", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Viral stocks were prepared and maintained as previously described [37] . Recombinant mKate-RSV expressing prototypic subtype A (strain A2) F genes and the Katushka fluorescent protein were constructed as reported by Hotard et al. [38] . HEp-2 cells (ATCC, VA) were maintained in Eagle's minimal essential medium containing 10% fetal bovine serum (10% EMEM), supplemented with glutamine, penicillin and streptomycin.", "Maxisorp plates (Nunc, 96 well) were coated with DS-Cav1 at 1\u03bcg/ml in PBS at 4\u02daC overnight.", "Supporting information S1 " ] },{ "paper_id": "0a0afb5dc02afa81689e0e75afe2f9a21ce09e70", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0a0cbd4cb08c862deadcb5aaef22a27b770c0791", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A total of 225 infants hospitalized with respiratory symptoms were enrolled from September 2005 through May 2006. Samples from 222 children were available for study in both sites; three specimens were only available for RMA testing. Study children were 57% male with a median age of 13 weeks [IQR 7-33 weeks]. The admitting diagnoses of these infants were bronchiolitis (58%), upper respiratory infection (33%), and other (9%)." ] },{ "paper_id": "0a11a6e99c61da77f540fa28b3ab843761537711", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Inflammatory lung disease, also called COPD, includes a wide range of lung ailments. These related diseases include asthma, pulmonary fibrosis, and chronic bronchitis. They are influenced by a combination of environmental, genetic, and epigenetic components [82] . COPD is a chronic inflammatory disease of the airways. This disease is hallmarked by airflow that is not fully reversible. Systemic and local airway inflammation has been implicated in the pathogenesis of COPD [83] . COPD is mainly associated with tobacco smoking, and recent studies investigating the pathophysiology of emphysema have demonstrated that cigarette smoke can cause cells to enter cellular senescence.", "Moreover, Ezzie et al. researched the difference of miRNA profiles expressed in the lungs of smokers with and without COPD. They concluded that miR-223 and miR-1274a were the most affected miRNAs in subjects with COPD [126] . Yet, COPD is a complex, multi-component, and heterogeneous disorder with a number of different pathological processes and subgroups with their own characteristics and natural history [133] . A better understanding of the complexity of the disease and potential clinical relevance of the identified miRNAs is needed.", "On the other hand, lipid-based vectors can also induce toxicity and non-specific activation of inflammatory cytokine and interferon responses [62, 63] . Although polymer-based vectors elicit a relatively less strong immune response than lipid-based vectors, effective siRNA delivery to a local area in lung diseases requires more attention to the development of non-toxic delivery vectors. An important point for siRNA-mediated inhibition of gene expression is whether the observed effects are specific rather than due to off-target effects and free from potential interferon responses [64, 65] . Interestingly, some studies have shown that it was possible to administer \"naked siRNAs\" to mice and down-regulate an endogenous or exogenous target without inducing an interferon response [66] ." ] },{ "paper_id": "0a124d3aa26def70b2db71f68c89dfe1996daf3e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We used the rubella virus with its G-and C-rich RNA genome (JN635295) to illustrate the skew plot analysis (Figure 1) .", "Data Availability e relevant databases ViralZone and GenBank used to support the findings of this study are included within the article (Materials and Methods). e GenBank IDs of the sequences are provided in the figures. e software used is mentioned by the references as provided by MAFFT and MEGA. Nucleotide randomization was performed by a BioWeb server application. e GenSkew algorithm was provided by Dr. T. Rattei. A web server version can be found at http://genskew.csb.univie.ac.at/.", "e authors declare that they have no conflicts of interest. " ] },{ "paper_id": "0a1533470817bc5ef0d0d0af56386a96b505dc0d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: Salmonid fishes are among the most widely studied model fish species but reports on systematic evaluation of reference genes in qRT-PCR studies is lacking.", "PAO was responsible for the experiment, data analysis and drafted the manuscript. KKL conducted the real-time RT-PCR analysis, and contributed throughout the experimental process. AEOJ constructed the qPCR assays for two of the genes. TON provided the cDNA from the smoltification experiment. IH participated as a supervisor in the study design, analyses and writing. " ] },{ "paper_id": "0a24f22d8d49dc503c52d43dbc51459fc06fbb14", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "sGP Can Subvert the GP 1,2 -specific Antibody Response", "Mutant ZEBOV GP plasmids for DNA immunization experiments were prepared using the EndoFree Plasmid Mega Kit (Qiagen) as per manufacturer instructions and redissolved in pure endotoxin-free water at a concentration of 4-6 mg/mL, and purity was verified by restriction analysis and spectrophotometry. For immunization, DNA was diluted in sterile PBS to 0.5 mg/mL and filter sterilized. Female BALB/C mice (Charles River Laboratory) at six mice per group received 50 mg of DNA intramuscularly (25 mg/leg) per immunization. Anesthetized mice were bled retroorbitally two weeks after each immunization and serum samples were stored at 280uC until use.", "sGP Differentially Interferes with Antibody-mediated Viral Neutralization by Antisera from sGP and GP 1,2 Immunized Mice", "Ebola virus (EBOV) is an enveloped single-stranded negative-sense RNA virus in the order Mononegavirales, which along with the Marburg virus (MARV) forms the Filovirus family. EBOV is the etiologic agent of Ebola Hemorrhagic Fever (EHF), a highly lethal hemorrhagic fever with up to 90% mortality [1] . Since its discovery in 1976, EBOV has caused sporadic outbreaks in Sub-Saharan Africa with death tolls in the hundreds. Interestingly, while filoviruses have been only recently discovered, they are one of the few non-retrovirus RNA paleoviruses identified in mammalian genomes, suggesting an ancient relationship with mammals [2, 3] . Growing evidence suggests that bats are the natural reservoir of EBOV in the wild today [4] [5] [6] ." ] },{ "paper_id": "0a3ef8eca5d6cd4d7a0fef83335cc02a2347492c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Protein samples were analyzed by performing electrophoresis on a 12% (w/v) SDS-polyacrylamide gel electrophoresis (SDS-PAGE) gel. For the immunodetection of the His-tag-fused scFv proteins, a monoclonal anti-His antibody conjugated to horseradish peroxidase (HRP) (Sigma-Aldrich) was used. An ECL kit (Amersham ECL Prime Western Blotting Detection Reagent, GE Healthcare) was used for signal detection.", "For enrichment of cells producing FlAsH tag (FLNCCPGCCMEP) from non-specific cells, cells harboring pMoPac16-MBP were diluted with non-specific cells harboring pMoPac16 at 1:10000 ratio. After labeling with with 25 mM of FlAsH-EDT 2 (Invitrogen), the mixed cells were applied to FACS and the fluorescent cells were sorted by the repeated FACS screening as described above.", "The GST-fused antigens were mixed with 0.05 M carbonatebicarbonate coating buffer (pH 9.6) to a final concentration of 2 mM. The antigen solution (100 mL) was loaded onto 96-well ELISA plate, which was then incubated for 2 h at 37uC. Subsequently, each well was washed four times with PBS-T (135 mM NaCl, 2.7 mM KCl, 4.3 mM Na 2 HPO 4 , 1.4 mM KH 2 PO 4 , and 0.5% Tween-20 at pH 7.2) and filled with 200 mL of 5% BSA solution, and the plate was incubated for 1 h at 37uC. After washing with PBS-T four times, each scFv sample (soluble lysate or purified sample) was loaded on to the plate, and the plate was incubated overnight at 4uC. Each well was washed four times with PBS-T, after which 1:5,000-diluted monoclonal Anti-His antibody conjugated to horseradish peroxidase (HRP) (Sigma-Aldrich, ST. Louis, MO) was added, and the plates were incubated for 1 h at 37uC. Finally, the wells were washed with PBS-T, and tetramethylbenzidien (TMB) was added for the colorimetric detection of the bound scFv clones. The reaction was arrested by adding 2 M of H 2 SO 4 stop solution. The absorbance was measured at 450 nm by using a TECAN Infinite M200 Pro ELISA plate reader (Tecan Group Ltd., M\u00e4 nnedorf, Switzerland). To confirm binding activity of scFv against inactivated whole FMDV, an FMDV serotype O kit (PrioCHECK FMDV type O, Prionics, Switzerland) was used; ELISA was performed in the same manner with the exception of the antigencoating step. " ] },{ "paper_id": "0a41b85153ef8a084f7b3476d4d38832f533e914", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Student's t-test for paired data was used to test for differences. Data given are the means and bars show standard deviations. Body weights were compared using non-parametric Wilcoxon-Whitney and Kruskal Wallis tests. All statistical calculations were performed with SAS vs. 9.1. (SAS Corporation, Cary, NC).", "Conclusions/Significance: siRNA treatment has potential for both prevention and early treatment of EHV-1 infections." ] },{ "paper_id": "0a4a2763f35864555a20b296c1daf1614f09e28f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The animal studies strictly followed the recommendations in ''Guide for the Care and Use of Laboratory ", ".", "been previously identified as an antifungal agent, was chosen for further study (Figure 4 )." ] },{ "paper_id": "0a4f30f5fd02ad89dc9ba18964325c6738807465", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Means and standard deviations were used to describe the distribution of continuous variables. Percentages were used to describe the distribution of categorical variables. A chi-square test was performed to examine the differences in educational background and MERS-related knowledge, diagnosis, and prevention between different major groups among medical students. SAS 9.3 (SAS Institute, INC, Cary, NC) was used for all statistical analyses.", "A structured questionnaire was adapted from the information released by the National Health and Family Commission of China and a previous MERS-related survey [7] . The questionnaire was comprised of 18 items including demographics and knowledge about MERS in three areas: diagnosis, treatment, and preventive measures. Response options for questions on knowledge about MERS included \"Yes\", \"No\", and \"Don't know\". A knowledge score was calculated by giving +1 for the correct answer (Yes/No), and 0 for \"Don't know\", with the highest possible score being 18. Higher scores indicated a greater level of knowledge.", "Our study had several limitations. Firstly, lacking the information about students' sources and the accessibility/availability of MERS-related knowledge (e.g., TV/internet/newspaper, etc.), as well as the varying levels of exposure (e.g., media/news time/day) to media, could be a limitation that potentially affects the reliability of the results. For example, the difference of knowledge scores between students in different majors could be confounded by students' individual habits of accessing information from media. Second, we did not have a general population for comparison. A comparison group consisting of randomly sampled non-medical general population might be needed in the study design to better understand the findings. Future studies addressing those points are warranted." ] },{ "paper_id": "0a4f344f96d5a21e3d0f33e199983738c37a1631", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The transition part, describing changes in state, is obtained from", ": : : : : : : : :", ": : : : : : : : : :" ] },{ "paper_id": "0a4ff36a0de0c6c9efdcc2f20e3223a31e4c05a0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "SRTI was assessed according to respiratory failure confirmed by an abnormal blood gas analysis result (based on the potential of hydrogen, partial pressure CO2, partial pressure O2, an oxygen saturation level of approximately 90% or less and the need for oxygen therapy) or by being a patient in intensive care unit (ICU) for mechanical ventilation treatment [14] ." ] },{ "paper_id": "0a617f5467e92a9a638ee23204247128635e32aa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "https://doi.org/10.1371/journal.pone.0204865.g001", "d\u00bdPlk1 dt \u00bc k 9 \u00bdmass s \u00bdCycB\u00f01 \u00c0 \u00bdPlk1\u00de \u00c0 k 10 \u00bdPlk1; \u00f011\u00de", "https://doi.org/10.1371/journal.pone.0204865.g008", "Similarly, I B (\u00c1) is an indicator function on the blood sites B, Table 5 summarizes all the parameter values in the reaction-diffusion module (31)-(36)." ] },{ "paper_id": "0a6d27149c1fc958d4f6a598cc165a7cb0ee0185", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Staphylococcus is a gram-positive bacterium that affects a wide range of avian species and widely spreads in poultry rearing environments, and presents itself as a part of normal flora of mucous membranes.", "Escherichia coli (E. coli) is a gram-negative, non-spore-forming, rod-shaped bacteria that grows both aerobically and anaerobically, and many strains are motile and have peritrichous flagella.", "E. coli is a ubiquitous micro-organism that is wildly spread in poultry environments and is a normal inhabitant in poultry microflora. Some E. coli strains such as avian pathogenic E. coli (APEC) cause collibacillosis that could be either systemic or localized. It is widely accepted that Collibacillosis is the most common infectious bacterial diseases of poultry of all ages [79] ." ] },{ "paper_id": "0a789bc7f1713d549288d3effb72ff34cd3b0ab0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Images were obtained using a Axio Observer inverted microscope and a Compact Light Source HXP 120C with Filter set 49, 10 and 20 for blue, green and red fluorophores respectively (Zeiss) Image analysis was done using ImageJ version 2.0.0-rc-43/1.50e. Initial calculations were performed in Excel for mac version 15.18, afterwards data was transferred to Graphpad Prism 6 for further analysis." ] },{ "paper_id": "0a851d4005336287cd41901a8fcd0ba3bab686c9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Infected cells :", "Data were extracted using www.WebPlotDigitizer.com. We fit each data set with a single virus model using custom-written software in Octave 3.6.4 [60] that uses either the leasqr function, which uses Levenberg-Marquardt nonlinear regression, or the nelder_mead_min function which uses Nelder-Mead minimization to minimize SSR.", "Eclipse cells :" ] },{ "paper_id": "0ab32c7726deaff1ef10c2ee762c2cb917d92929", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Virion from culture supernatant was harvested and concentrated by centrifugation and viral RNA was extracted and purified using the QIamp viral RNA kit (Qiagen, Germany). For each virus, an aliquot of 15 mg RNA was run on a 10% SDSpolyacrylamide/Bis gel under denaturing and reducing conditions at 150 V for 4 hrs at room temperature. The gel was washed with distilled water, stained with ethidium bromide before the photo was taken.", "Respiratory tract infections remain the main infectious disease of humans and account for a large proportion of public health spending worldwide. Despite recent success in discovery of novel respiratory pathogens during the last decade [16] [17] [18] , there is still a substantial proportion of RTIs remaining undiagnosed.", "His throat swab was taken on August 21 for virus isolation as described below.", "Immunofluorescence antibody testing (IFAT) and virus neutralization assay were conducted as previously described [5] . Briefly, for IFAT a freshly confluent monolayer of MDCK was infected with KamV and at full CPE, the infected cells were harvested, washed four times and suspended in sterile PBS at a cell concentration of approximately 3000 cells per millilitre. An aliquot of the infected cell suspension was carefully spotted onto each well of Teflon coated slides, followed by air-drying over a warm plate and subsequent fixation in cold acetone for 10 min. Serial 2-fold dilutions of serum samples were then added to detect specific reactivity. For detection of IgM, IgG was removed by absorption with protein A prior to serum dilution. Bound antibodies were detected using fluorescein conjugated rabbit anti-human IgM or IgG (Dako, USA). Specific reactivity/labelling were read under a UV fluorescence microscope (Olympus BX50, Japan). For VNT, serial 2-fold dilutions of control and test sera were prepared in duplicate starting at 1:10. An equal volume of virus working stock containing 150 TCID 50 was added to the diluted sera and incubated for 30 min. The pre-incubated virus/ serum mix was added to confluent cell monolayers and incubated for 1 h. The inoculum was removed, monolayers washed three times with PBS and cell media replaced. Ability of sera to neutralize virus was determined by scoring the extent of CPE observed in duplicate wells three days later.", "The family keeps a couple of chickens in the backyard and a few pet birds in the patio. A week prior to the onset of S1's illness, his wife bought 6 chickens from a neighbour and one of them died on day 2 of illness.", "In conclusion, the discovery and characterization of KamV corroborate our previous work on MelV and demonstrate the increasing risk posed by unknown bat viruses which are capable of infecting and causing disease in humans. This further highlights the urgent need to systematically survey bat-borne viruses in the international community so as to enable us to conduct more effective risk assessment, to provide forecast for potential future outbreaks and to devise better prevention and control strategies." ] },{ "paper_id": "0abbc904e7a1b2e1c3ea7be75ee2a61931e0a941", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Enteroviruses (EVs; genus Enterovirus, family Picornaviridae) are small positive-sense RNA viruses that include human enteroviruses, which comprise more than 100 serotypes and are among the most common pathogens that infect humans worldwide, especially children 1 . Most EV infections are asymptomatic, but some may lead to illnesses, ranging from mild to more severe, or even life-threatening, such as hand, foot, and mouth disease (HFMD), aseptic meningitis, encephalitis, myocarditis, pancreatitis, acute flaccid paralysis, and neonatal sepsis 1 . In recent years, outbreaks of HFMD caused by enterovirus A71 (EV-A71) or coxsackievirus A16 have occcured in China and several countries in Southeast Asia 2-6 . To date, there are no approved specific antiviral therapies available to treat diseases caused by EVs. Thus, there is an urgent need to identify safe and broad-spectrum drugs against existing pathogenic EVs.", "The data used to support the findings of this study are included within the article.", "We selected two well-studied compounds with different viral targets, to aid in the assay optimisation. Pleconaril is an enteroviral capsid inhibitor that inhibits enterovirus replication by blocking virus uncoating and release of viral RNA into cells 7,8 . Pleconaril was recently reported to have anti-enterovirus efficacy in the treatment of neonatal sepsis 9-11 . Rupintrivir (also known as AG-7088) is an irreversible inhibitor of the picornaviral 3 C protease, with demonstrated activity against rhinoviruses and several EVs 12-14 ." ] },{ "paper_id": "0ac675fdff45bfddf5aea34d37f58ad7df4f78b9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Comparative genomics of HAdV-B14p and two HAdV-B14p1 strains", "Amplified genomic fragments were purified using agarose gel electrophoresis with a QIAquick gel extraction kit, as per the manufacturer's instructions (Qiagen, Ltd.; Germany). Sangerbased DNA sequencing reactions were performed bi-directionally using an ABI Prism Big Dye Terminator v3.1 Cycle Sequencing Ready Reaction kit and AmpliTaq DNA polymerase (Applied Biosystems, Inc.; Foster City, CA). DNA sequencing ladders were resolved using an ABI 3730 DNA sequencer (Applied Biosystems, Inc.; Foster City, CA). Unresolved and ambiguous sequences were re-sequenced with additional custom primers located adjacent to the regions in question.", "Presented in Table 3 are the percent identities of select proteins spanning the genome. Proteins from all prototype genomes from all HAdV species are represented, with one from each but including all subspecies B1 and B2 prototypes. One chimpanzee adenovirus (SAdV-B21) is included, as it segregates into the subspecies B1 subclade." ] },{ "paper_id": "0acc757154434d8afc870e55c010962a61cc0af3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Additionally, there has been an increased focus on minimising the impact of false-negative results; i.e., assuring that negative results truly represent absence of PCR diagnostic targets. This is because false-negative results can occur from failure of one of the test steps (nucleic acid extraction, reverse transcription reaction, PCR set up or amplification)." ] },{ "paper_id": "0add910e9efb81f7b906101a7790b812074dc8b3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A panel of 39 individuals was studied; 35 western chimpanzees, two eastern chimpanzees, one central chimpanzee, and one individual of unknown geographical origin. This study was approved by the Stanford University administrative panels on human subjects in medical research and laboratory animal care.", "Allele frequencies for C1-bearing HLA-B allotypes are from the Allele Frequency Net Database [69] ; when no population data were available, the country listed in the IMGT-HLA database [68] is given.", "The B46 distribution map was generated using the GMT software package [70] and a previously developed script [71] ; for this distribution, only anthropology studies were used, and data from recent migrant populations were discarded when the geographical location of the pre-migration population could not be precisely ascertained.", "The 3DL3 and 2DL8 genes are represented on each of the sequenced KIR haplotypes by alleles that encode the same", "Recombination events with HLA-C introduced V76 into three N80 HLA-B allotypes ( Figure 6C ). Of these HLA-B*46 rose to high frequency in Southeast Asia ( Figure 6C ), where it originated ( Figure 6D ) [44] following the arrival of modern humans ,55-65,000 years ago [45] . During this selective sweep B*46 further diversified by point mutation to give 14 low-frequency subtypes ( Figure 6C ). The B*46 frequencies of 25.4% and 22.9% in the Yunnan Dai and Guizhou Miao, respectively, are the highest for any HLA-B allele in populations exceeding one million individuals, being of a magnitude typical for small, isolated or bottlenecked populations ( Figure S4 )." ] },{ "paper_id": "0ae65070d7cbfa7b5454181af026a8ea7391d5d2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Female inbred BALB/c mice were used for the assessment of immunogenicity and ZIKV challenge. Mice were purchased from either Envigo (Bicester, UK) or from Charles River (Wilmington, MA, USA).", "The preparation of MVA vaccine stocks was performed by the infection of permissive CEF cells at low multiplicity of infection (M.O.I.). The supernatants were collected and the remaining cells lysed by successive rounds of freezing and thawing. The released virus was further concentrated by centrifugation through 36% (w/v) sucrose cushions and titres determined by routine plaque assay in DF-1 cell monolayers [24] .", "Week 0 " ] },{ "paper_id": "0aef63f4f4c4cb195e71b50d0c6e721aba9f2a81", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Antibody-dependent enhancement (ADE) is a mechanism by which viruses, such as dengue, HIV and Ebola, gain entry into some target cells through the use of host antiviral humoral immune responses [1] . Here, we studied the ability of severe acute respiratory syndrome coronavirus (SARS-CoV) [2] to use ADE mechanisms to enhance its infectivity towards cells of the hematopoietic lineage." ] },{ "paper_id": "0b0208d63d06379d846edf649d47041fc2c1aa86", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ethical approval for this study was obtained from the Institutional Review Board (IRB) of the Chinese Center for Disease Control and Prevention. The IRB approved that verbal consent should be obtained from all participants. Subjects from whom consent was obtained were asked to complete the questionnaire.", "The novel influenza A(H7N9) virus has caused 2013 spring and 2013-2014 winter waves of human infections since its first emergence in China in March 2013. Exposure to live poultry is a risk factor for H7N9 infection. Public psychobehavioral responses often change during progression of an epidemic.", "(DOCX)" ] },{ "paper_id": "0b05d3ede3351f8b3edb22c74b0cfe933ba408c1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For the detection of ZEBOV-GP specific antibodies in mouse sera, soluble ZEBOV-GP antigen (ZEBOV-GPDTM) was produced and used in an enzyme-linked immunosorbent assay (ELISA) as described before [32, 33] . For the detection of VSVspecific antibodies VSV was propagated in Vero E6 cells. VSV particles were harvested after 48 hrs, purified by centrifugation through a 20% sucrose cushion and treated with 0.05% Triton-X100 in PBS prior to storage at 280uC. The ELISA used VSV antigen in a 1:100 dilution. Sera from mice infected with MA-ZEBOV were inactivated by c-irradiation as per standard operating protocol.", "Animals were handled in the Biosafety Level 4 (BSL4) containment space of the Integrated Research Facility (IRF) at the Rocky Mountain Laboratories (RML), Division of Intramural Research (DIR), National Institute of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH). Research was conducted in compliance with the guidelines of the NIAID/ RML Institutional Animal Care and Use Committee (IACUC). The facility, where this research was conducted, is fully accredited by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) with approved Office of Laboratory Animal Welfare (OLAW) assurance (#A4149-01). Research was conducted under a protocol approved by the IACUC. All procedures were conducted by trained personnel under veterinary supervision, and all invasive clinical procedures were performed while animals were anesthetized. Endpoint criteria, as specified by the IACUC approved scoring parameters, were used to determine when animals should be humanely euthanized.", "One-way ANOVA was performed using Prism 5 (Graph Pad Software Inc.)." ] },{ "paper_id": "0b0ce0d563375eba593f552fc31f82289982c829", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The ADHS' Human Subjects Review Board determined this surveillance was part of public health practice." ] },{ "paper_id": "0b104ed7194e21c4ba47460db675b638b0d29bc4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All data generated or analysed during this study are included in this published article.", "reported in metabolic diseases where it decreased adiposity, serum insulin and increased insulin sensitivity 16, 17 ; and in renal diseases where it decreased acute renal injury and fibrosis 18 . It has recently emerged that apelin has pro-tumorigenic effects in various cancer models possibly by promoting angiogenesis and that inhibition of the apelin pathway was protective against tumour growth 14, 19 . However, these beneficial effects of apelin peptides are limited by the rapid in vivo metabolism.", "Oxidation of the methionine residue in [Pyr 1 ]apelin-13 was identified, however since this modification was also observed in the extracted standards, it could not be ascertained if they occurred in vivo or as an artefact of the extraction process." ] },{ "paper_id": "0b137fde2327ae4665db6aef52d1c98fc4053864", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "CV % = standard deviation mean * 100 3", "(iv) Detection limit (limit of detection, LoD): the lowest amount of analyte in a sample which can be detected but not necessarily quantitated as an exact value.", "Despite being an important issue for the GMP production of ATMPs, in the literature, there are few papers regarding specific validation strategies [6] [7] [8] with very different approaches.", "(i) Specificity: the ability to assess unequivocally the \"analyte\" in the presence of components which may be expected to be present. Typically these might include impurities." ] },{ "paper_id": "0b14aca39651cc93fb2ca56a4ab433f57716ca37", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A particular problem are infections that are troublesome during pregnancy. There are few cases of cytomegalovirus (CMV) infection filed as OD. On the other hand, there are strict regulations concerning infectious diseases in pregnancy. For example, pregnant women with no natural immunisation against CMV need to stop working with young children in kindergartens or hospitals [43, 44] . It is beyond the scope of this analysis to decide whether these regulations are effective, as no systematic evaluation exists.", "A total of 124 influenza-related claims were registered throughout the whole period and 48 were confirmed as OD (Table 3 ). There was a spike during the H1N1 pandemic in 2009 (53 claims).", "A descriptive retrospective observational study was carried out about the mandatory claims and the confirmed ODs of infectious diseases of HWs, covering the last 22 years using insurance data." ] },{ "paper_id": "0b180c5c5edf329811114548e19a708303e7c1c2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cells were plated at a density of 10 4 cells/well in 2%FBS/ Medium in 96-well plates and were allowed to adhere overnight.", "Methods S1 Quantitative RT-PCR of TLR3 and apoptosis measurements in hPAECs. (DOCX)", "Numerical values are given as means 6 SD of n cells. Intergroup differences were assessed by factorial analysis of variance with post hoc Fisher's least significant difference test or Student's t-test (p values ,0.05 were considered significant).", "The major function of the vessel-forming endothelial cells is to maintain the blood-tissue barrier. Viral RNA has been identified as a pathogenic factor in different pulmonary diseases [39, 40] ." ] },{ "paper_id": "0b1af480d35b739da799df76a25463bc2ee4bbe5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The green pigment synthesized during conidiation in T. marneffei is dihydroxynaphthalene melanin" ] },{ "paper_id": "0b227d1996bc5dfd895b43f6c6e2449c58252c67", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The response rate to our survey questionnaire was relatively low (37.4%, N = 174); therefore, the results might be biased. However, our findings were similar to the findings reported by a study in the United Kingdom on the same topic [39] .", "Thus, our findings are relevant for other prefectures and are a good estimate for the level of preparedness among PCPs in Japan.", "Many PCPs (71.3%; n = 124) isolated patients with influenza-like illness from other patients, either using different consultation rooms or a physical barrier, and almost all institutions (94.8%; n = 165) provided pandemic vaccine to their patients." ] },{ "paper_id": "0b22db40e9e78fb29f6ae2938ed8ee2d00cd46b2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Turbidity measurements of \u03c66 following the procedure described by Oster (1951) demonstrated that \u03c66 surface charge is negative at pH 7 (spectra not shown).", "42" ] },{ "paper_id": "0b26d9ec6dfae866ae3f1a3f773036b1c8627147", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Accession number(s). The complete genomes of strains BR-I and Ma5 have been deposited in GenBank under the accession numbers KY626044 and KY626045, respectively.", "Because vaccination is a core tool for controlling AvCoV infection and due to the range of variables to be considered for this process (8) , the integration of experimental, field, and genomic data could improve the process of developing vaccines and predicting their behavior.", "This work was funded by CNPq (Brazilian National Board for Scientific and Technological Development) grants 400604/2016-7 and 301225/2013-3 and CAPES (Brazilian Coordination for the Improvement of Higher Education Personnel) grant 1841/2016. We are also grateful to the Swedish Research Links Program (grant 2013-6772)." ] },{ "paper_id": "0b3baf8685f86b7d620418cb17d29a60ce1d498a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Scanner G2505C (Agilent Technologies, US). The sample labelling, microarray hybridisation and washing were performed based on standard protocols provided by the Shanghai Oebiotech Corporation.", "Microarray data analysis is a core technology in transcriptomics and is widely used in life sciences research. This type of analysis has also made invaluable contributions to research in chickens [21] . We first used a transcriptomics approach involving microarrays to study the -01 FGFR2, TRAF2, IL1R2, FGFR3, FGF14, FGF16, TGFB3, FGF10, NFKB1, FGF13, FGF12, NFKB2, MAP3K4, RAC2, PAK1, PRKACB, AKT3, PTPN5, CACNG4, CACNG3, CACNA2D3 ", "Supporting Information S1 " ] },{ "paper_id": "0b48e310b1f5d0205ad5ffa292d950d2808185c0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The culture supernatants were collected from treated cells at the indicated time points and stored at \u221280\u00b0C. The protein levels of TNF-\u03b1, IL-1\u03b2, and IL-6 in cell cultures or mouse brain tissue lysates were measured by ELISA kits (eBioscience) following the manufacturer's instructions.", "Approximately 35,000-50,000 cases of Japanese encephalitis are reported annually in the region with 10,000 deaths, and nearly half of the survivors suffer from perpetual neuropsychiatric sequelae (3, 4) .", "Postnatal 3-4-day-old suckling BALB/C mice were infected with P3 strain of JEV. Upon onset of clinical manifestation of JEV such as poor brain response, limb paralysis, and whole body tremor, mice were killed and their brains were excised. Brain homogenate prepared in Dulbecco's modified Eagle's medium (DMEM) was centrifuged at 10,000g to remove cellular debris. The resultant suspension was filtered through 0.22 \u00b5m sterile filters to obtain viral suspension. Immediately, aliquots of filtered virus suspension were stored at \u221280\u00b0C until further use. The virus titer was determined by plaque formation assay on baby hamster Syrian kidney (BHK-21) cells as described previously (10) ." ] },{ "paper_id": "0b530925f860fe1a3191519482c19e8240834caf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The wild-type and mutant-type 3\u2032-UTRs of the ACE2 transcript were cloned into the psiCHECK-2 vector (Promega) through the NotI and XhoI restriction enzyme cutting sites. miRNA mimics were transfected into HEK293T cells using Lipofectamine RNAiMAX (Invitrogen). After 24 h, 1 \u03bcg of wild-type vector or mutant vector was transfected into ", "Plasma miRNA extraction and detection miRNAs were extracted from 400 \u03bcl plasma using an miRNeasy Serum/Plasma Kit (Qiagen, Hilden, Germany). A synthetic spike-in control, Caenorhabditis elegans miR-39 (cel-miR-39), was added to the lysed samples for internal normalization. cDNA was synthesized using the TaqMan MicroRNA Assays Kit and High-Capacity cDNA Reverse Transcription Kit (Applied Biosystems). PCR reactions were performed on a LightCycler 480 PCR system (Roche) using the TaqMan Universal Master Mix II (Applied Biosystems).", "NF-\u03baB p65/RelA-specific siRNA, p50-specific siRNA and nonspecific control siRNA were synthesized by GenePharma. The p65 siRNA duplexes (siRNA1: 5\u2032-GGACAUAUGAGA CCUUCAA-3\u2032; siRNA2: 5\u2032-CUUCCAAGUUCCUAUAG AA-3\u2032), the p50 siRNA (5\u2032-CGCCAUCUAUGACAGUAAA UU-3\u2032) or a control siRNA were transfected into cells (with a final concentration as 100 \u03bcM) with Lipofectamine RNAiMAX (Invitrogen) for 24 h, and then subsequent experiments were performed." ] },{ "paper_id": "0b65341c3090421acaac37ec4c93212277be55bb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The analysis is derived from the Ingenuity Pathways Analysis (p < 0.05).", "\u00a9 The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver" ] },{ "paper_id": "0b6962f3ef4cb5e76d6ccd144af840b6aec67474", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "https://doi.org/10.1371/journal.pone.0219428.g007", "https://doi.org/10.1371/journal.pone.0219428.g008" ] },{ "paper_id": "0b7581ab8ae5da78a11692b4c7d9399ec6dea283", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "M. bovis (ATCC 25025) and M. bovirhinis (ATCC 5189985) were purchased from the ATCC (United Kingdom (U.K.), Guernsey, Ireland, Jersey and Liechtenstein) and cultured in Heart Infusion Broth Medium (Difco, Detroit, Mich.). All isolates were grown at 37\u00b0C and 5% CO 2 for seven days in a modified standard mycoplasma broth medium [20] ", "Calves (n = 44) with or without BRD (increased respiratory rate and/or dyspnoea) were sampled for diagnostic purposes. Sampling of the calves was granted an exemption from requiring ethics approval by the institutional Animal Experiment Commission \"Dier Experimenten Commissie (DEC) Lelystad (2013111.b)\" because sampling was performed for diagnostic purposes. BAL samples were obtained as described [21] . Approximately 35-75 ml BAL was obtained from each calf after instillation of 100 ml PBS with 10% Fetal Calf serum (FCS). Foam, large purulent exudates and blood clots were removed from the BALF samples under aseptic conditions. BALF (25 mL) was centrifuged (4600\u00d7g, 10 min, 4\u00b0C). Sediment was resuspended in 0.5 mL Dulbecco's minimal essential medium (DMEM) with 5% FCS, carefully added to 1 mL freeze medium (DMEM, 50% FCS and 20% DMSO) and frozen at \u221280\u00b0C. The BALF supernatants were also stored at \u221280\u00b0C.", "Differences in PCR results were analysed for statistical significance by the non-parametric Mann-Whitney U test in the GraphPad Prism version 5.0 software, with P < 0.05 considered significant." ] },{ "paper_id": "0b7d50ddfae18226d4a66c578d9235d872c85056", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical analysis. Data are summarized as mean \u00b1 SEM or graphically displayed as box and whisker plots. Statistical analysis was performed using Prism Version 6.0c software (GraphPad). Data were analyzed using Student's t test. Spearman's rank test was used for correlation studies. P < 0.05 was considered statistically significant.", "were injected (2.5 mg per 50 \u03bc l per mouse) subcutaneously with medroxyprogesterone (Greenstone LLC) 7 days prior to infection. On the day of infection, mice were anesthetized and infected through the intravaginal route with HIV-1 BaL (10,000 Infectious Units 2.54 ng \u22121 of p24 per mouse) in a maximum volume of 20 \u03bc l. A sterile micropipette tip was used to deliver the virus and care was taken to ensure that no mucosal abrasions or tearing occurred.", "Assessment of viral load. Blood samples were collected from humanized DRAG mice pre-and post-infection every 3 days for two weeks and then at weekly intervals for a total of 16 weeks. Viral load in the whole blood was determined using the Abbott RealTime HIV-1 Test (Abbott Molecular, Inc.) with minor modifications. Whole blood specimens were collected in tubes containing EDTA solution and then frozen. To determine viral load, frozen blood samples were thawed and lysed. HIV-1 RNA was extracted following the FDA cleared test method and quantified. Although whole blood was used, no inhibition of the assay was observed based upon the performance of the internal extraction control. As the blood volumes collected were slightly variable, the values obtained were adjusted by 1 log to account for an average dilution factor of 10." ] },{ "paper_id": "0b7de7591cf59d3b9e8f9db423431c0850eb0276", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "1 Mathematical methods 1 ", "(", "In particular, 1" ] },{ "paper_id": "0b875918f93152038d3a87f24e51abc1fd99a348", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ifnw loci are also present in bat genomes and appear to have many tandem copies in species examined, unlike most other mammals [87] . Functional activities of bat IFN\u03c9 have not been described.", "Each program has advantages and disadvantages, so it is essential to carefully examine packages to determine which is most suited for a given dataset. Once the de novo assembly is completed, other software tools are employed to count reads from each sample for use in statistical analysis of transcript and isoform abundances. Several abundance estimation packages are freely available, including the Bioconductor package (composed of edgeR and DESeq) [114, 115] , and RSEM [116] and eXpress annotation [117] that provide quantitative and qualitative statistical analysis of differentially-expressed genes.", "Davis et al. [63] experimentally infected little brown bats (Myotis lucifugus) with rabies viruses and found that intramuscular infection led to rapid clinical progression of rabies, whereas subcutaneous infection led to delayed clinical progression. Notably, bats that developed rabies after subcutaneous infection were more likely to shed virus in salivary glands. Together, the data suggested that route of infection of rabies viruses among bats can influence clinical outcome and potential transmission among bats.", "In the early 2000s, a large number of Schreiber's bent-winged bats (Miniopterus schreibersii) were found dead in caves in the Iberian Peninsula, the border region of Spain, Portugal and France. Gene sequences of a novel filovirus, Lloviu virus, were detected in all 5 Schreiber's bats collected (throat and rectal swabs, brain, liver, lung) in a cave near Cantabria, Spain, but in none of 9 dead Myotis myotis bats collected at the site [71] . The authors speculated the die-off was a result of Lloviu virus infection; however, without a colony of Schreiber's bats it has not been possible to fulfill Koch's postulates." ] },{ "paper_id": "0b9583908e91f87840a0f844e7c4ebb546482c50", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The data were entered and verified using Microsoft Excel software and analysed using Stata version 12.0 (StataCorp, Texas 77845, USA) and R version 3.1.3 (R Foundation for Statistical Computing, Vienna, Austria). The categorical variables are summarized as frequencies and percentages. Different groups were compared using the \u03c7 2 test and Fisher's exact test. Student's t-test, the Wilcoxon-Mann-Whitney test and the Kruskal-Wallis test were used to compare different continuous variable between the groups. A p-value of less than .05 was considered statistically significant.", "This prospective case-control study was conducted from May to August 2016 at four major general hospitals in Quang Nam provincea rural area located in central Vietnam ( Figure S2 ). These included Quang Nam Central General Hospital, Quang Nam Provincial General Hospital, Quang Nam Northern Mountainous Region General Hospital and Quang Nam Regional General Hospital, which have approximately 2130 beds combined and serve 1,487,700 residents of Quang Nam province and thousands of people in the neighbouring districts of Quang Ngai province.", "Vector-borne infections, including emerging or reemerging infections, were frequently identified as the cause of AUF, as previously reported in Asia [1, 9] . " ] },{ "paper_id": "0b9b177210a4b23ff4745f2717083ba047a9e770", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical analyses were performed with SigmaStat 3.5 software (Systat Software) using non-parametric tests unless otherwise stated." ] },{ "paper_id": "0ba1801a150e25b029cf3c2a38573435b21dea80", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cells were harvested 24 h post-transfection and fixed in 0.1 M Cacodylate buffer containing 2.5% glutaraldehyde, post-fixed with 1% osium tetroxide, dehydrated in ethanol and embedded in Spurr resin. Thin section was cut with an ultramicrotome, stained with 5% uranyl acetate and 0.4% lead citrate. Concentrated viral samples were placed onto carbon-coated, UV-treated 200 mesh copper grids for 2 min. Sample-containing grids were rinsed for 15 secs in water, dried with filter paper, and stained for 1 min in filtered 1.3% uranyl acetate. Excess staining solution was removed by applying filter paper to the edge of each grid. Grids were allowed to dry before viewing with a JOEL JEM-2000 EXII transmission electron microscope. Images were collected at 20,0006 and 60,0006.", "The highly contagious severe acute respiratory syndrome (SARS) affected individuals in 30 countries in 2002 and 2003 [1] . Its causative agent was identified as a novel SARS-associated coronavirus (SARS-CoV) [1, 2, 3] that was initially classified as part of a separate coronavirus group [4, 5, 6, 7] , but is now described as a betacoronavirus [8] . As with most coronaviruses, SARS-CoV encodes four structural proteins: spike (S), membrane (M), envelope (E) and nucleocapsid (N) [4, 9] . Mature coronavirus particle assembly involves protein-protein and protein-RNA interactions. M, the most abundant structural protein [10] , is thought to play a central role in directing virus assembly and budding via interaction with E, S and N [10, 11, 12, 13, 14, 15, 16, 17, 18] . Translated on free polysomes, N is associated with newly synthesized viral genomic RNA to form helical nucleocapsids [19] . The M membrane glycoprotein is cotranslationally inserted into the endoplasmic reticulum (ER) and transported to Golgi complexes [20, 21] . M interacts with nucleocapsids on the cell membranes of ER or Golgi complexes [22, 23, 24, 25, 26] . In a similar manner, S and E proteins are translated on membrane-bound polysomes, inserted into the ER, and transported to Golgi complexes, where E and M interact and trigger virion budding with enclosed nucleocapsids [14, 19] . S is incorporated into virions via interactions with M. Virions accumulate in large, smooth-walled vesicles that are exocytotically released from cells [4] ." ] },{ "paper_id": "0baa7fbb346a50319eb57a4a1556c3f48938d0e6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "3) chemistry and synthetic oligonucleotides. If cloacal and oropharyngeal swabs of the same host had more than one subtype of influenza, then the infection was identified as a mixed infection.", "Where virus isolation was successful, sequence analysis [26] or hemagglutination inhibition (HI) assays [27] were performed to determine the subtype of influenza-positive samples. The Hartwell Center for Bioinformatics and Biotechnology at St. Jude Children's Research Hospital analyzed the sequences on Applied Biosystems' 3700 DNA analyzers by using BigDye Terminator (v.", "Seventeen H9N2-subtype isolates were tested using HI assays to determine the specific H9-antigenic group of the Bangladesh (12) Village-2 Ck 0 (7) 0 (7) 0 (7) 0 (7) 0 (7) 0 (7)", "Influenza A is a negative-strand RNA virus that uses aquatic birds as reservoir hosts [1, 2] and is classified by the surface proteins hemagglutinin (HA) and neuraminidase (NA). There are 16 HA and 9 NA subtypes, but not all combinations have been recovered from aquatic birds [2] . In the aquatic bird host, replication primarily occurs in the intestinal tract [3] . As such, most avian influenza viruses (AIV) cause only limited morbidity and mortality in birds. However, several subtypes, including H5N1, H7N7, H9N2, can infect the lungs and respiratory tracts of birds (and other animals), resulting in significant levels of disease and death [4, 5, 6, 7, 8, 9] ." ] },{ "paper_id": "0bb181551513e8bfdac02b7936920ac3f50d01c1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Xue et al. studied how flu changes in people with weak immune systems, who are infected for longer periods of time. Further studies are needed to reveal more about how flu viruses evolve in the more typical, shorter infections in otherwise healthy people. This kind of investigation is becoming easier because new methods are making it possible to examine the genetic material from many viruses at once. It is hoped that eventually, detecting mutations in individual infections could help predict how viruses will change worldwide, which might help researchers to design vaccines that will be more effective each year.", "We used the entire 20 mL volume of the reverse-transcription reaction as template in a 100 mL PCR reaction using KOD HotStart Reaction Mix (EMP Millipore) and a 24-primer cocktail as described in Figure 2 -source data 1 at a total concentration of 600 nM. We performed 35 cycles of PCR amplification with an annealing temperature of 55 degrees C and an extension time of 3 min.", "We purified the PCR product using 1X AMPure beads (Beckman Coulter) and prepared libraries for Illumina sequencing using Nextera XT (Illumina). We sequenced the libraries on a NextSeq 500 platform (Illumina) with 150 bp paired-end reads. We performed library preparation and sequencing in duplicate, starting from independent reverse-transcription reactions.", "The FASTQ files are available on the SRA as BioProject PRJNA364676. The computer code that performs the analysis is available at https://github.com/ksxue/parallel-evolution (with a copy archived at https://github.com/elifesciences-publications/parallel-evolution) and in Supplementary file 2 (Xue, 2017) ." ] },{ "paper_id": "0bca841af11fa978a07f916ec43b34d7c88b71c1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Changes in cell surface glycosylation are known to be associated with a large number of chronic diseases and the cancer glycans represent a very promising field for biomarker discovery [1] [2] [3] . ", "Nonasaccharide azide 1 (Fig 1B) was prepared from egg yolk followed by enzymatic hydrolysis and azidation [15, 16] . 5.1 mg (3.1 \u03bcmol) of nonasaccharide 1 were disolved in 203 \u03bcl of phosphate buffer (100 mM, pH 6.8, 1 mM MgCl 2 ). 10 units of lyophilized \u03b2-galactosidase (EC 3.2.1.23) were added to the solution. The mixture was incubated at 37\u00b0C for 3 days (TLC: 2-propanol, 1 M ammonium acetate, 2:1). After lyophilization, the residue was purified by gel filtration (Superdex 30, 1.6 x 60 cm, 0.1 M NH 4 HCO 3 , 0.9 ml min -1 ). The peak, eluting at 86 min, was lyophilized and desalted by gel filtration (Sephadex G-25, 2.5 x 15.5 cm, 5% ethanol in water, 0.6 ml min -1 ). The peak, eluting at 75 min, was lyophilized yielding 2.9 mg (2.2 \u03bcmol) of heptasaccharide 2 (70%). ", "Ethanol-fixed human trachea, esophagus, duodenal junction, jejunum, colon, pancreas, liver, ovary, uterus and vagina samples were obtained from organ donors. 18 tissue samples from 10 different individuals were used to prepare a tissue microarray (TMA) of healthy tissues. Ethanol-fixed colorectal tumor sections were obtained after cancer surgery. Formalin-fixed paraffin-embedded human NSCLC samples (n = 3 squamous cell carcinomas, n = 3 adenocarcinomas) were also obtained. A breast tumor and a lung tumor TMA (formalin-fixed; 40 tumors, 10 paired metastasis and 10 paired adjacent \"normal\" tissue) were bought from SuperBiochip (Seoul, South Korea). Formalin-fixed canine mammary tumors were obtained from \"laboratory of animal histopathology of the Nantes Veterinary School, ONIRIS) Immunostaining analysis was performed on 3-\u03bcm-thick tissue sections." ] },{ "paper_id": "0bcbf352d92ce90e1c2595fb458ded32b45002a0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Samples with high absorbance values in ELISA were also tested for hantavirus IgM antibodies and, in case of a positive result, RNA was extracted and screened by pan-hantavirus RT-PCR (Klempa et al., 2006) to target possible current infections which exhibit RNAemia.", "About 97% of people above 16 years participating in the study reported consumption of rodents and other small mammals. Professional exposure seemed not to play a statistically significant role within our study group, however, occupations in agriculture and meat preparation, usually having a higher risk for hantavirus infections (Mertens et al., 2011) , made up more than 70% of the probands, not including pupils. Many participants usually helped out in agriculture during harvest season, even if they work somewhere else, or they change occupation frequently. All these influencing variables might contribute to the postulated high exposure.", "In all 13 IgG-positive samples found to be also IgM-positive, no viral RNA was found by RT-PCR techniques. This is not surprising as hantavirus nucleic acid can be usually detected only up to 30 days after infection under good sampling and laboratory conditions (Ettinger et al., 2012; Korva et al., 2013) , while IgM can last for up to 2 years Hofmann et al., 2014) .", "Self-reported symptoms among the probands included problems common in African villages: 36% of the participants reported at least one type of recent health problem. Most common were malaria (n = 127), cough (n = 55), back pain (n = 47), and abdominal pain (n = 37). Four people reported fever. Of the hanta seropositive people four reported malaria, six reported cough, five reported back pain, two reported abdominal pain, and nine reported other symptoms. No hanta positive person reported fever only. Self-reported \"malaria\" is likely meaning symptoms that include fever. The self-reported medical information was not included into the statistical model due to the large number of different symptoms." ] },{ "paper_id": "0bd9e38537d45c72b8507471690027a78f8f4584", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "LGP2 is an RLR, and the CTD structure of the protein is similar to that of RIG-I (14) . Initial studies reported that LGP2 is a negative regulator for RIG-I signaling (15, 47) . However, knockout and biochemical studies have revealed that LGP2 functions as a positive regulator of the RIG-I pathway (48, 49) .", "Evidence also suggests that TRIM25 produces unanchored K63-linked polyubiquitin chains in response to viral infection and delivered them to RIG-I (23) . The same study also showed that the K172 residue of RIG-I was important for non-covalent binding of RIG-I with unanchored polyubiquitin chains (23) .", "HO and MO wrote the manuscript. TK and YF helped the discussion." ] },{ "paper_id": "0bdae8c38f570965cc9a630a44b7089c2a5da0ed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Antibodies. Rabbit, goat, or mouse antibodies against cyclin D1, cyclin E, phosphorylated-Rb (p-Rb) (Ser795), p21, \u03b2 -actin were purchased from Santa Cruz Biotechnology. Horseradish peroxidase (HRP)-conjugated secondary antibodies were purchased from Sigma. Fluorescein isothiocyanate (FITC)-conjugated secondary antibodies were purchased from Dako.", "Western blotting. Whole PK15 cell lysate extracts at different time points after PCV2 infection were prepared with a nuclear extract kit (Active Motif) following the manufacturer's protocol. The cell lysate extracts were diluted in 2\u00d7 sample buffer and boiled for 5 min. 20 \u03bc g of each protein extract was subjected to 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to nitrocellulose membranes. The membranes were blocked in TBST blocking buffer (20 mM Tris-HCl [pH 7.4], 150 mM NaCl, 0.1% Tween 20) containing 5% dry skim milk powder at RT for 2 h to prevent nonspecific binding. The membranes were then incubated with the antibodies raised against cyclin D1, cyclin E, p-Rb (Ser795), p21, ORF2, and \u03b2 -actin at RT for", "Scientific RepoRts | 6:27917 | DOI: 10.1038/srep27917 miRNA quantification. Total RNA was extracted from synchronized PK15 cells after PCV2 infection using Trizol Reagent (Invitrogen). Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) was used to determine the expression levels of miRNAs according to the protocol of miRcute miRNA cDNA kit (Tiangen Biotech, Co., LTD, Beijing). Briefly, the extracted RNA was polyadenylated and the first strand complementary DNA was synthesized using oligo (dT). U6 snRNA was used for normalization. The primers of miRNAs amplification include the universal primer and miR specific forward primers (ssc-miR-15a F: 5\u2032 -TAGCAGCACATAATGG-3\u2032 , ssc-miR-16 F: 5\u2032 -TAGCAGCACGTAAATATTGGCG-3\u2032 , ssc-miR-21 F: 5\u2032 -TAGCTTATCAGACTGATGTTG-3\u2032 , and ssc-miR-34a F: 5\u2032 -TGGCAGTGTCTTAGCTGGT-3\u2032 ). U6 snRNA F: 5\u2032 -CTCGCTTCGGCAGCACA-3\u2032 , U6 snRNA R: 5\u2032 -AACGCTTCACGAATTTGCGT-3\u2032 . Relative expression was analyzed using the \u0394 \u0394 Ct method." ] },{ "paper_id": "0be7b06a39aa31b27514a501ebdd477f42b0919a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "When accounting for an immediate reaction to challenge, antifragility thus contributes to fitness. A remarkable property of antifragility is the fact that, by definition, an antifragile entity will react to changes by providing a solution that is not exactly programmed. Hence it does not have a fixed fitness: its response is context and time-dependent. This type of behavior is also the hallmark of tinkering, giving credence to Taleb's reflection.", "The distribution of the length of the proteins important for stationary survival is compared in Figure 1 to that of all proteins in the E. coli proteome: it displays a remarkable bias both for short and long proteins.", "Birth, growth, maturation and senescence are the four ages of all cells. This is true of their components as well. In general the maturation step is ignored: cell's components are viewed as synthesized, used in their final form, then decaying and being either repaired or destroyed. Maturation and possibly functional improvement during ageing is rarely taken into account. Senescence and ageing are treated as equivalent. Yet, quite a few physico-chemical processes suggests that the state of cell components at any time should be seen as actively browsing through a series of ageing states. In fact, notwithstanding apoptosis (which may be a process to reset the system), most cells harbor a mixture of aged and young components, reflecting the overall history of their divisions (Figure 2 ).", "The recent dread of radioactive leaks near nuclear plants reminds us vividly of the vulnerability of life. \"Fragile\" is an epithet often associated with living organisms, perceived as delicate and easily damaged. But does this reflect reality? What would be the opposite of fragile? In a recent piece for Edge magazine [1] Nassim Taleb discussed another familiar attribute of life, tinkering. There he asserted that, contrary to the favored emphasis on intelligent engineering, \"tinkering outperforms design\". This property enables finding unexpected solutions, especially when challenged by \"normal accidents\" [2] , rare deleterious events (in terms of individual probability of occurrence) for which he himself coined the phrase \"Black Swan\" events [3] ." ] },{ "paper_id": "0bee52e6477404d2aed60b9ae06ac53bf92660de", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We next selected the 53\u00b0C treatment condition at neutral pH with different time points after incubation (0, 15, 30, 45, 60, and 120 min) to directly study the thermal stability and infectivity of all types of influenza viruses (Fig. 1C) . Significantly, only D/OK/13 was able to tolerate the high temperature of 53\u00b0C. All other types of influenza viruses, such as A/MN/08, A/CA/09 (pdm09HIN1), B/BR/08, and C/JHB/66, completely lost their capacity to survive when exposed to 53\u00b0C for 15 min (Fig. 1C) . Notably, D/OK/13 was able to maintain about 40% of its infectious titer for 2 h (Fig. 1C) . These results suggested that IDV is the most temperature-stable influenza type of all influenza virus types.", "IDV differs from all historically known influenza viruses in that it utilizes cattle as a primary reservoir. Adaptation to cattle may confer some unique features to IDV, which enhance its survival in this particular agricultural animal population. Such inherited characteristics through evolution may make IDV distinguishable from other types of influenza viruses circulating in ducks, pigs, or humans. As a first step toward identifying novel biological traits and better understanding the infection biology of newly emerging IDV, we directly compared the stability and infectivity of IDV to those of other influenza types following exposure to either high temperatures or low-pH solution. Interestingly, our experiments revealed that IDV was more resistant to high temperatures and highly acidic environments than the other three types of influenza viruses. Significantly, we found that the viral HEF glycoprotein is a primary force in dictating the exceptional stability of IDV infectivity at low pH and high heat.", "The viruses used in this study are listed in Fig. 1A , including two IAVs (originated from swine and human), one IBV (from human), one ICV (from human), and two IDVs (from cattle and swine). We started by investigating the effect of temperature on the stability and infectivity of the influenza viruses. Temperature gradients evaluated included 33\u00b0C, 37\u00b0C, 41\u00b0C, 45\u00b0C, 49\u00b0C, 53\u00b0C, 57\u00b0C, and 65\u00b0C. A temperature of 0\u00b0C was included as a control. All the viruses listed in Fig. 1A were treated under this set of temperatures for 1 h at neutral pH and then incubated on ice for another 30 min. After treatment, the infectivity of these viruses was determined by measuring viral 50% tissue culture infective doses (TCID 50 s) in MDCK (Madin-Darby canine kidney) cells using the standard protocol (6, 7) . Viral titers for all tested viruses were not impaired when treated at 33 to 41\u00b0C but started to decline at 49\u00b0C (Fig. 1B) . The 53\u00b0C treatment clearly discriminated IDV D/OK/13 (see Fig. 1A for the influenza virus strains and influenza virus abbreviations) from the three other types in that IDV retained a high residual infectivity (~2.5 log units of TCID 50 /ml), while IAV, IBV, and ICV were completely inactivated. Remarkably, IDV was still infectious when treated at 57\u00b0C, and the complete loss of its infectivity was observed only after 1 h of incubation at 65\u00b0C." ] },{ "paper_id": "0bf39c12d7c4576441079e2e758ec1eacfe015d1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "HFF cells were propagated as per standard laboratory protocols [40] .", "Recombinant human integrin \u03b19\u03b21 (R and D Systems); heparin, and fluorescein isothiocyanate (FITC) (Sigma) were used in this study." ] },{ "paper_id": "0c04a2b5c4c91d76c26736dd05ce6fc6385cc167", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The LILRA3 D1 crystal was cryoprotected in mother liquor containing 15% glycerol before being flash-cooled in liquid nitrogen. Diffraction data were collected using an in-house Xray source (Rigaku MicroMax007 desktop rotating-anode X-ray generator with a Cu target operated at 40 kV and 30 mA) and an R-AXIS IV++ imaging-plate detector at a wavelength of 1.5418 \u00c5 . The collected intensities were indexed, integrated, corrected for absorption, scaled, and merged using HKL-2000. Data collection and processing statistics are summarized in Table 1 .", "Key residues or structural elements crucial for influencing the binding affinity between Group 1 LILRs and HLAIs", "The atomic coordinates of LILRA3 D1 have been deposited in the RCSB Protein Data Bank with accession code of 3Q2C. ", "In all forward and reverse primers, a start or stop codon was introduced with NdeI or XhoI restriction sites accordingly. All of the PCR products were ligated into the pET21a vector (Novagen), transformed into E. coli strain BL21 (DE3) pLysS, and expressed in the form of inclusion bodies." ] },{ "paper_id": "0c0806be80c60f0e61f084f12ed847c265fc1d68", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data were analyzed using Stata version 11.0 (Stata Corporation) and SAS version 9.1 (SAS Institute). p-Values of ,0.05 were considered statistically significant.", "We obtained time series data on ultraviolet (UV) radiation and weather from Environment Canada monitoring stations in the Greater Toronto Area [9, 10] . Where daily readings were taken at multiple locations, the arithmetic means of environmental data were used as exposure variables." ] },{ "paper_id": "0c0e91904a6c84a7ee80cc69fe83370aaa3ca708", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Additional file 1: The questionnaire." ] },{ "paper_id": "0c1318a0ed68a50f13ef04c2cd0741d2e7016104", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "LH, JB, HSL, and HJL contributed conception and design of the study. JB and HSL performed the experiments and wrote the manuscript. YZ and JL performed the fluorescence experiments. GZ and YZ analyzed the data. LW and WJ made figures. HD, JY, and QX advised on experimental design and data interpretation. LH supervised the study, interpreted the data, wrote the manuscript and acquired the research funds. ", "HiScribe T7 Quick High Yield RNA Synthesis kit, Monarch RNA Cleanup Kit, NEBuffer 3.0, EnGen R Lba Cas12a (LbCas12a), and AhdI, EcoRI, and BamHI endonucleases were purchased from New England Biolabs (MA, United States). TaKaRa MiniBEST DNA Fragment Purification Kit Ver.4.0 and RNase inhibitor were obtained from TAKARA (Tokyo, Japan). The RAA kit was purchased from Hangzhou ZC Bio-Tech Co., Ltd. (Hangzhou, China). The constant temperature incubator purchased from Senxin (Shanghai, China) was set at 37 \u2022 C. Fluorescence intensity was measured by the Tecan Infinite M200 plate reader (Tecan, M\u00e4nnedorf, Sweden).", "The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation, to any qualified researcher.", "African swine fever (ASF) is a highly contagious hemorrhagic disease of domestic pigs and wild boars. ASF is caused by a large, complex double-stranded DNA virus, the African swine fever virus (ASFV) (Galindo and Alonso, 2017) . The disease shares similar clinical signs with classical swine fever (CSF) and several other swine diseases (Oura et al., 2013) , making its diagnosis difficult, especially outside of a diagnostics laboratory By 5 September 2019, 156 outbreaks were detected in China and 1,170,000 pigs were culled in an effort to halt further spread (Food and Agricultural Organization of the United Nations, 2019). There is no effective treatment or vaccine against ASF yet, so controlling ASF mainly relies on animal slaughter and sanitary measures (Galindo and Alonso, 2017; Dixon et al., 2019) . Therefore, accurate and timely diagnosis of ASF infections is crucial for controlling epidemics.", "Four targeted sequences were found by NCBI BLAST and Perl language programming in the conservative regions. The target sequences are listed in Table 1 . Based on these sequences, crRNAs were designed and prepared via in vitro transcription ( Table 1) . Target 1, which is located in the p72 gene, was used for subsequent tests. The in vitro cleavage results confirmed the crRNA guided LbCas12a cleavage activity of the assay (Figure 1 )." ] },{ "paper_id": "0c161375d1b822a44e873c134760ddb8600a550c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "NO, CP, and ES conceived, wrote, and edited this review. FF, ED, and BC revised and extended the parts of the text -specifically in the areas of the biochemistry and structural biology, and provided various other useful suggestions and contributions. FF prepared ", "The assumption that the viable ZF1 mutant (H229C) possesses increased ExoN activity, which could explain the reduced levels of dsRNA in infected cells, seems premature. Alternative explanations for this phenotype include changes in the efficiency or kinetics of RNA synthesis. Moreover, the reported reduction of viral double-stranded RNA accumulation by this mutant should be interpreted with caution, as this conclusion was based solely on the in situ immunodetection of dsRNA using a monoclonal antibody with a poorly defined specificity for CoV dsRNA replication intermediates. For example, it remains unknown how changes in the protein composition or subcellular localization of the RNA-synthesizing complex may affect the accessibility of dsRNA epitopes during such immunolabeling experiments.", "As mentioned above, for most of the novel metagenomicsderived nidoviruses we only know genome sequences, and their replication properties and enzymes have remained biologically uncharacterized thus far. This is clearly different for CoVs, which have a track record as an important group of (zoonotic) human and veterinary pathogens. With some exceptions (Durzynska et al., 2018) , also the structure-function analysis of the nidoviral ExoN enzyme has been based on CoV-derived variants of the enzyme, on which we will focus our attention from this point forward." ] },{ "paper_id": "0c22edd80a03a1b9de7f3d29b729ad1006d10674", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Arenaviruses have single-stranded, bisegmented ambisense RNA genomes and form enveloped virions [1] . Seven arenaviruses cause viral hemorrhagic fever in humans: the Old World arenaviruses Lassa and 'Lujo,' and the New World Clade B arenaviruses Machupo (MACV), Jun\u00edn (JUNV), Guanarito (GTOV), Sabi\u00e1 (SABV), and Chapare (CHPV) [2, 3, 4] . All of these viruses are US Select Agents and Risk Group 4 Pathogens [5, 6] . MACV, JUNV, and GTOV are also classified as US National Institute of Allergy and Infectious Disease Category A Priority Pathogens [7] . MACV causes human disease outbreak with high case-fatality rates. To date, at least 1,200 cases with <200 fatalities have been recorded [8, 9] .", "Currently there is no FDA-approved treatment to stop the spread of MACV once humans are infected. Defining interactions between the viral glycoprotein and a cellular receptor may allow for drug development that could limit viral spread in the infected individual and reduce infection during an outbreak. Our mutagenesis analysis of MACV GP1 experimentally elucidates the structure and functional interaction motifs of MACV GP1 and its receptor hTfR1. These studies therefore provide a solid platform for the future design and development of small molecule inhibitors and antivirals specifically targeting viral entry.", "Transferrin receptor 1 (TfR1) is the principle cell-surface receptor of MACV, JUNV, GTOV, and SABV [17, 18] , and a major determinant of host adaptation. However, studies on receptor use and cellular tropism suggest that the non-pathogenic Clade B viruses Amapari (AMPV) and Tacaribe (TCRV) can enter human cells in a human TfR1-independent manner [18, 19, 20] . Nevertheless, AMPV and TCRV use TfR1 orthologs of their principal host animals to infect nonhuman cells [21] . These studies reveal a complex pattern of receptor use for New World arenaviruses, suggesting the existence of additional receptor molecules, and a possible relationship between receptor use and disease potential.", "We have used purified MACV GP1 and MoMLV pseudotyped with the MACV glycoproteins in all experiments. Several studies suggest that retroviral vectors pseudotyped with the glycoproteins of arenaviruses adopt the receptor-binding characteristics of the corresponding viruses [17, 20, 27] . Therefore, we believe this surrogate system to be valuable for initial studies of viral cell binding and entry. However, it is important that the system is simplistic and uses only a few viral proteins in the absence of other viral-encoded proteins or genomic elements. Therefore, any results obtained with this system should be verified with infectious virus. Unfortunately, no reverse genetics system has been developed for MACV to date, making it impossible to evaluate the effect of the mutated residues on entry of infectious MACV.", "Arenaviral genomes encode at least four proteins from two segments (Large and Small). The Large segment encodes a matrix protein (Z) and an RNA-dependent RNA polymerase (L); the Small segment encodes a nucleoprotein (NP) and the glycoprotein precursor GPC [2] . GPC is cleaved by a cellular protease to a stable signal peptide (SSP), and two subunits, GP1 and GP2. The three cleavage products form a stable complex and mediate virus attachment to host cells and fusion of the arenavirion envelope with that of the cell [10, 11, 12, 13, 14, 15] . GP1 mediates the binding of the virion to a cell-surface receptor, whereas the class I fusion protein GP2 mediates membrane fusion after internalization of the virion into an acidified endosome [16, 17] . Interrupting the interaction of GP1 with its cell-surface receptor is a current focus of antiviral development since it would prevent the first and pivotal step of arenavirus host-cell infection." ] },{ "paper_id": "0c2489ea506fea5ac57b464c2a99f893cc867ff3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The protocol was approved by the institutional review board of each hospital.", "was based on patient self-report, which might not be totally reliable.", "On the other hand, strengths of our study include the participa- " ] },{ "paper_id": "0c3ceccabeff0296e424a649fe5931a1671f9905", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "https://doi.org/10.1371/journal.pone.0214871.g005", "Supporting information S1 " ] },{ "paper_id": "0c433c7c4e2e090b2d89d8456f9febed54b71966", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "IFITM3 were synthesized as codon-optimized genes for expression in human cells (GeneArt) and cloned into the BamHI and NotI sites of the lentivirus vector pSIN-BNHA (derived from pHRSIN-CSGW; Demaison et al., 2002) .", "Cells. A549 cells were maintained in F12 medium, and 293T, NPTr (Ferrari et al., 2003) and FLN-R cells (Friedrich-Loeffler-Institut) were grown in Dulbecco's Modified Eagle's Medium (DMEM) with 10 % FCS. Primary lung cells from the microbat (M. myotis) were grown in DMEM containing 10 % FCS, penicillin (100 units ml 21 ) and streptomycin (100 mg ml 21 ) and 20 % amnioMAX (Gibco).", "Endocytic uptake of microbat and pig IFITM3 from the plasma membrane" ] },{ "paper_id": "0c4f848837c2e8eaf750682d4195cc9076d0cef5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Leishmania infantum infection in cats in Italy PLOS Neglected Tropical Diseases | https://doi.org/10.", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111" ] },{ "paper_id": "0c589675855cd6a533025c50fb319ecd269c2d0d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All animal experiments were approved by the Hubei Administrative Committee for Laboratory Animals (permission number 00024534) and complied with the guidelines of Hubei laboratory animal welfare and ethics of Hubei Administrative Committee of Laboratory Animals.", "The one-way analysis of variance (ANOVA) was applied to analyze the experimental data. Data of three independent experiments were shown as the mean \u00b1 standard deviation (SD). Statistical significance was determined with a p-value < 0.01.", "YZ and SX designed research; YZ, KC, and DW performed research; YZ and LF analyzed data; YZ, HC, and SX wrote the paper. " ] },{ "paper_id": "0c58c5ce46bfa52188d231685cc1c6a440840b85", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The relationship between HPIV infection and neurologic disease has been studied for many decades. In a previous report, children hospitalized with HPIVs had serious febrile seizures [25] . In contrast, we found no significant difference in convulsion between HPIV-positive and HPIVnegative patients (p=0.726).", "Samples in this study were taken as part of standard care. The First Affiliated Hospital of Guangzhou Medical University Ethics Committee approved the experimental design and patient involvement in this study. Written informed consent was obtained from the patient for publication of this report and any accompanying images.", "For comparisons of categorical data, \u03c7 2 test and Fisher's exact test were used where appropriate. All tests were twotailed and p<0.05 was considered statistically significant.", "This study explored characteristics of the four HPIV types and provided novel insights into the epidemiology and clinical implications of HPIVs." ] },{ "paper_id": "0c58e0eb436a3d0cb4c5acfa41babc03b3dfe825", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The political impetus for action in response to many EIDs is not necessarily scientific evidence but societal perceptions. Indeed, in the face of scientific uncertainty and ethical ambiguity, ideological perspectives and short-term political considerations often supplant efforts to devise effective long-term interventions [28, 37] .", "(2)Ethical challenges", "(3)Legal challenges", "Rabies virus infects the central nervous systems of people, wildlife and domestic mammals. The disease is transmitted by bites from infected animals and once it becomes symptomatic, it is virtually always fatal. 55,000 people die and 7.5 million receive post exposure prophylaxis annually, costing $124 billion [91] . Rabies is endemic in much of South East Asia but its range is expanding. Focusing on Australia, the continent is free from Rabies, but the current expansion of the disease in Indonesia [92] is a genuine threat to northern regions. Although likely controllable in domestic dog populations [93] , if Rabies were to become endemic amongst wild or feral animals in this setting, current modelling indicates it would be almost impossible to eradicate [94] . Table 2 Significant historical (i.e. effectively eradicated) EIDs", "Hendra virus infection is endemic among at least two species of flying fox in Australia and causes rare, but catastrophic, human infection [85] . Loss of habitat has led to increasingly intense incursions of flying foxes into populated rural and peri-urban areas and promoted the 'spill-over' of Hendra virus into horses and then to people [86] . Hundreds of people have been directly exposed to Hendra virus, with seven confirmed human infections and four deaths since 1994. With over one hundred dead horses and persistent risk, the emergence of Hendra has had significant impact on equine and tourist industries in north eastern Australia, diverted major research resources and caused significant distress and controversy in the broader community [31, 87] .", "Severe acute respiratory syndrome (SARS) is a human respiratory infection, caused by a coronavirus isolated from Chinese horseshoe bats [95] . It was first reported in Asia in 2003 and, within a few months, spread to thirty seven countries in the Americas, Europe and Asia. It affected more than 8000 people and caused 774 deaths, before being successfully eliminated by concerted international efforts. The outbreak and fear that another pandemic could occur are estimated to have cost Canadian and east Asian economies US$200 billion [27] ." ] },{ "paper_id": "0c6dfd6796df35e619aa7b8099bd54174415fb52", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Analytical and preparative SFC separations were performed on a Waters Investigator SFC System controlled by ChromScope software (Waters, Milford, MA, USA). The system consisted of a FDM10 fluid control module, an Alias autosampler, a 10-port Thar columns oven, and a 2998 photodiode array (PDA) detector. Optical rotation of the separated enantiomers was measured by a Rudolph Autopol IV polarimeter.", "Carbon dioxide (food-grade) was obtained from Chengweifeng Inc. (Beijing, China). All the solvents were HPLC grade and were purchased from Merck (Darmstadt, Germany). (R,S)-goitrin (product number 111753) was from National Institutions for Food and Drug Control (Beijing, China). (R)-goitrin and (S)-goitrin were previously prepared by the NPLC method.", "Over the past decades, chiral separation has become an important research topic in the analytical science arsenal [9] [10] [11] . Individual enantiomers of chemical drugs may evince very different bioactivities and/or biotoxicities, so do natural products. While one isomer possesses a therapeutic effect, its enantiomer may be inactive and antagonistic or even has reverse effect. With this perspective in mind, it is imperative to investigate pharmacology and toxicology of (R)-goitrin and (S)-goitrin, respectively, which means large amount of resolved enantiomers need to be prepared for tests in vivo and in vitro." ] },{ "paper_id": "0c82e4a717a9242e0462b24a8759f98f0c83d677", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The mosquitoes, including Culex tritaeniorhynchus, Culex pipiens molestus, and Anopheles sinensis were collected from Yunnan province, China, in 2009. The samples were stored in liquid nitrogen until RNA extraction. No specific permits were required for the described field studies; the samples collected were not privately owned or protected and did not involve endangered or protected species.", "Total mosquito DNAs were extracted with TRIzol reagent (Introgen, Carlsbad, CA) according to the manufacturer's instructions. A pair of primers (forward primer: 59-ATA AAT TGA TCA GTC GTC CTC CAA C-39; reverse primer: 59-CTT GGG ATC ATT TCG GTC ATA T-39) were selected from the viral sequence assembled with the mappable reads. The PCR was conducted in a 50 ml reaction mixture containing 16Easy Taq PCR SuperMix (TransGen Biotech, Beijing, China), 1 mM each of the forward and reverse primers and 10 ng of template DNA. After pre-denaturation at 94uC for 3 minutes, 35 cycles of amplification (30 sec denaturation at 94uC, 30 sec annealing at 55uC, and 60 sec polymerization at 72uC) were performed, followed by a final incubation at 72uC for 5 min. PCR products were visualized on a 1% agarose gel stained with ethidium bromide." ] },{ "paper_id": "0c842a151c9e010a7c70151d029c91a118bde887", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Dendritic cells (DC) are key antigen presenting cells that prime na\u00efve T cells and drive the adaptive immune response. They are very effective in sensing viruses through a wide range of surface, cytosolic, and endosomal receptors, and Toll-like receptors (TLR) are crucial DC pattern recognition receptors between those.", "Porcine macrophages express CD163, a scavenger receptor, CD169 (also known as sialoadhesin", "As a whole, DC responses against PPRSV showed a general dysregulation of the IFN response, downregulation of activation and maturation markers with an induction of IL10 and Treg (Figures 1 and 2 ).", "Seven-week-old nursery pigs in a commercial setting were injected with MN 1-18-2, and at day 2 pi, approximately 50% of viremic pigs had greater than 50% reduction in NK cell mediated cytotoxicity. Reduced frequency of CD4\u2212CD8+ and CD4+CD8+ T cells and upregulated frequency of lymphocytes bearing natural Treg phenotype was detected in viremic pigs. All of the viremic contact pigs also had comparable immune cell modulation [100] .", "Funding: This research was funded by CSIC. Check carefully that the details given are accurate and use the standard spelling of funding agency names at https://search.crossref.org/funding, any errors may affect your future funding." ] },{ "paper_id": "0c917c3becd5b37cc4e44ad2c822ba132d339728", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Signal Transduction and Targeted Therapy (2020) 5:8", "Targeting cancer stem cell pathways for cancer therapy Yang et al.", "; https://doi." ] },{ "paper_id": "0c95f3083af8f4daf852527cc3d25b6b8af3a54c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supporting information S1 Table. Clinical characteristics and raw real-time data for sputum specimens. (DOCX) ", "Nucleic acid technologies are having a significant impact on the diagnosis, treatment, and control of drug-resistant Mycobacterium tuberculosis (M. tuberculosis), and there is a growing emphasis on developing and deploying molecular diagnostics outside of reference laboratories and closer to the point of need (e.g., [1, 2] ). Most tests for diagnosing pulmonary tuberculosis a1111111111 a1111111111 a1111111111 a1111111111 a1111111111 are performed on sputum [2] [3] [4] , which as clinical sample matrix is also important for managing cyctic fibrosis patients [5, 6] ; detecting and diagnosing respiratory viruses [7, 8] , pneumonia [9] , and other lower respiratory tract infections [10] ; and even lung cancer diagnosis or screening [11] .", "Competing interests: Nitu Thakore \u00c3 , Ryan Norville, Christopher Cooney \u00c3 \u00a5, Darrell Chandler \u00c3 , and Rebecca Holmberg\u00a5 are all employees of Akonni Biosystems. Akonni Biosystems intends to manufacture the automated workstation as a commercial product. Those with asterisks are also shareholders of Akonni Biosystems. Those with \u00a5 have patents related to the extraction technology used in this research. This affiliation does not alter our adherence to PLOS ONE policies on sharing data and materials.", "Numerous, iterative instrument designs and experiments were performed to arrive at the prototype workstation and optimized protocol described here. The prototype workstation and design/engineering rationale are described in the results and discussion, below." ] },{ "paper_id": "0ca5279816f66f7fd8c0bdb09d15f5953e019b68", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data Availability e data used to support the findings of this study are included within the article.", "e data was analyzed using SPSS 20.0. e statistical methods used are chi-square test for counting data and independent sample Kruskal-Walis test for measurement data.", "Disclosure e first author is Su Ma, the co-first author is Lili Feng, the co-first author is Wenxia Ding." ] },{ "paper_id": "0ca675e1d62eeff5188b3cfa32f4cf16ea634dc4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Not until July 16, when WHO acknowledged that further spread of the pandemic was inevitable and that individual case counting was no longer essential, did the three MECIDS countries stop sharing daily reports of new cases.", "Recently, efforts have shifted away from Salmonella, toward other issues. Laboratory and public health professionals from all three countries have attended meetings dedicated to the identification and Alex Leventhal et al. characterization of another foodborne pathogen, Shigella; general laboratory safety and security issues; and the use of bioinformatics in microbiology and molecular epidemiology.", "MECIDS partners share a unique geographical situation. Located at the junction of three continents (Asia, Africa and Europe), between the Mediterranean Sea and Arabian Desert, the three countries act as a ''bottleneck'' through which a large portion of the world populations of certain migratory bird species concentrate on their way to and from their winter quarters in Africa ( Figure 2 ). These birds serve as a continuous source of viruses, such as West Nile and avian influenza (AI). It has been estimated that every year approximately 500 million birds pass through Israel alone." ] },{ "paper_id": "0ca8648d40bee3056b3f9840de6d34b57ed121d0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "supplemented with penicillin (100 U/ml), streptomycin (100 mg/ml) and 5% fetal calf serum (FCS) (Sigma).", "Information concerning the specific role of VP5 during virus replication is somewhat controversial. Whilst some reports describe VP5 as a proapoptotic polypeptide [4, 5] , others provide experimental data supporting that it prevents IBDV-induced apoptosis [6, 7] . According to several reports VP5 expression enhances the virus progeny size and promotes virus release [6, 8, 9] .", "doi:10.1371/journal.pone.0123470.g003", "Infectious bursal disease virus (IBDV), the best characterized member of the Birnaviridae family, is the etiological agent of an immunosuppressive disease (IBD) that affects juvenile domestic chickens (Gallus gallus) [1] . The global importance of this disease is highlighted by its inclusion in the list of notifiable diseases by the World Organisation for Animal Health (OIE) (http:// www.oie.int/en/animal-health-in-the-world/oie-listed-diseases-2014/)." ] },{ "paper_id": "0cafb384b401aeefaa3286bb0cf76309434e2288", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "RNA interference (RNAi) technology is also being used to impair virus replication against respiratory syncytial virus, hepatitis viruses, influenza virus, poliovirus and HIV [109, 110] . Low molecular weight phenolic compounds such as flavonoids and phytochemicals isolated from plants were previously tested and are being used for anti-dengue therapy [111, 112] . An anti-viral inhibitory effect ranging from 50-75 % against DENV replication was observed when methanolic extracts of Momordica charantia and Andrographis paniculata were used in cultured primate cells [113] .", "The authors disclose that there is no conflict of interest.", "This Project is funded by the King Abdulaziz City for Science and Technology (KACST) under grant number ( \u202b\ufe8d\u202c \u202b\ufe95\u202c -33 -26 ). The authors are also grateful to the" ] },{ "paper_id": "0cc12d028d0f63383a4243bb73d76f70ae229daa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Conservative amino acid motifs are bold and underlined. doi:10.1371/journal.pone.0049842.t002", "Care of laboratory animals and animal experimentation were performed in accordance with animal ethics guidelines and approved protocols. All animal studies were approved by the Animal Ethics Committee of Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (SYXK (H) 2006-032).", "Amino acid sequence of the insert a" ] },{ "paper_id": "0cd1453fb9f28809b7544dcdcb0d6b3b4e42b3cc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Animal and Human Rights Statement This article does not contain any studies with human or animal subjects performed by any of the authors.", "Conflict of interest The authors declare that they have no conflict of interest.", "Abrahamyan LG, Chatel-Chaix L, Ajamian L, Milev MP, Monette A, Clement JF, Song R, Lehmann M, DesGroseillers L, Laughrea " ] },{ "paper_id": "0cd911d564b693ebedf57fa37c28b8ea5705c174", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are expressed as median with interquartile range (IQR) for continuous variables and count with percent for categorical variables. Fisher's exact test was used to analyze categorical variables. Statistical analyses were carried out using SPSS 12.0 (SPSS Inc., Chicago, IL, USA) and a P value of ,0.05 was considered to be statistically significant. " ] },{ "paper_id": "0cd96fd42139b22b63e5752eda2c38990a18763a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For real-time RT-PCR analysis, the total RNA of cells was extracted by using the RNA easy kit (Qiagen, Valencia, CA). Briefly, the total RNA (1 mg) of each sample was reversely transcribed in 20 mL using 0.5 mg of oligo dT and 200 U Superscript II RT (Invitrogen, Carlsbad, CA). The amplification was carried out in a total volume of 20 ml containing 0.5 mM of each primer, 4 mM ", "Table S1", "Found at: doi:10.1371/journal.pone.0002637.s001 (0.05 MB DOC) " ] },{ "paper_id": "0ce0b8bb68417974932e98c094ec93fbefc5193b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Abbreviations AI: aromatase inhibitor; BAF: Brahma-associated factor; BRG: Brahma-related gene; BST2: bone marrow stromal cell antigen 2; CBP/p300: CREB-binding protein 300; CRCs: chromatin remodeling complexes; CREB: cyclic AMPresponsive-element binding protein; DAB: 3,3\u2032-diaminobenzidine; (D)" ] },{ "paper_id": "0ce2f11a7c4da992b9a8686bd3b2ed53064a2ac8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0ce5bbc5edc608a6561d64e63edaad4a2bcad084", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Liquid chromatography-mass spectrometry (LC-MS) grade water, methanol, and acetonitrile were purchased from J.T. Baker (Center Valley, PA, USA). HPLCgrade chloroform was purchased from Merck (Darmstadt, Germany). Analytical grade acetic acid and commercial standards used for biomarker identification were purchased from Sigma-Aldrich (MO, USA). Internal standards (IS) including Arachidonic acid-d8, 15(S)-HETE-d8, Leukotriene-B4-d4, and Lyso-Plateletactivating Factor C16-d4 (PAF C-16-d4) were purchased from Cayman (Cayman Chemical, USA).", "The cell lipid extract was analyzed using an Acquity UPLC system coupled to a Synapt G2-HDMS mass spectrometer system (Waters Corp., MA, USA). The chromatography was performed on a Waters ACQUITY BEH C18 column (1. 1-40 min) . The column and auto-sampler temperature were maintained at 45\u00b0C and 10\u00b0C, respectively. The injection volume was 8 \u00b5l.", "Plasmids. FAS-Luc containing FAS promoter was a gift from Dr. Bruce Spiegelman (Addgene plasmid#8890). pSynSRE-T-Luc (named as HMGCS-Luc for clarity) containing the HMGCS promoter (Addgene plasmid#60444), pcDNA3.1-2 \u00d7 FLAG-SREBP-2 (Addgene plasmid#26807), pcDNA3.1-2 \u00d7 FLAG-SREBP-1c (Addgene plasmid#26802) were gifts from Dr. Timothy Osborne. The luciferase constructs IFN\u03b2-Luc and ISRE-Luc were provided by Dr. Dong-yan JIN (The University of Hong Kong). The LXRE reporter plasmid pGreenFire1-LXRE, named as LXRE-Luc in this study, was obtained from System Biosciences.", "Reporting Summary. Further information on experimental design is available in the Nature Research Reporting Summary linked to this article." ] },{ "paper_id": "0cec675c685c32258b42e915ab84a45851b6dd26", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nucleic Acids Research, 2016, Vol. 44, No. 15 7025 ", "As introduced above with dnaX, transcription slippage in bacteria on runs of 9 As or Ts results in mRNAs with up to 6 extra nts, with translation of the subset of 3 or 6 additional nts generating zero frame encoded product containing one or two extra amino acids. Among other relevant cases of slippage are those in Shigella flexneri, human TGFBR2 and ATRX (381) , and the endosymbionts Buchnera aphidicola and Blochmannia pennsylvanicus (244) .", "Another reported early was the carlavirus, potato virus M (462) . However, as there are reasons for caution (463) , this will not be considered further here.", "One Shine Dalgarno sequence serves as both an initiator and frameshift stimulator in an IS element (194) . Mechanis- tic studies of their action are described in a separate section below." ] },{ "paper_id": "0ced1f946cce007aa319a0ba38aef2c4b14dab0e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The 9 mer peptides with a score exceeding 24 were selected in \"SYFPEITHI\"." ] },{ "paper_id": "0cf083b09e13b9c6d8fe008590784d479f67f2f6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The results show that FHV-1 genomes are highly conserved. The lack of recombination detected in the FHV-1 genomes suggests that the risk of attenuated vaccines recombining to generate virulent field viruses is lower than has been suggested for some other herpesviruses. The SNPs detected only in the vaccine isolates offer the potential to develop PCR-based methods of differentiating vaccine and clinical isolates of FHV-1 in order to facilitate future epidemiological studies.", "Author details" ] },{ "paper_id": "0cf8f9fb2f0481a0e6a4b83cbffb07acfa20d6b0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Fussenegger on gene therapy [65] , and Nielsen on systems biology in areas such as antibiotic production by microorganisms [66] .", "Workbook S1 Packaged Tableau Workbook for use with Tableau Reader 7.0. (ZIP)", "To achieve this objective we have exploited the increasing availability of digital tools for visualisation and interaction with scientific data to promote engagement with this field of research.", "In terms of the volume of publications network mapping reveals the prominence of the University of California at Berkeley, the Swiss Federal Institute of Technology (ETH), Harvard and MIT. The data does not discriminate by discipline with the social sciences represented in work at Berkeley, Exeter and Edinburgh while law is represented in work at Duke University [7, 10, 46, 47] ." ] },{ "paper_id": "0cf9f507a18a00de76b8bb61a2c5c2b66680dd50", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The envelope protein Structure" ] },{ "paper_id": "0cfbd799dde9aedd35ace107455d6b0bee8fa640", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Samples were prepared for amplicon sequencing following the Illumina protocol for 16S rRNA gene sequencing (Part # 15044223, Rev. B) with modification to ensure sufficient amplification from samples that yielded low amounts of DNA. The recommended primers (forward: 5'CCTACGGGNGGCWGCAG, reverse: 5'GACT ACHVGGGTATCTAATCC) target the V3/V4 region of the 16S rRNA gene [39] with Illumina adapters attached ", "The associated non-parametric p-value describes the chance of seeing an m 2 value at least this extreme in 999 permutations using Monte Carlo simulations. A p-value of 0 means that no value as extreme as the calculated m 2 was observed in these permutations. This was carried out within QIIME and plotted with Emperor [57] .", "Species-level identification could not be achieved with the V3/V4 region. Some taxa contain multiple OTUs (which may not be the same species). It is also possible that multiple species have been classified as the same OTU if the sequences are more than 97% identical.", "The model included sex (Male/Female), recent antibiotic usage (within the past month; Yes/No) and length of breastfeeding (Never/Under 6 months/6 to 12 months/ Over 12 months/Current) to control for these potential confounders. All nasopharyngeal swabs from both groups were included in the analysis except those with missing data for the above covariates (n = 4), leaving 98 control NPS and 86 case NPS for comparison." ] },{ "paper_id": "0d0a0fdfcb384b60703d3ea329672f668d7c118e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "FACS based sorting of fluorescent parasites to purify populations of homogeneously expressing cells may represent another potential experimental approach but the low number of cells possible to recover in such a sorting experiment may be inappropriate for use in a drug sensitivity assay. Development of a superior inducible system in P. falciparum may also address these issues. A conditional protein stabilisation system has been used to excellent effect to address several questions of Plasmodium biology, but the applicability of this system to all subcellular destinations is uncertain [84, 85] .", "The drug sensitivity assays were performed using the SYBR Green staining method after 48 hours of growth as previously described by Smilkstein et al. [51] with some modifications as detailed in [52] .", "The parasite Plasmodium falciparum is the causative agent of severe malaria in humans, killing somewhere between 600,000 and 1.2 million people each year [1, 2] . The complex life cycle includes an asexual proliferation within human erythrocytes, characterised by three distinct stages: rings, trophozoites and schizonts. Adaptations to the intra-erythrocytic lifestyle have created new and in some cases unique organelles, such as an endosomal/lysosomal-like organelle, the food vacuole (FV) (reviewed in [3] )." ] },{ "paper_id": "0d12fa6f695fdb75443b00c49514e7850ef461e5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Written informed consent was obtained from all mothers who participated in the study and the ZVITAMBO trial and the investigation reported in this paper were approved by The " ] },{ "paper_id": "0d1448dbed0b123a78907316826d116ad97cfbcf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "With regard to viral infections, however, our search of NCBI GEO revealed expression array studies in which human PBMC samples were devoid of TAAR1 at baseline ( Table 1) .", "All authors contributed to the writing of the manuscript. LF performed all meta-analyses and compiled all data presentation.", "When available, statistical analysis within a dataset was carried out using the Analyze Dataset tool located at the bottom of the dataset of interest's page." ] },{ "paper_id": "0d1ca8ed239b0d50c0dc8a21041a1a1c43045806", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This is a qualitative descriptive study [11] that employed in-depth semi-structured interviews with PCPs to understand their experience from their own perspective [12] .", "The sampling strategy was directed towards recruitment of \"information-rich\" cases [13] :", "These themes were further grouped under three broad categories (Table 3) ." ] },{ "paper_id": "0d1d6d059b8f14bab7c89cdcda4cda11e38233dc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The results of viral inhibition were calculated as a percentage of the negative control (medium plus drug diluent). All statistical analyses were performed by one-way ANOVA with Tukey's post-test using the GraphPad Prism 5.0 software (GraphPad Software, San Diego, CA, USA).", "Berberine is an isoquinoline alkaloid belonging to the structural class of protoberberines and is encountered in many plants including Berberis vulgaris [9] . It exhibits several pharmacological properties and is particularly effective against entry and replication of many viruses, including the human cytomegalovirus (HCMV) [10] , herpes simplex virus (HSV) [11] , influenza virus [12] , Chikungunya virus (CHIKV), and other Alphaviruses [13] . Emodin, an anthraquinone derivative, is also a naturally occurring compound derived from the Chinese herbs Rheum palmatum [14] , Polygonum multiflorum [15] , Aloe vera [16] , and Cassia obtusifolia [17] . Emodin possesses a wide spectrum of pharmacological effects, including antiviral activity, against Coxsakie B5 virus (CVB5), human respiratory syncytial virus (HRSV) [18] , influenza A virus [19] , Epstein-Barr virus (EBV) [20] , herpes simplex virus (HSV) [21] , hepatitis B virus (HBV) [22] , and Japanese encephalitis virus (JEV), which is another Flavivirus [23] .", "Stock solutions of Emodin and Berberine were diluted in 0.2% dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO, USA). The working solutions were obtained by dilution, in different concentrations, of both drugs in Dulbecco's modified Eagle's medium (DMEM) (Sigma-Aldrich, St. Louis, MO, USA).", "Strategies to combat ZIKV infection include the development of vaccines [6] and the screening of molecules that inhibit the different phases of the viral lifecycle [7, 8] ." ] },{ "paper_id": "0d1d976e7073e6c1bbc69805f5c61a2f8607c911", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "More than 2 billion people worldwide are infected with the hepatitis B virus (HBV), of whom 400 million are chronically infected. A significant fraction of chronically infected individuals develop liver cirrhosis and hepatocellular carcinoma [1, 2] , and approximately 1 million die annually from HBV-induced liver disease [3] . HBV is a small, enveloped DNA virus belonging to the Hepadnaviridae family, which replicates preferentially in liver cells and utilizes a unique replication strategy involving the reverse transcription of pregenomic RNA (pgRNA) [4] .", "Several molecules, such as phenylpropenamide derivatives (AT-61 and AT-130) and heteroaryl-pyrimidines (HAP), have been developed to circumvent drugresistant CHB. Phenylpropenamide derivatives inhibit encapsidation of HBV wild-type (WT) and LMVresistant mutant pgRNA in vitro [21, 22] ; however, clinical trials were discontinued due to toxicity [23] . A Phase I clinical trial of HAP, which inhibits HBV core (C) protein dimerization and blocks nucleocapsid formation, has been conducted [24, 25] and both RNAi [26, 27] and inhibitors of a newly identified HBV receptor, sodium taurocholate polypeptide, are being tested [28] ." ] },{ "paper_id": "0d33d89c32913354f7164225a906ff85339293e2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Since the 1970s, NDV has been considered a useful laboratory virus for replication and virulence studies, as recently summarized [13] ." ] },{ "paper_id": "0d354b208fdfa2806bf33fd03e940e057b339de5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Screening Assays for Ebola virus (EBOV, Strain Kikwit).", "Immune-staining was used to visualize infected cells. Cells were treated with anti-GP specific monoclonal antibody (6D8) (1 to 1000 dilution) followed by anti-mouse IgG conjugated with Dylight488 (Thermo) (1 to 1000 dilution) in blocking buffer containing 3% BSA in PBS. Nuclei were stained with Draq5 (Biostatus) diluted in PBS buffer.", "Infection was done using Ebola virus (Kikwit) MOI = 0.5 (calculated for 4,000 cells/well, assuming one complete round of replication of HeLa cells at 15\u00b12 hrs after cell seeding) and 10ul of virus dilution was dispensed in each well except column 2, representing \"no infection control\". Cells were incubated with the virus for 24 or 48h. Infection was terminated by fixing samples in formalin solution." ] },{ "paper_id": "0d40afa4fc54a163858aeffbe43be47bf89b6f39", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Therapeutic antibodies currently approved as disease treatments", "By reviewing currently approved mAbs, one may easily see how sophisticated formats were developed in response to challenges posed by therapeutic indications. These mAb engineering solutions are highlighted by antibody-drug conjugates, glycoengineered mAbs, immunomodulators, bispecific mAbs, and CAR-T cells.", "Ublituximab is a glyco-engineered anti-CD20 antibody currently under clinical investigation in five late-stage clinical studies for different cancers (chronic lymphocytic leukemia, CLL, non-Hodgkin's lymphoma) and noncancer (multiple sclerosis) indications. Three Phase III studies are exploring the efficacy of ublituximab in combination with other anti-cancer agents. Among these studies, the UNITY-CLL Phase III study (NCT02612311) is evaluating the combination of ublituximab and TGR-1202, a PI3K delta inhibitor, compared to anti-CD20 obinutuzumab plus chlorambucil in untreated and previously treated CLL patients. Two other Phase III studies (UL-TIMATE 1, NCT03277261 and ULTIMATE 2, NCT03277248) are evaluating the efficacy and safety of ublituximab compared to teriflunomide in 440 patients with relapsing multiple sclerosis [70] .", "The mAb market enjoys a healthy pipeline and is expected to grow at an increasing pace, with a current valuation of $115.2 billion in 2018 [44] . Despite this high growth potential, new companies are unlikely to take over large shares of the market, which is currently dominated by seven companies: Genentech (30.8%), Abbvie (20.0%), Johnson & Johnson (13.6%), Bristol-Myers Squibb (6.5%), Merck Sharp & Dohme (5.6%), Novartis (5.5%), Amgen (4.9%), with other companies comprising the remaining 13% [44] ." ] },{ "paper_id": "0d5be5a4268da7c08b478ca36721d46bd67bbe69", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MiRNAs, a new class of endogenous, 18-23 nucleotide long noncoding and single-stranded RNAs, were recently discovered in both animals and plants. They trigger translational repression and/or mRNA degradation mostly through complementary binding to the 3\u2032UTR of target mRNAs. Studies have shown that miRNAs can regulate a wide array of biological processes such as cell proliferation, differentiation, and apoptosis [11] [12] [13] [14] .", "The data discussed in this publication have been deposited in NCBI's Gene Expression Omnibus [38] and are accessible through GEO Series accession number GSE44455.", "The ", "Given the nature of viruses, being intracellular parasites and using the cellular machinery for their survival and replication, the success of the virus essentially depends on its ability to effectively and efficiently use the host machinery to propagate itself. This dependence on the host also makes it susceptible to the host gene-regulatory mechanisms, i.e. the host miRNAs may also have direct or indirect regulatory role on viral mRNAs expression." ] },{ "paper_id": "0d5f9dd2c1626d1d3a4228b838fc0bc666363a3c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The proteomes of 1,000 MERS-CoV genomes and 1,000 SARS-CoV genomes were retrieved from GenBank, respectively. After sequence alignment with MAFFT, the dominant amino acid for each site was elected as a reference sequence. The mutation frequency = the number of overall mutations for each amino acid/(the number of occurrences of the amino acid in the reference sequence\u00d7total number of sequences).", "Bats harbor many zoonotic viruses, including highly pathogenic viruses of humans and other mammals, but they are typically asymptomatic in bats. To further understand the antiviral immunity of bats, we screened and identified a series of bat major histocompatibility complex (MHC)", "The sequences of 56 MHC class I genes (including predicted genes) from bats were retrieved from the NCBI database (S1 Table) . Higher mammal MHC I heavy chain sequences were retrieved from the Immuno Polymorphism Database (IPD) (www.ebi.ac.uk/ipd/mhc) and the UniProt database (www.uniprot.org). Previously deposited marsupial (opossum, tammar wallaby, koala, Tasmanian devil) and platypus MHC I transcripts were included in these analyses (S1 Table) . Sequence alignments were generated with ClustalX [48] and ESPript [49] . Similarities were calculated using DNAMAN (https://www.lynnon.com/)." ] },{ "paper_id": "0d673eba8d23c47646d0f5b69937ee87716aa1df", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Diverse paramyxoviruses in African fruit bats", "PCR products were cloned into pGEM-T Easy (Promega) and one or more clones from each sample were sequenced (Big Dye Terminator v3.1; Life technologies -Applied Biosystems). Obtained sequences were aligned with polymerase genes from the subfamily Paramyxovirinae using MUSCLE (Edgar, 2004) and CLUSTAL_X (Thompson et al., 1994) . Phylogenetic trees were constructed using Mr Bayes (Ronquist & Huelsenbeck, 2003 ) under the GTR+I+G model (as determined by MODELTEST; Posada & Crandall, 1998) .", "Although co-roosting with other species has not previously been observed, and sheeting was supervised throughout the sampling period, detection of these sequences in samples directly collected from individual bats would be required to confirm their origin." ] },{ "paper_id": "0d6a162406af842f2324077d73de17b2e85cffdb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The viruses and/or bacteria that could be detected by the 7 kits mentioned above are listed in Table 1 .", "When a signal was detected, it was considered as positive. The interpretation of the results obtained by each kit was validated with the acknowledgement of the corresponding supplier.", "The diagnosis of ARI relies both on clinical examination, radiological exploration and biological nonspecific inflammatory tests (including the level of protein C reactive or procalcitonin). The identification of the causative agent(s) is often omitted or limited to a few pathogens easy to detect by rapid antigen direct tests (influenza viruses and respiratory syncytial virus (RSV) in respiratory specimens, Streptococcus pneumoniae and Legionella pneumophila in urine specimens). However, the distinction between viral and bacterial infections is often impossible by using nonmicrobiological criteria [3] [4] ." ] },{ "paper_id": "0d76724747e4dd9c957017bb1dd628f087f652a3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "\u2022 Inter-professional communication and teamwork skills.", "\u2022 Ability to recognize and treat zoonotic and vector borne disease \u2022 Ability to assess and improve patient environments Knowledge competencies: \u2022 Zoonotic and vector borne diseases \u2022 Animals as sentinels \u2022 Human-animal bond and role of service animals, therapy animals, etc.", "The one health concept-research and clinical aspects" ] },{ "paper_id": "0d7c95184b8a77a7fc0e35995ddc804ba4145429", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Primary antibiotic susceptibility testing is conducted using either automated or Kirby-Bauer tests. ETEST \u00ae is a method to supplement testing with antimicrobial susceptibility testing (AST) reagent strips that determine minimum inhibitory concentrations [54] . Recently, SeLux has developed a Next Generation Phenotyping (NGP) platform, which is a high-throughput, fully-automated AST testing system, enabling same-shift susceptibility testing of up to 50 antibiotics in parallel [55] . This assay differentiates antibiotic-induced bacterial growth modes with a surface-binding fluorescent amplifier.", "Urine antigen testing is also available for select pathogens, and is rapid with results in less than 1 h. Enzyme immunoassay and lateral flow assays are used to detect serogroup 1 of Legionella pneumophilia, the strain most common to cause infection, and enzyme immunoassay is available for S. pneumoniae detection [46-50].", "The gold standard for identification of bacterial, viral, and fungal pathogens remains culture. For bacterial pathogens, testing for antimicrobial susceptibility should also be conducted to ensure adequate therapy is being administered." ] },{ "paper_id": "0d80c3f53b8900bb8d958492553dc052c2b3c628", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "CD3/CD16CD56, Simultest\u2122 Leucogate\u2122 (CD45/CD14) and Simultest\u2122 Control \u03b31/\u03b32a (IgG 1 FITC/IgG 2a PE). Lymphocytes were gated in the forward-side scatter plot and various cell subsets were estimated.", "Isolated human PBMC were suspended in HybridoMed DIF 1000 medium (Biochrom, Berlin, Germany) containing 10 \u03bcg/mL gentamycin, 100 \u03bcg/mL streptomycin, 100 U/mL penicillin and 10% FCS (HyClone Laboratories, Logan, UT, USA) and incubated at 37\u00b0C/5% CO 2 and finally cultured (1 \u00d7 10 6 cells/1 mL/well) in 48-well microtiter plates (Greiner Bio-one GmbH, N\u00fcrtingen, Germany). Cells were activated with agonistic CD3 (OKT3, mouse IgG1, Ortho Biotech, Bridgewater, NJ, USA), CD28 (clone CD28.2, mouse IgG1. Beckman-Coulter, Krefeld, Germany) and CD40 (clone B-B20, Trinova Biochem, Gie\u00dfen, Germany) mAb, 100 ng/mL each, or with hkSE (1.25 \u00d7 10 5 CFU/mL; ade -, his -, SALMOVAC SE \u00ae , Impfstoffwerk Dessau-Tornau, Rosslau, Germany).", "Vitality response of human PBMC to mAb or hkSE was evaluated by 3-[4,5-dimethylthiazol-2yl]-2,5-diphenyltetrazoliumbromide (MTT)-reduction test as previously reported [26] ." ] },{ "paper_id": "0d82c429737f250a7bcd230fea2e4725edc2439a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The most studied alphacoronaviruses (alpha-CoVs) are the Transmissible Gastroenteritis Virus (TGEV) and Porcine Epidemic Diarrhea Virus (PEDV), which both infect suckling piglets and lead to a high mortality rate [72, 73] . Recurrent outbreaks of PEDV have occurred across Asia and the USA, causing significant economic losses [73] . Alpha-CoV also includes human pathogens such as HCoV-229E and HCoV-NL63, which are associated with respiratory tract infections such as the common cold to bronchiolitis [74, 75] . Despite their medical and veterinary relevance, however, the exact mechanisms of alpha-CoV replication and pathogenesis are not well characterized yet.", "Gammacoronaviruses (gamma-CoVs) are viruses that mainly infect poultry but are also transmissible to humans. They replicate in the respiratory tract and thus cause respiratory defects. The Infectious Bronchitis Virus, which causes major loses in the poultry industry, is the model virus for gamma-CoV. Similarly to other CoV, the IBV genome encodes several nsp proteins that help with replication and interfere with host cell functions.", "The two most studied Arteriviridae are PRRSV and the equine arteritis virus (EAV). The PRRSV strain, which was historically first characterized and is commonly referred to as atypical (i.e., AP PRRSV), causes the abortions in 10-50% of the sows, and fever and anorexia leading to the death of 5-10% of them [69] . However, in 2006, the emergence of a novel virulent highly pathogenic PRRSV (HP PRRSV) strain, carrying mutations in nsp1\u03b2, nsp2, and ORF5 genes, caused higher morbidity (50%) and mortality (20%) rates in piglets and sows [70] . The equine arteritis virus, in contrast, infects horses and donkeys, and can cause abortions in pregnant females and mortality in neonates [71] ." ] },{ "paper_id": "0d8784d230453109b9340461f2692f0f2d048927", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The subcultured osteoblast MC3T3 cells were seeded at a density of 5,000 cells/cm 2 in 40 mm dishes and cultured in \u03b1-Modified Eagle's Medium (\u03b1-MEM; Sigma-Aldrich) containing 10% (v/v) fetal bovine serum (FBS; Nichirei Biosciences Inc., Tokyo, Japan). On the next day, this was replaced with differentiation medium, containing 2 mM glycerophosphate and 50 \u03bcg/mL sodium ascorbate at final concentrations, to induce osteoblast differentiation. When necessary, 100 \u03bcM 2BP in less than 0.1% DMSO, or 0.1% DMSO alone was added to the differentiation medium at final concentrations. All cultures were incubated at 37\u00b0C in a humidified atmosphere containing 5% CO 2 for 27 days. Mineralized nodules were stained with Alizarin Red S (Sigma-Aldrich). The standard staining procedure was used. The mineralized nodules were checked every three days.", "Osteoblast-like MC3T3 cells were provided by the RIKEN, Cell Bank (RCB 1126). The procedures for cell culture, transfection, and protein expression were the same as reported previously. When necessary, 2-bromopalmitic acid (2BP; Wako, Osaka, Japan) and 17-octadecynoic acid (17-ODYA; Sigma-Aldrich) were dissolved in 99.5% dimethyl sulfoxide (DMSO; Wako) and added to differentiation medium at concentrations of 100 \u03bcM and 50 \u03bcM in less than 0.1% DMSO, respectively [30, 31] .", "In 2010, Dr. Yount and co-workers reported that the antiviral activity of IFITM3 is dependent on S-palmitoylation on the protein [10] . The S-palmitoylation [23] is a post-translational modification on proteins by C 16 saturated-fatty acids (palmitic acids) covalently attached to certain cysteine residues via a thioester linkage (Figure 1-B) . The modification is reversibly catalyzed by protein acyltransferases and acylprotein thioesterases, and confers unique properties to the protein, such as membrane binding and targeting, immunoreactivity," ] },{ "paper_id": "0dadaf875ce55724213796d3670ad73c5d8bd2a1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "statistics. Student's t tests were calculated using GraphPad Prism software. Significance was set at p < 0.05 and denoted as *p < 0.05, **p < 0.01, ***p < 0.001 and ***p < 0.0001. All results are expressed as the mean \u00b1 standard deviation (SD).", "Results" ] },{ "paper_id": "0db6ae77cd580f4e8c3cb6728de4a2a6197a727c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(a) (b) (c) (d)", "Animal ID Infection 0 7 14 21 28 35 55 ", "PI506 2661 \u2212 \u2212 \u2212 + ++ +++ ++ 2664 \u2212 \u2212 + +++ ++++ +++++ ++++ 2665 \u2212 \u2212 + +++ ++++ ++++ +++ 2676 \u2212 \u2212 \u2212 ++ +++ ++++ ++++ 2682 \u2212 \u2212 \u2212 ++ ++ ++++ ++++ 2684 \u2212 \u2212 \u2212 +++ +++ ++++ ++++ Trangie 2675 \u2212 \u2212 \u2212 +++ ++++ ++++ +++ 2677 \u2212 \u2212 \u2212 ++ +++ +++ +++ 2685 \u2212 \u2212 \u2212 +++ +++ ++++ +++++ 2686 \u2212 \u2212 ++ +++ +++++ +++++ +++++ AO554 2666 \u2212 \u2212 ++ +++ ++++ +++++ ++++ 2668 \u2212 \u2212 +++ \u2212 +++++ +++++ +++++ 2669 \u2212 \u2212 +++ ++++ +++++ +++++ +++++ 2673 \u2212 \u2212 \u2212 ++ ++++ +++++ ++++\u2212 \u2212 + + +++++ +++++ ++++ 2674 \u2212 \u2212 \u2212 \u2212 ++++ ++++ ++++ 2680 \u2212 \u2212 + ++++ +++++ +++++ +++++ VR1112 2662 \u2212 \u2212 \u2212 \u2212 ++ ++ ++ 2678 \u2212 \u2212 +++ +++ +++++ +++++ +++++ 2683 \u2212 \u2212 \u2212 + + ++ ++ Contact 2663 \u2212 \u2212 \u2212 \u2212 \u2212 \u2212 \u2212 2681 \u2212 \u2212 \u2212 \u2212 \u2212 \u2212 \u2212" ] },{ "paper_id": "0dbb8e8757f40e57ded9443666880d99a63c8d7e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All the obtained data was analysed using GraphPad prism 6.00 program (San Diego, CA, USA). Statistical significance was determined by one-way ANOVA (with Tukey's multiple comparisons tests). A non-parametric Chi square test was used to analyze significant differences in mortality of birds following SG challenge. Data are represented as mean \u00b1 standard deviation. p values of < 0.05 were considered statistically significant.", "\u00a9 The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat iveco mmons .org/licen ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver" ] },{ "paper_id": "0dbc8dd1c306474ee5d560eaab38a9500bceb7d9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0dbd0395f35ca86b7afb6e0325025b8741dfa771", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0dbfaa6ddc08bef9b502de5cd6c0a2a3b7af0106", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "H.L.R. currently works for GeoVax, Inc., which is advancing a DNA prime-MVA boost vaccine. She owns stock in GeoVax as well as being on patents. S.L. is on DNA vaccine-related patents. E.F.F. is on DNA vaccine-related patents.", "The authors would like to acknowledge Joe Santoro for his technical support of the early DNA vaccine experiments in the Robinson laboratory.", "We are eternally indebted to Dr. Guido Majno for his provision of Departmental support for our early work on DNA vaccines and to the Howard Hughes Medical Institute for having supported postdoctoral work on DNA vaccines for S.L.", "DNA vaccines were pioneered by several groups in the early 1990s. This article presents the reflections of one of these groups on their work with retroviral vectors in chickens that contributed to the discovery and early development of DNA vaccines. Although the findings were initially met with skepticism, the work presented here combined with that of others founded a new method of vaccination: the direct inoculation of purified DNA encoding the target antigen." ] },{ "paper_id": "0dc51a358655e78b2b47b4bc7c8b240556696a35", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Keywords: RNA virus, dengue virus, funding models, interdisciplinary, vaccines, clinical trials as topic", "\u2022 generating definitive knowledge on immune responses that confer protection vs. those that do not.", "\u2022 delivery platforms that determine the breadth and longevity of immune responses." ] },{ "paper_id": "0dc958db13e5ac3b76b8204a8081ad0cec38bcfa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0ddcebebb542f8a0905a3cf82a59f404158d3de2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "To create positive controls, PCR products generated from whole organisms were purified and cloned into plasmids using the TOPO TA cloning system (Invitrogen, Carlsbad, CA), following the manufacturer's instructions. All positive controls were sequenced to verify the amplicon sequences and the possibilities of any mismatches generated during cloning. The positive controls were further amplified to generate large quantities that were purified using Qiagen Plasmid Midi Kit (Qiagen, Valencia, CA). The synthetic RNA standards were generated from linearized target sequence plasmids by using T7 in vitro transcription system (Promega, Madison, WI).", "The analytical testing of both multiplex assays demonstrated excellent LOD (1-10 input copies for all analytes) and no significant cross reactivity with a large number of agents that might be in clinical samples." ] },{ "paper_id": "0ddcfc9bedfb0a87a7221dd2448bd41d3ba9cc51", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Even though the association is not statistically significant, we observe that Patients 3, 4 and 5 have the highest fraction of dead cells and also the highest symptom scores AUC ( Table 2 , Fig 3) .", "Our parameter estimates are of the same size as previous estimates from studies using comparable models (for example [11] ). As the parameters in these models tend to be highly correlated, the uncertainty around individual parameter estimates is generally large. Our analysis is limited by the small sample size which, however, is not unusual in studies fitting viral dynamics models.", "Both time to peak viral load and generation time were negatively correlated with initial viral growth. This means that an infection caused by slowly reproducing virus spreads more slowly and has a later peak than an infection caused by faster reproducing virus." ] },{ "paper_id": "0defab5b2520008da1413d0f75d29fe0ae656ea9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Author Contributions: A.C.F. and R.C.K. designed the study. A.C.F. and R.C.K. analyzed the data. A.C.F. and R.C.K. prepared the manuscript.", "Funding: This research received no external funding.", "The authors declare no conflict of interest." ] },{ "paper_id": "0df2a9766ade17a0d9a625ef02722fc167ee0526", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Microscopical examination of lungs. The lung tissues collected at 5dpi were fixed in 10% phosphate-buffered formalin for histopathological examination which was performed as described previously [37] [38] [39] . Briefly, samples were processed for paraffin embedding and cut into 5-\u03bc m-thick sections. One section from each tissue sample was stained with hematoxylin and eosin (H&E) stain. Another section was processed for immunohistological staining with a rabbit polyclonal antibody (orb176401; Biorbyt, USA) against influenza A virus NP. Specific antigen-antibody reactions were visualized by using DAB Detection Kit (Polymer) (ORIGENE, Wuxi, China) and counterstained with hematoxylin.", "Total RNA in PAM cells or lung homogenates were extracted using TRIzol reagent at specified time points according to the manufacturer's instructions (Invitrogen). Oligo-(dT) primed cDNA was generated from 1 \u03bc g of total RNA per sample using Superscript III First-Strand Synthesis SuperMix (Invitrogen). The qRT-PCR mixture for each sample consisted of 10 \u03bc l 2 \u00d7 SYBR green PCR master mix (Applied Biosystems), 7 \u03bc l of nuclease-free water, 0.5 \u03bc l of each primer, and 2 \u03bc l of cDNA template. Amplification was performed using the 7500 real-time PCR system (Applied Biosystems) with the following program: 1 cycle at 95 \u00b0C for 10 min, followed by 40 cycles of 95 \u00b0C for 15 s and 60 \u00b0C for 1 min. Expression values for each gene, relative to RPL4, were calculated using the 2 \u2212\u25b3\u25b3CT method. Each experiment contained three technical replicates for each sample, with two experimental replicates performed. Primers for qRT-PCR analysis of pig IFN-\u03b1 /\u03b2 are listed as following: IFN-\u03b1 , Forward, 5\u2032 -GCCTCCTGCACCAGTTCTACA-3\u2032 , Reverse, 5\u2032 -TGCATGACACAGGCTTCCA-3\u2032 ; IFN-\u03b2 , Forward, 5\u2032 -TGCAACCACCACAATTCC-3\u2032 , Reverse, 5\u2032 -CTGAGAATGCCGAAGATCTG-3\u2032 .", "The severity of microscopic lung lesions was scored by the distribution or by the extent of lesions within the sections examined as follows: 0, no visible changes; 1, mild focal or multifocal change; 2, moderate multifocal change; 3, moderate diffuse change; and 4, severe diffuse change 40 . The detection of swine influenza antigen in lung was executed through a ranked sore of 0-4, which was used to evaluate the number of positive cells per section taken from each block, as previously described 41 . The indication of the scores was as follows: 0, no SIV-antigen-positive cells; 1, 1-10 positive cells; 2, 11-30 positive cells; 3, 31-100 positive cells; and 4, = or > 100 positive cells. Two independent pathologists scored all lungs and slides from blinded experimental groups.", "No microscopic lesions and SIV-positive signals were observed in the lungs of control pigs (Fig. 5B ,C). Taken together, the above results further demonstrated that truncated PA-X increased the pathogenicity of SIV in pigs." ] },{ "paper_id": "0df659d4611fe09f4fa6ef2c22ec087985182ccb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "0e046152bb9c537c62ed4c4616a0b627ccfc992a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Murine macrophage-like cells, J774A.1, were obtained from the American Type Cell Culture Collection (ATCC TIB-67). Cells were cultured in complete medium: Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum, Glutamax, and penicillin/ streptomycin at 37\u00b0C with 5% CO 2 .", "(1-((PBS -\u03b1 PA83 IgG)/(PBS -50 ng LeTx))) \u00d7 100. ", "In humans, the anthracis bacilli can cause three types of infections: cutaneous via abrasions in the skin, gastrointestinal through ingestion of spores in contaminated meat and inhalation when spores less than 5 uM um are deposited into the lungs [1] . The mortality rates vary between each form of the disease with cutaneous anthrax presenting as a self-limiting and treatable infection with only a 20% case fatality rate. When left untreated gastrointestinal infections can progress rapidly and have over 80% case fatality rates. Inhalation anthrax infections are rare but have a high case fatality rate (over 75%) even with antibiotic treatment." ] },{ "paper_id": "0e08edfdafcee24569ce5be73cec8acb26142ba8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Confirmation of an organized NS2B protein structure on eukaryotic membranes", "Cells infected with DENV undergo a series of detrimental functional and structural changes, such as cell rounding, shrinkage, and dislodgment from the growth surface [3] . In addition, the membranes of DENV-infected cells are compromised during viral RNA replication, assembly, and egress, which induce remodeling and redistribution of distinct cell membrane structures [4, 5] including the rough endoplasmic reticulum (ER) and Golgi apparatus [6] . These phenomena result in dramatic cytopathic effects that compromise the viability of infected cells.", "Dengue viruses (DENVs) are enveloped (+) sense RNA viruses belonging to the Flaviviridae family. The DENV replication cycle initiates following receptor binding to the host cell membrane, which is followed by internalization via endocytosis and subsequent release into the cytoplasm. The genome is then translated into a large polyprotein, which is proteolytically processed to yield 3 structural proteins (envelope, membrane precursor, and capsid) and 7 non-structural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) [1, 2] ." ] },{ "paper_id": "0e1c072b035756104151484e6548cac0517cc5f2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(a) Select a pattern, p, with maximal score in H. ", "1. J = \u2205", "V in {1... N} (a) Sort V by \u2211 k = 1...N c ik (b) generate_matrix(J, V) function generate_matrix(J, V) 1. While length(V) > 0 (a) k = shift(V) (b) if(|J| = 0 or \u2211 i\u2208J c ik > 0 or -\u2211 i\u2208J c ik 10 5 L \u22121 ), and considerable technical skill and expertise for accurate analysis.", "For bacteria, serological testing is particularly challenging, especially for identifying atypical bacterial agents such as Mycoplasma pneumoniae. With varied sensitivity (14% -77%) and specificity (49% -97%) as compared to PCR, serological testing has limited usefulness clinically (Beersma et al., 2005; Wellinghausen et al., 2006) . The clinical utility of serologic tests is further limited because they require both acute and convalescent sera to monitor seroconversion or to identify a four\u2212fold increase in antibody titer (Loeffelholz and Chonmaitree, 2010) . Additionally, serological tests are not relevant for identifying frequently recurring viral infections as the serum IgM levels are lower due to repeated exposure to vaccines or circulating viruses. For optimal virus specific IgM testing, an acute-phase serum specimen should be obtained early in the course of illness (Dunn, 2015) ." ] },{ "paper_id": "10829aeda495398ba475afbd713e36bdc58cfcd0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Having established that only intracellular signals are taken into account, it is still challenging to distinguish between intact and degraded forms of peptide or cargo. In two studies, a fluorescence-based quantification method was combined with either HPLC analysis [163] or \"cell activity by capillary electrophoresis\" [165] to verify the integrity of cargo and carrier.", "PEI covalently modified with the HIV-1 gp41-derived peptide HGP led to a 38-fold increase of gene expression after plasmid DNA delivery and also enhanced siRNAmediated knockdown of GAPDH by approximately 2-fold [199] . 30 % of cells incubated with PEI-HGP polyplexes showed not only the punctuate plasmid DNA staining observed with PEI polyplexes alone, but also a diffuse fluorescence throughout the cell, indicative of endosomal release of vectors. This would explain the observed increase in transfection efficiency, since the overall uptake was unaffected.", "In principle, either the peptide or the cargo can be labeled by a reporter group, e.g. a radioisotope [156] or a fluorophore [157] . Fluorescent peptides or cargos have been quantitatively evaluated by FACS [54] or fluorescence correlation microscopy (FCS) [158] or FRET [159] . In all cases, it is crucial to distinguish between internalized and membraneassociated signals. For this purpose, a simple wash step with just buffer is not sufficient to completely remove membranebound peptide/cargo-complexes [54, 55] . Extracellularly bound complexes can be efficiently removed for example by enzymatic digestion with trypsin [160] , acid wash [161] or heparin treatment [55, 162] . Alternatively, discrimination between intra-and extracellular material is possible through chemical modification of extracellular components [163] or fluorescence quenching [164] .", "In another approach, Jiang et al. [175] extended the 3' end of the sense strand of a siRNA with a nuclease-resistant DNA hairpin to obtain a so-called \"crook\" siRNA. This modification had no effect on RNAi-mediated reporter gene inhibition and served as a primer for a filling-in reaction followed by PCR. Parameters were chosen so that the initial rate of template amplification correlates with the initial con-centration of the \"crook\" siRNA. Under these conditions, quantification of attomolar siRNA levels per cell was possible after liposomal transfections with Oligofectamine." ] },{ "paper_id": "108b012df7e6ae774a2a83243c0662f376637426", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The experimental protocol was approved by the Iowa State University Institutional Animal Care and Use Committee (Approval No. 2-14-7742-S; approved on the 5 th of March 2014).", "The selected commercial SDPP was incorporated into a nonpelleted, complete feed, at a final inclusion of 5%. Based on average intake of 215 g/d for a 28 day old pig fed for 28 d, average plasma consumption was 10.5 g/d, for a total consumption of 301 g of SDPP per pig. In addition, a diet without SDPP was also produced to provide equivalent dietary energy and lysine compared to the diet containing SDPP.", "doi:10.1371/journal.pone.0104766.t004", "Porcine epidemic diarrhea virus emerged in North America in April 2013 [1] . Since the initial discovery, PEDV has spread rapidly through the pig population and is present in 30 U.S. States, Canada and Mexico as of May 2014. PEDV, an Alphacoronavirus, is a member of the Coronaviridae family which is a group of single-stranded, positive-sense RNA viruses [2] . PEDV isolates can be divided into genogroups 1 and 2 [3] ." ] },{ "paper_id": "108ebac20ee26fd05a2ba7ad43523957c34d871e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Here t~t{t i . At time t~t i ,", "From Eqn. 4, it can be determined that when", "then" ] },{ "paper_id": "10905e5423cc57fa9bd97aba8a348a3866953874", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All authors listed have made a substantial, direct, and intellectual contribution to the work and approved it for publication. ", "All these approaches have explored different scenarios to evaluate the more efficient therapeutic combination that seems to move toward personalized vaccinations for cancer patients." ] },{ "paper_id": "1090afa5b76644ce9e3be9d9d0e67ad651f846d9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Thiobarbituric derivatives were synthesized as shown in Fig 2. Reaction between benzoyl chloride 10, ammonium thiocyanate and the opportune amine led to intermediates 11a and 11b; consequent hydrazinolisis and coupling reaction with diethylmalonate 13 in basic conditions furnished monoalkylated thiobarbituric derivatives 14a and 14b. Finally Knoevenagel condensation with aldehyde 6 in refluxing acidic EtOH led to compounds 15a and 15b.", "The majority of emerging or re-emerging viruses are zoonoses, and it has been demonstrated that the passage among different species is easier for enveloped viruses in comparison a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "(Z)-4- (5-((1-benzyl-4,6- 179.42, 171.68, 162.05, 161.72, 160.30, 159.71, 158.73, 151.34, 138.28, 136.86, 134.45, 131.61, 130.83, 128.57, 127.31, 116.43, 114.46, 113.68, 113.38, 113. " ] },{ "paper_id": "10978f83e192204ea4f2347d49886969558a8b99", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Site-directed mutagenesis method was employed for the generation of ZIKV fragments containing the desired UFS mutations, the generated Not I-Avr II restriction fragments were then subcloned into the infectious clone of ZIKV strain FSS13025 (Shan et al., 2016) , which was kindly provided by Professor Pei-Yong Shi.", "The DENV4 mini-genomes were constructed by joining various 5 0 -300 nt fragments with the 3 0 UTR sequence using overlapping PCR techniques. The mutations targeting cHP and 5 0 CS were also introduced by overlapping PCR.", "The following source data is available for figure 9:" ] },{ "paper_id": "109a7800d93fdf2a2c64a261aab1182dd5b607af", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The results were analyzed by a chi-square test the using SPSS 17 software. A P value < 0.05 was considered statistically significant.", "This study was performed in accordance with the principles expressed in the Declaration of Helsinki and approved by the Ethics Committee of the China-Japan Friendship Hospital. Informed consent was obtained from all patients.", "There are some limitations of this study. This study is limited by virtue of the retrospective analysis at only one center. And there was no randomized and blinded control group with conservative treatment in this study." ] },{ "paper_id": "10a769cac0a76b41a6a82be148c1a2675e9d4604", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The expression of various receptors was assessed with monoclonal antibodies and detected using the Accuri C6 flow cytometer (BD Biosciences). To measure endogenous hTIM1 expression, cells were stained with mouse anti-hTIM1 antibody (clone 219211, R&D Systems) or purified mouse Fc (mFc) as a negative control.", "Relevant SwissProt accession numbers are Q96D42 (hTIM1), Q8TDQ0 (hTIM3), Q96H15 (hTIM4), P30530 (hAxl), Q9BYF1 (hACE2), P02786 (hTfR1) and O15118 (NPC1).", "Text S1 Molecular causes underlying the inefficient viral usage of TIM3. (DOC)", "The plasmids encoding N-terminally myc-tagged human ACE2 (hACE2) and civet cat ACE2 were previously described [37] . Also previously described were the expression plasmids encoding the entry glycoprotein precursors of Zaire EBOV (Mayinga) and Lake Victoria MARV (Musoke), both lacking the mucin domains, Amapari virus (AMAV, BeAn 7063), Tacaribe [37] [38] [39] [40] [41] [42] [43] . The precursor of the Oliveros virus (OLIV) entry protein was synthesized by GenScript based on Genbank ID AAC54654.1 and was cloned into pCAGGS." ] },{ "paper_id": "10a9a18d6d821b917178be32b20f98c9e21d6028", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following human stool samples were provided by the National Reference Center (NRC) for HAV/HEV (Villejuif, France): HAV GIA (stools no. 780627147; 1181216151), HAV GIB (1280210015; 1280514230), HEV G3c (1280511146), HEV G3f (1280418084; 1280530128) and HEV G4 (1280615097; 1280522166).", "The Poisson distribution was used to estimate the average number of template copies per chamber in a panel [24, 25] . All samples were characterised by a corresponding absolute quantity. No positive chambers were observed in negative samples.", "Four viral strains were obtained from infected cell culture supernatants: two enterovirus strains (human B6 coxsackievirus (Schmitt strain: ATCC 1 VR-1037AS/MK\u2122) and human echovirus 19 (Burke strain)), one Adenovirus 40 strain (ATCC VR-931) and one Astrovirus GI strain.", "Nine nl of reaction volume mix were charged onto each of the 2304 chambers on the chip with the IFC controller MX." ] },{ "paper_id": "10abe76a05511196ea1f252383f0c70d592e7444", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Lung weight and lung viral titres were compared across arms using ANOVA, with day of necropsy entered as a covariate. Differences between treatment groups were estimated using marginal means, with Sidak's adjustment for multiple comparisons. Statistical analyses were performed using SPSS version 15.0 (SPSS Inc. USA). Statistical significance level was set at a = 0.05.", "A complete macroscopic post-mortem examination was performed on all animals. This included examination of the external surfaces and all orifices; the thoracic, abdominal and pelvic cavities with their associated organs and tissues; and the neck with its associated organs and tissues. Lungs were weighed and all lung lobes were inspected and lesions described. The left lung (including trachea) was collected during autopsy, inflated with 10% neutral buffered formalin for fixation/histology and microscopic examination. Paraffin embedded tissue sections (left cranial lobe, left caudal lobe, right cranial-, middle-and caudal lobes and accessory lobe) were stained with haematoxylin and eosin and assessed by light microscopy for aspects like congestion, emphysema, presence of foreign body, haemorrhagy, bronchioloalveolar hyperplasia and inflammation, and oedema." ] },{ "paper_id": "10c5b88204b337e7d05aceba5fc73d041153d0d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "RT-PCR was performed using a SuperScript II onestep RT-PCR Platinum Taq kit (Invitrogen, Carlsbad, CA, USA) to obtain cDNA. Conventional PCR was performed using Ex Taq polymerase (Takara, Otsu, Japan). All products were subjected to electrophoresis on a 2% agarose gel. PCR/RT-PCR protocols for each virus were available in detail (see Supplementary 1 available online at http://dx.doi.org/10.1155/2013/869521).", "Chi-square test with a significance level of < 0.05 was conducted to compare infection rates among different patient groups.", "The seasonal distribution of EV was regular, remaining at a stable detection rate (0.81%) throughout spring before reaching a peak in summer. No cases were observed from ", "We codetected HBoV with IFVA, HRV, EV, and IFVB in the study. The codetection rate of 2.5% in LRTIs and 1.6%" ] },{ "paper_id": "10ce102dd3c76f690ebe84048a5d734598b3d2f1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Facebook, the most popular social networking website [1], has invigorated a wide range of health sciences studies. Facebook use for disease surveillance [6] or public health issues [7] [8] [9] shows its broad scope for improving public health. Researchers have also used Facebook to address specific health concerns. For example, studies have been conducted to assess Facebook's potential in engaging smokers in smoking cessation treatment [10] and to evaluate it's scope in recruitment and retention of young adult American veterans into an online alcohol intervention study [11] . While most Facebook based health studies focus on information dissemination to individual users, surprisingly few have focused on how health agencies are involved in Facebook based communications [12] [13] [14] . This paper addresses this gap.", "We included features that are generally used in Facebook-based studies [12, 31, 32] as well as those that are seldom considered (see Table 1 ).", "The Facebook Graph API [30] was used to collect all posts from an account's timeline as of late January 2013. For each post, we recorded its unique identifier, number of likes, shares, comments and other metadata as described below.", "The Facebook Graph API provides information about the type of a particular post. Posts are classified into six selfexplanatory categories, namely link, music, photo, question, status (a post is an uncategorized status if it is simply textbased and does not belong to any of the other categories), and video/Adobe's ShockWave Flash format (SWF). ", "One aspect of Facebook analysis that is often overlooked is post content. We hypothesize that some topics are more attractive to a wider group than others. For example, a post about information dissemination of the outbreak of West Nile virus (\"West Nile virus is a potentially serious illness. What you need to know: http://go.usa.gov/r9g4\") generated far more activity compared to a job posting from U.S. Public Health Service Nurses (\"National Park Service has a Registered Nurse Manager position open in Yosemite, CA. This position closes on November 19. If interested, please send a cover letter and CV to S**** C**** at email@nps.gov.\").", "The coefficients of the logit regression in the zero portion of the model indicate how the features relate to crossing the 'hurdle' of obtaining at least one activity (i.e. either a like, share or comment). " ] },{ "paper_id": "10dab751e09a2f4ef5a81f68b82c76c8be09343f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "10dd2aeb61d54b45337a96f3c6243b72d6764732", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(ZIP)" ] },{ "paper_id": "10e691d6bf9cfc219bb72a2761d37ae5f1677f77", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "10f4664e4d1e58018892a7a2ab1eae868d59f2f3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Simplifying gives", "Since", "Then we have g\u00f00\u00de \u00bc L \u00c0 m\u00f0s\u00fem\u00de\u00f0g\u00fem\u00de bs > 0 when R 0 > 1, g\u00f0 rsL d\u00f0s\u00fem\u00de \u00de \u00bc \u00c0 m\u00f0s\u00fem\u00de\u00f0g\u00fem\u00de bs < 0, and g 0 \u00f0M\u00de \u00bc h 0 \u00f0M\u00de\u00f0L \u00c0 d\u00f0s\u00fem\u00de rs M\u00de \u00c0 d\u00f0s\u00fem\u00de rs h\u00f0M\u00de < 0 holds true for any M satisfying L \u00c0 d\u00f0s\u00fem\u00de rs M > 0. Thus there must exist one and only one positive root M \ufffd < rsL d\u00f0s\u00fem\u00de that satis-" ] },{ "paper_id": "10f63acdd41437902fb627803c57d57dec2c4716", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Despite the global distribution of IBV, poultry in Finland remained free of clinical cases until April 2011 [9] after which outbreaks involving several CoV genotypes have occurred in Southern Finland.", "ARTICLE HISTORY" ] },{ "paper_id": "10f87d75360ca119636fcd75da502bcb0bf7845d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "[Male participant (P23), 65 years old]", "[Male participant (P8), 34 years old]", "[Male participant (P32), 35 years old]" ] },{ "paper_id": "10fbf7274b0bdfe7153269489851fc3d8f121bcd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Rotavirus (RV) is the primary etiological agent of severe dehydrating diarrhea in young children worldwide, and is responsible for almost half a million deaths annually [1, 2] . In 2006, two live attenuated RV vaccines, RotaTeq and Rotarix, were introduced to the market and are now licensed for use worldwide. Studies thus far indicate that these vaccines are both safe and effective at preventing RV-associated disease and mortality although their efficacy is significantly diminished in the poorest countries of Asia and Africa [3] .", "Viral particles were first concentrated from RRV-infected MA104 cell lysates by genetron extraction and pelleting over a sucrose cushion. DLPs were then generated by treating the particles with 10 mM EDTA to remove the outer VP4/VP7 layer, followed by cesium chloride density gradient centrifugation as described [77, 78] . DLPs were dialyzed against tris-buffered saline (TBS). DLP concentration was determined by Bradford assay. DLPs were aliquoted and stored at -80\u00b0C.", "RV RNA synthesis is carried out by the endogenous, virionassociated RdRP, VP1, and the virion-associated guanylyltransferase and methyltransferase, VP3 [6] . RV transcripts possess a type I 5' cap structure, m 7 GpppGm [56] . We postulated that if capping by VP3 is not 100% efficient, some of the RV mRNAs extruded into the cytoplasm might have exposed 5' phosphates, a known RIG-I ligand [12, 13] . Second, if the VP3 methyltransferase activity is not completely efficient, then some of the transcripts may contain incompletely 2'-O-methylated 5' caps, a molecular signature that has been shown to induce IFN in an MDA5-dependent manner [24] ." ] },{ "paper_id": "11022b299f98034d0060f9c036333f1b9024d7a1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "and Oklahoma were the states with the most diagnostic case submissions testing positive for PEDV [10] . Subsequently, PEDV has continued to spread rapidly and as of June 2014 has been confirmed in 30 states in the USA [10] .", "Evidence of airborne transmission of enteric pathogens (bacteria and viruses) has been shown previously [12] . Drying of swine feces due to increase in temperature and resuspension of feed deposited on the floor of pig buildings can result in the generation of dust able to adsorb and carry microorganisms and odorous compounds [11] . We speculate that this is one likely mechanism by which PEDV became aerosolized and remained suspended in the air, and may contribute to both within farm transmission and area spread in high density pig regions. Furthermore, PEDV has a low infectivity dose and is able to survive in the environment for extended periods facilitating the risk of disease transmission [15] .", "To determine whether PEDV could become airborne under field conditions, 8 swine herds located in Oklahoma (US) and belonging to one production company were identified. Finishing and breeding herds that were experiencing acute PEDV outbreaks during each day of air collection throughout the study were purposively selected. Air collection was conveniently performed at different locations downwind, ranging from 0.006 to 15 miles (9.6 m to 24.14 km) from each of the farms starting from the furthest distances each day. A total of 62 samples were collected using an air cyclonic collector as described above for 30 min, with samples stored on dry ice and submitted to the UMN VDL for PEDV RT-PCR testing." ] },{ "paper_id": "11115aa43542f817d78ca0c8ec2b50e04eb7cc17", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "It is known that the degree of pathogenicity depends on the virus species, with 5 species ( Zaire ebolavirus, Sudan ebolavirus, Bundibugyo ebolavirus, Tai Forest ebolavirus, and Reston ebolavirus) identified to date. Ebolaviruses belonging to Reston ebolavirus (REBOV) do no cause symptomatic disease, whereas those belonging Published: xx xx xxxx OPEN www.nature.com/scientificreports/ 2 SCIenTIFIC REPORTS | (2018) 8:5495 |", "Statistical analysis. Student's paired t-test was used to determine the statistical significance of the differences. A p-value of less than 0.05 was considered statistically significant.", "Ebolaviruses comprises 5 species that exert varying degrees of mortality/infectivity in humans with" ] },{ "paper_id": "111968f7fb102882c193488965e41d5d0f0103dc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Input buffers are continuously polled by the corresponding component and processing continued once data is available. An adjustable buffer length according to load expectation helps to prevent overflows.", "For instance, Figure 9 shows a screenshot of the implemented sequential workflow for a distance based phylogenetic analysis." ] },{ "paper_id": "111db95189df3fa90756c174fbb5abff1ca1bb01", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The performance of the prediction models were evaluated by several measures: sensitivity, specificity, accuracy, positive predictive value (PPV), negative predictive value (NPV), Matthews correlation coefficient (MCC) and the area under the ROC curve (AUC), which are defined as follows ", "where" ] },{ "paper_id": "111e82fd55d8b42cd523cf365b53dfcdaa2165d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "HI Titer VN Titer LaSota 6.7 \u00b1 0.41 0 rNDV-IBV-T/B 6.6 \u00b1 0.32 6.82 \u00b1 0.26 PBS 0 0", "The ciliostasis activity of the tracheal explants was examined on 10 tracheal ring explants per chicken (5 chickens of each group) 5 dpc. The tracheas were carefully removed and examined for ciliary activity within 2 h after collection as described in the referenced papers [43, 44] . Briefly, 1 to 2 mm sections from the middle of each trachea were prepared and examined under a low-power microscope, and ciliary activity was scored as follows: 0, denotes all beating cilia; 1, 75% beating; 2, 50% beating; 3, 25% beating; and 4, absence of beating (100% ciliostasis). A maximum possible ciliostasis score of 40 suggested complete ciliostasis (total lack of protection).", "Vaccines 2019, 7, x 6 of 15", "Avian infectious bronchitis (IB) is an acute and highly contagious viral respiratory disease of chickens. IB occurs worldwide and causes substantial economic losses in the poultry industry [1] [2] [3] [4] [5] . IB is caused by the infectious bronchitis virus (IBV) which belongs to the order Nidovirales, family Coronaviridae, genus Gammacoronavirus. IBV causes upper respiratory illness, nephritic syndrome, and a drop in egg production in layer chickens [1] . The mortality rate can be high in young chickens, especially with other secondary complications such as viral and bacterial infections [6] [7] [8] [9] [10] ." ] },{ "paper_id": "11227aa67f131d1b8220d5c45b4bf592f0a48ef4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Target peptide (2554.6) containing fraction obtained above were loaded onto a home-made C18 column (100 mm \u00d7 100 \u03bcm) packed with Sunchron packing material (5 \u03bcm) and followed with nano-LC-ESI-MS/MS analysis without digestion. The LTQ mass spectrometer (Thermo Finnigan, USA) was operated in a datadependent mode, in which the initial MS scan recorded the m/z ratios of ions over the mass range from 400-2000 Da firstly, and then the five most abundant ions were automatically selected for subsequent collisionactivated dissociation." ] },{ "paper_id": "112c03868171e79e5f64b72e7c837fd4875d88f4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "ZNA probes provide broad flexibility with respect to experimental design and represent an effective alternative to minor groove binder-DNA and locked nucleic acid probes [26] .", "Student's t-test was used to compare the viral loads between the various clinical symptom groups. The correlation between PRRSV and PRDC was evaluated using the chi-square test with Yate's correction. P values <0.01 and <0.001 were considered significant and highly significant, respectively. ", "A novel type of modified oligonucleotides known as ZNA was recently developed as a method for the clinical diagnosis of pathogens, such as the hepatitis B virus [27] . ZNAs are able to discriminate between complementary sequence that are a perfect match and those that are mismatched by a single base pair [25] . ZNAs are particularly efficient at low magnesium concentrations, low primer concentrations and high annealing temperatures [25] ." ] },{ "paper_id": "11416bee008daf3c42621002ba7f3a6939601b0d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Tetherin inhibits the release of not only HIV-1 but also that of a broad spectrum of other enveloped viruses, including alphaviruses, filoviruses, rhabdoviruses, arenaviruses, herpesviruses, paramyxoviruses, flaviviruses, orthohepadnaviruses, orthomyxoviruses, and other retroviruses (reviewed in [23] [24] [25] ). Many of these viruses have evolved diverse strategies to antagonize tetherin. HIV-1 Vpu counteracts human tetherin by reducing its cell-surface expression via lysosomal and proteasomal degradation [26] [27] [28] [29] [30] [31] [32] [33] [34] or by trapping tetherin intracellularly and/or preventing its recycling back to the PM [1,2,32,35-38]. The specificity of HIV-1 Vpu towards tetherin antagonism also varies from species to species. HIV-1 Vpu counteracts tetherins from human, chimpanzee, and gorilla; however, it is relatively inactive against tetherin from other non-human primates and non-primates [28, [39] [40] [41] [42] . Simian immunodeficiency virus (SIV) and HIV-2, which do not encode a vpu gene, antagonize tetherin through their Nef and envelope (Env) proteins, respectively, in part through an intracellular sequestration mechanism [29, 39, [42] [43] [44] [45] [46] [47] [48] .", "HeLa or 293T cells were transfected with HIV-1 molecular clones, virions were collected after 24 h, pelleted in an ultracentrifuge, cell and virus pellet were lysed in a buffer containing 50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 0.5% Triton X-100, and protease inhibitor cocktail (Roche Life Sciences, Basel, Switzerland). After denaturation by boiling in sample buffer, proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), transferred to polyvinylidene difluoride (PVDF) membrane, and incubated with appropriate antibodies as described in the text. Membranes were then incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies, and chemiluminescence signal was detected by using West Pico or West Femto Chemiluminescence Reagent (Thermo Fisher Scientific, Waltham, MA, USA). The protein bands were quantified by using Imagelab-Chemidoc (Bio-rad Laboratories, Marnes-la-Coquette, France)." ] },{ "paper_id": "1146cc4ce6094ad35cc188166285b8c519986b6d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Accession number(s). The complete genome sequence of PEDV strains JSLS-1/2015 and JS-2/2015 have been submitted to GenBank under the accession numbers KX534205 and KX534206, respectively.", "To our knowledge, this is the first report of a complete PEDV sequence isolated from dead pigs with a long-fragment deletion in ORF1b. So, further studies will be carried out to explore the virus's biological activities and pathogenesis in causing disease comprehensively.", "Two porcine epidemic diarrhea virus (PEDV) strains, JSLS-1/2015 and JS-2/2015, were isolated from piglets with watery diarrhea in South China. Two genomic sequences were highly homologous to the attenuated DR13 strain. Furthermore, JSLS-1/2015 contains a 24-amino-acid deletion in open reading frame 1b, which was first reported in PEDV isolates." ] },{ "paper_id": "114b18b271ebb99486d88b94f526864870ec4f11", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "11588188717735eb36e684003283dbe2d9832286", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Taken together, the NPC1 protein is a filovirus receptor with unexpected characteristics: In comparison to cell surface receptors used by other viruses, NPC1 is unique in recognizing the filoviral glycoprotein only after uptake into the cell and after proteolytic processing. The identification of small molecule inhibitors directly or indirectly inhibiting NPC1-usage by GP 1,2 for host cell entry [20, 129] makes it an attractive candidate for antiviral therapy.", "Integrins are cell surface expressed heterodimeric type I transmembrane glycoproteins, which are composed of two non-covalently linked subunits (\u03b1 and \u03b2) [122] . The integrin family in mammals comprises eighteen \u03b1 and eight \u03b2 subunits which can assemble into 24 different heterodimers [139] . These heterodimers, in turn, convey specificity to cell-cell and cell-extracellular matrix adhesion, immune cell recruitment, extravasation, and signaling events [121, 140] . Members of the integrin family have been discovered as attachment factors or receptors for a large number of enveloped and non-enveloped viruses, including herpesviruses [141] [142] [143] , adenoviruses [144, 145] , hantaviruses [146] [147] [148] [149] , picornaviruses [150] [151] [152] , and reoviruses [153, 154] . The association with viral surface proteins and microbial pathogens are followed by multiple signaling events, some of which promote cytoskeletal reorganization and thus facilitate receptor-mediated endocytosis (as reviewed in [155, 156] and references therein). It is not surprising that numerous viruses hijack integrins for infectious entry, as they are widely expressed in various tissues throughout the body ( Table 2) .", "Filovirus infection causes severe hemorrhagic fever in humans and non-human primates. Outbreaks of filovirus hemorrhagic fever occur in equatorial Africa and are associated with high case-fatality rates [1] . At present, neither vaccines nor antiviral drugs have been approved for combating filovirus infection. The filoviridae family comprises two genera, Ebolavirus (the ebolaviruses) and Marburgvirus (the marburgviruses). The genus Marburgvirus includes a single species, Marburg marburgvirus, which has two members, Marburg virus (MARV) and Ravn virus (RAVV). The genus Ebolavirus includes five species, each of which has a single member: Zaire ebolavirus (Ebola virus, EBOV), Sudan ebolavirus (Sudan virus, SUDV), Ta\u00ef Forest ebolavirus (Ta\u00ef Forest virus, TAFV), Bundibugyo ebolavirus (Bundibugyo virus, BDBV) and Reston ebolavirus (Reston virus, RESTV) [2, 3] . Filoviruses exhibit different virulence in humans: EBOV and MARV infection is associated with case-fatality rates of up to 90% [4, 5] while RESTV seems to be apathogenic [6] [7] [8] . Nevertheless, infection of non-human primates with RESTV can induce hemorrhagic fever [9] . Evidence is emerging that African [10] [11] [12] [13] , Asian [14] and possibly also European [15] bats are natural reservoirs of filoviruses and these animals could transmit the virus directly to humans or via intermediate hosts, including gorillas [16, 17] and swine [6, 14, 18] . Thus, filoviruses pose a threat to human and animal health in different continents, but virulence factors and pathogenesis are incompletely understood.", "Cathepsins comprise serine, aspartic and cysteine proteases and carry out diverse biological functions, including antigen processing for MHCII presentation [168] [169] [170] . Cysteine proteases of the papain family, some of which are localized in endosomes, are expressed as preproenzymes and are activated by proteolysis in the endoplasmatic reticulum and the late endosome/lysosome [168] [169] [170] . The low pH environment present in the latter compartment is essential for cathepsin enzymatic activity." ] },{ "paper_id": "1174cadd31854c1128f0bbf2a61d31b2b72f61c3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Two investigators (KPK and SWHL) independently screened the titles and abstracts. Full texts of relevant articles were retrieved and reviewed independently to determine eligibility for inclusion in the review. Any disagreement was resolved through discussion.", "Data regarding study design, participants, interventions, clinical outcomes, and adverse events were independently abstracted by two investigators (KPK and SWHL) using a standardized data collection form. We also contacted five corresponding authors for additional information [17] [18] [19] [20] [21] and two responses were received [17, 20] .", "Supporting information S1 " ] },{ "paper_id": "118373b29085c6212547a34993be16eb98008dd0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1185137c3c9ddbc0c91aa718179dadd11039f771", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cell culture. 293T Antibodies. The following antibodies were used as primary antibodies: Anti V5 (Invitrogen), anti \u03b2-actin (Sigma-Aldrich), anti VSV-M (Kerafast). As secondary antibody, an anti-mouse HRP (horse radish peroxidase) conjugated antibody was employed (Dianova). All antibodies were diluted in phosphate buffered saline containing 0.5% Tween20 (PBS T) and 5% skim milk.", "Plasmids. We employed pCAGGS-based expression plasmids encoding vesicular stomatitis virus (VSV) glycoprotein (VSV-G), wild-type (wt) MERS-S or cleavage site mutants 748 SSVR 751, 748 ASVA 751, 763 NYT 765, 884 ASAA 887 and 748 ASVA 751 + 884 ASAA 887 that have been described previously 10, 16, 21, 23 . Additionally, MERS-S-proteins containing single amino acid exchanges at the cleavage sites of the S1/S2 border, ASVR (R748A) and RSVA (R751A), or the S2\u2032 site, ASAR (R884A) and RSAA (R887A), were generated by overlap extension PCR (S protein mutants are summarized in Fig. 1 ). For all S proteins, we constructed versions with or without a C-terminal V5 tag. Further, we generated expression plasmids for human TMPRSS2 and human DPP4 N-terminally linked to DsRed (DsRed DPP4) by PCR-based methods and inserted the respective open reading frames and into the pQCXIP vector. In case of the expression vector for TMPRSS2, the vector encoded selection marker for puromycin resistance was exchanged by that for blasticidin resistance taken from the (pcDNA6/TR) vector. The integrity of the PCR-amplified sequences was verified by automated sequence analysis (Microsynth Seqlab).", "SCientifiC REPORtS | (2018) 8 :16597 | DOI: 10 .1038/s41598-018-34859-w sufficient for S protein-driven entry. The S protein is synthesized as an inactive precursor and is converted into its active form upon cleavage by host cell proteases 8, 9 . In fact, proteolytic processing of MERS-S might be sufficient to trigger the membrane fusion reaction and is subsequently referred to as activation. The host cell proteases responsible for MERS-S activation constitute potential targets for antiviral intervention and the identification of their cleavage sites might instruct the generation of inhibitors. Therefore, the proteolytic activation of MERS-S is in the focus of ongoing research endeavours." ] },{ "paper_id": "11855c4ce9640d35da8dd4c54e913843a41c9252", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Acute respiratory infections (ARI) are prevalent worldwide and infections by influenza virus are particularly responsible for morbidity and mortality among children and other groups considered at high risk for complications from viral infections [1, 2] .", "Routine clinical evaluations, including the Pediatric American College of Rheumatology 30% (ACRPed30) [14] were conducted during both surveillance periods prior to and at 30, 90 and 180 days after influenza vaccination.", "The study protocol was approved by the Ethics Committee of the Hospital das Cl\u00ednicas da Faculdade de Medicina de Ribeir\u00e3o Preto-USP (Process number 10542/2007) and the parents of all children and adolescents involved in the study gave informed consent for their participation." ] },{ "paper_id": "1185a17f1cb650e0433ab8c84202cc242c54f6cc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "HCWs where effective pharmaceutical interventions may not be available, e.g. the 2003 severe acute respiratory syndrome (SARS) epidemic and the Middle East Respiratory Syndrome (MERS) outbreaks since 2012 [2, 3] .", "We would like to thank Abrar Chughtai for his contribution to the study." ] },{ "paper_id": "11914635e8fc7c041e815263d5e20ca4ad9166bb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "to thank the broilers farm's owners for their cooperation and patience during samples collection.", "All Authors declare that they have no conflict of interest.", "ARTICLE HISTORY" ] },{ "paper_id": "119585987862e9f02ef0a1748462fb38ecb95b53", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Where do we go from here?", "Editorial" ] },{ "paper_id": "1196301d4e04f2283f18f95fbbbd6bc5cf6e341f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Goat and sheep sera were obtained from Innovative Research.", "Vero cells (African green monkey kidney epithelial cells) were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% FBS, 1% penicillin/streptomycin, and 1% glutamax (DMEM+++) in a humidified environment containing 5% CO 2 at 37\u00b0C.", "The experiments described in this paper used a live attenuated vaccine (MP12) derived from the RVFV ZH548 strain that had been isolated in 1977 from a patient with uncomplicated RVFV. The virus was generated by 12 serial passages in MRC5 cells, inducing 25 nucleotide changes across the viral genome [14] ." ] },{ "paper_id": "11a3797796973b32b0763f8127b908f4783e5734", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The identity of the heavy and light chains of each MAb was determined using Pierce Rapid Isotyping Kit with Kappa and Lambda Mouse (Thermo, Rockford, IL, USA).", "Care of laboratory animals and animal experimentation was performed in accordance with animal ethics guidelines and approved protocols. All animal experiments were approved by the Animal Ethics Committee of Harbin Veterinary Research Institute of the Chinese Academy of Agricultural Sciences. The Animal Ethics Committee approval number was SYXK (Hei) 2011-022.", "Virus-infected cell lysates or expressed fusion proteins were subjected to electrophoresis on 12% SDS-PAGE after reduction with dithiothreitol (DTT) at 100uC for 5 min, then the samples were transferred to a nitrocellulose membrane. Nonspecific antibody binding sites were blocked with 5% skimmed milk powder in PBS overnight at 4uC. The membranes were incubated with MAbs as the primary antibody, after which each blot was washed five times with PBST and treated with IRDye 700conjugated goat anti-mouse secondary antibodies (LICOR Biosciences, NE, USA). Blots were visualized by scanning the membranes with a LICOR Odyssey infrared image system (LICOR Biosciences)." ] },{ "paper_id": "11ad2acc16067afbf2ce40d422647c3d899ecbd4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Textbooks in Medicine and in other health related areas teach that infectious respiratory diseases such as Tuberculosis and Influenza have a common symptom: cough. Those textbooks also teach that via cough is how these diseases are spread and transmitted to noninfected susceptible individuals. Cough mechanisms are described in those textbooks with emphasis in clinical diagnostic and management of the individual with cough [7] [8] [9] .", "IRD are a leading cause of morbidity and mortality in humans. They cause great disruptions in many sectorseconomic, educational, recreational, and familial -and can bring worldwide healthcare systems to near collapse. IRD, whether bacterial, mycotic or viral, are transmitted to non-infected persons when an infected individual expels droplets loaded with pathogenic microorganisms during coughing.", "The end result of this debate will have a direct influence on social distancing (i.e. how far apart people should position themselves to prevent infection) and on whether current recommended primary prevention measures and commonly used personal protective equipment are effective barriers to transmission." ] },{ "paper_id": "11ae714b01d105e39919f2a6d9b2471153963d25", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MDRGN have previously been defined as Enterobacteriaceae with extended spectrum beta-lactamase (ESBL)phenotype, and Enterobacteriaceae, Acinetobacter baumannii and Pseudomonas aeruginosa resistant against piperacillin, any 3rd/4th generation cephalosporin, and fluoroquinolones +/\u2212 carbapenems [7, 25] .", "Patient's entry criteria for NIMCU were a stable circulatory constitution and respiratory status without the need of invasive ventilation neither non-invasive continuous positive airway pressure (CPAP).", "Parents were encouraged to visit their neonate 24 h a day. The total amount of visitors/baby was limited to two persons. At their first visit, all visitors received a short instruction of the hygienic rules performed by the attending nurse.", "The Enterobacter cloacae isolates from the transmission event were whole genome sequenced to investigate their identity. They depicted an identical new multilocus sequence type (allele variants depicted in Table 3 ), and carried both the AmpC beta-lactamase bla ACT-7 and the fosfomycin resistance gene fosA, indicating a clonal spread." ] },{ "paper_id": "11bf75e973011d86b1039b707ed086b98deb5642", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MM wrote and conceived the manuscript. AC, DM, and SM contributed to conception and generated data. BO, SV, and SM revised the manuscript, read, and approved the submission.", "This publication is part of a project entitled CurB-Sviluppo di nuove molecole candidate alla cura di HBV, funded by Regione Lombardia, Programma Operativo Regionale 2014-2020, Obiettivo Investimenti in favore della crescita e dell'occupazione (cofinanziato con il FESR), Asse Prioritario I-Rafforzare la Ricerca, lo Sviluppo e l'Innovazione, Azione I.1.b.1.3-Sostegno alle attivit\u00e0 collaborative di R&S per lo sviluppo di nuove tecnologie sostenibili, di nuovi prodotti e servizi-R&S Per Aggregazioni. Call per l'Attivazione di un percorso Sperimentale Volto alla Definizione degli Accordi per la Ricerca, Sviluppo e Innovazione. art. 11 della Legge 241/1990 1 ." ] },{ "paper_id": "11ccc8d0c6d5b3297821a0e39535ce9dcb4810ef", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Inclusion (all criteria required)", "2. Diseases: epidemic and pandemic respiratory infectious diseases. Namely, avian influenza, swine influenza, Middle East respiratory syndrome (MERS), and severe acute respiratory syndrome (SARS).", "3. Behaviors: preventive, avoidant, and management health-related behaviors (reported, intended, or actual)." ] },{ "paper_id": "11d016e4272c8a89fe7986afde61e6fb91908304", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Interferences between pathogenic bacteria and specific commensals are known. We determined the interactions between nasopharyngeal microbial pathogens and commensals during viral upper respiratory tract infection (URI) and acute otitis media (AOM) in infants.", "We obtained a total of 20,976,078 high-quality bacterial sequences comprising 13,982 unique operational taxonomical units (OTUs). Of 971 sequenced samples, 948 (98%) yielded ! 1000 There was no association between with age or sample type (p > 0.2 and p > 0.3, respectively). SDI by bacterial culture results are displayed in Fig 2A. The median SDI was 2.49 for samples with no otopathogen, compared to 2.04 in samples positive for S. pneumoniae only (P = 0.022); 1.82 for H. influenzae (P = 0.040); 2.41 for M. catarrhalis (P = 0.620) and 2.09 for 2 or more otopathogens (P = 0.048).", "We analyzed 971 specimens collected monthly and during URI and AOM episodes from 139 infants. The 16S rRNA V4 gene regions were sequenced on the Illumina MiSeq platform." ] },{ "paper_id": "11d9deb4869385080d322af3026110247fb4d145", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Accession number(s). The whole-genome sequence of the hPyV4/USA/AR001/2016 isolate has been deposited in GenBank under the accession number KX787894.", "We report here the complete genome sequence of a WU polyomavirus (WUPyV) isolate, also known as human polyomavirus 4, collected in 2016 from a patient in Arkansas with an acute respiratory infection. Isolate hPyV4/USA/AR001/2016 has a double-stranded DNA genome of 5,229 bp in length.", "Here, we describe a novel WUPyV isolate from a nasopharyngeal swab collected from a 13-month-old male (hPyV4/USA/AR001/2016) with no significant past medical history who was seen in the emergency department (ED) of Arkansas Children's Hospital in Little Rock, Arkansas, USA, on 15 March 2016. His symptoms included nonproductive cough, wheezing, and increased work of breathing. The patient was afebrile, had a heart rate of 160, respiratory rate of 36, and S A O 2 at 95%. He was given vaponephrine and albuterol in the ED. He improved and was able to be discharged home with albuterol as needed." ] },{ "paper_id": "11dcdcd827d9e2a609a7396a335d6c9891d99c28", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "11dfd91790da005937371365098de726ddfaec98", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "11f13e2859eb22b349dbef68fd8124b8ba445aac", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "11f2984bccfb6cb8952bceea9209357821a0583a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "11f3022ad1def6dfb1b29712112b96739ff3c498", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We would like to thank LetPub (www.letpub.com) for providing linguistic assistance during the preparation of this manuscript.", "Ethics approval and consent to participate Not applicable Consent for publication Not applicable", "The authors declare that they have no competing interests." ] },{ "paper_id": "11f8eeb589bf8737b2805b3bb50ca12b73884c64", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The ", "Results are presented as mean \u00b1 the standard deviations (SD). Statistical comparisons were made by using Student's t-test. p value less than 0.05 was considered statistically significant and p value less than 0.01 was considered highly significant." ] },{ "paper_id": "11fe16ac2f99335e81c64bb6b83761ed5b700963", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In D. melanogaster, among various lncRNAs, the hsw\u03c9-transcript was reported to form perinuclear omega-speckles in the nuclei in response to heat shock [21] , roX1androX2 found in the male-specific lethal (MSL) protein complex affected dosage compensation [22] , yellow-achaete intergenic RNA(yar) lncRNA influenced circadian rhythms [23] , CASK regulatory gene CRG lncRNA regulated Ca 2+ /calmodulin-dependent protein kinase (CASK) transcription [24] , and Sphinx lncRNA influenced courtship behavior [25] .", "The knowledge in the field of lncRNAs, and their mode of action and function can provide deep insight into the evolution and function of genomes during host-pathogen interactions.", "The success of insects in adverse environments indicates the advanced defense mechanisms employed by these organisms. With the passage of time, some insect species became resistant to most pathogens, and some remained susceptible to various infections. Insects exhibit both humoral and cellular immune responses against pathogens. The lack of an adaptive immune system has forced insects to choose immediate non-specific responses that include the production of antimicrobial peptides, phenoloxidase, apoptosis, phagocytosis, encapsulation, and nodulation. With the advent of molecular biology techniques, a large amount oftranscriptome data has been published and reviewed on the model organism Drosophila melanogaster, while other insect species have been investigated to a lesser extent. Transcriptome sequencing provides information on all transcripts occurring in different cells and tissues [1, 2] , while RNA sequencing provides data on multiple classes of non-coding RNAs (ncRNAs) [3] [4] [5] [6] ." ] },{ "paper_id": "1204dc3b147d4e4d5ccc3d4aff7551d39f5fe438", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Respiratory disease (Asthma, COPD a ) 8", "Immunodeficiency (common variable immunodeficiency, HIV) 2", "Cancer (multiple myeloma, synovial cell cancer) 2" ] },{ "paper_id": "120aebc8b074393770c411ebf774ed18a5a2a1da", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Recherche M\u00e9dicale (M.D.). This is manuscript number 21323 from the Scripps Research Institute. We apologize to authors whose work we may have misinterpreted or failed to cite. ", "The hepatitis C virus (HCV) is a major causative agent of acute and chronic liver diseases worldwide. 130-170 million people are persistently infected with HCV and have a high risk of developing liver cirrhosis and hepatocellular carcinoma [8] . A hallmark of HCV is its high propensity to persist with up to 80-90% of infected individuals failing to eliminate the virus. A prophylactic vaccine is not available and its development has been seriously hampered by the high genetic variability of the virus. Treatment options for chronic HCV infection are also limited. Indeed the current therapy, a combination of polyethylene glycol-conjugated interferon-\u03b1 and ribavirin, is associated with numerous side effects, has many contraindications and on average only approximately 50% of those patients who can qualify for treatment, tolerate its toxicity, and complete six months of therapy are cured [9] . A large number of direct-acting antiviral agents are under development at this time with the hope of eventually replacing interferon and ribavirin as the treatment of choice for chronic HCV infection.", "Recently, several papers have been published that shed light on the ability of HCV to modulate the autophagy pathway and on the capacity of several autophagy proteins to positively regulate HCV productive infection [41] [42] [43] [44] [45] [46] . Here we review these recent advances, present our understanding of the mechanism(s) by which autophagy proteins can enhance HCV infection, and discuss the implications of those concepts for the survival of HCV in infected cells." ] },{ "paper_id": "12127085d9546a704eb677320d4df5b44f4dce8f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "http://orcid.org/0000-0003-0400-8635", "ARTICLE HISTORY" ] },{ "paper_id": "121638b718d18f7bb5086223540f74cf61e49800", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Her physical examination revealed that she was obese, had a body temperature of 39.0\u00b0C, a pulse rate of 112beats/ minute and blood pressure of 145/90 mmHg. Her respiratory rate was 20 breaths/minute with oxygen saturation of 94% on room air. Her chest auscultation was unremarkable. She had a widespread, erythematous maculopapular rash with scattered petechiae on both legs. Examination of the oropharynx revealed erythema but no exudate.", "The chest radiograph at presentation was abnormal in 90% of patients. The most common pattern of abnormality was bilateral interstitial infiltrates (57%), although lobar consolidation was also noted reasonably frequently (24%).", "Written informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.", "Of the 21 cases retrieved in our literature search, 57% of the patients were men, and overall the patients' median age was 40 years (age range, 18 to 60 years). Where recorded, the commonest ethnic origin of patients was Caucasian (40%). Significant co-morbidity was uncommon among patients, but obesity was frequently noted as an examination finding." ] },{ "paper_id": "121f06c44cde088607a6f4d16098eb6101513c01", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Methods: Seventy-two male adult Wistar rats were divided into three groups and treated as follows.", "All data are presented as the mean \u00b1 SD. Statistical analysis was performed using SPSS 13.0 software (SPSS Inc., Chicago, IL, USA). One-way analysis of variance (ANOVA) with Turkey's post hoc test was used to examine differences between groups. Statistical significance was set at P <0.05." ] },{ "paper_id": "12329a694934f5824e1ef7d695a7a1fa0310f52c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "B-Cell epitopes are antigenic residues that B Lymphocytes bind to. These antigenic determinants can be either continuous, or conformational. Continuous epitopes, also known as linear epitopes, are formed by continuous sequences of residues. The majority of epitopes (90%) are within the conformational class [4] , which are the result", "doing this search experimentally, searching exhaustively by brute force, is an extremely time consuming endeavour. Thus, computational approaches are employed, and are the primary subject domain of computational vaccinology. Epitope prediction, the ability to predict with some probability whether a particular amino acid belongs to an epitope, can guide our experimental based search and save us a significant amount of time.", "The SEQ194, HIV, Pellequer, and AntiJen sequences were all calculated by measuring the cross-reactivity between the intact protein and the peptide fragments. AntiJen and SEQ194 have extremely low epitope densities (1.4 and 6.6%, respectively); HIV and Pellequer have an order of magnitude higher epitope densities (37.1 and 37.6%, respectively); and SARS has the highest epitope density of the five datasets (63.7%). Thus, together these 5 datasets represent a realistic test of the classifier that is to be used to search for new epitopes within new protein sequences, covering a wide spectrum of possible epitope densities." ] },{ "paper_id": "123683340d6d91bf7251d4b91b7503f907dd56cc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Step " ] },{ "paper_id": "123db7e17bb17a0d4ff1e7ef87cb629d6ac78125", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Human coronavirus OC43 (Nidovirales: Coronaviridae:", "Further human coronaviruses complete genome sequences included HCoV-HKU1 (KF686341.1), HCoV-NL63 (DQ445911.1), HCoV-229E (JX503061.1), HCoV-SARS (AY291315), and two HCoV-MERS (KJ156949 from a strain detected in a human patient and KJ713299.1 detected in a dromedary camel).", "Human coronavirus evolution " ] },{ "paper_id": "1244246ac28247b5674d6f4a8587e064bb565d7f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Proportions standardized by age, gender and education attainment, and the corresponding 95% confidence intervals (95% CI) were calculated using logistic regression models for each type of behavior in the three residential areas and the total sample.The logistic regression model used for calculating the risk ratios of each behavioural outcome is showed below:", "50.1% of the respondents reported cleaning hands immediately after touching birds when buying and most say that they do this after touching backyard birds, bird cages or bird droppings. When slaughtering birds at home, the most frequently adopted protective measure was wearing aprons, outer garments or coveralls (13.7%, 95% CI: 6.2-27.3%), though a few reportedly wore gloves, boots or face masks (Table 1) .", "Live animal markets were found to be responsible for the spread of Severe Acute Respiratory Syndrome Coronavirus in 2003 [30] , and many H5N1 avian influenza virus infections [31] . However, perceived health risk from live animal sales did not increase from 2006 through 2013 even though human H7N9 cases were again closely linked with live bird exposures in wet markets [2, 3] . This suggests that knowledge deficiency or risk fatigue and adaptation may both be targets for public health education. However, compared with the 2006 survey, the proportion of respondents citing poor market hygiene as a cause of avian influenza infection had doubled in 2013, suggesting increased awareness of and attribution to poor hygiene rather than retail practice s that artificially concentrate and mix live animals as the main cause.", "Only half of those who bought live poultry touched the birds directly when buying, but more than 80% of these respondents reported cleaning their hands immediately after touching birds in the backyard, probably because hand-washing facilities are more likely to be available at home than in the LPMs. Easy access to hand-washing facilities in wet markets may promote handwashing practices for those who touch birds. However, persons who reported slaughtering birds at home generally adopted no protective measures, an practice similar to that observed among live poultry traders [24] . This risks exposing them and their families to avian-sourced infections like H7N9 and gives a direction for educational interventions." ] },{ "paper_id": "12590435a221d10824ab106e66d0f9fec397db40", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "FAD was released from recombinant proteins by heating at 75 C for 5 min in the dark and analyzed by highperformance liquid chromatography (HPLC). Briefly, HPLC separation was achieved with a Synergi 4u Fusion column (25 cm \u00c2 4.6 mm, 5 mm) using a gradient of 5 mM ammonium acetate, pH 6.5, to acetonitrile 50% and water 50% over 35 min at a flow rate of 0.6 ml/min. Flavins were detected by fluorescence emission (525 nm) using a Waters 474 scanning fluorescence detector set at 450 nm for excitation.", "Transfer RNAs (tRNAs) are highly and diversely modified, and each has a unique pattern of modification (1) (2) (3) . These modifications are post-transcriptionally introduced at precise positions by specific enzymes and play important roles in folding, stability, identity and in the functions of tRNAs.", "The acid resistance experiments were performed essentially as previously reported (39) . Briefly, strains were grown in LBT containing 0.4% glucose to stationary phase. The cultures were then diluted 1:1000 into EG medium [minimal E medium containing 0.4% glucose; (40) ], pH 2.0, supplemented or not with 0.7 mM glutamate. Samples were obtained at 0, 1, 2, 3 and 4 h post acid challenge and spotted on LAT plates.", "There are very few data available on the identity determinants required by TrmL. Methylation of the ribose The ratio was calculated as CFU/ml recovered on LAT supplemented with tetracycline versus CFU/mL recovered on LAT." ] },{ "paper_id": "125b3f6dd69d07e5dac7fa45b6567008bd1244ae", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Knowledge is always accompanied by uncertainty." ] },{ "paper_id": "126b264339dd9d8ee65cc747822e16c83af57e12", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Despite substantial efforts to control PRRS, no production or vaccination regimen has demonstrated sustaining success 19, 20 . This is likely in part due to biosecurity challenges and both antigenic and genomic variations among PRRSV isolates, allowing for frequent transmission between pig populations and persistence of the virus in infected pigs 21 . Attenuated live virus vaccines have been commercially available for over two decades, however, PRRS remains one of the top challenges for swine producers and outbreaks of PRRS. Therefore, an improved vaccine is needed to prevent and control PRRS.", "Differences between two groups for VN antibody titers of individual pigs were analyzed using analysis of variance (ANOVA). A two-tailed P-value of less than 0.05 was considered significant." ] },{ "paper_id": "1275c64d711b3973f7e25ebc72bbc7c99341dd00", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In conclusion, this work reveals some new mechanisms by which PNS neurons control the cytokine response during alphaherpesvirus infection and contribute to severe neuropathies.", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111" ] },{ "paper_id": "12834756cf70a24e0bc14906b131ca587f86dc02", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Tissue samples were collected from pigs died from diarrhea symptoms on farms, the small intestine was immersed in phosphate-buffered saline (PBS), washed several times to eliminate residual blood, and then placed in a centrifuge tube and stored at \u2212 80\u00b0C until use.", "The experimental procedure for virus isolation is in African green monkey kidney (VERO) cells according to reference [25] . The isolates were determined by more propagation until apparent cytopathic effects appeared.", "Prior to RNA extraction, frozen small intestine samples (~20 mg) were homogenized in liquid nitrogen. Then, total RNA was extracted by using a commercial extraction kit (EasyPure Viral DNA/RNA Kit; TransGen Biotechnology, Inc., Beijing, China) according to the manufacturer's instructions. The RNA was dissolved in DEPC-treated water for cDNA synthesis. The extracted RNAs were suspended in 100 \u03bcl of elution buffer and stored at \u2212 80\u00b0C until use." ] },{ "paper_id": "1291b42497aeef11d21f1fcf33ee7e910a3396dd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "EVD in 2014 started and propagated in western Africa. Guinea was the index country which exported the infection to Sierra Leone and Liberia initially, and later to Nigeria, Senegal and Mali in addition to Spain and United States of America.", "In 2014 WPV was actively transmitted within at least ten countries with a risk of exportation and infection to others. Eastern Mediterranean Region is shouldering the greater portion of this burden particularly due to \"Pakistan to Afghanistan\" and \"Syria to Iraq\" exportations. While, \"Cameroon to Equatorial Guinea\" and \"Equatorial Guinea to Brazil\" are the other documented exportations in the rest of world during 2014 [18] . As a response, emergency committee of IHR (2005) on polio was conducted three times and has approved the temporary recommendations for three categories of countries.", "As per International Health Regulations (IHR-2005) [1] , Public Health Emergency of International Concern (PHEIC) is defined as \"an extraordinary event which is determined to constitute a public health risk to other States through the international spread of disease and to potentially require a coordinated international response\" [2] . PHEIC concept is one of the major update points in IHR (2005) version. It considers prevention, protection, response and containment of an event in such a manner that is fully aligned with human right's preservation and avoidance of unnecessary interference with international travel and trade [3] ." ] },{ "paper_id": "1292b5cdd7a8850cf1d0ceb1df706012c469da62", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "129341a52b43ccd59368d094950322d983ebe223", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Assumptions of normal distribution and equal variances of numerical data were tested using a Shapiro-Wilk W and a Brown-Forsythe test, respectively. All summary statistics are reported as medians and interquartile ranges (IQR) or as percentages.", "Positivity for tested gastrointestinal parasites ranged between 21 and 41%, whereas the study prevalence for both viruses evaluated reached approximately 20% (Table 1) ." ] },{ "paper_id": "1297127819be12e7f5319edd0a9b35fd5cc566b7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Expression and purification of GST-E7 was undertaken following our previous published protocols [14] . Expression vectors for E7 with point mutations or deletions were also described previously [46, 63] ." ] },{ "paper_id": "12a4354b2c97189beca7e04d721508f420928396", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "CM and WF contributed equally to this work. CM and WF wrote the manuscript and made the figures. LC-C edited the final version of the manuscript. ", "In addition to canonical initiation of translation, capindependent mechanisms of translation have also been described for DENV. Indeed, DENV can achieve vRNA translation and wild-type production of infectious viral particles when capdependent translation is inhibited by treating the cells with drugs that impair the phosphoinositol-3 kinase (PI3K) pathway.", "Downstream of IFN production and signaling, the sfRNA also plays a role in ISG expression at the post-transcriptional level. Indeed, host RNA-binding proteins G3BP1, G3PB2 and CAPRIN, which are involved in ISG translation are inhibited by their association with DENV sfRNA in Huh7 cells (Bidet et al., 2014) . G3BP proteins are core components of SGs (Anderson and Kedersha, 2006 ) whose formation and functions are modulated by flavivirus infection, as discussed above. Hence, it is tempting to speculate that, through the hijacking of SG components, flaviviruses remodel the host proteome by positively or negatively regulating the expression of pro-and anti-viral host proteins, respectively." ] },{ "paper_id": "12aa5eeb50296d810121cc1b2f87f053c39ce204", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(C) Predicted 3D structure of the MMTV SU in space-filled form generated using Swiss-Model is shown. The RBS is indicated in yellow, the glycosylation site in green, basic residues in blue and acidic residues in red. In the right panel, the RBS is enlarged and the charge change caused by G to E substitution at position 42 is highlighted.", "Knock-down of hTFR1 by small interfering RNA Hs578T cells (plated at a density of 3 \u00d7 10 5 cells per well of a six-well plate, one day before transfection) were transfected overnight with human TFRC SMARTpool (25 nM," ] },{ "paper_id": "12af3b3c07569926eb1ce96ebd4d5bffd05ce54a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For the GST pull-down experiments, human serum were incubated for 2 h at 4uC with 5 mg of purified GST or GST fusion proteins bound to glutathione beads (GE Healthcare, Little Chalfont, Buckinghamshire, UK). The adsorbates were washed with lysis buffer and subjected to SDS-PAGE and immunoblot analysis. Purified AHSG protein was included as a loading control. ", "Two reporter plasmids encompassing 21091 to +22 bp of the human AHSG promoter were generated by PCR from two genomic DNA samples with either 2799A OR -799T, using the primers P1: 59-cgcagatctGGTCTCCATGAGAGGGCTTC-39 and P2: 59-cgcaagcttCAGGCGTGCAGGTGGTTG-39, respectively. The PCR product was digested with BglII and HindIII and ligated into a pGL3-basic promoter-probing vector (Promega) containing the firefly luciferase gene as a reporter. The constructs were sequenced to ensure correct cloning.", "Genotype Allele " ] },{ "paper_id": "12bc05b6a9ae2d8823f67b0a8200fb7f72c45f9b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supplementary materials are available at Open Forum Infectious Diseases online. Consisting of data provided by the authors to benefit the reader, the posted materials are not copyedited and are the sole responsibility of the authors, so questions or comments should be addressed to the corresponding author.", "Medimmune, and payments from GlaxoSmithKline for participation in a DSMB. All authors have submitted the ICMJE Form for Disclosure of Potential Conflicts of Interest. Conflicts that the editors consider relevant to the content of the manuscript have been disclosed." ] },{ "paper_id": "12bc88e7428c240181f181ca0358dac85ae16289", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Mitoxantrone, a cytotoxic drug with immunomodulatory properties, is used to treat progressive forms of MS [129] . Mitoxantrone increases the ex vivo production of the Th2 cytokines IL4 and IL5, but with no significant changes in IFN\u03b3, TNF\u03b1, IL10, or IL17 expression by PBMCs or CD4 + T cells, indicating that the immunomodulation afforded by mitoxantrone treatment in MS acts through the enhancement of Th2-type cytokines [130] .", "These advances in identifying unique therapeutic targets for MS have instigated numerous phase II and phase III clinical trials, for example, trials of various mAbs, including those directed against CD52 (alemtuzumab), CD25 (daclizumab), and CD20 (rituximab), and trials of disease-modifying therapies, such as teriflunomide, laquinimod, and fumarate [135, 155] . For example, alemtuzumab, a humanized mAb, targets the surface molecule CD52 on all T-cell populations and other cellular components of the immune system, such as thymocytes, B cells, and monocytes [156] .", "In summary (Figure 2 ), these immunomodulatory agents and neuroprotective therapies for MS have great value as clinical agents, to be tested in clinical trials or preclinical studies, and in the development of novel therapeutic strategies for MS [55] ." ] },{ "paper_id": "12c2a6ee1e3e7cf0f915e5c5454627b7e1ed9db3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are presented as the means \u00b1 standard deviations and are representative of at least three independent experiments. Differences between groups were analyzed by analysis of variance (ANOVA), and means were compared by Student's t-test. p-values less than 0.05 were regarded as significant. Results for percent initial body weight were also compared by using Student's t test. Comparison of survival was done by log-rank test using GraphPad Prism 6 version.", "The mice were intra-nasally infected with five times the 50% mouse lethal dose (MLD50) of H1N1, H5N2, H7N3 or H9N2 in 20 \u03bcl of PBS per mouse. Treatment and challenge experiments were conducted in an approved BSL-2 + facility. The body weight and survival were recorded up to 13 dpi. Mice showing a more than 25% body weight loss were considered to have reached the experimental end point and were humanely killed. At 3 and 5 dpi, three mice from each of the two groups from the H1N1-challenged set were randomly sacrificed to measure the lung virus titers.", "The animal study was conducted under appropriate conditions with the approval of the Institutional Animal Care and Use Committee of the Bioleaders Corporation, Daejeon, South Korea, Protocol number: BSL-ABLS-13-004. They are in accordance with Institutional, National and International laws for Laboratory Animal Experimentation." ] },{ "paper_id": "12c3660c37af4a311a3a14667a12ce48388dd6ce", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Time from exposure to manifestation of symptoms within which concern for disease is valid 8-10d, never more than 21d", "Non-human animals that can harbor and/or spread Ebola Bats 6 Historical Information Information that has nothing to do with current outbreak Historical data on past outbreaks, information regarding nations involved, etc.", "Any statement that is factually inaccurate but stated as question of hearsay \"Some are asking if Ebola is spread through the air\"" ] },{ "paper_id": "12c70c4d576fce0b20fce2b35e47b05baea97e35", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "After 40 years of reform, China's economic and comprehensive national strength have achieved breakthroughs, and resource allocation in all aspects has been strengthened overall; however, many structural problems have accumulated following years of sustained \"rapid development.\" A recent document shows that China has focused on the \"unbalanced and inadequate\" development and addressed it as a major social conflict [12] , which applies to the public health field.", "Suppose the sample containing n individuals is divided into K groups, each group is g k(k = 1, 2, 3\u2026K) , the number of individuals in g k of group k is n k , then P k k\u00bc1 n k \u00bc n, y i and y k represent the human share of an individual i and the total human share of a group k, respectively. T b and T w represent the between-group differences and withingroup differences, respectively, so the decomposition of Thiel T index is as follows:" ] },{ "paper_id": "12c7bde10bc2422a099a326c99cba1ec1e496431", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Primers used to generate the described plasmids are available upon request. Constructs ORFs were verified by DNA sequencing and protein expression confirmed by Western blot (WB).", "Viruses 2012, 4 2138 D471G mutation on viral infection, suggesting that NP self-association is an excellent target for the development of new antivirals against arenaviruses." ] },{ "paper_id": "12cbf7162f5525c020e909c85db4142007c64603", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "New approaches to benzotriazole derivatives are therefore expected to have a broad-ranging impact. Among the various N-substituted benzotriazolyl derivatives, as compared to N-alkyl and N-acyl compounds, those with a C-O-N bond are less common. Typically the latter are synthesized by the alkylation of BtOH with alkyl halides [17, 18] , quaternary alkyl ammonium salts [19] , or via a Mitsunobu reaction (Scheme 1) [20] .", "1919" ] },{ "paper_id": "12d267205009c178b6a50506db717ff650d93415", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "12d7a96036ca9e861d3636d55d3841452e455c73", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study has been reviewed and approved by the Institutional Review Board of Samsung Medical Center and informed consent was waived by the board. Patient records/information were anonymized and de-identified prior to analysis.", "Conceptualization: KWS.", "Formal analysis: YBC." ] },{ "paper_id": "12f712c348c26e092759d804778defe2d2d4af6f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Consistent with the responsiveness of MERS-CoV to interferon treatment in vitro, combinational treatment of IFN-\u03b12b and ribavirin reduced virus replication and improved clinical outcome in MERS-CoV infected rhesus macaques [30] . It was further demonstrated that IFN-\u03b21b treatment showed a better outcome in the virusinoculated common marmosets [31] .", "Unlike most other human-pathogenic coronaviruses, which mainly cause self-limiting upper respiratory tract infections, MERS-CoV is capable of causing severe disease with lower respiratory tract involvement and extrapulmonary manifestations [11, 12] . Patients with severe MERS often present with pneumonic symptoms including fever, cough and dyspnea, with some progressing to respiratory failure and acute respiratory distress syndrome [13, 14] . Extrapulmonary manifestations such as renal failure, hepatic dysfunction, and diarrhea are not uncommon [13, 15] . Additionally, deranged coagulation profile and hematological changes may also be observed in severe MERS [15] . The infectious virus could be recovered exclusively from patients' respiratory tract, whilst viral RNA could be detected extrapulmonary specimens such as blood, urine and stool by nucleic acid amplification tests [16, 17] . These clinical and laboratory findings are suggestive of possibly disseminated viral infection.", "While the cellular tropism of SARS-CoV in human respiratory tract resembles that of MERS-CoV [21, 22] , a number of immune cells displayed distinct susceptibility to MERS-CoV and SARS-CoV.", "The MERS-CoV mouse models have been utilized to test the efficacy of antiviral drug, neutralization antibody and vaccine. A Venezuelan equine encephalitis replication particle expressing MERS-CoV spike protein (VRP-S) was demonstrated to substantially reduce the virus titer in lung tissues of the immunized hDPP4 transduced mouse model [44] . The same group subsequent examined the VRP-S in a more permissive hDPP4 transgenic mouse model [59] . The VRP-S immunized hDPP4 transgenic mice were completely protected from lethal infection. Pretreatment with serum of the mouse immunized with VRP-S can also be protected from fatal infection [59] . Two fully human neutralization antibodies binding to distinct epitopes of MERS spike protein, which were generated using the mouse expressing human antibody, displayed the preand post-exposure protection efficacy from MERS-CoV infection in hDPP4 transgenic mice [61] ." ] },{ "paper_id": "12fc7df6445be6360090621b75df383ce86772af", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In vivo LPS injection CWE (20, 100 or 500 mg/kg of body weight) was given to mice via oral gavage for 6 days. Control mice received an equal volume of normal saline during the experimental period. Each group consisted of 12 mice. On day 7, LPS (serotype 055:B5; Sigma, St. Louis, MO, USA) (1.3 mg/kg) was injected intraperitoneally 1 hour before blood sampling. Blood was obtained by cardiac puncture. As a reference drug, dexamethasone (Sigma) (5 mg/kg) was injected intraperitoneally 18 hours before the LPS injection. Blood samples were centrifuged at 800 g for 20 min. The serum samples obtained were stored at \u221220\u00b0C until used.", "Chronic inflammatory responses found in most autoimmune diseases and metabolic diseases exhibit common characteristic processes where macrophages are initially activated and interferon (IFN)-\u03b3-producing type-1 T helper cells subsequently stimulate macrophages to release more inflammatory cytokines. Together with our previous findings that CWE prevented anti-CD3stimulated T cells from secreting IFN-\u03b3, our current study clearly shows that CWE is able to interfere with the chronic activation of macrophages [16] ." ] },{ "paper_id": "12fe4cca998a403e153ae872595eab2676c77d2f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "After ethical committee agreement (Comit\u00e9 d'Ethique-H\u00f4pital Erasme, reference number P2007/175), AECII were isolated from macroscopically tumor free regions of lung tissues obtained following lobectomy or pneumectomy for lung cancer. The AECII isolation was adapted from a previously described technique [27] . After differential adherence of contaminating mononuclear cells, non-adherent AECII were plated at 5 \u00d7 10 5 cells/well in 48 wells flat-bottomed plates precoated with type I collagen (1%) to obtain pure AECII [28] . Cells reached confluence after 24 or 48 hours.", "The purity averaged 85.78% (81.78% -90.03%) (median, inter-quartile ranges) for the nine independent AECII isolations as assessed by flow cytometry (see below)." ] },{ "paper_id": "130c4c6c7faab2f0c0143b6f0cd0118b27c91dea", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "131902a67f5e00ae13b9239427325dfd53413349", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Protein modification was conducted as previously described [13] . Briefly, the proteins were dissolved in 0.1 M phosphate (final concentration, 20 mg/mL). Subsequently, 3-hydroxyphthalic anhydride (HP), maleic anhydride (ML) or succinic anhydride (SU) was added, respectively, in five aliquots with a 12-min interval, while pH was adjusted to 9.0. To optimize the condition of anhydride modification, HSA was modified with 2.5, 5, 10, 20, 40 or 60 mM anhydride (HP, ML or SU), respectively. The mixtures were kept for another 1 h at room temperature and then extensively dialyzed against PBS.", "Female BALB/c mice six to eight weeks of age were purchased from the Animal Center of Fudan University (Shanghai, China). Mice were housed in cages with barrier filters in certified rooms and were fed and watered ad libitum. The protocol for the use of animals in this study was approved by the Animal Center of Fudan University (Permit number: 2013N-067). The animal studies were conducted in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals." ] },{ "paper_id": "13194f8e42df83d260e53ad9bf7448577e9319e5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The flaviviruses WNV, DENV, and JEV share some common features, such as transmission via mosquitoes, and cross-react with each other in serological tests.", "Japanese encephalitis virus (JEV) is the most important cause of epidemic encephalitis in most Asian regions. The virus belongs to the genus Flavivirus of the family Flaviviridae; about 35,000-50,000 cases of and 10,000 deaths from JEV infection are reported annually [1] . JEV was first isolated in Japan in 1935, following which it spread to most other Asian countries. At present, this virus is even found in regions beyond its ecological boundaries. Recently, JEV has spread to regions as far as northern Australia [2, 3] . Hence, there is a concern that JEV might become a global threat. In fact, it is not unusual to find 2 or more flaviviruses co-circulating in one area. In Southeast Asia, the most important flaviviruses are JEV and dengue viruses (DENV) [4] . In northern Australia, Kunjin virus is found to co-circulate with JEV [5] . In Vladivostok, Russia, studies have reported the detection of WNV in birds [6] . In addition, there is evidence that WNV infection in India from Japanese encephalitis nonendemic areas and endemic areas [7] .", "Ninety-six-well microtiter plates were coated with purified fusion protein or denatured inclusion body in 0.1 M carbonate buffer (pH 9.6) at 4\u00b0C overnight and blocked with 5% skim milk for 3 h. Subsequently, the plates were washed 3 times with PBST (phosphate buffered saline, PBS with 0.1% Tween 20). In the binding assay, the plates were incubated with diluted rabbit hyperimmune sera or swine sera at 37\u00b0C for 1 h followed by washing 3 times with PBST. Bound antibodies were detected with horseradish peroxidase (HRP)-conjugated secondary antibody. The reaction was stopped with 2 M H 2 SO 4 , and the absorbance was measured at 450 nm by using a microplate autoreader (Bio-Rad). In peptide ELISA, microtiter plates were coated with the synthesized peptide." ] },{ "paper_id": "131e5a7c8626d4fec5bfe8d77666d1d8556e5a4c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Dengue virus (DENV), a member of the Flaviviridae family, is an enveloped virus containing a~11 kb genome of positive single-stranded RNA which encodes three structural proteins (C, pr-M, E) and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, NS5) [4] . Four serotypes of dengue virus (DENV1, DENV2, DENV3 and DENV4) cause dengue fever (DF) and more severe manifestations like dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) [1] .", "Solvents methanol, ethyl acetate, formic acid and dimethyl sulfoxide (DMSO) reagent or HPLC grade and silica gel (Kiselgel 69) were obtained from Merck KGaA (Darmstadt, Germany). Media and supplements for cell culture were purchased from Sigma-Aldrich Chemicals (St. Louis, MO, USA) and molecular grade agarose was obtained from Promega (Madison, USA). All other reagents used in analytical methods were purchased from Sigma-Aldrich Chemicals, except where otherwise indicated.", "Besides caffeoylquinic acids, two dicaffeoyltartaric acid derivatives were detected. Both components (10 and 11), showed [M-H] ion at m/z 473 and the formation of a predominant product ion at m/z 311 (loss of a caffeoyl moiety). In the MS2 and MS3 experiment the loss of a second caffeic acid moiety was observed, resulting in a base peak at m/z 149. Since this fragmentation was already reported, it is concluded that these compounds are chicoric acids, also present in lettuces [39] ." ] },{ "paper_id": "131e6a035170ed5bd2dba6bec02649e9508a0c55", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Scientific RepoRts | 6:34617 | DOI: 10.1038/srep34617", "Ethics statement. The Animal Care Committee of The Catholic University of Korea approved the experimental protocol, and all the experimental procedures were carried out in accordance with the protocols approved by the Animal Research Ethics Committee at the Catholic University of Korea. All procedures performed followed the ethical guidelines for animal studies." ] },{ "paper_id": "1329ea9b040bdc8af7c30f7ba4b5755e352deae8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Sequence alignment analysis was performed using the Clustal W program implemented in DNAStar software. A phylogenetic tree was then constructed by the neighborjoining method using the Molecular Evolutionary Genetics Analysis (MEGA) software version 5.1 with 1000 bootstrap replications set at 1000. Moreover, the possible recombination event was evaluated in the S and N genes by recombination detection program (RDP) 3.34 software.", "For the two enteric coronaviruses (PEDV and TGEV) in pigs, the recombination events were often detected. However, most of them were from intra-recombination [27] [28] [29] [30] . Recently, only one emerging recombinant/chimeric virus (named swine enteric coronavirus, SeCoV) was discovered in swine feces and resulted from inter-recombination of PEDV and TGEV, which had a TGEV backbone and a PEDV spike gene [31, 32] . In this study, there were no any possible recombinant events occurring in PDCoV strains. Maybe, the number and length of our obtained PDCoV sequences were limited. In the following study, the recombination event of PDCoV warrants further attentions.", "Before 2012, the subfamily Coronavirinae included three genera (Alphacoronavirus, Betacoronavirus and Gammacoronavirus). However, in 2012, an emerging genus, Deltacoronavirus, was found in many animal species including swine from Hong Kong [1] . At present, more than five different coronaviruses have been described in swine populations. Among them, porcine epidemic diarrhea virus (PEDV), transmissible gastroenteritis virus (TGEV), and porcine respiratory coronavirus (PRCV) belong to the genus Alphacoronavirus; meanwhile, porcine hemagglutinating encephalomyelitis virus (PHEV) and Porcine deltacoronavirus (PDCoV) are assigned to the genus Betacoronavirus and the genus Deltacoronavirus, respectively [1] . Numerous studies have shown that more than half of porcine coronaviruses (including PDCoV) were enteropathogenic and caused acute diarrhea and vomiting in pigs, which resulted in huge economic losses for the global swine industry [2] [3] [4] [5] [6] .", "This study reported the prevalence of PDCoV on swine farms in southern China. Phylogenetic analysis of currently circulating PDCoV strains in this region and other previously reported strains supported the theory of geographical clustering of PDCoV infection landscape. The origin of various PDCoVs in different countries and regions should be further studied." ] },{ "paper_id": "132d356a5461491379ccfb628fca604ef66b53e2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data availability. The authors declare that the data supporting the findings of this study are available within the article and its supplementary information files, or available from the authors upon request.", "Viruses and cells. All the B/Yamanashi/166/98 NS1/NP mutant viruses were generated by reverse genetics method, employing the eight-plasmid bidirectional transcriptional system as described by Hoffmann et al. 36 . Virus stocks were grown in 9-day-old fertilized chicken eggs, and virus titers were determined using plaque assays in MDCK cells. All eight segments of the recombinant viruses were sequenced. A549 (CCL-185) and MDCK (CCL-34) cells were obtained from the American Type Culture Collection (ATCC) and maintained in Dulbecco's modified Eagles' medium (Invitrogen) supplemented with 10% fetal bovine serum. To establish the IFN-b-inducible S-3F-ISG15GG A549 cell line, a plasmid was constructed by inserting into the pGL3 vector a KpnI-XbaI DNA fragment composed of a S-3F-ISG15-encoding sequence linked to an ISG15 promoter element at its 5 0 end. This DNA fragment was a product of PCR-mediated ligation of two smaller fragments: one fragment contains a ISG15 promoter sequence (bases -740 to 0) that was amplified from HeLa genomic DNA; the other fragment encodes S-3F-ISG15 generated by PCR-mediated addition of 3xFlag-S sequence to an ISG15-encoding sequence. The constructed plasmid (9 mg) was co-transfected with 1 mg of a linear puromycin selection marker (Clontech) into A549 cells. After selection with medium containing 1 mg ml \u00c0 1 puromycin, individual clones were selected, expanded, and the clone showing the strongest IFN-b-dependent induction of S-3F-ISG15 as well as its conjugates was used for virus infection experiments. The control IFN-b-inducible S-3F-ISG15AA A549 cell line was generated using the same procedure.", "Assay of association of ISGylated NP with NS1B and free NP. Cytoplasmic and nuclear fractions from USP18 siRNA-transfected, IFN-pretreated and virusinfected S-3F-ISG15GG A549 cells were prepared using the same procedure as described in assaying vRNP formation, except that RNaseOUT was replaced with Benzonase in presence of MgCl 2 to remove RNA. The resulting fractions were subject to double-affinity selection, and analysed by immunoblots probed with NP or NS1B antibody." ] },{ "paper_id": "132e94687b6ac1d68f3a33dcf090bc6f5865bb98", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We hope that this hypothesis-generating study will encourage the incorporation of pharmacokinetic data in future studies of bronchiolitis. Although validation studies in other populations are needed, this study underscores that the development of personalized approaches to the treatment of bronchiolitis may benefit from the analysis of specific genetic variants.", "Conclusions: ADRB2 genotype may be predictive of severity of acute respiratory tract infections in African Americans, and potentially identify a subset of infants who may respond to beta-agonist therapy." ] },{ "paper_id": "133933d03341e293921239f0d6a2b3ea4f1f574c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "LoopampH DNA LAMP kits were purchased from Eiken Chemical Co. Ltd (Tokyo, Japan, Code No.: LMP206). The Eiken LoopampH Fluorescence Detection Reagent (Code No.: LMP221), a Calcein-based reagent that indirectly indicates the progress of DNA amplification in the LAMP reaction, was used for fluorescence experiments. LAMP primer sequences for P. falciparum (Integrated DNA Technologies , Coralville, IA, USA) were as described by Poon et al. [40] Genomic DNA from P. falciparum for preparing contrived samples was obtained from the PATH laboratory specimen collection.", "To verify that the device could incubate a LAMP assay, the Eiken kits were used as per package insert instructions, except where noted below. Clinically relevant dilutions of genomic DNA were made in Eiken kit buffer to yield the DNA concentration and approximate parasite count noted for each experiment. All dilutions were prepared as single solutions and then aliquoted across treatment conditions to minimize preparation variation. No template controls (NTC) were prepared first and immediately sealed to reduce the possibility of contamination. Mineral oil was layered on the tops of the samples to minimize evaporation. All reactions were incubated at 63uC." ] },{ "paper_id": "1340cfab5e9d9c4e29144766f379fe8f10e4cc29", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Members of the Coronaviridae family form a diverse group of enveloped, singlestrand, positive-sense RNA viruses. The Coronaviridae family is divided into the Torovirinae and Coronavirinae subfamilies, both characterized by their exceptionally large RNA genomes: 20.2 kb (Bovine nidovirus TCH5) to 33.5 kb (Ball python nidovirus) and 25.4 kb (Porcine deltacoronavirus HKU15) to 31.8 kb (Bottlenose dolphin coronavirus HKU22), respectively. Torovirinae and Coronavirinae subfamilies are able to infect a diverse array of vertebrate species. They have a distinct genomic architecture and replication strategy shared with other members of the Nidovirales order, which also includes the Arteriviridae, Mesoniviridae, and Roniviridae families (2, 3) . Coronaviruses (CoVs) are classified into four genera, with Alphacoronavirus and Betacoronavirus containing members that infect mostly mammalian species and Gammacoronavirus and Deltacoronavirus grouping viruses infecting both birds and mammals (4) .", "This work highlights the importance of incorporating biological data into sequencebased classifications for virus taxonomy. Within the Alphacoronavirus 1 species, this allows for more biologically relevant and useful virus groupings. We believe that this practice should continue to be encouraged and/or added once such data become available for viruses discovered solely through sequence information.", "While current criteria based on analyses of key replicase domains allow the definition of coronavirus species, we believe that it is useful to also provide subspecies classifications based on other genetic loci such as the S gene to allow for more functionally relevant classifications." ] },{ "paper_id": "1341e9e33488d304353f31081a8422ed8715b5b6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Protein phosphorylation is a reversible post-translational modification that can regulate the activity of enzymes, mediate protein-protein interactions, alter the subcellular localization, conformation, and/or oligomeric state of proteins, as well as regulate the addition or removal of other types of post-translation modifications [41] . This important type of modification is not limited to cellular proteins; a growing body of literature has demonstrated that phosphorylation of viral proteins has important consequences for different viral processes [42] [43] [44] [45] .", "Pathogens 2018, 7, 97 2 of 14 2008, outbreaks in Sierra Leone have resulted in an overall case fatality rate of 69% in hospitalized patients [12] . LASV infection results in fetal loss in most cases [13] . Further, pregnancy greatly increases the risk of fatality from Lassa fever for the mother [13] . Of Lassa fever survivors who were hospitalized, approximately one-third developed hearing loss, and in two-thirds of those patients, the hearing deficit was permanent [14] . Intravenous ribavirin treatment has been shown to reduce mortality from Lassa fever, particularly if administered during the first six days of fever onset, but there is a clear need for more effective therapies [5] . No United States Food and Drug Administration (FDA)-approved vaccines exist for the prevention of LASV infection.", "Supplementary Materials: The following are available online at http://www.mdpi.com/2076-0817/7/4/97/s1. Figure S1 : Mass spectra for identification of the Y97 and S98 phosphorylation sites in LASV Z, Figure S2 : Mass spectra for identification of the S18 phosphorylation site in LASV Z. ", "Arenaviruses have a simple, negative-strand RNA genome that encodes a total of four proteins on two segments. The small (S) segment encodes both the nucleoprotein (NP), which encapsidates the viral genome and is required for its replication, and the envelope glycoprotein (GP), which interacts with cell surface receptors to mediate cell entry and membrane fusion [15] [16] [17] [18] [19] [20] . The large (L) genome segment encodes the viral RNA-dependent RNA polymerase (L), which replicates and transcribes the genome, and the viral matrix protein (Z) [19] [20] [21] [22] . The Z protein is a structural component of the virion, forming a matrix layer on the inner leaflet of the viral envelope, and carries out an array of important functions during viral propagation [23, 24] . The Z protein of pathogenic arenaviruses antagonizes interferon production by binding to retinoic acid-inducible gene I (RIG-I) and melanoma differentiation-associated protein 5 (MDA5) to disrupt interactions between RIG-I-like receptors and mitochondrial antiviral signaling (MAVS) [25] . Z can inhibit the translation of capped cellular mRNAs and also regulate the activity of the viral polymerase [26] [27] [28] . Z is also an important coordinator of virus particle assembly by interacting with each of the other three viral proteins [29, 30] ." ] },{ "paper_id": "134da4eba94dc9b9f03a9244d62aee56abe0de56", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Allantoic fluid was collected, tested by hemagglutination assay [36] , and stored at \u221285 \u2218 C. Egg infectious dose (50%) was calculated by the formula of Reed and Muench [37] .", "The US Poultry industry annually produces over 43 billion pounds of high-quality broiler chickens and turkeys and over 90 billion eggs, which in 2010 had a market value of $34.7 billion [1, 2] . Avian diseases are a constant threat to the industry. Viruses are of particular concern because antibiotics cannot control them, although vaccines can control some avian viral infections. Avian vaccines are an important component of protecting the value of commercial poultry. However, many commercial birds are not vaccinated because of the cost, labor, and difficulty in differentiating infected from vaccinated animals.", "Weight loss or body temperature did not differ much among treatment groups, and therefore we believe that apparently these measures of health were not predictive of survival.", "The ectodomain of the M2 protein is an attractive choice for a cross-subtype vaccine. Its amino acid sequence is not only highly conserved, but also nonglycosylated, which is essential for antigens expressed from bacteria. Although M2e is only weakly antigenic in the context of an infection or whole virus vaccine, antibodies against M2e reduce infection and protect against viral replication and death, at least in mammalian models [25, [28] [29] [30] [31] [32] 39] ." ] },{ "paper_id": "13580111f45eb6e4af4142774eb95f0e52350e92", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1358b278b691bdd7439d849fa8a002f9f9b8fe95", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "135f5ee5fba1a4280521d45e4fa882354f63e691", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "[\u2026]: an option for a 'long' format which is readily compatible with (Wickham, 2016) for ggplot2" ] },{ "paper_id": "1363643127b0fd76d3c6b848e07cfc2ed3f75328", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The entire screen was performed twice in separate runs one week apart.", "The MTS was performed in duplicate with three compound libraries. The Spectrum Collection (MicroSource Discovery Systems) comprises 2000 compounds with a wide range of biological activities and structural diversity. The NIH Clinical Collection contains a total of 727 compounds previously used in human clinical trials (http://www.nihclinicalcollection. com). Finally, the Bio-active Lipid I Screening Library (Cayman Chemical) contains 846 bioactive lipids. Individual compounds for secondary confirmation of hits were purchased from Sigma, dissolved in DMSO, and diluted in OptiMEM for in vitro testing.", "Determination of reduced signal due to cell toxicity was a key aspect of the assay. Some compounds were toxic and reduced virus signal non-specifically as a consequence of reducing cell signal ( Figure 3 ). However, some compounds exhibited a clear virus-specific effect, with a reduction of virus signal but retained cell signal ( Figure 3 )." ] },{ "paper_id": "136f5dd69cd65fb0826ded4d9f51af7969dfcbcd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Abbreviations", "Tumor necrosis factor GM-CSF Granulocyte macrophage-colony stimulating factor DTT Dithiothreitol G3PDH", "Glyceraldehyde-3-phosphate dehydrogenase IPTG Isopropylthio-b-D-galactoside" ] },{ "paper_id": "1378320afa873bdb81e3f3314a430c7a208d2d08", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Additional file 1: Multilingual abstracts in the six official working languages of the United Nations.", "Please see Additional file 1 for translations of the abstract into the six official working languages of the United Nations.", "Rapid molecular markers for mass population screening and diagnosis-based triage and increasing the effectiveness of quarantine or other social distancing measures including the development of synthetic antibody techniques for monitoring infection-related changes in protein levels.", "More research in host-based early-warning alert models and understanding of the contribution of context, culture, and ecosystems on asymptomatic/ presymptomatic factors in Ebola pre-exposure diagnosis prior to the appearance of symptoms. Monitoring a person's blood serum chemistry for changes that suggest a compromised health status or non-invasive sampling of breath and saliva is attractive in theory." ] },{ "paper_id": "137b25ee1545c4b01332709ab1e24dcf935d6f96", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Proteins were harvested by using SDS-lysis buffer containing 1% Triton X-100, 0.5% NP-40, 150 mM NaCl, 10 mM Tris-HCl (pH 7.4), 1 mM EDTA, 1 mM EGTA (pH 8.0), 1% SDS, 0.2 mg/mL PMSF, 1 \u03bcg/mL aprotinin, 1 mM sodium orthovanadate, 2 \u03bcg/mL pepstatin, 2 \u03bcg/mL leupeptin and 10 mM sodium fluoride.", "Data obtained from two groups with different treatments were analyzed by two-tailed, paired Student's t-test (statistical significance if p < 0.05)." ] },{ "paper_id": "137c77a97b865b5d85e90b50782a1bdf78539ec4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supplemental material for this article may be found at https://doi.org/10.1128/JCM .01658-17.", "SUPPLEMENTAL FILE 1, PDF file, 0.1 MB." ] },{ "paper_id": "138200f99f62c51776c9afec55d856e854ea8ff1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Another role for SPP in ERAD has come from a recent paper describing the cleavage of the unfolded protein response (UPR) regulator XBP1u by SPP (65) . XBP1u is a type II membrane protein and undergoes intramembrane cleavage within a conserved type II TM domain while integrated in a complex containing SPP, the protease Derlin-1, and the E3 ligase TRC8, which prime SPP for XBP1u cleavage. An ectodomain shedding of SPP substrates prior to SPP cleavage is thought to be required and normally performed by SP in signal sequences but such cleavage was unnecessary in the case of XBP1u, similarly to what we have described for Trh4 (52, 65) . In general, the UPR induces a strong downregulation of MHC class I molecules at the cell surface (66, 67) .", "Thus, SPP activity seems to have a direct impact on MHC class I peptide presentation by cleavage of leader sequences from nascent proteins and the liberation of some C-termini for MHC class I loading. A more indirect role that impacts on MHC class I presentation has been revealed and occurs through an ERAD pathway. This is also supported by a recent study using a systemslevel strategy reporting the involvement of SPP in the network that coordinates the ERAD response (68).", "What triggers the cleavage of Trh4 by SPP is not known yet. In addition to its liberation function of small transmembrane substrates, SPP has been shown to associate with misfolded membrane proteins in complexes where SPP is represented as a monomer, dimer, or multimer (57) . It was suggested that such high molecular weight complexes act as chaperones to dispose of membrane aggregates (57, 58) . The role of SPP in this degradation machinery might be to liberate such aggregates from the ER membrane. These discoveries were based on the viral US2 and US11 proteins, which successfully labels MHC class I molecules in the ER for retrograde transport to push this protein back to the cytosol for degradation by proteasomes (59, 60) . Interestingly, the SPP family member, presenilin 2, seems to be associated with this membrane proteolysis as well (61) . Since SPP and presenilin 2 have opposing preference for type I and type II transmembrane orientations, such a \"degradome\" machinery might be responsible to clear the ER membranes. This type of machinery is called the ERassociated degradation (ERAD) pathway. ERAD is an ER quality control system, which monitors the integrity of nascent or ERresident proteins and targets incorrectly folded or misassembled proteins to degradation. The disposal of misfolded MHC class I heavy chains also occurs through the ERAD pathway in the absence of viral interference (62) . Clearly, viruses take advantage of these existing pathways and hijack them in order to evade immune recognition by cytotoxic T cells (63, 64) ." ] },{ "paper_id": "1392d02729b5e2f1a63ff3ff259e10a8c45e5a55", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The internal reliability of the pre and post-conference questionnaires was assessed separately. Cronbach's \u03b1 coefficients of 0.809 and 0.861 respectively were obtained, indicating a high internal consistency of the RIPLS questionnaire used.", "Traditionally, doctors have been trained to be self-reliant and independent, with the profession relying more on expertise, autonomy and responsibility rather than interdependence, deliberation and dialogue [1] . In recent years however, increasing focus has been placed on the importance of team-based care and collaboration between various healthcare professionals.", "(Additional non-IPE events held during the conference included a symposium on \"Surviving Medical and Nursing School\", as well as a scientific poster competition and a symposium on hospital residency for senior medical students.)", "The literature suggests that IPE at the level of undergraduate learning could translate to improved working relations and understanding between the different healthcare professions. It is recommended that IPE be introduced early in the commencement of undergraduate healthcare courses, as this may help amend negative attitudes and avoid the formation of stereotypical views [2] [3] [4] ." ] },{ "paper_id": "1399e34d62b515e482ccde6c4cae500b19546909", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "However, several newly emerged H5N1 AIVs in Egypt have been found to have acquired the human receptor SA\u03b1-2,6-Gal binding ability during their emergence in birds [76] .", "Like other influenza viruses, IDVs possess a negative-sense single-stranded RNA genome. However unlike IAVs that contain 8 segments, IDVs comprise seven genomic segments that are predicted to encode nine proteins, including glycoprotein hemagglutinin-esterase fusion (HE), polymerases PB2, PB1, and P3, nucleoprotein, matrix protein (M1 and CM2), and nonstructural proteins (NS1 and NEP) [59] . IDVs use 9-O-acetylated sialic acid as their cellular receptor on host cells such as ICVs [60] .", "Many viral pathogens have been implicated in BRD, which include bovine viral diarrhea virus, bovine herpesvirus 1, bovine respiratory syncytial virus and bovine parainfluenza 3. Experimental studies in calves with IDV showed damage that results in the induction of inflammation in the trachea. IDV could be a significant player in BRD and could facilitate coinfections with other bovine pathogens [59] . In addition to the animal health implications of IDVs, a recent study found IDV antibodies in 34 out of 35 persons that had contact with cattle and only 2 out of 11 that did not have any exposure to cattle [68] . The results of this study raised the possibility that IDV could be relevant from a public health stand point and that it could pose a zoonotic risk to cattle-exposed workers. With much still to be characterized about the new IDV species, exploring its impact on human an animal health through epidemiological studies will be vital to understanding spread of this virus.", "The International Committee on Taxonomy of Viruses (ICTV), which is responsible for developing, refining, and maintaining a universal virus taxonomy, has recently released revised classification of Orthomyxoviridae [57] . In earlier classification, Orthomyxoviruses belonged to any one of the five genera: Influenzavirus A, Influenzavirus B, Influenzavirus C, Thogotovirus and Isavirus [58] . However, the most recent classification of Orthomyxoviridae includes eight genera and nine species (Table 1) . Genus Alphainfluenzavirus comprises the species influenza A virus, Betainfluenzavirus comprises the species influenza B virus, Gammainfluenzavirus comprises the species influenza C virus, and Delatinfluenzavirus comprises the species IDV [58] . " ] },{ "paper_id": "139b81bc9c99d76cffc2014c4851942d2f592950", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ ". ", "We now compare the performance of our model, as defined by equation (1) ", "For large enough m, since {E k,t } is approximately a white noise process,{D k,t } is approximately a moving average process of order L -1 with coefficients \u03b8 0 = 1, \u03b8 j = a j-1 /a 0 for j = 1, ..., L -1, and innovation variance ." ] },{ "paper_id": "13a1c758877b216e51c51e9ee532ab5c3e0c12fb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "into the cytosol where they activate a number of apoptotic pathways, ultimately leading to programmed cell death [18, 24, 44, 48, 60, 62] .", "\u2022\u2212 . Due to their high content of organic chemicals, ambient UFPs contribute proportionally more redox-cycling chemicals than larger particles [4, 24, 44, 60] .", "The \u2022 OH radical is more reactive than O 2" ] },{ "paper_id": "13a2da5074d1480d1e302628606afd1f17ac782e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A code was given to each enrolled participant and a physician examined each participant prior to the biological assessments, which included naso-pharyngeal swab collection for PCR analysis. The patient was interviewed directly to determine socio-demographic characteristics, patient's medical history and vaccination status, using a standard questionnaire. For children, these information were obtained from their mothers or care takers. For each enrolled study participant, paired nose and throat swabs were collected for pathogens detection. Symptoms presented by each participant on the day of survey, as well as data obtained from interviews and biological investigations were assigned on a case report form (CRF).", "Studies conducted in Africa, identified respiratory tract infections due to Streptococcus pneumoniae as a main cause of non-malaria febrile illnesses among other causes such as typhoid fever, urinary tract infection and other parasitic infections other than malaria [11] [12] [13] .", "Samples were collected by the study physician using a sterile nylon flocked swab and placed in viral transport medium (\"BD Universal Viral\"), labelled and transported on ice at Pasteur Institute Dakar for further processing and storage of the samples. " ] },{ "paper_id": "13ab857b7b076f5a00bb3becf27e9780fcecf26e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Among all the genetic human immunodeficiency virus (HIV) subtypes that exist in the world, subtype C is responsible for~50% of HIV-1 infections globally which included parts of Africa and Asia regions namely China, India etc., whereas in North America and Europe, the majority of HIV infections ligand, Bax, caspase 8, Receptor-binding cancer antigen expressed on SiSo cells (RCAS)-1, TNF-related apoptosis-inducing ligand (TRAIL), activation of cyclin-dependent kinases, microtubule alteration and inhibition of expression of manganese-dependent superoxide dismutase [39, 46, 47] .", "Authors declare that the data supporting the findings of this study are available within the paper and its Supplementary Information Files. The data are also available from the corresponding author upon request. The nucleotide sequences are available at GenBank with the accession numbers: HQ110625, FJ432073, HQ110614.", "T a t N 1 2 T a t V T 6 T a t D 6 0 T a t B T a t C" ] },{ "paper_id": "13af5f3171885fd9385c4320e14ce219aa345022", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "13b8c068799a93b4441116bb6cabae222d126d32", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Currently, standard immunological methods [7] or methods based on polymerase chain reaction (PCR) [8, 9] are widely used to identify the above mentioned viruses. Unfortunately, they can detect only one agent in a specimen." ] },{ "paper_id": "13b976db365e4973e7e0fe44646393b672c4a2db", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Surface plasmon resonance binding assays. Surface plasmon resonance (Biacore) assays were performed on CM-5 dextran chips (GE) covalently coupled to the ligand via amine coupling. The running and injection buffers were matched and consisted of 150 mM NaCl, 0.01% Tween-20, 0.1 mg/ml BSA, and 10 mM HEPES at pH 7.5. Response unit (RU) values were measured as a function of analyte concentration at 298 K. Kinetic analysis was performed using the global fitting feature of Scrubber 2 (BioLogic Software) assuming a 1:1 binding model. For experiments using hAPN as a ligand, between 300 and 400 RU were coupled to the CM-5 dextran chips. For experiments using 9.8E12, 1900 RU was immobilized.", "Viral inhibition assay. HCoV-229E was originally obtained from the American Type Culture Collection (ATCC VR-740) and was produced in the human L132 cell line (ATCC CCL5) which was grown in minimum essential medium alpha (MEM-\u03b1) supplemented with 10% (v/v) FBS (PAA).", "Received: 29 May 2017 Accepted: 6 October 2017" ] },{ "paper_id": "13bc396fab607d24e0dfd5b38704463d13a85c08", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "13d39b597ef6853185ff1e43a4420984a8c6416e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Vero cells were grown in high glucose DMEM supplemented with 10% heat-inactivated FBS and 1\u00d7 Antibiotic-Antimycotic solution (Gibco/Life Technologies, Carlsbad, CA, USA).", "The dose-response curves were fitted with four-parameter logistic functions (Equation (1)), where A min and A max are the upper and lower asymptotes (minimal and maximal drug effects), m is the dose that produces the half-maximal effect, and \u03bb is the steepness (slope) of the curve.", "Several critical issues should be also considered while developing A-1155463 or its derivatives as antivirals. While A-1155463 may possess broad-spectrum antiviral activity in vitro and against some other viruses in primary patient samples ex vivo [12] [13] [14] , its antiviral efficacy should be evaluated in vivo. Also its side effects, including its immuno-and neuro-modulatory properties, " ] },{ "paper_id": "13d3cd2797da7eb9cc334821680a7b30badafa11", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Inducible Tregs are further divided into subclasses of iTregs, which are classified based largely on the mechanisms they use to mediate regulation (though the functional mechanisms of suppression utilized by these various iTregs are not strictly limited to each subpopulation -for example, multiple iTreg populations use surface molecules such as CTLA-4 or PD-1 to mediate infectious tolerance). Tr1 induced regulatory cells mediate suppression primarily through the secretion of the immunosuppressive cytokine IL-10, and are further characterized by their lack of Foxp3 and CD25 expression which are expressed by nTregs (7) . The second class of iTregs are Th3 cells, which were one of the earliest populations of Tregs and were identified as playing a role in mediating tolerance in experimental autoimmune encephalitis (EAE). These cells express CD25 and Foxp3 and predominantly utilize TGF-\u03b2 to mediate suppression, with minimal expression of IL-4 and IL-10 (8).", "While the Tr1 and Th3 populations of iTregs were long considered to be the only defined induced regulatory populations, research has identified another population of induced Tregs that can are potent mediators of suppression as well as in the propagation of infectious tolerance: iTr35 regulatory cells. These inducible regulatory cells were identified by Dario Vignali and colleagues and mediate suppression primarily through the expression of the regulatory cytokine IL-35 (9) . In this review, we will discuss the identification and characterization of IL-35, how it mediates suppression, the role it has been shown to play in disease, and the importance of IL-35 and more specifically iTr35 cells in propagating infectious tolerance.", "As clearly illustrated in Table 1 , IL-35 plays an important role in a variety of diseases. Furthermore, research from our group has identified that IL-35-expressing Tregs also play a central role in mediating tolerance in transplantation tolerance, immune responses to non-inherited maternal antigens (NIMAs), and prostate cancer [Ref. (23) ; and Olson et al., unpublished results], which we also found were dependent on the expression of CTLA-4. Interestingly, when we examined collagen type V-specific regulatory responses, we did not find a role for IL-35 [contrary to results obtained from other groups (16, 34) ] nor CTLA-4, though we did find that these responses relied heavily on TGF-\u03b2. This suggests that the regulatory responses we identified in the transplant, NIMA, and prostate cancer patients may have been relying on iTr35 cells, whereas the responses we identified to collagen V were nTregs, and suggests that potentially CTLA-4 and IL-35dependency may be a technique that can be used to identify this population of inducible regulatory cells." ] },{ "paper_id": "13e902f62fb20b66fbbc69e9ec434243342d16cd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Coronaviruses (CoVs) are found in a wide variety of animals [1] in which they can cause respiratory, enteric, hepatic, and neurological diseases. Based on genotypic and serological characterization, CoVs were traditionally classified into three distinct groups [2] [3] [4] . Recently, the Coronavirus Study Group of the International Committee for Taxonomy of Viruses has replaced the traditional groups 1, 2, and 3 CoVs with three genera, Alphacoronavirus, Betacoronavirus, and Gammacoronavirus, respectively [5] . As a result of their unique mechanism of viral replication, CoVs have a high frequency of recombination [2, 6] . Their tendency for recombination and high mutation rates may allow them to adapt to new hosts and ecological niches [7] [8] [9] [10] .", "Viral RNA was extracted from the fecal samples using EZ1 Virus Mini Kit v2.0 (QIAGEN). The RNA was eluted in 60 \u00b5L of AVE buffer (QIAGEN) and was used as the template for RT-PCR.", "The authors declare no conflict of interest.", "The PCR products were gel-purified using the QIAquick gel extraction kit (QIAGEN). Both strands of the PCR products were sequenced twice with an ABI Prism 3700 DNA Analyzer (Applied Biosystems), using the PCR primers. The sequences of the PCR products were assembled manually." ] },{ "paper_id": "13f8fe9cd4b06843fce134699ecc8b89cf6a2353", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "where T is the latest time of observation (i.e., December 22 in our case study) and c T = (c 1 , c 2 , : : : , c T ).", "where t in the right-hand side indicates the time since infection (or the so-called \"infection-age\"). We assume that c t follows a Poisson distribution. The likelihood to estimate u consisting of the parameters R 0 , n, and a t is derived as", "(1)" ] },{ "paper_id": "13fbc589f8307a0f1a6c7eccd2651743c780bd6a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Accession number(s). The complete genome sequence of PDCoV strain CH/ JXJGS01/2016 has been deposited in GenBank under the accession number KY293677.", "The full-length genome sequence of CH/JXJGS01/2016 determined in this study will increase our knowledge of PDCoV virology, providing a basis for the development of diagnostic tools and vaccine candidates. Further in-depth phylogenetic analysis of PDCoV requires more complete genome sequences of PDCoVs originating worldwide.", "The complete genome sequence of a variant of porcine deltacoronavirus, isolated from a diarrheal piglet and designated CH/JXJGS01/2016, was sequenced and analyzed. Phylogenetic analysis demonstrated that CH/JXJGS01/2016 shares the highest nucleotide and amino acid identities with the Chinese strain NH (GenBank accession number KU981059)." ] },{ "paper_id": "140cdf5d99f486ccd0346d07cad3fa66b2567c42", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: Rift Valley fever virus (RVFV), a member of the genus Phlebovirus within the family Bunyaviridae, is a negativestranded RNA virus with a tripartite genome. RVFV is transmitted by mosquitoes and causes fever and severe hemorrhagic illness among humans, while in livestock it causes fever and high abortion rates.", "The PCR product consisting of a wild-type ZH501 M-segment by M430F and M1041R was directly sequenced, or cloned into pSTBlue-1 by AccepTor Vector Kits (Novagen, Darmstadt, Germany) according to the manufacturer's instruction. Thirtyfive clones were sequenced by T7 primer." ] },{ "paper_id": "142a615ffb970d12beaa9597bff2b9c49da4bb96", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Funding received from Bill and Melinda Gates Foundation.", "ethical approval Not required." ] },{ "paper_id": "1434efe4d841738948735807bd1d1f1e9a36225e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "study participants from the Stockholm (Sweden) area entered the baseline step of the ILI study in the context of the Swedish national LifeGene project 1 .", "vaccine containing A/ H1N1/California/7/2009 (adjuvanted with ASO3, i.e. DL-\u03b1-tocopherol, vitamin E; squalene and polysorbate).", "Swedish residents who were offered the pandemic flu vaccine received Pandemrix (GSK)" ] },{ "paper_id": "14374db205f6934d9cba148624462000bc6ec7be", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Accession number(s). RNA sequencing data have been submitted to the NCBI BioProject database under BioProject no. PRJNA394932 and SRA accession no. SRP113049.", "Supplemental material for this article may be found at https://doi.org/10.1128/mBio .02469-18. ", "Statistical analysis. Statistical analysis was performed with the unpaired t test using GraphPad Prism version 5.03 (GraphPad Software). Values are depicted as mean \u03ee standard error of mean (SEM). A P value of \u03fd0.05 was considered statistically significant." ] },{ "paper_id": "1449e7aedd623536a61d71bf1505622093774208", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Feline coronavirus (FCoV) is an enveloped RNA virus belonging to Coronaviridae. The disease is prevalent especially in catteries and multiple-cat household [1] . FCoV consist of two biotypes; Feline infectious peritonitis (FIPV) which is highly fatal and caused immune mediated complex, and feline enteric coronavirus (FECV) which caused from asymptomatic infection to severe enteritis [1, 2] .", "Although evidence of FIP have been reported among cat population in Malaysia [5, 6] , the circulating FCoV virus neither isolated nor characterized. Thus, the objectives of this study are to isolate and determine the FCoV biotypes occurring in Malaysia.", "Viral RNA was extracted from infected cell cultures or Ascites fluid using Trizol Reagent (Invitrogen, USA) according to manufacturer's instructions. RT-PCR was performed using Access RT-PCR system (Promega, USA) [6] with previously described primers p205 and p211 [16] . Positive samples were further differentiated into type I and type II FCoV using biotypes specific oligonucleotide primers targeting S-gene region [17] . All primers were synthesized by First Base Laboratories Sdn Bhd, Selangor, Malaysia.", "Indirect immunofluorescent antibody test (IIF) on infected cells showed viral antigens were present in the cytoplasm, where the earliest signals appeared as fine to coarse immunofluorescent granules in the perinuclear region of the infected cells at 6 hours PI ( Figure 4 )." ] },{ "paper_id": "144bd370f94a0844a954100eb08bf1df9403ddaf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Chloramphenicol acetyl transferase (CAT) activity assay using a mini-genome system", "All experiments were performed in 3-8 biological repeats. Statistical tests and graphical data presentation were performed using SigmaPlot 10.0 Software (Systat Software, Inc., USA), GraphPad Prism 5 Software (GraphPad Software, Inc., USA) and MS Excel 2010 (Microsoft Corporation, USA). All data are presented as the mean \u00b1 standard deviation of the mean (SD). The significance between two groups was determined via \"Student t-test\"." ] },{ "paper_id": "1455bb070334751379d26c7c161a1f17b8d07a0c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Although in vitro potency and lipophilicity of compounds are important parameters to evaluate, the concept of Lipophilic Efficiency (LipE) aids in establishing a more balanced relationship between the potency observed in vitro and lipophilicity properties of evaluated chemical compounds [27] . Ryckmans et al. [19] reported that high quality lead compounds possess higher LipE values.", "Human red blood cells infected with the P. falciparum clone W2 (chloroquine-resistant) were maintained in continuous culture as previously described [30, 31] . The human red blood cells and plasma were ceded by the Funda\u00e7\u00e3o Hemominas-Hemon\u00facleo Divin\u00f3polis [32] . The synchronization of the parasites was achieved by sorbitol treatment [33] and parasitaemia was determined microscopically in Giemsa-stained smears.", "In 2010, there were an estimated 219 million cases of malaria, a global infectious disease, and it was responsible for 660,000 deaths [1] . The arsenal of antimalarial drugs is limited and currently the most effective treatment against the pathogenic agent Plasmodium falciparum includes artemisinin combination therapies (ACTs), although resistance to artemisinins has been reported in four countries of the South-East Asia region: Cambodia, Myanmar, Thailand and Vietnam [2, 3] .", "One of the main challenges in the development of new antimalarial drugs is how to achieve a viable lead candidate with good pharmacokinetic properties: absorption, distribution, metabolism, excretion and toxicity (ADMET) [15] ." ] },{ "paper_id": "14597dad9c71c07579c0a5e5e9878aa1c003f50e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Provincial epidemiologists and local public health doctors conducted face-to-face interviews with all affected individuals, their family members and medical staff using a standard questionnaire designed by the Chinese Center for Disease Control and Prevention (China CDC). A variety of epidemiologic information was collected, including that which is related to personal information, comorbidity, and exposure condition and infection areas. Investigations generally began within 24 h of a diagnosis of suspected infection, clinical circumstances permitting.", "A cluster was defined as two or more persons with an onset of symptoms within the same 14-day period, who were associated with a specific setting such as a classroom, workplace, household, extended family, hospital, other residential institution, military barracks, recreational camp or live bird market [19] .", "Total viral RNA was extracted from the respiratory specimens using a Qiagen RNeasy Mini Kit, according to the manufacturer's instructions. The specific primer and probe sets were provided by the China CDC. All cases were confirmed by rRT-PCR methods." ] },{ "paper_id": "145bb000d606bc2ea82e7e11f79363796bc9b7b1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "To verify that the predicted platypus genes were expressed as mRNA and eliminate the possibility of amplification from DNA templates, gene-specific PCR primers were designed based on sequences on two separate exons.", "We used the CEACAM classification proposed by Beauchemin et al. (1999) [27] and Kammerer et al. (2007) [22] . If an orthologous relationship to human proteins could not be defined, the proteins were denoted by the generic gene name in the GenBank. In nonmammalian species, all CEACAM family genes were annotated with a Roman letter based on their chromosomal localization.", "Carcinoembryonic antigen cell adhesion molecules (CEA-CAMs) and pregnancy-specific glycoproteins (PSGs; also known as Schwangerschafts Protein 1) are characterized by an N-terminal immunoglobulin variable domain-like region followed by a varied number of immunoglobulin constant domain-like structures. The prototypic member, CEA (or CEACAM5), was initially discovered as a membrane-anchored tumor antigen [1] . CEACAM subfamily proteins have since been shown to play important roles in the regulation of immune responses, angiogenesis, the differentiation of mammary glands, insulin signaling turnover, tumorigenesis, and metastasis [2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12] . By contrast, PSGs have been characterized as highly glycosylated major proteins from human syncytiotrophoblasts during pregnancy. High levels of human PSGs have been detected in maternal serum as early as 3 days postfertilization, coinciding with the attachment of the blastocyst to the uterine wall, and were believed to be critical for protecting the semiallotypic fetus from the maternal immune system during pregnancy in, at least, primates [13, 14, 15, 16, 17, 18, 19] ." ] },{ "paper_id": "1460431a11ae554624fded17f039eacbda52effb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "1 \u30fbSupplementary Figure S1 Chromatograms of size fractionation HPLC 2 \u30fbSupplementary Figure S2 LC-ESI-MS and MS 2 spectra of 88 strial glycans 3 \u30fbSupplementary Figure S3 Positive ion mode MALDI-QIT-TOF-MS spectra of SALSA-4 derivatised glycans 5 \u30fbSupplementary Figure S4 LC-ESI-MS and MS 2 spectra of A3-13 species 6 7 \u30fbSupplementary", "GnM5 M a n \u03b1 1 -6 a r m M a n \u03b1 1 -3 a r m" ] },{ "paper_id": "14626b4b98947a5534bdcc578b6659c258f7e7dd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Neutralizing Antibody Titer ED50 (AVG) ", "Vaccine candidates induced high titers of neutralizing antibody.", "Vaccines 2019, 7, x 5 of 13" ] },{ "paper_id": "1469710f9b5dce0601307791210b86a225dd1be1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Influenza A virus is a remarkably promiscuous virus. Viruses circulating in birds, pigs and people garner the most attention, given their impact on public health, yet influenza virus naturally infects a diverse array of animals. These hosts include dogs, horses, cats, non-human primates, cattle, seals,", "whales, guinea pigs, ferrets, mink, giant pandas, pikas, raccoon dogs, anteaters, camels, and penguins (reviewed in [15] [16] [17] ). The detection of influenza A virus in bats, which represent ~20% of all known mammals, dramatically expands the host range of this virus.", "Influenza A virus is a member of the Orthomyxoviridae family with a segmented genome composed of eight single-stranded negative-sense RNAs [18] . The viral genome exploits splicing, frame-shifting and leaky scanning to code for at least 14 different proteins. Influenza viruses are classified into subtypes based on their two major surface proteins, hemagglutinin (HA) and neuraminidase (NA). Prior to the identification of influenza virus in bats, 16 HAs and nine NAs had been identified, circulating primarily in avian reservoirs. Of these, only H1N1, H2N2, and H3N2 are known to have caused pandemics in humans." ] },{ "paper_id": "146fa23813d36d8da4ea4ab928d5cac594fdbd44", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The south and southeast regions of Jeju Island, especially Namwon-eup, showed the highest incidence of scrub typhus. Workers in mandarin orange orchards seemed to be the highest risk group for scrub typhus infection.", "The median age of the patients was 58-years-old (range, 8 to 91) and 43% of them worked in the agricultural, forestry or livestock industry. Regardless of their job, 87% of the patients had a history of either working outdoors or of other activities before developing scrub typhus.", "From January 2011 to December 2016, 446 patients were diagnosed with scrub typhus on Jeju Island. The patients' personal data and the environmental factors that might be related to scrub typhus were investigated and retrospectively analyzed." ] },{ "paper_id": "14723bfc42908c3f8f522692be41062a7cda62d4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "147422b51b66a3e9c76f32fab4b4a004f67e8a16", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In some cases, VHHs are only effective or needed in a certain organ, cell type or cell compartment. Multiple formatting options are available to specifically target or deliver VHHs to one of these regions, e.g., linkage to antibodies or peptides, provide posttranslational modifications or in situ expression by bacterial vectors.", "The small size, single domain build-up and the presence of hydrophilic amino acids in FR2 go together with a typically high solubility and physical stability of VHHs. As a result, these proteins can ", "Some viral targets may be located inside the infected cell and thus hard to reach by antiviral VHHs. This problem can however be overcome by linking the VHH to a cell-penetrating peptide such as penetratin. This approach has been applied for the development of anti-hepatitis C virus (HCV) VHHs. Several intracellular viral proteins were considered as targets: the viral RNA-dependent RNA polymerase, the NS3 helicase/NTPase and the multifunctional HCV NS4B protein [84] [85] [86] [87] . In vitro, penetratin-linked VHHs directed against these targets could suppress HCV replication. These VHHs have not been tested yet in vivo." ] },{ "paper_id": "1477e7acddb857281705b48912ade3fd5b3f2a6e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "147b848766e7280950bd8ac4d1c02efb55e63ef3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The research proposal was approved by the ethics committee of the Sendai Medical Center (#26-03) and the ethics committee of the National Institute of Infectious Diseases (#873). The consents of participants were obtained verbally. When participants were under 20 years old, consents were obtained from parents or guardians.", "Multiple-sequence alignments were constructed with the MAFFT software (ver. 7.123b) using the default settings [41] . Phylogenetic analysis was performed with the maximum likelihood methods in the MEGA software (ver. 7.0.21) [42] . The statistical significance of the tree topologies was tested with bootstrapping (100 replicates).", "Human metapneumovirus (HMPV) is a major causative agent of acute respiratory infections especially in young children, older people, and patients with underlying conditions such as PLOS " ] },{ "paper_id": "14898820328acb4f3dcf85f33f3addb113d5a97d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Similar to HPV E6, the HTLV-1 oncoprotein Tax allows for sustained AKT phosphorylation under low serum conditions, and this may be due to Tax interacting with the regulatory p85 subunit of PI3K [70] . Another study showed that Tax-conferred growth factor independence through mTORC1 [71] .", "Several viral oncoproteins such as EBV LMP1 [15], KSHV vGPCR [242] , HBx [243] and HTLV-1 Tax [69] were shown to signal through the potential AMPK-activating kinase TAK1. TAK1-AMPK connections in the context of these viral proteins, however, have not been examined.", "The endoplasmic reticulum (ER) is the major cellular site for folding and maturation of secreted and transmembrane proteins. ER stress ensues when the number of unfolded and/or misfolded proteins that enter the ER exceeds the capacity of the ER chaperone machinery and triggers a regulatory response termed the unfolded protein response (UPR) that adjusts the ER work load to its folding/refolding capacity [279] . Moreover, the UPR also activates autophagy [139] . The signaling pathways that activate the UPR have been reviewed in detail elsewhere [279, 280] and are outlined in Figure 5 ." ] },{ "paper_id": "1495c1fa93db3b9a5d12b5ae15ff0c8639b83452", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "What are the marketing networks? Biosecurity is generally quite low in both smallholder and larger commercial farms. What are some effective/feasible ways to reduce AI risk?", "How can these be tested in practice?", "What are antiviral drug and poultry vaccination policies?" ] },{ "paper_id": "14a0b8d9f05d4baef14cfa9178748cb9d504d523", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Doctor's Name; EGF: epidermal growth factor; ELISA: enzyme-linked immunosorbent assay; EPO: erythropoietin; FSH:", "follicle-stimulating hormone; GnRH: gonadotropin-releasing hormone; IFN\u03b3:", "interferon-gamma; IGF-1:" ] },{ "paper_id": "14ae1c8c866fcbdad5e965f296a90a8cbf41f689", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Mouse anti-PRRSV N protein and monoclonal J2 anti-dsRNA antibodies were purchased from Jeno Biotech Inc. (Chuncheon, South Korea) and Scicons (Hungary), respectively. Cellular DNA, mitochondria and lysosomes were stained with DAPI, MitoTracker Red and Lyso-Tracker Red, respectively (all reagents were from Molecular Probes, OR, USA). Rabbit anticalnexin, anti-LC3 and anti-IgG Alexa Fluor were purchased from Cell Signaling Technology. A goat anti-mouse IgG-Gold antibody was obtained from Sigma-Aldrich.", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111" ] },{ "paper_id": "14b23be79f302d4603f64e7a45d56574a23b59f5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Coronaviruses are enveloped, single-stranded, positive-sense RNA viruses that cluster within the family Coronaviridae (order Nidovirales). They infect a wide variety of species, including humans, livestock, and companion animals. In humans, they usually cause mild to moderate respiratory symptoms, although more severe cases occur mostly in individuals with impaired immune responses [1] . The emergence of severe acute respiratory syndrome coronavirus (SARS-CoV) in China in the winter of 2002, and of Middle East Respiratory Syndrome coronavirus (MERS-CoV) in September 2012, reminds us that coronaviruses pose a significant threat, and that zoonotic transmission is common [2] [3] [4] [5] [6] .", "Subsequently, PCR was performed with using KAPA PROBE FAST qPCR Master Mix (Kapa Biosystem). Rox was used as a reference dye. The amplification program, specific probes and primers for each virus are listed in Table 1 .", "CRCoV nucleocapsid gene was codon optimized, synthetized, and cloned into pETDuet vector via BamHI and AatII sites. Plasmid identity was confirmed by sequencing. N protein was expressed in E. coli Origami cells following induction with 0.5 mM isopropyl-\u03b2-D-thiogalactopyranoside (IPTG) at 20 \u2022 C for 16 h. Protein was purified on Ni-nitrilotriacetic acid resin (IMAC Sepharose 6 Fast Flow)." ] },{ "paper_id": "14b4d32ff078c4db9661a587e43a30a7bf227ed9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Feline coronavirus (FCoV) belongs to the family Coronaviridae and the order Nidovirales [1] and affects both wild and domestic cats [2] . FCoV contains a positive polarity RNA genome approximately 29 kb in length, consisting of 11 open reading frames (ORFs). Two major ORFs encode a replicase, four ORFs encode the structural proteins S (spike), E (envelope), M (membrane), and N (nucleocapsid), and five ORFs encode the nonstructural proteins 3a, 3b, 3c, 7a, and 7b [3] .", "FCoV can cause a mild or sometimes apparently symptomless enteric infection, especially in kittens, and is also associated with a lethal, systemic disease known as feline infectious peritonitis (FIP) [4, 5] . FIP is characterized by fibrinous, granulomatous serositis, with protein-rich effusions in the body cavities of affected cats (effusive or \"wet\" FIP), as well as granulomatous-necrotizing lesions, periphlebitis and granulomatous inflammatory lesions in several organs, especially, liver, kidney, spleen, leptomeninges, and eyes (noneffusive or \"dry\" FIP) [6] .", "Brown et al. [18] have proposed yet a third hypothesis for FIP pathogenesis. These authors suggest, after phylogenetic 2 Advances in Virology ", "Another important factor involved in the pathogenesis of FIP is systemic inflammatory reaction. Acute phase proteins (APP) are plasma proteins produced by hepatocytes during systemic inflammation [65] . The major feline APP is \u03b11-acid glycoprotein (AGP) [66] . In humans AGP is overexpressed during systemic inflammatory responses and its function appears to be related to an immunomodulatory activity [65] ." ] },{ "paper_id": "14c6dff031b3bcf8a7ea8486965b1dd888cf46a4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The study of animals was approved by the Institutional Animal Care and Use Committee at the New York Blood Center (Approval #194.14). All animal studies were carried out in strict accordance with the recommendations of the American Veterinary Medical Association (AVMA) Guidelines and the approved protocols.", "Mice were subcutaneously immunized with 10 \u03bcg/mouse of recombinant MERS-CoV S-RBD-Fc protein formulated with Freund's complete adjuvant (Sigma, St. Louis, MO) and boosted once with 5 \u03bcg/mouse of the immunogen and Freund's incomplete adjuvant at 2-week intervals. Sera collected at 10 days post-2 nd vaccination were used to detect neutralizing activity.", "Generated MERS-CoV pseudovirus was able to infect a variety of cell types from human and non-human hosts", "The codon-optimized genes expressing full-length S protein of MERS-CoV (humanbetacoronavirus 2c EMC/ 2012, hCoV-EMC, GenBank accession no. AFS88936.1) were synthesized by GenScript (Nanjing, China) by replacement of the N-terminal signal peptide (residues 1-17) with CD5 signal sequence and insertion into pcDNA3.1 vector (Invitrogen, Carlsbad, CA). The constructed recombinant MERS-CoV plasmid (rMERS-CoV-S) containing the S gene was confirmed for correct insertion by sequencing analysis." ] },{ "paper_id": "14c756dfe065a0ed1ff950195576f8975d209c93", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Additional file 1: Tables S1 and S2; Figures S1 and S2." ] },{ "paper_id": "14f427656a9898ce76f31cb012f258a9aa6d1ce3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In this study", "Heifers, n (%) 44 (100) 11 (100) 12 (100) 14 (100) 7 (100)", "Median age (Years) 6 (4 to 9) 4 (4 to 7) 6 (4 to 9) 6.5 (4 to 8) 6 (5 to 8) " ] },{ "paper_id": "15029a39f0a27d1bbccb6fed1793ea25700d9e57", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "150e648964270067a1ea14caffbc3427f756dafb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ethics statement. As this research involved human blood, the aims of our study were explained to all the dengue patients involved (all were adults) and all provided written informed consent. The collection methods of clinical samples and epidemiological data were reviewed and approved by the Institutional Ethics Review Board of Southern Medical University and were carried out in accordance with the approved guidelines. Samples were selected randomly based on the laboratory diagnosis and clinical signs.", "Databases of E gene molecular evolution were created via a screening process based on epidemiologic and phylogenetic methods. Among them, 81 strains in Guangdong constituted the local database, whereas 403 strains in other countries made up the imported database.", "Based on DENV1 isolated from the outbreak in 2014, we systematically collected the E protein gene from 2005 to 2018 from GenBank. With the epidemiological data since 2005 supplied by the Guangdong Provincial CDC, we studied phylogenetics, molecular characteristics, and epidemiology to strengthen the foundational research of DENV1 for the prevention of large-scale dengue epidemics, providing preventive and control measures of DF with important evidence." ] },{ "paper_id": "1516a62bffb7478ad5cbec0bde15290baf5384a3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "HMGB1 Enzyme-Linked Immunosorbent Assay (ELISA) Serum HMGB1 was measured by ELISA using commercially available kits (HMGB1 ELISA Kit II; Shino-test, Sagamihara, Japan) following manufacturers' instructions. The sensitivity of the assay was 1.0 ng/mL.", "Hepatocellular damage was assessed by measuring serum alanine aminotransferase (ALT) and aspartate aminotransferase (AST) using a SPOT CHEM SP-4420 analyzer (ARKRAY, Kyoto, Japan).", "Two types of immunohistochemical controls were used. (1) Sections were processed by replacing the primary antibody with normal non-immune serum. (2) Sections were processed by replacing the primary antibody with an irrelevant antibody (GFP; Invitrogen). The immunoreactions were completely absent in control sections." ] },{ "paper_id": "15228615c1656f39a5ec8dcc8bc26ef0371d4040", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cells on coverslips were fixed with 4% paraformaldehyde in phosphate-buffered saline (PBS) for 10 min and permeabilized with 0.2% NP-40 in PBS. The coverslips were soaked in 1% bovine serum albumin in PBS, and then incubated at room temperature for 1 hour with a primary antibody. After being washed twice with PBS, the coverslips were incubated at room temperature for 1 hour with a secondary antibody. The coverslips were then incubated at room temperature for 5 min with 3 mM 49,69-diamidino-2phenylindole (DAPI) and finally mounted on glass plates, and cells were observed under the fluorescence microscope.", "The virus transmission undergoes from infected to uninfected cells through either basolateral [36] [37] [38] or apical [39] [40] [41] [42] sides. In the case of influenza virus, cell-free progeny virions are released only from the apical surface of polarized epithelial cells [43] . This releasing polarity is achieved by directed transport of viral membrane proteins to the apical plasma membrane [44] . Indeed, that HA and NA glycoproteins are associated with lipid rafts, and the raft association has been implicated in apical transport [45, 46] .", "The production of rabbit polyclonal anti-NP antibody was described previously [53] , and this antibody was used as a primary antibody for indirect immunofluorescence assay. A goat antirabbit IgG antibody conjugated to Alexa Fluor 488 or Alexa Fluor 568 was purchased from Invitrogen and used as a secondary antibody for indirect immunofluorescence assay. A polyclonal antibody against influenza A virus was obtained from 2-month-old female rabbit immunized with 250 mg of purified virions of influenza virus strain A/Puerto Rico/8/34 [54] . The generation of antibodies was boosted three times and used as neutralizing antibodies to block the influenza virus infection." ] },{ "paper_id": "1522b3c191730bb3161a610fadb3bf06095ab902", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "Supporting information S1 " ] },{ "paper_id": "15253c08a446817c195eab73473fc2f215528705", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study was supported by the Agricultural Science and Technology Innovation Program (ASTIP) of Chinese Academy of Agricultural Science. We thank Accdon for their linguistic assistance during the preparation of this manuscript.", "WL wrote this manuscript and CD designed this project." ] },{ "paper_id": "1536008edcc909523ffc39c62b8389ba0ee76f95", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Similar results were found for hospitalizations, with 4 of 5 countries registering a decrease, with significant decreases in both Singapore (\u2424 1 \u03ed \u03ea0.090, P \u03fd 0.001) and Australia (\u2424 1 \u03ed \u03ea0.067, P \u03fd 0.001), whereas a significant increase was observed in Taiwan, ROC (\u2424 1 \u03ed 0.065, P \u03fd 0.001) ( Table 2) .", "The equations for the respective models of Poisson and linear regressions are shown together with Tables 1-4 (footnotes). The regression coefficients, \u2424 1 and \u2424 2 , each refer to the slope when the dependent variable-death counts, hospitalization rates, or C:R-is regressed on the independent variable, time in years or log(C:R). These regression coefficients (\u2424 1 and \u2424 2 ) would be interpreted as the average annual percentage change of the dependent variable in relation to the independent variable.", "The general decline in asthma mortality and hospitalizations across Asia Pacific (Figs. 1, 2) coincided with significant increases in C:R ratios across the region (Fig. 3) ." ] },{ "paper_id": "15372a2da42ddcb56ac4edc88090a6a425c5fad0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "\u25aa laboratory tests performed to investigate the illness;" ] },{ "paper_id": "153bc127b399f445ca2ec0e0709379efaada43bc", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "no clear source of infection to humans and an epidemiologic pattern that is more sporadic than the classic epidemic pattern of SARS [2] . Of further concern is the significant increase in reported cases since March 2014; in April 2014 alone, the number of reported cases exceeded the total number of cases that had been reported in the two years prior [2] .", "With MERS CoV there was no epidemic peak in the first 12 months as there was with SARS [12] . Instead, there were infrequent cases over a longer period than would be expected for a disease that is not highly infectious (see Figure 1 ). This pattern is suggestive of a sporadic rather than epidemic source of ongoing infection in humans. Estimates of the reproductive number, R0, are low, and range from 0.42 < R0 < 0.92 [33] , and 0.8 < R0 < 1.5 [34] , suggesting the infection does not have epidemic potential and cannot be easily sustained in the human population by human-to-human transmission alone [9, 35, 36] . A low reproductive number is supported by the epidemiologic pattern, however, the surge of cases in April 2014, inclusion of asymptomatic and mild infections and the increasing size and transmission generations of recent clusters would under-estimate this calculation.", "The first outbreak of MERS-CoV occurred in a hospital in Jordan in April 2012, with subsequent cases and clusters occurring throughout the Arabian Peninsula. Phylogenetic analysis of the virus has revealed that MERS-CoV has been in circulation since at least 2003 [4] , much longer than previously estimated based on the most common ancestor for the MERS-CoV strains found in humans [5] , and well before the first confirmed case in Jordon. Travel from the infected regions has resulted in additional cases in over a dozen countries, with limited local transmission occurring in the UK, France, Tunisia, and Iran. Furthermore, five of the highest travelled airports in the world are located in countries where MERS-CoV has been transmitted [6] , creating the possibility of a pandemic [7] ." ] },{ "paper_id": "1542e8e707bd5fa1cb6b3919722fc30ced018c1f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Percutaneous and transjugular liver biopsies and HVPG measurements were performed as we have previously described [5] . Fibrosis stage was scored using the Scheuer classification: no fibrosis (F0), minimal portal fibrosis (F1), periportal fibrosis (F2), fibrosis beyond the portal tract making septums (F3) and cirrhosis (F4) [6] .", "See (Data S1).", "See (Data S2)." ] },{ "paper_id": "1546fd2f004f233eea33c99a54f863ee80ffedaf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The data were extracted from AEIS database and downloaded in Microsoft Excel and Access format. The statistical analyses were performed in SAS 9.1 and SPSS 14. The geographical distribution analysis was performed in Arc GIS 9.2." ] },{ "paper_id": "154880a8053db7adb802ae5350656b649496b4a3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "DC-SIGN is a transmembrane lectin receptor on dendritic cells with multiple immune modulation function [18] DC-SIGN can recognize many pathogens, such as viruses (HIV-1, dengue, and measles virus) [19] [20] [21] , bacteria (Helicobacter pylori, Mycobacterium tuberculosis) [22] , and fungi (Candida albicans and Aspergillus fumigatus) [23] contributing to generation of pathogen-tailored immune responses and immunosuppressive response by the MAPK pathway in DCs [24] . The real cause of KD remains unknown. It is generally accepted that KD results from an undefined infectious process trigger in a genetically predisposed individual [25] .", "Genotyping of CD209 rs4804803 SNP. Genomic DNA was isolated from heparin-anticoagulated blood samples using a standard phenol-chloroform extraction followed by 70% alcohol precipitation. Genotyping for the CD209 variant (\u2212336 A/G; rs4804803) was carried out using Custom TaqMan SNP Genotyping Assays (Applied Biosystems, Foster City, CA, USA). The primer sequences were 5 -GGACAGTGCTTCCAGGAACT-3 (forward) and 5 -TGTGTTACACCCCCTCCACTAG-3 (reverse). The Taq-Man minor groove binder probe sequences were 5 -TACCTGCCTACCCTTG-3 and 5 -CTGCCCACCCTTG-3 . The probes were labeled with the TaqMan fluorescent dyes VIC and FAM, respectively. The PCR was conducted in total volume of 15 \u03bcL using the following amplification protocol: denaturation at 95 \u2022 C for 10 min, followed by 40 cycles of denaturation at 94 \u2022 C for 20 s, followed by annealing and extension at 60 \u2022 C for one minute. After the PCR, the genotype of each sample was determined by measuring the allele-specific fluorescence in the ABI Prism 7500 Sequence Detection System, using SDS 1.1 software for allele discrimination (both Applied Biosystems). To validate the genotyping by real-time PCR analysis, 100 PCR products were subject to restriction fragment length polymorphism (RFLP) analysis with MscI restriction enzyme (New England Biolabs, Beverly, MA, USA) and showed a 100% identical result between these two genotyping systems as noted in our previous report [17] .", "The Scientific World Journal [27] [28] [29] , further investigation into other candidate SNPs contributing to KD morbidity is needed. Besides dendritic cells, IVIG was observed to affect many other cells, including endothelial cells, monocytes, neutrophils, and T and B cells [30] [31] [32] . The numerous effects of IVIG therapy also partly explain there not being an association of \u2212336A/G SNP of the DC-SIGN gene with IVIG resistance in KD.", "The Hardy-Weinberg equilibrium was first checked. The statistical differences between case and control in genotype and allele frequency were assessed by chi-square test. The statistical differences in the genotype and allele frequency of KD patients with and those without CAL formation, aneurysm formation, patients responding to IVIG, and those showing resistance were assessed using chisquare test. SAS 9.1 for Windows was used for data analysis." ] },{ "paper_id": "154eae1741c2ed718dec40b25f60eca4b56e0a74", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1552cf77b6385950e197c67c2ed55ed6e1879ced", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Received: 12 April 2010 Accepted: 10 August 2010 Published: 10 August 2010" ] },{ "paper_id": "155cca2a90a5430ac391b46983efa4c13f193289", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "WTA thus provides an isothermal alternative to random RT-PCR, and could become an invaluable method in diagnostic applications, particularly when used in conjunction with oligonucleotide microarrays. " ] },{ "paper_id": "155de81e6f3c3ca342aa733e289b749a5394a26b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Alpha-O Peptides did not fund any of this research. The paper is a mathematical paper that refers to self-assembling protein nanoparticle (SAPN), a technology that has been patented by P.B.", "Regarding D 3 symmetry, the necessary condition is", "Competing interests. P.B. is CEO of the company Alpha-O Peptides and has patents or patents pending on the technology.", "Funding. Funding for G.I.'s visit to York via Italian National Group of Mathematical Physics (GNFM-INdAM) and by EPSRC grant EP/K028286/1 is gratefully acknowledged. R.T. also thanks the Royal Society for a Royal Society Leverhulme Trust Senior Research Fellowship (LT130088)." ] },{ "paper_id": "1560867701aecc60f73407501a5c5c85e53c8522", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All flow cytometry data were collected on either a FACSCalibur (BD Biosciences, San Jose, CA) or CyAn flow cytometer (Dako North America, Carpinteria, CA) and then analyzed by FlowJo software (Tree Star, Ashland, OR)." ] },{ "paper_id": "15640dc97f36ae7b410f731003235ee8a3cae495", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The kinetic parameters were determined with a published method (30) . In this assay, the initial velocity is given as a function of the enzyme concentration [E] with the following equation:", "IGF-1 and IGFBP3 were obtained from PeproTech Asia (USA). Anti-IGF1R b and anti-phospho-IGF1R (Tyr1135/1136)/insulin receptor (Tyr1150/1151) were from Cell Signaling Technology, Inc. (Danvers, MA). Antiinsulin Rb and anti-phospho-insulin Rb were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-IGFBP3 was from Abcam (Cambridge, UK). The polypeptide GPETLCGAEL was synthesized by Kelowna International Scientific (Taiwan). Matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF) analysis was carried out in the MASS core facility, NRPGM, National Science Council, Taiwan. CL1-0 cells were a gift from Dr Yang Pang-Chyr of the National Taiwan University (27) . NCI-H460, H520, and H661 cells were purchased from the American Type Culture Collection and cultured according to instructions.", "Reduction of the ligand concentration and a blockade of IGF1-IGF1R binding are promising anticancer strategies (26, 49) . Our results suggest that the proteolytic processing of IGF-1 is another alternative way to control the IGF axis. Consistent with this, the expression of the DPP-IV protease is reduced in certain cancer types (e.g., human lung SCC). Because DPP-IV inhibitors are currently used to treat human type II diabetes (50, 51) , their potential long-term impact on the balance between cell growth and apoptosis in this niche warrants further investigation." ] },{ "paper_id": "15724c0c0f8675d894aa76e25c9a29f4266d0440", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Colistin sulfate and resveratrol were obtained from Sigma-Aldrich (Saint Quentin Fallavier, France). Resveratrol (Thermo Fisher, Germany) was dissolved in dimethyl sulfoxide (DMSO) (Sigma-Aldrich, Saint Louis, USA) at a concentration of 20 mg/mL.", "-\"The content is object of Italian Patent Application No.", "102017000025738 filed on 08.03.2017\" -\"The content is object of International Patent Application No." ] },{ "paper_id": "15753984412d073dd4c6daed84e3d294f728b636", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "these mice is not ideal for studies seeking to understand innate and adaptive responses to viral infection. Therefore, a better model system for oral CVB3 infections is needed since some effects, such as those imparted by intestinal microbiota, can only be uncovered by using the natural oral infection route (30) (31) (32) (33) (34) .", "Statistical analysis. Data throughout are shown as the mean \u03ee the standard error of the mean. The differences between groups were examined by unpaired two-tailed Student t tests. P \u03fd 0.05 was considered statistically significant. All analyses were performed with Graph Pad Prism 6.03 software (GraphPad Software, La Jolla, CA).", "This work, including the efforts of Julie K. Pfeiffer, was funded by HHS | National Institutes of Health (NIH) (AI74668). This work, including the efforts of Julie K. Pfeiffer, was funded by Burroughs Wellcome Fund (BWF)." ] },{ "paper_id": "1575931c6fe7aea67ea3ced0ebe1df4d2604864c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1579fbff7af9b156c6f49fee0526e48f852ea460", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Infectious Bronchitis (IB) is an acute and highly contagious viral respiratory disease of chickens 1,2 . IB causes major economic losses in commercial chickens throughout the world 1,3 . It is one of the most prevalent diseases in the poultry industry. The disease is usually characterized by respiratory signs including ocular and nasal discharges, gasping, coughing and sneezing. However, the virus can also infect urogenital and reproductive tracts causing renal dysfunction and decreased egg production 3,4 .", "We performed all experiments involving virulent IBV in our USDA approved Biosafety level-2 and Biosafety level-2 plus facilities following the guidelines and approval of the Animal Care and Use Committee (IACUC), University of Maryland.", "Statistical analysis. Data were analyzed among groups by One-Way-ANOVA test. The student t-test was used to compare two groups. To avoid bias, all animal experiments were designed as blinded studies." ] },{ "paper_id": "15909c5986b0407310ef629ce19ebe562be7c20c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The baseline characteristics, symptom severity and degree of interference with daily life were similar in both arms (Table 1) . We identified an aetiology in the baseline sample of 73% (48/66) of participants (Table S1 ). Amongst these, 56% were rhinovirus and 31% were coronaviruses (COV), with the rest due to enterovirus, influenza A virus, parainfluenza virus type 3 (PIV-3), respiratory syncytial virus (RSV) and human metapneumovirus (HMPV). We detected dual infections of rhinovirus with an enterovirus/COV HKU1 in two.", "Published: xx xx xxxx opeN www.nature.com/scientificreports/", "80% in the intervention arm used 3% HS, while 9% each used 2.5%, 2% HS. All but one used Cornish sea salt. One participant left without the sea salt and used another brand available at home. An individual in the control arm reported performing nasal irrigation but provided no further information." ] },{ "paper_id": "159542778cfb78258a07f195a5b4aaf400cdcbcb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Group 1 consisted of 66 organisms, of which 22 were from the Salmonella genus. Parvovirus B19 had a moderate correlation with sunshine (mean r = 0.54), followed by Salmonella Enteritidis with sunshine (r = 0.52) and" ] },{ "paper_id": "15a1cb9e790f884e0513e9f0112a909e95a96c67", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The following installs the necessary packages, if they are not already installed.", "pkgs <-c(\"plyr\",\"pomp\",\"reshape2\",\"magrittr\",\"ggplot2\",\"scales\", \"foreach\",\"doMC\",\"doMPI\",\"iterators\")", "R.version.string sapply(pkgs,function(x)as.character(packageVersion(x))) ## [1] \"R version 3.1.2 (2014-10-31)\" ## plyr pomp reshape2 magrittr ggplot2 scales foreach ## \"1.8.1\" \"0.62.5\" \"1.4.1\" \"1.5\" \"1.0.0\" \"0.2.4\" \"1.4.2\" ## doMC doMPI iterators ## \"1.3.3\" \"0.2.1\" \"1.0.7\"" ] },{ "paper_id": "15a5a243bb623a17ee4f0c18c4e3bea8c065ed11", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Transmissible gastroenteritis (TGE) is a highly contagious infectious disease of pigs that is characterized by vomiting, diarrhea, and dehydration. Notably, the mortality rate of this disease in seronegative suckling piglets can reach up to 100% [1] . TGE is caused by the TGE virus (TGEV), which infects the gastrointestinal tract, causing villus atrophy and crypt hyperplasia, and disrupting intestinal nutrition absorption [2, 3] .", "\u03b2-tubulin was also analyzed.", "doi:10.1371/journal.pone.0165585.g002" ] },{ "paper_id": "15be11732e317af7fa6c86abea963f89af68cc36", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "15ca0457de2d05a3796f024899edc9c55c86e4ba", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ethics Statement. The study design and methods were approved by the Institutional Review Board of Center for Clinical and Translational Research of Kyushu University Hospital (IRB serial number: . The methods were carried out in accordance with the approved guidelines. All patients or their relatives gave their informed consent within written treatment contract on admission and therefore prior to their inclusion in the study." ] },{ "paper_id": "15d37cf2a310ff8cce48b1c1f3eaea846b17bbd2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The descriptive statistics were presented as frequencies and percentages." ] },{ "paper_id": "15d52271667c76c6db91907ad72ecb65fb88ec84", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Early work on the viral sequences of Egyptian H5N1 used bioinformatics to model molecular phylogenetic evolution but did not consider geographic dispersion between different regions within the country [14, 15] . Phylogenetic analysis indicated a distinct clade of European-Middle Eastern-African (EMA) isolates [15] that is also classified as clade 2.2 [16] . EMA had three sub-clades with genetic similarities despite being geographically distinct [15] .", "By considering geography as a state within genotype evolution, it is possible to infer locations that are impacted by certain clades. This also enables epidemiologists to understand the migration from a given origin to a perceived endpoint; information that is vital for controlling spread of disease. Pinpointing specific trade routes leading to virus propagation within the country can enable targeted inspections and other disease control measures, improving the efficient use of public health resources.", "[35] to downloaded additional HA sequences from 2010-2012 in Egypt. For the HA gene, IRD considers a complete segment to contain at minimum 1,659 sequences. Thus, we specified this minimum segment length and also excluded sequences without a governorate name. This added 152 sequences to the final set for a total of 226." ] },{ "paper_id": "15d784a335abf0ea0266e9a2406b8d87f25c8f2f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are shown as the mean 6 SEM. Statistical tests, as described in the figure legends, were used to compare experimental groups, with p , 0.05 considered significant. GraphPad Prism 6 (GraphPad Software) was used for data analysis and preparation of all graphs.", "CD4 + cells from infected WT, Il27ra 2/2 , and Ifnar1 2/2 mice were enriched from lung homogenates using anti-CD4 microbeads (L3T4; Miltenyi Biotec) according to manufacturer's instructions. Purified cells were .95% CD4 + T cells as assessed by flow cytometry (data not shown). Cells were kept in 350 ml of RLT buffer (Qiagen) at 280\u02daC before processing. RNA was extracted using RNeasy Mini Kits (Qiagen) and reverse transcribed to cDNA with a high-capacity reverse transcription kit (Applied Biosystems). The expression of indicated genes was quantified by real-time PCR (ABI Prism 7900; Applied Biosystems) and normalized against Hprt1 mRNA levels. TaqMan primer probes (Applied Biosystems) for Il10 (Mm00439616_m1), Ifng (Mm01168134_m1), Csf2 (Mm01290062_m1), and Hprt1 (Mm00446968_m1) were used.", "M. tuberculosis experiments were performed under BSL-3 conditions. M. tuberculosis HN878 bacilli were grown to midlog phase in Middlebrook 7H9 broth supplemented with 10% oleic acid albumin dextrose complex (Difco), 0.05% Tween 80, and 0.5% glycerol before being quantified on 7H11 agar plates and stored in aliquots at 280\u02daC. Mice were infected via the aerosol route using a three-jet Collison nebulizer unit (BGI), calibrated to deliver \u223c100-200 CFUs to the lung. The infection dose was confirmed by determining the number of viable bacteria in the lungs of five mice just after the aerosol infection. For bacterial load determination, mice were euthanized by CO 2 inhalation and the lungs were aseptically excised, individually homogenized, as described previously (29) , followed by plating serial dilution of the organ homogenate on Middlebrook 7H11 agar supplemented with 10% oleic acid albumin dextrose complex. CFUs were counted after 3 wk of incubation at 37\u02daC, and the bacterial load per organ was calculated." ] },{ "paper_id": "15da0bac7ba69e867df1af947566ee74e80bdb0e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "were adsorbed in a 300-mesh copper net for 2 min. The samples were observed via electron microscopy after negative staining.", "Recombination analysis was completed using RDP4 software. 18 Methods, including RDP, Bootscan and SiScan, were used. Likely parental isolates and recombination breakpoints were detected under default settings. Criteria for determining recombination and breakpoints were a P-value o10 \u2212 6 or a recombination score 40.6.", "In 2015, tissue from one small intestine and 14 anal tissue strips were harvested from a pig farm in Anhui Hefei (AHHF). The clinical symptoms were vomiting, yellow and watery diarrhea, rapid weight loss and dehydration. Intestinal content was collected from an infected piglet and was mixed with PBS at a ratio of 1:5. The suspension was then centrifuged at 6000g for 15 min at 4\u00b0C and was filtered using a 0.22-\u03bcm filter." ] },{ "paper_id": "15dd9abbe4084c12712f094415c5ca9980aaacda", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "We successfully amplified and sequenced two partial DRA exon 2 sequences from three ancient dromedaries Table 2 ). The sequence recovered from AQ34 was identical to Cadr-DRA*02, while AQ30 showed an additional three C/T substitutions when compared with the reference sequence (Fig. 5) .", "All alignments and resulting phylogenetic trees are available at the TreeBASE (http://treebase.org/treebase-web/ home.html) under DOI http://purl.org/phylo/treebase/ phylows/study/TB2:S18850.", "All sequences were submitted to GenBank (http:// www.ncbi.nlm.nih.gov/genbank/) and are available under accession numbers KT936396-KT936421." ] },{ "paper_id": "15dddee0b99b7095553fde91f32e7ae83c15e9ef", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "15f2b1915443fff0466f0dd89c7c0ab6761833b4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Resolved proteins were electro-blotted on 0.2 mm nitrocellulose membrane (Bio-Rad) using 20 mM Tris, 0.05% SDS, 150 mM glycine and 20% V/V isopropanol transfer buffer. Membranes were blocked with 5% skimmed milk, in Tris buffered saline (TBS: 25 mM Tris/HCl, 150 mM NaCl, 2 mM KCl, pH 7.4) and incubated over night with a dilution of 1/300 rabbit antisera. Membranes were washed three times with TBS-Tween-20 (TBS containing 0.05% Tween-20) and further incubated with monoclonal, anti-rabbit, peroxydase conjugate (Sigma), diluted at 1/750 in 5% skimmed milk. After 2 hours the membrane was washed three times with TBS-Tween-20 and developed using 4-chloronaphthol (Sigma) in presence of hydrogen peroxide.", "The genus Orbivirus currently includes twenty two distinct virus species, with genomes composed of 10 segments of linear double stranded RNA (dsRNA), that are vectored by Culicoides midges, ticks, phlebotomine flies, anopheline or culicine mosquitoes. The three economically most important orbiviruses: Bluetongue virus (BTV) (the Orbivirus 'type-species') African horse sickness virus (AHSV) and Epizootic hemorrhagic disease virus (EHDV) are all transmitted by Culicoides biting-midges [1] . Several tick-borne orbiviruses can infect humans, including members of the Changuinola virus, Corriparta virus, Lebombo virus, Orungo virus and Great island virus (GIV) species.", "SCRV, which persistently infects tick cells but does not grow in mammalian cells, appears to have a non-functional NS4 ORF that is interrupted by a stop codon. These observations suggest that NS4 expression could play a role in productive infection of mammalian cells." ] },{ "paper_id": "15f3676a843fc2b08f47c1e0c49d78f63519caeb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Pumas from three study sites spanning coastal southern California, Colorado, and Florida were sampled and their FIV Pco status assessed.", "No explicit solution", "Further examination of co-infection patterns in puma would be a valuable direction for future research.", "with S the proportion of susceptible pumas, I the proportion of infected pumas, and parameters \u03b2 and \u03b3 describing the shape of the Weibull model. We used an ordinary differential equation solver (lsode) and then taking" ] },{ "paper_id": "15f3da54587d39ca8a3c8eabffb84fc463266ab0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nucleotide sequence accession number. The complete genome sequence of PEDV strain CH/ZMDZY/11 was submitted to GenBank under the accession no. KC196276.", "We report here the complete genome sequence of the porcine epidemic diarrhea virus strain CH/ZMDZY/11 isolated from central China. Our data, together with sequence data of porcine epidemic diarrhea virus (PEDV) isolates from other parts in China, will help to understand better the epidemiology and genetic diversity of PEDV field isolates in China.", "single-stranded RNA virus belonging to group 1 of the genus Coronavirus of the family Coronaviridae, is a causative of porcine epidemic diarrhea (PED), an acute and highly contagious enteric disease characterized by watery diarrhea, vomiting, dehydration, and high mortality in nursery piglets (1) . Since December 2010, PED outbreaks have been observed in most of the provinces in China. To date, the complete genome sequences of several PEDV strains from southern China have been reported (2) (3) (4) (5) (6) (7) (8) (9) (10) . To understand the diversity, as well as the epidemiological and molecular characteristics, of PEDV isolates in China, we sequenced the complete genome of CH/ZMDZY/11, a virulent PEDV strain that was isolated from a suckling piglet with severe diarrhea in Henan, a central province in China." ] },{ "paper_id": "160c4bd7c9401bed81b339157fa4ab54242ca8ff", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Animal protocols were performed under the approval of the Institutional Animal Care and Use Committee at Western University of Health Sciences, Pomona, California (WesternU). Fertilized eggs, descended from Modified Wisconsin Line 3, were obtained from Dr. W. Elwood Briles, Northern Illinois University, and incubated and hatched under standard conditions at (38\u02daC/50-65% humidity) [10, 13] at WesternU. In addition to daily health monitoring, fresh food and water were provided ad libitum. Experimental animals were euthanized by insufflation of isoflurane gas (Butler, Dublin, OH).", "Whole blood samples were collected via jugular venipuncture in EDTA tubes from age matched chicks at 14-18 weeks old. At no time did the amount of blood harvested from each animal exceed 1% of body weight. and stored at -80\u02daC. The morphology of adherent cells was observed daily under bright field microscopy (20x objective).", "Purity of monocyte cultures using this culture method was confirmed by IFA and FACS using monoclonal antibody KUL01 as previously described as part of a different aspect of this study [13] .", "A 50 \u03c1g/ml ch-IFN\u03b3 solution (Invitrogen, Carlsbad, CA) was prepared in RPMI w/o Phenol Red culture medium (Invitrogen, Carlsbad, CA). After washing the cells twice with warm PBS, macrophage cultures were stimulated with 1 ml of RPMI-ch-IFN\u03b3 mixture [13] ." ] },{ "paper_id": "1613fd55dff3cde4f7f32fd5b667e548f860b5d3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: Fevers of unknown origin constitute a substantial disease burden in Southeast Asia. In majority of the cases, the cause of acute febrile illness is not identified.", "Our findings demonstrate the utility of multiplex diagnostic assays for differential diagnosis of respiratory tract infections and underscore the increasing importance of EV-68 in respiratory disease.", "Mass Tag PCR data were analyzed using non-parametric statistics. The confidence score was calculated using fold inter-quartile range distance of the positive control or the test sample from the 95th percentile cut-point of the negative control distribution for a tag. The score is similar to parametric z-score but is distribution free." ] },{ "paper_id": "16145009d7725e0b39d5522f56ac9781d258eeb8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1621345a6fa32695580f1455de8a7f6284a0f9e9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All tests are two-tailed unless otherwise indicated. P values less than 0.05 were considered statistically significant." ] },{ "paper_id": "1624c6455f4fb4a8e871403b0e27a217bcdc83b2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Passive mixing principles are very attractive because they rely on diffusion or chaotic advection through specially-designed microchannels. They can also operated by avoiding the need of any external energy source. Active mixing schemes, on the other hand, improve the mixing performance by applying external forces to perturb sample flows and consequently to accelerate the diffusion processes. The latter configuration often leads to a complex device design [17] .", "Droplets help in achieving a rapid mixing of reagents: the rate of DNA hybridization in a homogeneous solution is about 40-fold faster than the hybridization rate in solid-liquid interfaces such as those of microarrays.", "NASBA utilizes two RNA target-specific primers and three enzymes (i.e., avian myeloblastosis virus reverse transcriptase, T7 DNA-dependent RNA polymerase (DdRp) and RNase H).", "An improvement in the real-time NASBA integration in microfluidic environment was introduced by detecting artificial human papilloma virus (HPV) 16 sequences and SiHa cell line samples in cyclic olefin copolymer (COC) microchips [119] . In this multipurpose microchip platform, the sample was automatically distributed into 10 parallel reaction channels for simultaneous detection in 80 nL volumes, making it possible to specifically amplify and detect several different targets with high sensitivity by only using one single sample." ] },{ "paper_id": "16283e25f01d47898ad2b82d56bd81d5ccf44a5d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical significance was determined using the Student's t test. For all data analyzed, a significance threshold of P < 0.05 was assumed. The values are expressed in some figures as means \u00b1 standard deviation (SD). ", "Cats with clinically diagnosed FIP have very rarely been cured, although several therapeutic strategies have been attempted. Some cats treated with prednisolone and phenylalanine mustard or cyclophosphamide have gone into remission [26] . Various immunosuppressants, such as glucocorticoids and cyclophosphamide, may prolong life but do not alter the fatal outcome [4] .", "Authors' contributions YT carried out all experiments, participated in the data collection and analysis, and prepared the manuscript. SO, MI, and ST carried out cell culture and virus preparation. YS performed some of the biochemical experiments and TS carried out luciferase assays. All authors read and approved the final manuscript." ] },{ "paper_id": "1628fb770b782044ef43a9c63252b5d3b25a38ba", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Author Contributions: Burtram C. Fielding and Aasiyah Chafekar made an equal contribution in the writing of this manuscript.", "[98]", "One pot RT-LAMP ", "Acknowledgments: Burtram C. Fielding receives funding from the National Research Foundation (NRF) (South Africa) and the University of the Western Cape Senate Research Fund. Any opinion, findings and conclusions or recommendations expressed in this material are those of the authors and, therefore, the NRF does not accept any liability in regard thereto." ] },{ "paper_id": "162c064dae8c02e477c00bbcd60b974ae794649f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Surveillance pyramid approaches: reconstruct conditional probabilities of appearing at one severity level conditional on reaching a lower severity level; combine data sources that have relatively complete ascertainment of higher severity levels (e.g., hospitalization, ICU, death) with those having relatively complete ascertainment of lower levels (e.g., seeking medical attention, hospitalization) [10, 11] . CFR can then be estimated as a product of conditional probabilities with associated uncertainties [17] .", "Serologic ascertainment of infection [18, 19] to provide a population denominator for infections regardless of symptoms, combined with active surveillance for more severe outcomes.", "Individuals identified before becoming cases (e.g., as healthy contacts of infected persons) and actively followed regardless of clinical severity could be analyzed separately as a prospective cohort for whom the course of disease could be observed and this restriction readily made." ] },{ "paper_id": "162d42b98a0abdf3d7ee609fe464918e457f55fd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Abbreviations BCG: Bacillus Calmette-Gu\u00e9rin; HSP: Heat shock proteins; IgM: Immunoglobulin M; KD: Kawasaki disease", "Here, we present a case report of a 7-month old infant with laboratory-confirmed measles who presented with erythema and induration at the BCG inoculation site.", "On admission, he looked unwell, was febrile (temperature 38.5\u00b0C) but had normal vital signs (pulse rate 125/min, respiratory rate 48/min). He had an erythematous maculopapular rash involving mainly the face, neck and trunk, with some areas of confluence (Fig. 1a) . In addition, a welldefined erythematous, indurated area measuring 2.5 cm in diameter was seen at the site of the BCG scar (Fig. 1b) . No conjunctivitis, cervical node enlargement, mucosal changes or extremity changes (swelling/erythema of the hands or feet) were found." ] },{ "paper_id": "162ffba72e95c4b2686b0b273b47c376aad61ba7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Another method for host recognition of viruses involves retinoic acid inducible gene-I (RIG-I) and melanoma differentiation factor 5 (MDA5) [46] . To clear viral infections, RIG-I-like receptors and MDA5 recognize cytosolic viral RNAs via the helicase domain [47] . In contrast to TLRs that are predominately present in leukocyte subsets, these receptors are ubiquitous in human cells. Neutrophils and monocytes themselves can become infected by viruses [48] and therefore possess cytoplasmic and endosomal mechanisms to recognize them, including RIG-I and MDA5 signaling cascades in the cytoplasm and endosomal TLRs. In fact, the double-stranded RNA mimetic poly(I:C) stimulates neutrophils to increase many antiviral genes, including type I IFN mRNA transcripts, IFN-responsive genes, TNF-\u03b1, and IFN regulatory factor (IRF)7 [49] . When infected with encephalomyocarditis virus (EMCV), MDA5-deficient mice mount significantly reduced TNF-\u03b1 and IFN-\u03b2 responses [49] . Similar results were also observed after infections with Coxsackie B virus (CVB) [50] and West Nile virus (WNV) [51] . Notably, TNF-\u03b1 and IFN-\u03b2 have the capacity to upregulate the expression of major histocompatibility complex molecules on antigen-presenting cells, which would make viruses more susceptible to T-cell-mediated clearance.", "Clearly, the cross-talk that is occurring between monocytes, neutrophils, and T-cells constitutes a crucial bridge between innate and adaptive immunity. Future investigations are encouraged to examine the full extent of communication between these cells, further elucidate the mechanisms, and the anatomical locations of these interactions. Depletion assays will be beneficial to determine which cell subsets can mount effective anti-viral responses, not just by T-cell and APC interactions, but also by direct interactions with neutrophils and monocytes.", "Myeloid cells are able to translate micro-environmental cues into an effector profile that initiates lymphocyte responses [123] . Innate lymphoid cells (ILCs) react to pathogens indirectly through myeloid or epithelial cell-derived cytokines and other inflammatory mediators including IL-12, IL-23, and IL-33 [124] . ILCs are derived from a lymphoid progenitor but do not contain either a B or T-cell receptor due to the absence of the recombination-activating gene [125] . There are three major subsets of ILCs: groups 1, 2, and 3. Group 1 includes cells that produce IFN-\u03b3 and TNF-\u03b1 and is predominately composed of classical natural killer (NK) cells. ILCs that require GATA3 and ROR\u03b1 to develop and express the cytokines IL-5 and IL-13 are denoted as group 2, while intestinal ILCs that express NKp46 and depend on ROR\u03b3 comprise group 3 [126] . Since evidence shows that ILCs are tissue-resident cell types with limited capacity to directly recognize PAMPs [123] , myeloid cells may play a crucial role in controlling ILC homeostasis and function [127] .", "Neutrophils, inflammatory monocytes, and their roles in mitigating bacterial infections have been extensively studied and well characterized. Exciting new research in immunology and virology has demonstrated that these first responders of the innate immune system are also crucial in limiting viral infections, replication, and associated off-target pathological damage. A multifaceted range of tactics is utilized to combat an equally diverse range of viruses, including phagocytosis, the formation of extracellular traps, the production of cytokines such as IFNs, and modulation of ILCs and lymphocytes." ] },{ "paper_id": "1638100b254164ee9af7d66be61794a7efa07b78", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Eight-wk-old female SPF BALB/c mice with body weight of 17-18 g were purchased from Beijing Laboratory Animal Research Center (Beijing, People's Republic of China), and housed in microisolator cages ventilated under negative pressure with HEPA-filtered air. During the experiments, mice were given food and water ad lib.", "Human infections with avian H5N1 influenza virus from birds have occurred successively since the first case was reported in Hong Kong, 1997 , which demonstrated that an avian influenza virus could cross the species barrier to infect humans and it is possible that avian influenza virus mutates to be able to transmit among humans [1 -3] . As of 12 December 2008, the World Health Organization (WHO) reported that H5N1 virus had caused 390 human infections with 246 people deaths, representing a mortality rate over 60% [4] . WHO has warned of a substantial risk of pandemic of avian influenza in the near future." ] },{ "paper_id": "16406822b5673734cefa5a986007b6fff662c7b5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The authors would like to thank Sam Carding for creating Figure 1 .", "Declaration of personal interest: None. " ] },{ "paper_id": "164f04163f53a4fb15d74a03b6ab473b50c30989", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "164f0fed97b05b34ea5df0f4e4e9e204d05f7849", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Genotype distributions were tested for Hardy-Weinberg equilibrium using goodness-of-fit test (1 df). Informative missingness was checked by coding successful genotypes into one group and failed genotypes into another group followed by 262 Chi-square test for T2D and t-test for the quantitative traits of interest. One SNP (rs805264) with significant result (p,0.001) indicative of informative missingness (IM) was excluded for further T2D association analyses (Supplelmentary Table S2 ).", "Results from functional analyses were analyzed by Student's ttest for two-group comparison, and one way ANOVA for multiple group comparisons. A statistical significance is considered at p,0.05 level. All statistical analyses were performed using the SPSS program (SPSS version 15.0, Chicago, IL, USA) unless otherwise specified.", "Ectopic expression of APOM was achieved by transient transfection of APOM1 or APOM5 cDNA (cloned into the pCMV-Myc vectors) into cultured cells at 70% confluence using LipofectamineTM 2000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufactorer's protocols [16] ." ] },{ "paper_id": "165cfcb6f439f6d779d1e94b0b8a3db96c79b22e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Having been identified to have been in contact with Case C in the hospital, 169 people (51 patients and 118 hospital employees) were subjected to either cohort quarantine or home quarantine for 14 days. However, there were no more newly infected people.", "We reviewed the MERS outbreak investigation report of the KCDC, and interviewed the healthcare worker who had recovered from MERS. Using the media interview data, we reaffirmed and supplemented the nature of the exposure." ] },{ "paper_id": "165d5a3cf0dc10f8229b0c6fcf149cd244cbd73a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Quantitatively, according to this model, sporadic human cases subsequent to that date teach us very little more about whether the virus may ultimately adapt to humans.", "] m . 10 6 (May et al. 2001) .", "Together the parameters R 0 ( i ) and M (i ) define the stochastic process of evolution and infection as follows. For a given infected individual, there are three possible events that could occur next: transmission, pathogen adaptation, and host recovery/death. These have probabilities p i , q i , r i , respectively, where" ] },{ "paper_id": "166142fd39f6000cf789299a7df7fedc36b300cb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Spleen leukocyte suspensions were prepared using DNAse I and collagenase D [23] , stained as detailed in S1 File, and acquired on a FACSCanto II Flow Cytometer (BD Bioscience).", "doi:10.1371/journal.ppat.1004897.g005", "The animal care and use protocols (ID no. 11-09/09/2011) were designed in accordance with national and international laws for laboratory animal welfare and experimentation (EEC Council Directive 2010/63/EU, September 2010), and approved by the Marseille Ethical Committee for Animal Experimentation (registered by the Comit\u00e9 National de R\u00e9flexion Ethique sur l'Exp\u00e9rimentation Animale under no. 14)." ] },{ "paper_id": "16627f4c7134394da448b1417a771d13ad7cca4a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "As post-disaster studies generally report a lack of baseline data as a major handicap to understanding the trajectory for psychosocial recovery, [17, 18] our study takes the first steps in establishing baseline for data vital for emergency planning, against which impact and recovery can be monitored." ] },{ "paper_id": "1664a9df618ca74e099245a2bd65f3172aeac284", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The data are expressed as the mean \u00b1 standard deviation (SD). The statistical significance of data was analyzed using Student's t-test or one-way analysis of variance (ANOVA) by SPSS 19.0. Values of p < 0.05 was considered to be statistically significant.", "(Continued on next page)" ] },{ "paper_id": "16673eca9ff4c1f57f53126415ad2f89b8cab557", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study was approved and consent was waived by the Beth Israel Deaconess Medical Center Institutional Review Board (protocol number: 2008-P-000412).", "Proportions were compared using the Chi-squared test and means were compared using the Mann-Whitney U test. Values of p < 0.05 were considered statistically significant and all tests were two-sided. The statistical analysis was performed in R (version 3.2.1; R Foundation for Statistical Computing, Vienna, Austria).", "Authors' contributions LDS, SFB, DM, and FP conceived of the study and participated in its design. DB and CH performed the statistical analyses. All authors participated in the interpretation of results and manuscript drafting or critical review. All authors read and approved the final manuscript." ] },{ "paper_id": "166ac544dda68154d0cfb96da75f30e457d6eda2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The virus neutralization test for detection of PRRSV neutralization antibodies was performed as follows. Samples of sera were diluted 1:4 in DMEM medium (Sigma-Aldrich) supplemented with 3% FBS. Then, heat inactivated sera (56 \u2022 C for 60 min) were diluted 2-fold serially in flat-bottom 96-well-microplate (NUNC). Next, equal volume (50 \u00b5L) of media containing 50 PRRSV PFU (Lelystad-CAPM V-490) was added to each well. Following incubation (60 min at 37 \u2022 C) MARC-145 cells were added to each well (3 \u00d7 10 4 per well) in 100 \u00b5L media per well. After 5 days of cultivation (37 \u2022 C, 5% CO 2 ), the cytopathic effect (CPE) of PRRSV on MARC-145 was evaluated by optical microscopy. The reciprocal value of the last sera dilution causing 50% reduction of CPE was defined as virus neutralization antibody titer.", "Our study had the following three aims:", "The normality of data distribution were confirmed. Experimental groups were compared using non-parametric Man-Whitney test. Data from different dates were compared using non-parametric Wilcoxon test for paired samples. ", "MT, VC, JS, and MF designed the study. MT, LL, JS, and KN performed the experiments. LL, HK, LK, PO, and JF performed the lab work and analyzed the data. LK produced the figures and statistical analysis. MT wrote the manuscript. JS and MF participated in manuscript preparation. All authors read and approved the final manuscript." ] },{ "paper_id": "1673be3a6c0cd5762dcdabc21816f4acdc102e31", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "with other G2b PEDVs in other countries [7] . Therefore, development of the Taiwan G2b PEDV-based vaccines would be very helpful for controlling and reducing the disease burden.", "The results of IgG level, IgA level, body weight, antibody titer, and viral shedding were statistically compiled with SAS 9.4 (Statistical Analysis System, SAS Institute Inc., Cary, NC, USA). The differences between each group were compared by one-way analysis of variance (ANOVA). The significance was determined to have a p-value < 0.05 (p < 0.05)." ] },{ "paper_id": "1679d2d946adeb59a2ce943f067d4bde57f5577d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Hemotropic mycoplasmas (hemoplasmas) are cell-wall free bacteria that attach to red blood cells and potentially induce hemolytic anemia [1] . In the domestic cat, at least three feline hemotropic mycoplasma species are known: Mycoplasma haemofelis (M. haemofelis), \"Candidatus Mycoplasma haemominutum\" (\"Cand. M. haemominutum\") and \"Candidatus Mycoplasma turicensis\" (\"Cand. M. turicensis\") [2] [3] [4] [5] . The pathogenic potential significantly varies among the three feline species; M. haemofelis is the most pathogenic of the three species, and an acute infection often results in hemolytic anemia [1, 6] .", "Long-term outcome of M. haemofelis infection: recovery in the absence of antibiotic treatment", "Serum chemistry was performed using a Cobas Integra 800 system (Roche Diagnostics, Rotkreuz, Switzerland) and included the laboratory's standard feline clinical chemistry panel: bilirubin, glucose, blood urea nitrogen (BUN), creatinine, protein, albumin, cholesterol, triglyceride, alkaline phosphatase, amylase, aspartate aminotransferase, alanine aminotransferase, lipase, sodium, chloride, potassium, calcium and phosphate. Globulin values were calculated by subtraction of albumin from the total protein concentration. Reference ranges are stated as 5% and 95% quantiles and were determined for routine purposes using identical methods and blood samples from 59 clinically healthy cats." ] },{ "paper_id": "167b459cba8933f49d8cb5585f442a68fe326361", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Virions were absorbed to carbon-formvar coated grids (Electron Microscopy Sciences) by floating grids on 5 ml drops of sample for 30 seconds (s). Grids were blotted dry, stained with 2% uranyl acetate in water for 30 s, blotted to remove excess stain and airdried. Samples were visualized using a JEOL JEM 2100 LaB6 Transmission Electron Microscope.", "Syrian golden hamster kidney fibroblast cells (BHK-21; ATCC# CCL-10) were grown in monolayer cultures maintained in Minimum Essential Medium (Eagle's MEM, Cellgro) supplemented with 9% fetal bovine serum (FBS, Gibco), 0.3% glucose (w/v), 3.4 mM L-glutamine, 90 U/ml penicillin and 90 mg/ml streptomycin, and kept in a 5% CO 2 atmosphere at 37uC. Infectivity [plaque forming units (PFU) per ml] of virus stocks was determined by standard plaque assay on BHK-21 cells. Recombinant wild-type (wt) VSV (Indiana serotype) was generated previously [46] using pBS-L, pBS-P, pBS-N, and pVSVFL(+) plasmids, and was kindly provided by John K. Rose (Yale University) [47] .", "To grow and purify virus VSV, BHK-21 cells were infected with at a multiplicity of infection (MOI) of 0.001 and incubated at 37uC in media containing 5% FBS. Virus containing media was collected around 24 hours (h) post infection (p.i.) when most cells were infected but significant cell detachment had not yet occurred in order to maximize exclusion of cellular debris. The media was centrifuged at 3,0006 g for 10 minutes (min) to remove large cellular debris. The virus was then purified as described in [48] , with slight modifications. In brief, clarified supernatants were underlayed with 5 ml 20% (w/v) sucrose in HEN buffer (10 mM HEPES pH 7.4, 1 mM EDTA, 100 mM NaCl) and centrifuged at 28,000 rpm and 4uC for 3.5 h in a Beckman SW32 Ti rotor. The resulting virus-containing pellet was resuspended overnight in HEPES buffered saline, pH 7.5 [HBS; 21 mM HEPES, 140 mM NaCl, 45 mM KCl, 0.75 mM Na 2 HPO 4 , 0.1% (w/v) dextrose] and then centrifuged in a 7.5-27.5% continuous gradient of Optiprep (Axis Shield) in HBS at 26,500 rpm and 4uC for 30 min using a Beckman SW40 Ti rotor. The virus-containing band was removed from the gradient, diluted with ET buffer (1 mM Tris-HCl pH 7.5, 1 mM EDTA), pelleted by centrifugation at 27,000 rpm and 4uC for 1.5 h using a Beckman SW40 Ti rotor and resuspended in ET buffer.", "Recombinant wt VSV was grown in BHK-21 cells and purified using gradient centrifugation. The purity of the resulting material was then examined by electron microscopy (EM). As seen in Figure 1 , nearly all of the material present was clearly identifiable as VSV virions, although many of them were bent, a previously observed form that is generally believed to be infectious [57] and may represent an EM processing artifact [58, 59] . The titer of these purified virions on BHK-21 cells was 1.4610 11 PFU/ml, demonstrating this preparation was highly infectious." ] },{ "paper_id": "16844dca24405d3c94a4366cd94598a6a7357fc8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Sanjay Chotirmall is a member of the editorial board (Section Editor). Dominik Hartl has an affiliation with University of T\u00fcbingen and Roche Basel ", "Consent for publication has been obtained from all persons for the included images.", "In the following two sections, we will focus on the microbiological (a) and immunological/inflammatory (b) findings associated with the pathogenesis of bronchiectasis." ] },{ "paper_id": "168667e863cc79cb44157edf0e39ca66a37b2b7b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For demographic analyses, differences between groups were assessed using Chi-square tests and analysis of variance (ANOVA).", "Two thousand eight hundred thirteen staff completed paper questionnaires while 235 completed electronic surveys. Three thousand forty-eight HCW participated (38%), which exceeded our target participation rate by three-fold.", "Although respondents reported that they believed the majority of their HCW colleagues would comply with IPC guidelines (61.5% \"mostly\" comply, 31.5% \"partially\" comply), there was wide variability in reported use of personal protective equipment and only 81-87% expected compliance with handwashing after interacting with patients with communicable respiratory diseases (Table 7) . Additionally, most respondents believed that patient charts would inaccurately report single or multiple HCW-patient interactions." ] },{ "paper_id": "1686765b6847c2b132d0129be10f7263bac5973e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For each of the prototype strains, virions were purified on discontinuous sucrose gradients [12] . The viral proteins were denatured and reduced and were separated on 10% SDS-Polyacrylamide gels and negatively stained using E-Zinc \u2122reversible stain kit (Pierce, Rockford, IL, USA). Each serotype was analyzed on a separate gel to avoid cross contamination. The N protein bands were excised from the gels and destained with Tris-glycine buffer, pH 8. The excised gel bands were minced in a clean pestle and mixed with elution buffer (50 mM Tris-HCl buffer pH 8, 150 mM NaCl, 0.5 mM EDTA, 5 mM DTT and 0.1% SDS) and transferred to the upper chambers of Nanosep centrifugal device (Pall Life Sciences, Ann Arbor, MI, USA). The proteins were eluted by centrifugation at 13000 \u00d7 g for 5 minutes, and the eluted proteins were quantified and 200 \u03bcg of each protein was mixed in complete Freund's adjuvant and injected subcutaneously into a rabbit. After two weeks, a booster immunization was given with 200 \u03bcg of protein in incomplete Freund's adjuvant and two weeks later the hyperimmune sera were collected. The sera were tested by western blot and were found to recognize specifically the homologous N protein (data not shown). The sera were stored at -80\u00b0C until further use.", "Hence, we have investigated the replication and pathogenicity of APMV-1 to -9 in hamsters inoculated intranasally. The intranasal route was intended to resemble the natural route of APMV infection as well as a likely route for vaccine vector administration. In this study, hamsters were chosen as the mammalian animal model because they are widely used to study replication and pathogenesis of a variety of viruses such as adenovirus [49] , herpes virus [50] , Nipah virus [51] , human RSV [52] , human parainfluenza viruses, SARS virus [53] , and Eastern equine encephalitis [54] .", "Hamster No.", "The other half of each tissue sample was used for IHC and histopathology. The tissues were fixed in 10% neutral buffered formalin, held for approximately seven days, and processed for IHC and histopathology. Paraffin embedded 5-micron sections of all the tissue samples were prepared at Histoserve, Inc. (Maryland, MD, USA). The sections were stained with hematoxylin and eosin for histopathology. Sections were also immunostained to detect viral N protein using the following protocol. Briefly, the tissue sections were deparaffinized in two changes of xylene for 5 min each, hydrated in two changes of 100% ethanol for 3 min each, changes of 95% and 80% ethanol for 1 min each, and finally washed in distilled water. The sections were processed for antigen retrieval in a water bath containing sodium citrate buffer (10 mM citric acid, 0.05% Tween 20, pH 6.0), at 95-100\u00b0C for 40 min and then allowed to cool to room temperature for another 60 min. The sections were rinsed in PBS-Tween 20, twice for 2 min each. The sections were blocked with 2% BSA in PBS for 1 h at room temperature. The sections were then incubated with a 1:500 dilution of the homologous primary N-specific rabbit antiserum in PBS for 1 h in a humidified chamber. After three washes in PBS, the sections were incubated with the secondary antibody (FITC conjugated goat anti-rabbit antibody) for 30 min. After a further wash cycle, the sections were mounted with glycerol and viewed under an immunofluorescence microscope." ] },{ "paper_id": "16874a8b95e04383b0ee7049220a36354ffab2ea", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Analyses were performed using Microsoft Excel 2010 (Microsoft Corporation, Redmond, WA, USA), GraphPad Prism Software 4.0 (GraphPad Software Inc., La Jolla, CA, USA), and PSI-Plot V 7.0 (Poly Software International, Pearl River, NY, USA). Student's t-test was used to compare group means. p-values < 0.05 were considered as significant.", "Medicines 2018, 5, 79 2 of 15 is shown using various biochemical assays including cross-linking, nuclear magnetic resonance, and X-ray crystallography methods [6, 7] .", "Materials and Methods" ] },{ "paper_id": "168ee484462356a280cd7fe162b1b7a8d81e80c5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Days post-infection FAN Fangchinoline HCoV-OC43 Human coronavirus OC43 IFN Interferon IL Interleukin TET Tetrandrine TNF Tumor necrosis factor ", "Statistical analysis was performed using GraphPad Prism Software V.6.05 for Windows (GraphPad Software, Inc., San Diego, CA, USA). Data are presented as mean \u00b1 standard error of the mean (SEM). Probability (p) values were calculated by one-way analysis of variance (ANOVA) followed by Tukey's test as indicated in the figure legends (* p < 0.05, ** p < 0.01, *** p < 0.001, and **** p < 0.0001)." ] },{ "paper_id": "1697f41650571796c51a52e8f5412d293f620c79", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All FilmArray Respiratory Panel reagents were purchased using Collaborative Research Grant Funds supplied by the Department of Laboratory Medicine and Pathology at Mayo Clinic.", "All statistical analysis was done using comparison of proportions online chi-squared calculator (https://www.medcalc.org/calc/comparison_of_ proportions.php)." ] },{ "paper_id": "1699f74dc5e3e5ee7417778d18f7f5a46fb7c879", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Both ERAV and ERBV are associated with respiratory diseases in horses and are therefore primarily found in nasal, nasopharyngeal and oral secretions [3] [4] [5] [6] . Infected horses develop fever, anorexia, nasal discharge, cough and lymphadenitis. These respiratory diseases in horses are of particular importance because of their effect on", "Real-time quantitative RT-PCR showed that the amount of ERBV RNA in the four positive samples ranged from 8.28 \u00d7 10 3 to 5.83 \u00d7 10 4 copies per ml of fecal sample (Table 1) .", "Viral RNA was extracted from the fecal samples using EZ1 Virus Mini Kit v2.0 (Qiagen, Hilden, Germany). The RNA was eluted in 60 \u03bcl of AVE buffer (Qiagen, Hilden, Germany) and was used as the template for RT-PCR." ] },{ "paper_id": "169ca2aef2c810471d33aa6522aa25a70594ae26", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Mallard ducks are", "Chickens have a single polymorphic Mx gene with variable, but mostly weak anti-influenza activity that depends on chicken breed [235, [242] [243] [244] [245] . Schusser and colleagues showed that chicken Mx lacks GTPase activity [245] . It was previously shown that mutations disrupting GTP binding and GTPase activity also disrupt the antiviral activity of Mx, and it was assumed that GTP hydrolysis was necessary for antiviral function [228] . A more recent structural analysis found that MxA oligomerization is critical for viral nucleoprotein sequestration, and that GTP binding, but not necessarily hydrolysis, stabilizes MxA multimers [246] . In fact, MxA oligomerization reduced the rate of GTP hydrolysis, and antiviral activity was preserved when MxA bound a synthetic GTP analog that could not be hydrolyzed.", "Ensembl ID" ] },{ "paper_id": "16a04dc7659daf72dfd1706f843b74d691048b6f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data are shown as the means \u00b1 SD of three independent experiments done in triplicate. For each assay, student's ttest was used for statistical comparison. A value of P < 0.05 was considered significant.", "Mouse monoclonal antibodies against cyclin A, GRP78, NF-\u03baB p65, \u03b2-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, Inc., CA, US). Porcine anti-PEDV polyclonal antibody was kindly provided by China Animal Health and Epidemiology Center (Qingdao, China). Mouse anti-GFP monoclonal antibody was purchased from Millipore (USA), Horseradish peroxidase (HRP)-conjugated secondary antibody was purchased from Pierce (Pierce, Rockford, IL, US). The MG132 proteasome inhibitor was purchased from Calbiochem (USA) and the nuclear staining dye Hoechst33342 and ER-Tracker\u2122 Red probe were obtained from Invitrogen (USA).", "Cells were harvested and washed with ice-cold PBS, then treated with ice-cold RIPA lysis buffer with 1 mM phenylmethyl sulfonylfluoride (PMSF). Cell lysates were centrifuged at 12 000 \u00d7 g at 4\u00b0C for 10 min. Protein concentrations were measured using BCA Protein Assay Reagent (Pierce, Rockford, IL, US). Equivalent amounts of proteins were loaded and electrophoresed on 8-12% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Subsequently, proteins were transferred to polyvinylidene difluoride (PVDF) membranes (Millipore Corp, Atlanta,GA, US). The membranes were blocked with 5% nonfat dry milk at room temperature for 1 h, and then incubated with indicated primary antibodies over night at 4\u00b0C, followed by HRP-conjugated secondary antibodies at room temperature for 1 h. The signal was detected by enhanced chemiluminescence (ECL) reagents (Pierce, Rockford, IL, US)." ] },{ "paper_id": "16ab54289da4d53548b4cf171a642e19fd81e660", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "16c14c63746634d9cc1a2d4257b7d7560af187ba", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All experiments were performed in triplicate unless noted otherwise. Statistics, noted where applied, were performed in Microsoft Excel and GraphPad Prism. P-values.0.05 were considered non-significant (ns).", "Mammalian cell lines Vero, HeLa, and BHK-21 were maintained in DMEM (Gibco) supplemented with 10% newborn calf serum (NCS, Gibco) and 1% penicillin-streptomycin (P/S, Sigma), at 37uC with 5% CO 2 . Mosquito cell lines C6/36 and U4.4 (Aedes albopictus) and Aag2 (Aedes aegypti) were grown in L-15 media, supplemented with 10% fetal bovine serum (FBS, Gibco), 1% P/S, 1% tryptose phosphate, and 1% non-essential amino acids (NEAA), at 28uC with 5% CO 2 . Drosophila melanogaster S2 cells were grown in Schneider's Drosophila media (Gibco), supplemented with 10% FBS, 1% L-Glutamine, and 1% P/S at 25uC.", "Antimutator and mutator variants are valuable tools to study where the threshold of advantageous polymerase error exists for viruses facing different selective pressures. In this respect, arboviruses represent a special evolutionary position due to their need to replicate in disparate hosts, which is accompanied by distinct selective pressures. Arbovirus fitness is not necessarily reduced due to obligate host-cycling (alternating passages of CHIKV did not limit viral fitness), yet it has been shown that evolvability may be reduced due to these evolutionary constraints [33, 34, 35, 36, 37, 38] . For alphaviruses, evidence suggests that viral diversity is most restricted in the insect host, due to more stringent population bottlenecks and selective pressures [33, 34, 35, 37, 39, 40] . Since minority variants are thought to play important roles in arbovirus pathogenesis, transmission, and emergence [25, 41, 42, 43, 44, 45] , the implications of altered polymerase fidelity and mutation rates merit further study. Recently, this question was partially addressed using a chikungunya virus antimutator variant [25] ." ] },{ "paper_id": "16eb672447620efa83aa59f913d690a95240f488", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Recent results indicate that PTX3 has therapeutic activity in chronic lung infections by Pseudomonas aeruginosa, a major cause of morbidity and mortality in cystic fibrosis (CF) patients. Treatment with recombinant human PTX3 causes enhanced clearance of bacteria from the lungs of chronically infected mice, reduced production of local pro-inflammatory cytokines and chemokines, www.frontiersin.org neutrophil recruitment in the airways and histopathological lesions. Also in this condition, the PTX3-dependent recognition and phagocytosis of Pseudomonas aeruginosa involves the interplay with complement and Fc\u03b3Rs (Moalli et al., 2011b) .", "C-reactive protein and SAP are the main acute-phase reactants in human and mouse, respectively. CRP is barely detectable in the plasma of healthy human adults (\u22643 mg/l) but its concentration increases by as much as 1000-fold in several pathological conditions. As opposed to this, the concentration of human (but not murine) SAP is substantially invariant (30-50 mg/l), even during the early acute-phase response. Human CRP and SAP are both produced by hepatocytes, where the pro-inflammatory cytokine IL-6 is a major inducer of CRP both on its own and in synergy with IL-1 (Pepys and Hirschfield, 2003) .", "As a consequence, these data point to a critical role of glycosylation in the modulation of PTX3 functions. It has been suggested that PTX3 can act as double edged sword. Following binding to microbial moieties, it has opsonic activity, activates complement and enhances leukocyte recruitment. On the other hand, PTX3 per se can act as a regulatory molecule of innate immunity and inflammation by dampening excessive neutrophil recruitment. This latter activity in particular is clearly dependent on PTX3 glycosylation .", "Here we review past and present literature on this family of proteins, with major emphasis on the long pentraxin PTX3 and the glycan-dependent mechanisms underlying its functions in pathogen recognition and crosstalk with other components of the innate immune system." ] },{ "paper_id": "16f4fcc0f008c01ee4711085e070b3dcb17040d4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Herpesviruses (HVs) infect a wide variety of vertebrate hosts including mammals, birds, reptiles, amphibians and fish, and at least one invertebrate group, bivalve molluscs. HV share a characteristic virion structure, which consists of a large, linear, double-stranded DNA genome, an icosahedral capsid, a proteinaceous matrix (the tegument) and an envelope containing viral proteins [129] .", "Upon transmission to a new host species, viruses must usually adapt to a new genetic and immunologic environment in order to replicate and spread to other individuals within the species [1] . The high rates of mutation and replication of RNA viruses, such as human immunodeficiency virus (HIV) and influenza, facilitate the occurrence and fixation of those mutations that become beneficial under certain conditions [2] . Viral adaptations to new hosts primarily manifest as amino acid substitutions which can allow more efficient virus cell entry into the new host [3, 4] , block interactions with detrimental host proteins [5, 6] or promote escape from both the new and the old host's immune responses [7, 8] .", "The authors declare that they have no competing interests." ] },{ "paper_id": "16fb795aec2acb8b86ddac119772abde6392d40f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "16ffa1f7efaf96880e6f3c22d2de9c5672169303", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Each\u00d1 i is calculated using N 0 , N 1 , \u2026, N i21 . Then the one-stepahead residuals are calculated as", ". .", "We present these residuals averaged over the T days observed." ] },{ "paper_id": "1703fbc6de47798061e7ec8d87182906fedab8e3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Study approval. The Institutional Review Board at King Faisal Specialist Hospital and Research Center, Jeddah (KFSHRC-J), KSA, approved the study. Written informed consent was obtained from all study participants.", "Clinical information. CW demographic and clinical data were obtained by one of the corresponding authors (A. N. Alagaili) at the time of blood collection, using a written questionnaire.", "Statistical analysis. Fisher's exact test was used to compare differences between groups, with P values of \u03fd0.05 considered statistically significant.", "We report no conflicts of interest." ] },{ "paper_id": "170f0a7070650e42066d011135cc9e9d9f931223", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "170fc4f86244f8f795de48b349db6759add5a834", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "\"EIDs have always been here around us. They are always here. It is just the trend of the infection that differs from time to time; that is, a strain of EID is dominant at this time, then another strain will take its place and become dominant later.\" (P15)", "(1) familiarizing with data; (2) developing initial codes;", "To access data for further analysis, please contact the Corresponding Author via stanleylam@twc.edu.hk.", "\"Whenever there are changes in the alert level, for example, the level has been stepped up from Alert to Serious this month, there have been some corresponding modifications to our practice in workflow and disease prevention. I would then realise the situation is getting worse, and I am in greater danger.\" (P4)" ] },{ "paper_id": "1713f0cf6cf8f5e4134cb4b78d5ab4d2c3cc8791", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Our Institutional Research Ethics Board has approved this case report, and the need for informed consent has been waived.", "A 41-year-old female presented ambulatory to the Emergency Department at 11:41 PM with a 3-week history of feeling generally unwell. She complained of severe myalgias, chills, and a fever two days earlier. She had been unable to go to work for the previous 4 days due to her illness.", "Her investigations were significant for acute renal failure with a creatinine of 214 umol/L. Her white blood cell count was 7.2 \u00d7 10 9 /L, hemoglobin was 130 g/L, and platelets were slightly decreased at 115 \u00d7 10 9 /L. Her lactate was 1.5 mmol/L, and her venous blood gas showed a mild compensated metabolic acidosis with a ph of 7.32, a CO2 of 39 mm Hg, and a HCO3 of 20 mmol/L. Her urine b-HCG was negative. Liver function studies and liver enzymes were not performed on initial presentation." ] },{ "paper_id": "17192bd07c09aa9e70552f7f15f90f0a6b8180c6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "To address these issues, we asked the following questions:", "Third, we manually checked overlapping genes, after having selected a single representative virus species per genus. Briefly, during this step, we identified 124 independent, putatively expressed overlaps out of 1207, and discarded 1016 homologs; we also excluded 114 other overlaps, being truncated forms of overlaps already considered. During the process of manual curation (see below), we then removed 72 overlaps out of the 124 initially identified, coming to a total of 52 proven overlaps.", "In 2 overlaps, the interaction affects the virus replication. In influenza A virus, the F2 protein interacts with PB1, regulating its polymerase activity [74] . Likewise, in Sesbania mosaic virus, the RdRp domain of polyprotein P2ab shows an increased polymerase activity when interacting with the p10 domain of polyprotein P2a [75] ." ] },{ "paper_id": "1731adb9524645ed8e10be851313f796f82459c0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Coronaviruses (CoVs) are enveloped viruses with large positive-sense single-stranded RNA genomes. CoVs infect a variety of mammalian and avian species, and can cause serious disease in humans, as exemplified during the 2002-2003 outbreak of the severe acute respiratory syndrome (SARS).", "It is now clear that the CoV E protein has multiple functions during infection, although they are not clearly understood. Also, the role(s) for the E protein in different CoVs may not be identical. A comprehensive model of E protein function will provide a better understanding of CoV biology and the mammalian secretory pathway, and may provide a target for therapeutic intervention during CoV infection.", "bending scission A.", "Understanding the protein-protein interactions of CoV E is an important step in elucidating the functions of the protein. Since the sequences of the E proteins are quite divergent, it will be interesting to determine if different CoV E proteins interact with the same host proteins, or are able to elicit a similar effect through interactions with other proteins." ] },{ "paper_id": "17334b138ba80214847f144ebc57ce27ff9c23cf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "On establishing the diagnosis of melanoma, the patient refused chemotherapy or surgery for lack of money. He died two months later. ", "His complete blood count showed a mild anemia level of hemoglobin 9.8 g/dL and mild leukocytosis with a white blood cell count of 10.46 \u00d7 109/L and neutrophils at 7.72 \u00d7 109/L. Metabolic panel was normal except for a serum potassium level of 2.89 mmol/L. Serum tumor markers, including CEA, SCC, CYFRA21-1, NSE, AFP, CA19-9, and CA72-4, were all normal. Serum antinuclear antibody test, anti-neutrophil cytoplasmic antibody test, thyroid function test, erythrocyte sedimentation rate, and T-SPOT were also all negative, as were tests for hepatitis, syphilis, and HIV. Serum lactate dehydrogenase was not detected. A pulmonary function test showed that his pulmonary ventilation function and diffusing capacity for carbon monoxide (DLco) were in normal reference ranges. Fractional exhaled nitric oxide concentration was 3.6 ppb.", "The authors declare that they have no competing interests.", "Written informed consent was obtained from a direct relative of the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the editor of this journal." ] },{ "paper_id": "173ce92cbc6f228d5bfbdbd7ba7137523ebe36bd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "17413f651645c2b9c92555e9ce1404b9290eccab", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Hen eggs: Hen eggs were purchased from Valo BioMedia, Germany. At 48 h after inoculation with virus, the eggs were euthanized by an overnight incubation at 4\u02daC and the allantoic fluid was harvested. According to \" \u00a7 14 TierSchVersV-Geltung f\u00fcr Tiere in einem fr\u00fchen Entwicklungsstadium\" experiments conducted before the last third of the development of the animal commences do not require approval.", "Human lung: Human lung explants were obtained from patients who underwent lung resection for cancer or pulmonary hypertension at hospitals in Hanover, Germany (Hannover Medical School, Klinikum Siloah/ Nordstadt). All patients gave written consent. The experimentation with human lung tissue was approved by the ethics committee of the Hannover Medical School and Klinikum Region Hannover. Only lung tissue containing no tumors as qualified by medical pathologists was used for the experiments. Tissue was processed immediately on the day of resection.", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "NHP lung: All animal work was conducted according to relevant national and international guidelines, in particular EU directive 2010/63/EU and the German animal protection law. The Animal Welfare and Ethics Committee of the German Primate Center approved the entire study and use of lung material from NHPs. Lungs originated from rhesus macaques (Macaca mulatta), cynomologus macaques (Macaca fascicularis) and common marmosets (Callithrix jacchus) of the German Primate Center. Animals were euthanized by an authorized veterinarian for animal welfare reasons, i.e. suffering from severe trauma after aggressive group conflicts, automutilation or marmoset wasting syndrome. Before euthanasia, animals were deeply anaesthetized using a combination of ketamine (Ketavet1, Pfizer) and xylazine (Rompun1, Bayer). Macaques were then euthanized by a lethal dose of sodium pentobarbital (Narcoren1, Merial GmbH) given intravenously. Marmosets were euthanized by a lethal dose of sodium pentobarbital (Narcoren1, Merial GmbH) given intracardially. Only animals with a healthy respiratory system were included in the study." ] },{ "paper_id": "176274e5fb44083ebc8c91d87e013d624533c7f6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The bioinformatics approaches and rationale for the methodology adopted in this study have been previously described [20] and are summarized in Figure 1 .", "The global approach described herein provides a framework and methodology for large-scale and systematic analysis of conserved sequences of other pathogens, in particular for rapidly evolving viruses such as influenza A virus [75] and HIV [63] . These studies will offer insights into their diversity and evolutionary history, together with providing critical data for rational vaccine development, structure-based design of candidate inhibitory compounds, and improvement of the current diagnostic methods. ", "Background: Genetic variation and rapid evolution are hallmarks of RNA viruses, the result of high mutation rates in RNA replication and selection of mutants that enhance viral adaptation, including the escape from host immune responses. Variability is uneven across the genome because mutations resulting in a deleterious effect on viral fitness are restricted. RNA viruses are thus marked by protein sites permissive to multiple mutations and sites critical to viral structure-function that are evolutionarily robust and highly conserved. Identification and characterization of the historical dynamics of the conserved sites have relevance to multiple applications, including potential targets for diagnosis, and prophylactic and therapeutic purposes." ] },{ "paper_id": "1763110ecc1742f6158f410a0c4f0b923118fd79", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Mouse embryonic fibroblasts (MEFs) deficient in Pik3cg were prepared as described [27] and maintained in DMEM (Sigma, St.", "AlexaFluor488-or AlexaFluor546-labeled dextran (Mr 10610 3 ), AlexaFluor546-labeled transferrin, LysoTracker Red, Alexa-Fluor594-conjugated anti-mouse antibody, and AlexaFluor647conjugated anti-rat or anti-mouse antibody were purchased from Invitrogen (Carlsbad, CA). LY294002 was obtained from Calbiochem (San Diego, CA). An antibody to EEA-1 was purchased from BD Bioscience (San Jose, CA), that to HA was from Roche, that to Ras was from Oncogene Research Product (Cambridge, MA), that for b-actin was from Santa Cruz Biotechnology (Santa Cruz, CA), and those to phospho-Akt and Akt were from Cell Signaling Technology (Danvers, MA). The anti-NP antibody was a kind gift from A. Takada (Hokkaido University, Sapporo, Japan)." ] },{ "paper_id": "1771673809c10324fde2768ce37d548a5077577f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Plasma Flavonols, Metabolites and Hormones. Plasma concentrations of flavonols (quercetin, isorhamnetin, tamarixetin and kaempferol) were measured via HPLC as previously described [26] with a detection limit of 2 nmol/L and a recovery rate of 92 \u00b1 2%. The intra-and inter-assay coefficients were 0.5 and 7.2%, respectively. Plasma metabolites were analyzed using an automatic spectrophotometer (ABX Pentra 400; Horiba ABX, Montpellier, France) and respective kits: glucose (#A11A01667), lactate (#A11A01721), albumin (#A11A01664) and triacylglycerides (#A11A01640) from HORIBA ABX, Montpellier, France; total protein (#553-412) and cholesterol (#553-127) from mti-diagnostics, Idstein, Germany; urea (#LT-UR 0010) from Labor+Technik, E. Lehmann, Berlin, Germany; and non-esterified fatty acids (#434-91795, #436-91995) from WAKO Chemicals, Neuss, Germany.", "Effects and differences were considered significant at P < 0.05.", "Experimental procedures were conducted in compliance with the German Animal Protection regulations with approval of the authorities of the state Mecklenburg-Western Pomerania, Germany (Landesamt f\u00fcr Landwirtschaft, Lebensmittelsicherheit und Fischerei Mecklenburg-Vorpommern; LALLF M-V/TSD/7221.3-1.1-044/12). Liver biopsies were performed under local lidocaine anesthesia and all calves received metamizole post-operatively for pain relief.", "The ban on antibiotic performance promoters by the European Union in 2006 increased efforts to establish natural alternatives to enhance health and productivity in breeding. Special focus has been directed to phytochemicals because their use can be manifold according to the respective compound [10] . Flavonoids are secondary plant metabolites that are widely distributed in the plant kingdom and are able to modulate inflammation and immune function and exert antioxidative activity [11] [12] [13] ." ] },{ "paper_id": "17752cd197628ca49a7b800528bdd68532e4a148", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: Entry of Severe Acute Respiratory Syndrome coronavirus (SARS-CoV) and its envelope fusion with host cell membrane are controlled by a series of complex molecular mechanisms, largely dependent on the viral envelope glycoprotein Spike (S). There are still many unknowns on the implication of cellular factors that regulate the entry process.", "Ezrin is present at the site of entry of Spike-pseudotyped lentiviral particle", "The African green monkey kidney Vero E6, human embryonic kidney (HEK) 293T, human cervix carcinoma HeLa cell lines (ATCC, Manassas, VA, USA), and HeLa-F5, which stably express ACE2 [10] , were used in this study.", "S endodomains are accessible to cellular machineries i/ during production, maturation, trafficking, and assembly of viral envelope proteins (pre-budding steps), and ii/ at a critical stage of virus entry, just after formation of the fusion pore, and after fusion. We hypothesized that during these crucial stages of infection, interactions between the S endodomain and cellular machineries could participate in regulating infectivity and host cell susceptibility to infection.", "For lentiviral pseudotyped particles (pp) production, the pNL4.3.Luc R + E 2 lentiviral vector, a gift from Dr. Pierre Charneau (Institut Pasteur, Paris), was used [59] . The pCI-VSVG plasmid encodes the sequence for vesicular stomatitis virus (VSV) G glycoprotein cloned in the pUC19 vector and was kindly provided by Dr. Garry Nolan (Stanford University, USA). pEGFP-Vpr, a pEGFP-C1 derived plasmid enabling fusion of HIV Vpr to GFP [60] , was used to produce fluorescent GFP-Vpr SARSpp. The pcDNA-optSD8 and pCDNA-optSD8-C1 plasmids, which contain full-length optimized SARS-CoV S genes with D8 or D8 with C1 cysteine to alanine substitutions at the C-terminus respectively were synthesized and cloned by GeneCust (Dudelange, Luxembourg)." ] },{ "paper_id": "17787dbfbb012b537726971936c74cab0aa701b1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Contemporary data on immunological, haematological and viral responses and predictors of reported therapeutic failure after initiation of free antiretroviral treatment in Cameroon were collected to evaluate existing treatmentmonitoring algorithms and to complement efforts to scale-up and improve the management of HIV/AIDS [20] .", "The categories", "A sum-up with respect to authorship reveals a total of 97 contributing scientists. Most of them contributed to a single piece (n = 90, 92.8 %), while the remaining seven authors were engaged with two or more articles, up to a maximum of four contributions [8, 11, 17, 26] .", "Four research articles discuss the role of governments in disease endemic-countries and encourage cooperation in the field of zoonotic diseases [13, 15, 18, 26] . Another investigation highlights the collaboration between various governmental ministries as well as among medical and veterinary doctors by employing the \"One World -One Health\" concept [14] ." ] },{ "paper_id": "177c9a5fa045b94ea25f72ab17240cdb82585946", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: People 65 years or older are at greater risk of serious complications from the seasonal influenza compared with young. To promote elderly people's behavioral compliance toward influenza prevention, the aim of the current project is to develop, implement, and evaluate a theory-based low-administration-cost intervention building on a leading psychological theory, the Health Action Process Approach (HAPA).", "Given the links the research team has established with the elderly centers (including District Elderly Community Centers, Neighborhood Elderly Centre) in our previous projects, we will make contacts (i.e., phones, emails, and faxes) with center-in-charges and employ their support in championing recruitment to the study. We plan to recruit participants who are registered as members of the elderly centers at the three main territories of Hong Kong (i.e., Hong Kong Island, Kowloon, and New Territories)." ] },{ "paper_id": "178363fb71ad0ae91e621e6e51fc03bb521f5695", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Enhanced version: This article can also be viewed as an enhanced version (http://plosone.org/enhanced/pone.0007165/) in which the text of the article is integrated with interactive 3D representations and animated transitions. Please note that a web plugin is required to access this enhanced functionality. Instructions for the installation and use of the web plugin are available in Text S1.", "Selenomethionine (SeMet) labelling of the protein was carried out using prepacked M9 SeMet growth media kit (Medicilon) following manufacturer's instructions.", "The ligand-free form crystals were grown at room temperature in sitting drops. A final concentration of 5 mM ADP, 1:100 chymotrypsin (w/w) were added into the protein stock solution and 0.5 mL protein solution was mixed immediately with 0.5 mL well solution containing 15% polyethylene glycol (PEG) 4000, 0.2 M ammonium acetate, 0.1 M sodium citrate, pH 5.6 and set up for vapour diffusion crystallization. The SeMet crystal used for structure determination was grown in 14.55% PEG4000, 0.2 M ammonium acetate, 0.1 M sodium citrate, pH 6.0, with 1:100 chymotrypsin (w/w) and 5 mM ADP in a sitting drop setup. Crystals grew to a mountable size within 24 hours. Paratone oil was used to cryo-protect the crystals." ] },{ "paper_id": "17889315db35509927f4fd1fb1d656b800365377", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "No contact developed TB disease after contact with a TB case on an airplane.", "This level of risk is consistent with published data (0-4%) from 1993 to 2008 [10, [21] [22] [23] but much lower than the risk reported in the early 1990s (30%) [24, 25] .", "A binomial estimation of the 95% confidence intervals (CI) was performed using R software (Version 3.01, The R Foundation for Statistical Computing, Vienna, Austria) to compare the IGRA positivity between the age groups." ] },{ "paper_id": "179338a972eb486bae25e1898b54441c7534e0b2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Combating antimicrobial resistance (AMR) is a national and international priority. The U.S. National Institutes of Health [1] , Center for Disease Control [2] , World Health Organization [3] , and United Nations [4] have prioritized the issue. On Sept. 18, 2014 former President Barack Obama issued AMR-focused Executive Order 13676 [5] , which was followed by a National Action Plan for Combating Antibiotic Resistant Bacteria [6] .", "Primers F1 and R1 (Table 1) were combined at a final concentration of 176 nM with control DNA (MGAS10394) dilutions at indicated concentrations, in 1X PowerSYBR (ThermoFisher Cat # 4367659) and run on an Agilent Stratagene Mx3005P. We used a 2-step program with 40 cycles of 30 s at 95\u00b0C and 1 min at 60\u00b0C. The total program time was 2 h 16 min.", "For specificity testing, human DNA was derived from primary adipose-derived cell line ASC080414A (commercially obtained from Zen-Bio, Raleigh, NC) cultured in a humidified 5% CO2 incubator at 37\u00b0C. The growth media consist of Dulbecco's Modified Eagle Medium (DMEM, ThermoFisher # 11965118) supplemented with 10% fetal bovine serum (ThermoFisher # 10082147), 1X Penicillin / Streptomycin (ThermoFisher # 15140122), and 1X Glutamax (ThermoFisher #35050061), changed every 3 days. Total DNA was purified using the Nucleospin Tissue kit (Macherey-Nagel, D\u00fcren, Germany) and quantified on a Qubit Fluorometer (ThermoFisher), which was also used to measure bacterial DNA liberated in crude lysates." ] },{ "paper_id": "17a425d3e66241ada9c347aa0e0387231be31dcd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The chemical analysis was performed on an Agilent RRLC 1200 series system (Agilent) equipped with a degasser, a binary pump, an auto-sampler, a DAD and a thermostated column compartment. The herbal extract was separated on an Agilent ZORBAX SB-C18 column (1.8 mm, 4.6650 mm) . An Agilent QQQ-MS/MS (6410A) equipped with an ESI ion source was operated in negative or positive ion mode. The drying gas temperature was 325uC; drying gas flow: 10 L/min; nebulizer pressure: 35 psig; capillary voltage: 4000 V; delta electro multiplier voltage: 400 V. Ten mL (after a 0.45 mm Millipore filter) samples were injected. In a negative mode, a linear gradient elution was applied from 15-20% B at 0-3 min, 20-30% B at 3-8 min, 30-40% B at 8-14 min, 40-75% B at 14-18 min, 15-15% B at 18.5-22 min. In a positive mode, a linear gradient elution was applied from 10-35% B at 0-5.5 min, 35-65% B at 5.5-6 min, 65% B at 6-10 min, 65-80% B at 10-14 min, 10% B at 14.5-18 min. Agilent Mass Hunter workstation software version B.01.00 was used for data acquisition and processing.", "The phagocytic capability of cultured macrophages was measured by using the Vybrant Phagocytosis Assay Kit (Molecular Probes, Eugene, OR). Macrophages (10 5 /well) were incubated with fluorescein-labeled E. coli K-12 bio-particles and intracellular uptake was quantified by measuring fluorescence emitted by engulfed particles. Extracellular fluorescence was quenched by trypan blue. The trypan blue was then removed, and the amount of bio-particles engulfed by the cells was quantitatively measured using Spectra Max Gemini EM ELISA plate reader at 480 nm excitation and 520 nm emission.", "RAW 264.7 murine macrophages (American Type Culture Collection, Manassas, VA) were cultured in high-glucose Dulbecco's Modified Eagle's medium supplemented with 100 U/mL penicillin/streptomycin, 10% heat in-active fetal bovine serum (all from Invitrogen). The density of Raw 264.7 cells in 24-well plate was 5,000/well. Cells were incubated under 5% CO 2 at 37uC for 24 hours before the transfection. pNF-kB-Luc was transfected to cultured RAW 264.7 macrophages by Lipofectamine 2000. Twently-four hours later, the transfected cells were challenged with different herbal extracts. The transfection efficient was over 80%, as determined by another control plasmid of having a bgalactosidase, under a cytomegalovirus enhancer promoter. -39 and 59-AGG TTG ACT TTC TCC TGG-39 for murine TNFa (251 bp; NM_013693) ; The GAPDH was used as an internal control in all cases, and its primer sequences were 59-AAC GGA TTT GGC CGT ATT GG-39 and 59-CTT CCC GTT CAG CTC TGG G-39 (657 bp; NR_0215885). SYBR green signal was detected by M63000ptm multiplex quantitative PCR machine (Stratagene, La Jolla, CA). Transcript levels were quantified, where the values of target genes were normalized by GAPDH expression in the same sample at first before comparison. The PCR products were analyzed by gel electrophoresis and melting curve analysis to confirm the specific amplification.", "After transfection with the luciferase reporter gene construct and drug treatment for 24 hours, the cells were stored frozen in 280uC, or solubilized in lysis buffer (100 mM potassium phosphate buffer, pH 7.8, containing 1 mM DTT) immediately and transferred into 1.5-mL eppendorf tubes. After vortex for 10 min in 4uC, the lysates were centrifuged in 13,2006g for 5 min in 4uC. Sixty mL of the cell lysates was transferred to the assay plate and set on the luminance reading machine (FLUOStar OPTIMA, Germany), which would automatically add luciferase reagent A and B (Invitrogen) into the lysates, and activated the luciferase activity. The readings of luminance intensity were equalized by the protein concentration of lysates, and the data indicated to the luciferase activities of the samples." ] },{ "paper_id": "17a5402664095260470c65dee52c38311b3ea399", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Critical to successful outbreak prevention and management is recognizing the need to identify, test, and employ biosafety and biosecurity measures that are sustainable and adoptable in local conditions, account for local infrastructure, laws, and social structure, and prevent accidental and deliberate release of studied pathogens. Outbreak investigations for Ebola virus, Middle East Respiratory Syndrome coronavirus (MERS-CoV), and SARS-CoV demonstrated the need for locally effective biosafety measures that protect healthcare workers, diagnostic laboratory workers, and animal health workers from exposure to the outbreak viruses, and biosecurity measures that prevent access to pathogens by malicious actors. Applied research may identify measures that enhance current risk management efforts, such as laboratory and clinical biosafety, biosecurity, and biorisk management.", "Approaches for improving communication between researchers and policy-makers, the funding landscape, and open access policies could help promote research that addresses key knowledge gaps in health security policy and practice, and translate funded research to global health decision-making.", "Although these results often are published in academic literature, decision-makers may not be aware that the studies exist, may not have access to the publication or the information contained therein, may not know how best to integrate the information into their decision-making processes, and/or may prefer to rely on scientific studies conducted by government, rather than non-governmental, researchers. Therefore, the existence of research, biosurveillance platforms, and official reporting mechanisms for infectious disease events does not necessarily indicate that these activities intersect and inform each other.", "The 2014-2016 West-African Ebola virus disease (EVD) outbreak reinforced the concept that a major pathogen outbreak in one country can affect other countries throughout the region and world, and highlighted the aforementioned gaps in leveraging existing knowledge and practices to facilitate outbreak response [13, 14] . This outbreak demonstrated that urban settings, socio-cultural traditions, and local migration affect outbreak dynamics. These lessons, along with the development and use of an experimental Ebola virus vaccine, contributed to very different responses in the 2018 outbreaks in the Democratic Republic of Congo (DRC) [15] . However, conflict and an unsafe public health response environment in the DRC towards the end of 2018 and into 2019 have led to a significant increase of known cases to over 1000 [16] . As long as the security situation ensues, the number of cases will continue to increase and the ability of researchers to collect information about circulating strains will be hampered." ] },{ "paper_id": "17a5e67e3855ae5fa7d1a711f3249b6813c28386", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Human melanoma cells (MeWo [61] , from Charles Grose, University of Iowa) and fibroblast cells (MRC-5, American Type Culture Collection, Manassas, VA) were grown in Minimum Essential Medium with 10% fetal bovine serum (FBS). HeLa cells (American Type Culture Collection) were maintained in Dulbecco's Modified Eagle Medium with 10% FBS. SF9 or H5 (Spodoptera frugiperda) insect cells were cultured in TNM-FH medium (BD Biosciences Pharmingen, San Diego, CA).", "Expression and purification of polyhistidine-tagged human wildtype (IDE-w.t.) and mutant (IDE-E111Q) IDE proteins in E. coli were performed as previously described [12] with minor modifications. Briefly, plasmids pProEX-IDEwt and pProEX-IDE-E111Q [12] were propagated in E. coli Rosetta (DE3) cells and protein expression was induced with isopropyl-1-thiogalactopyranoside at a final concentration of 200 mM for 16 hrs. The cells were then lysed in RIPA buffer (10 mM Tris-HCl, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.1% NP40, 0.5% deoxycholic acid, 0.5% SDS), and polyhistidine-tagged IDE was purified through a Talon metal affinity column (Clontech, Mountain View, CA), eluted with 250 mM imidazole, and dialyzed overnight in PBS at 4uC.", "Insect SF9 cells were infected with a recombinant baculovirus expressing the extracellular domain of VZV gE with a C-terminal (histidine) 6 tag [64] . Three days after infection, tissue culture supernatant was harvested and gEt protein was purified through a Talon metal affinity column (Clontech, Mountain View, CA)." ] },{ "paper_id": "17b715fd64ea139c0ed35b555de365b47585da64", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nipah \u00b7 MERS-CoV \u00b7 Chikungunya \u00b7 Rift Valley fever \u00b7 CEPI ", "Bundesgesundheitsbl 2020 \u00b7 63:65-73 https://doi.", "Today's world is characterized by increasing population density, human mobility, urbanization, and climate and ecological change. This global dynamic has various effects, including the increased appearance of emerging infectious diseases (EIDs), which pose a growing threat to global health security. Outbreaks of EIDs, like the 2013-2016 Ebola outbreak in West Africa or the current Ebola outbreak in Democratic Republic of the Congo (DRC), have not only put populations in lowand middle-income countries (LMIC) at risk in terms of morbidity and mortality, but they also have had a significant impact on economic growth in affected regions and beyond.", "Coalition for Epidemic Preparedness Innovation (CEPI) Marcus Thranes Gate 2, 0473 Oslo, Norway gunnstein.norheim@cepi.net" ] },{ "paper_id": "17b8edaf62be1b907bf750a94c4b881f3db1f7be", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The authors declare that they have no competing interests." ] },{ "paper_id": "17bbe32558609da8c1aceab2b751383aa9c3c18b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A detailed understanding of the functional roles of P. falciparum novel merozoite antigens, their localization, and their fate during invasion is critical to the identification of targets of host immunity and prioritization of merozoite antigens for inclusion in blood-stage malaria vaccines.", "The C-terminal \u03b1-PfSRA human antibodies (\u03b1-PfSRA P3) were affinity-purified from plasma samples of malaria-exposed children as described previously [19] .", "Immunofluorescence microscopy was carried out using P. falciparum (3D7)-infected erythrocytes smeared onto glass slides and fixed in prechilled methanol for 30 minutes. Fixed erythrocytes were permeabilized using 0.1 % Triton X-100 formulated in phosphate-buffered saline. Nonpermeabilized, liquid immunofluorescence assay (IFA) was carried out as described previously [22] . After the washing step for both IFA conditions, the slides were blocked for 1 hour in PBS containing 3% bovine serum albumin. Slides were probed with primary and secondary antibodies for the respective antigens and mounted in vectashield (Vector Laboratories Inc) supplemented with 4\u2032,6-diamidino-2-phenylindole for staining the nucleus. Fluorescence microscopy was performed on an Olympus fluorescence microscope (BX41). Images captured were processed using the open access Fiji-Image J software (National Institutes of Health).", "To identify new blood-stage proteins as potential vaccine candidates, a systematic screening procedure was implemented. This included analysis of temporal gene expression relative to other well-characterized invasion-type genes and in silico interrogation of protein structural features. Once all of these selection criteria were ascertained, sequence alignment analysis was done to evaluate the conservation level of the target gene across the different Plasmodium species orthologs. Finally, we scanned the entire protein sequence using a current state-of-the-art online threading program to identify coiled-coil regions [15] ." ] },{ "paper_id": "17bcc640fec147856a5d625a1d17970429665b65", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Researchers conducting the experimental infection wore N-95 respirator masks, protective glasses and gloves when performing this procedure and throughout the entire study when they were accessing the pigs.", "Means and standard deviations from macroscopic and microscopic lung lesion scores were analyzed using ANOVA. The response variables that had a statistically significant effect (p \u2264 0.05) by treatment group were further analyzed through pair-wise comparisons using the Tukey-Kramer test. The analyses were performed using SAS (SAS System, SAS Inst., Cary, North Carolina, v 9.2).", "A triple reassortant H1N1 strain A/Sw/IA/00239/04 (IA04) belonging to the \u03b2 cluster used in previous studies [34] [35] [36] and isolated from field samples at the University of Minnesota Veterinary Diagnostic Laboratory was used for challenge. The IA04 influenza virus was grown in bulk quantities using Madin-Darby canine kidney (MDCK) cells using standard procedures [37] .", "Seeder pigs were infected intratracheally and intranasally with a total of 2 mL of the IA04 H1N1 challenge virus at a titer of 1 \u00d7 10 6 tissue culture infectious dose (TCID)50/mL. Before the inoculation, all piglets were sedated by an intramuscular injection of a dissociative anesthetic at the recommended dose of 6.6 mg/kg (Telazol \u00ae , Fort Dodge Animal Health, Fort Dodge, IA, USA)." ] },{ "paper_id": "17cfe7cc0c68b1002bb31a2b2afa988ab9cdc890", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Adenovirus (AdV) is a non-enveloped, double-stranded DNA virus, and is divided into five genera: Mastadenovirus, Atadenovirus, Ichtadenovirus, Siadenovirus, and Aviadenovirus. Recently, several novel members of Mastadenovirus were identified, and more than 40 species were registered in the International Committee", "Bat AdV-Mm32 Bat AdV-A Bat AdV-G Bat AdV-B Bat AdV-Vs9 Canine AdV1 Canine AdV2 Skunk AdV-A Equine AdV-A Human AdV-B Human AdV-E Human AdV-D Human AdV-C Human AdV-A Human AdV-F Bat AdV-C Tree shrew AdV-A Bovine AdV-B Ovine AdV-A Porcine AdV-C Bat AdV-F Bat AdV-D Bat AdV-E Murine AdV-A" ] },{ "paper_id": "17cff89c1672094997155613467334c9b1b410e8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Researchers have addressed concerns about plant-specific glycosylation by altering the pathway that plant cells use to process the recombinant protein.", "Current methods in plant biotechnology cannot precisely control the expression level of transgenes in plants in a consistent manner and not every plant species is readily transformed. This means that the amount of pharmaceutical produced may vary in each plant species, or even in different plant parts (i.e., leaves, fruit, and seeds). Levels of expression in subsequent generations may also vary. Given this scenario, it is very difficult to accurately quantify the appropriate dosage of edible vaccines for children and adult patients. Edible vaccines can also trigger immune tolerance after oral administration. Lastly, most of the ingested protein will be degraded by digestive processes. Collectively, these disadvantages greatly restrict the clinical use of edible vaccines [30, 32] .", "A primary objective of PMF is to reduce the cost of producing novel therapeutic proteins. Using PMF to create a vegetable, seed or fruit health supplement could be a practical alternative to using PMF to develop a processed pharmaceutical drug. [57, 58] expressed lumbrokinase, an anti-thrombotic enzyme from earthworm, in sunflower kernels. Mice and rats that were fed the transgenic kernels exhibited a strong degradation of blood clots [58] . Unlike a vaccine or a therapeutic protein, lumbrokinase has been widely sold and used as a health supplement to dissolve blood clots and maintain healthy cardiovascular function in people. This makes lumbrokinase a good candidate for PMF since, in general, health supplements do not need a medical prescription and have less regulations for commercialization [59] ." ] },{ "paper_id": "17d0d25ab7105e239f9d13e41489d01d9a40c34a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "17d4c1e70195453379ed6529851c51d204fdc926", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Five of the six bulls with paired serum samples either seroconverted (four) or had a strong increase in BRSV antibody level in percent positivity of at least 70 % (one). Two of the six bulls seroconverted for BCoV and two of them had a strong increase in antibody level for BPIV3. The seven animals tested were positive for BRSV on nasal swabs (five) and/or BAL samples (seven) by RTqPCR (Table 1) .", "Total no. of pos. 5/6 2/6 2/6 5/7 7/7", "The plot of mean AAW over time, comparing 2011-2012 date by date (Fig. 4) , showed that the AAW of 2011 started higher, then fell to a lower level and stayed below the control year level for many months. When the groups were compared with respect to average FCR as well as ADG, the 2011 group had poorer figures (Table 4 )." ] },{ "paper_id": "17d6161faae981aa6c56ac58d9c1d30ed581b05f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Four virus genome sequences containing IRES element were tested in IRSS " ] },{ "paper_id": "17d92d371f5552921b86de6fb6cd7e65344ddb2e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Informed consent was obtained from the participants of this study and the study protocol was approved by the institutional review board of Ajou University Hospital (AJIRB-SBR-SUR-15-287).", "Of the 8,242 participants in the community health survey in 2015, 7,281 people (88.3%) agreed to participate in the survey, from whom a total of 6,739 people (92.6%) were finally included, except 145 cases for which survey numbers were incorrect and 397 cases for which several data were missing." ] },{ "paper_id": "17dbd5741595c1e5b7508063b31147be9263e7f0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Human bronchial epithelial cells were isolated from patients (. ", "cell proliferation assay, the selective index for K22, i.e. the CC 50 / IC 50 quotient, was 157. Compound J15, although showing anti-HCoV-229E activity similar to that of K22 exhibited a somewhat less favorable cytotoxicity profile in the cell viability assay ( Figure S1B ).", "The ChemBioNet diversity library of 16671 compounds was obtained from the Leibniz Institute for Molecular Pharmacology (Berlin, Germany). Library was provided in a 384 well plate format, each well containing 5 ml of a compound solubilized in DMSO to a final concentration of 10 mM. Hit compound K22 was purchased from ChemDiv (San Diego, CA; catalog number 4295-0370). The correct structure and purity of K22 (.95%) was confirmed in our laboratory by NMR and LCMS analyses." ] },{ "paper_id": "17e4de7b95ed440d0df3a87e85e9fca8b64b0de7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Then we define the media function, g, as follows:", "_", "Following infection, individuals recover after T R time periods. Therefore, if X i t\u00c0 1 \u00bc S and X i t \u00bc I, then:" ] },{ "paper_id": "17ef76b6acdc223229e3a6ed236bed4c2fc0f811", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Author contributions-Y. L. and M. K. R. conceived the project. Y. L. designed and conducted the experiments. S. L. C. also conducted experiments. Y. L. and M. K. R. analyzed the data and wrote the manuscript, which S. L. C. helped revise." ] },{ "paper_id": "17fe16cf66ebbe693a2e75dda11d14513fec7519", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "To date, the implementation of market closures has been based on viral surveillance data relying on virus detection alone.", "This study was financially supported by the United States Agency for International Development (USAID) under grant number GHA-A-00-06-00001. ", "Four of the eight markets located on open streets. In these street markets, traders pay a daily market fee of about 3,000-5,000 VND 3 per trader. Some of these street markets are nearby to official, enclosed marketplaces that do not sell live poultry. One market is neither indoors nor on a public street, but on an area of barren land. When it rains, the ground turns to mud." ] },{ "paper_id": "1803065327394f7f38931024cd4219d47f5f7d8b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Viruses 2019, 11, x FOR PEER REVIEW 10 of 15", "Funding: Funding support came from NIH grants U19AI135995, AI132244, AI132223, U54 HG007480, U19 AI115589, U19AI142790, and contract HHSN272201400048C and grant INTU1901 from the Coalition for Epidemic Preparedness and Innovations." ] },{ "paper_id": "1804d84a48b0228ffdc40a1af0eb63d469630852", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "1) Aged 30-69 years at study entry.", "Immune deficiency or auto-immune disease (eg. HIV/AIDS, lupus, rheumatoid arthritis, multiple sclerosis, inflammatory bowel disease). Co-Investigator Dr. Muller will advise in questionable cases.", "The widely used PANAS scale reliably assesses both positive and negative affect (emotion). 338 Self-reported positive and negative emotion have long been known to be independent predictors of psychological and physical health. 339 In the ARI setting, positive and negative emotion predict not only symptom expression, but actual infection as indicated by viral shedding. 9;13;340 In an RCT setting, PANAS scores improved after MBSR training, (p < 0.05) as compared to controls. 30" ] },{ "paper_id": "18073920e12ee20d939dee5116c586da8accfd82", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All laboratory testing was performed under a sterile hood in a Biosafety laboratory 3 (BSL3) according to standard operating procedures described in " ] },{ "paper_id": "1808454d2e8c7d1088e58a5e3a52111a8c507554", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All samples were extracted by using Qiagen RNA mini kit (Qiagen, Germany), in accordance with the manufacturer's protocol.", "Human enteroviruses (HEV) belonging to the Picornaviridae family are ubiquitous viruses responsible for a wide range of clinical syndromes ranging from mild respiratory symptoms to serious conditions, including aseptic meningitis, encephalitis and acute flaccid paralysis. Some serotypes support respiratory infections, and it has been confirmed that they are responsible for bronchopneumonias and occasional fatal cases [1] [2] [3] [4] . As for many RNA viruses, the genetic evolution of HEV occurs over time by means of point mutations and recombination phenomena allowing the virus to adapt to environment modifications and host selective pressure [2, 5, 6] . This genetic evolution is linked directly to virulence characteristics, tissue tropism and hence to the pathogenic potential of these viruses [5, 7] . More than 100 different serotypes of non polio enteroviruses have been recognized and recently two new enterovirus, the HEV104 and the HEV109, classified within HEV species C, were reported in association with respiratory diseases [8] ." ] },{ "paper_id": "1817050ed534376723c94abc3b5496beea55ed5b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Neonatal calf diarrhea (NCD) is a major disease worldwide when calves are reared intensively, and constitute substantial cost in terms of calf mortality, opportunity costs for labor and capital, veterinary costs and loss in calf value. The term NCD generally refers to a disease complex characterized by acute, undifferentiated diarrhea in young calves. It is a multifactorial disease where, besides the causative pathogenic agent, calf age, management and environmental factors, may influence the clinical outcome [1] .", "Field veterinary practitioners all over Sweden were invited to submit samples from dairy herds by their own choice, for a case/control study. One inclusion criterion was BVDV-free dairy herds; i e. participation in the national BVD control program and declared free from BVDV. Other inclusion criteria were > 29 cows, and that case and control herds should have experienced > 6 and < 3 diarrhoeic calves respectively, out of the 20 most recently born.", "The samples were streaked on horse blood agar (5% v/v) and on MacConkey agar and incubated at 37\u00b0C for 18 h. From each sample, 25 colonies that morphologically corresponded to E. coli were sub-cultured on horse blood agar [15] . Isolates were confirmed as E. coli by testing for production of tryptophanase (indole) and \u03b2glucuronidase (p-nitrophenyl-\u03b2-D-glucopyanosiduronic acid, PGUA). Only lactose-positive isolates with typical morphology and positive reaction in both tests were selected for further analysis." ] },{ "paper_id": "18176d1030fff6410b83e0df1591b3617fc739cb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Our work highlights the importance of surveillance of circulating MERS-CoV in both camels and humans followed by functional analyses of the biological impact of variations uncovered. Further sequencing and functional studies should be conducted to characterize the frequency and effects of other variations.", "Middle East respiratory syndrome coronavirus (MERS-CoV) is the most recently characterized human coronavirus, causing over 1800 reported infections to date and with a high case fatality rate above 35%. First reported in 2012, human MERS infections are still occurring, with a main focal point in the Arabian Peninsula, but with occasional imported cases to other countries.", "Quantitative data were analyzed and plotted using GraphPad Prism 7 (GraphPad Software, La Jolla, CA, USA). Statistical significance analyses were performed using two-tailed Student's t-test. To describe P-value significance, the following convention was used: not significant (NS), P40.05; significant (*), P \u2264 0.05; highly significant (**), P \u2264 0.01; and very highly significant (***), P \u2264 0.001." ] },{ "paper_id": "181bef55321b315c053d17800f248442f38d15fa", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Consider the Laplacian L at a point. It can be represented with its eigendecomposition:", "We use iterated gradient descent to calculate the mean:", "Another computationally beneficial feature of the log-Euclidean metric is the closedform expression that it has for calculating the mean of a set of matrices:", "Once the spectrum has been plotted, techniques such as k-means clustering can identify communities. This should produce a sufficient approximation of the separatrices between maxima. However, if two eigenvectors are used, it may even be easier to identify communities visually.", "If \u03c4 \u2265 0.5, then" ] },{ "paper_id": "181d47c4050ebc63d4831f8dd0df88b785bf4985", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Although the above findings have provided evidence for both direct and indirect antibacterial properties of P. sidoides, the pronounced anti-infective capabilities of this herbal medicine cannot adequately be explained merely on the basis of the observed antibacterial activities.", "The mucociliary system represents a defence mechanism of the nasal cavity and the bronchial tree for cleaning the air of bacteria and foreign particles, with the ciliary beat frequency (CBF) being an important parameter for determining its efficacy. EPs \u00ae 7630 significantly and concentration-dependently increased CBF of an adherent monolayer culture of human nasal epithelium cells. At 30 \u00b5g/mL, the increase was ca. 125% compared to the equilibrium phase [33] . After washing procedures the CBF returned to that of the equilibration period. However, subsequent examinations have to prove the effect under in vivo conditions with emphasis on the mucociliary clearance.", "Induction of protective immunity against Leishmania infection and other pathogenic agents is closely linked to the production of cytokines. The analysis of the data obtained from densitometric measurements revealed that the iNOS and cytokine (IL-1, IL-10, IL-12, IL-18, IFN-\u03b1, IFN-\u03b3 and TNF-\u03b1) mRNA levels of infected RAW 264.7 cells were significantly enhanced in response to LPS plus IFN-\u03b3 when compared with those of non-infected cells. Notably, EPs \u00ae 7630 produced similar transcript profiles with considerably increased and prolonged up-regulations distinctly expressed under infectious conditions ( Figure 5 ) [67] [68] [69] ." ] },{ "paper_id": "1821674721e32961f0f8c6aa3dc7c13c96b693c4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All relevant data are within the paper. Any additional data use and transfer is monitored by ISGlobal's Data Management and Biostatistics Unit (contact e-mail: ubioesdm@isglobal.org).", "Minimum inhibitory concentrations (MICs) of a variety of antifungal agents were determined (Table 3 ). All triazole antifungal agents (fluconazole, voriconazole, itraconazole and posaconazole) had MICs less than or equal to the defined epidemiological cut-off values (ECVs) 26 . One isolate showed a MIC to flucytosine (16 \u00b5g/mL), one dilution higher than the ECV (8 \u00b5g/mL). Although all the isolates presented a MIC \u2264 1 \u00b5g/mL to amphotericin, the MICs of three C. neoformans molecular type VNI (1 \u00b5g/mL) and two C. gattii (1 \u00b5g/mL) were one dilution higher than the defined ECVs (0.5 \u00b5g/mL) 27 ." ] },{ "paper_id": "1829dd66176c20fb22a9d7186d62fa596cc93f9c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Airway epithelial damage [56, 57] and mucus metaplasia, both of which occur in asthma, may provide rhinovirus with increased access to more readily infected basal cells [58] and goblet cells [59] , thereby increasing viral replication.", "Infancy: Exacerbations of Preexisting Airways Disease or a Factor in Asthma Development?", "(This theory was also used to explain how nasal allergies promote asthma.) More recently, release of proinflammatory mediators from the nose and bone marrow into the circulation has been proposed [9] . (1) Viral infection (most commonly rhinovirus) (2) Allergen exposure (tree, grass, and weed pollens; mold; animal dander; dust mites; and cockroach particles) (3) Exercise (4) Irritants including environmental tobacco smoke exposure, smoke from wood-burning appliances or fireplaces, strong odors from perfumes, cleaning agents, air pollution, and occupational dust or vapors (5) Medications (aspirin and other anti-inflammatory drugs, and beta blockers) (6) Changes in weather (cold air, changes in temperature, and humidity) (7) Gastroesophageal reflux (8) Sinusitis" ] },{ "paper_id": "183e393843de9d6c653897f1039ad10af9750347", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Since 2003/04, Ontario hospitals have reported day procedure events to NACRS rather than the DAD.", "The primary practical challenge that we faced was working with the large event-data files.", "In principle, it was straightforward to construct the desired distributions, i.e.," ] },{ "paper_id": "18421f153f74c6b0f8f9efe88c2aad6b70547b99", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All authors listed, have made substantial, direct and intellectual contribution to the work, and approved it for publication.", "Sequencing and primary data quality control was performed at the Genomics Unit of the Centre for Genomic Regulation (CRG) in Barcelona, Spain. We thank Anna Menoyo, Anna Ferrer, Magda Montfort, Irene Gonz\u00e1lez, Manuela Hummel, and Sarah Bonnin for technical assistance, Avital Brodt and Roni Wilentzik for computational analyses, and Shirley Smith for scientific editing. We thank Tel-Aviv University for core funding and technical support.", "will require integration with additional genomic data, including proteomics, trans-acting polymorphic loci, and epigenetic data.", ": the higher the (absolute) founder effect on a certain eQTL target, the stronger the contribution of the DNA changes in the eQTL region of this founder strain." ] },{ "paper_id": "1842bb195a368132b3f4b433e1b1a71590fdc31e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "One hind leg was removed from each pupa and stored at -20uC before DNA extraction to determine the subfamily (patriline) for each individual. DNA was extracted from each leg using a standard Chelex 100H method [43] . Briefly, each sample was incubated for 60 min at 55uC, 15 min at 99uC, 1 min at 37uC, and 15 min at 99uC in 150 ml of a 5% Chelex 100H solution with 5 ml 0.35 mg/ml proteinase K.", "Raw Data S1 Raw Ct values for all qPCRs run in the main experiment. (PDF) Results S1 The expression of genes evaluated by full, 3factorial ANOVAs indicated that developmental time is a significant factor, that was as important as treatment but for most genes interacted with treatment. (PDF)", "Initially, approximately 20 adult bees from a heavily IAPVinfected colony were frozen in liquid nitrogen, ground to a fine powder, and homogenized in 10 ml extraction buffer (0.1 M potassium phosphate buffer, pH 7.5, 0.2% diethyldithiocarbamate, 1/5 volume of diethyl ether). Emulsification ensued by adding 5 ml carbon tetrachloride and centrifuging at 10,000 rpm for at 4uC for 10 minutes (Rotor: Sorvall RC-5B) and collecting the supernatant.", "Pupae were individually homogenized and submitted to total RNA extraction, using TRIzolH (Invitrogen, Carlsbad CA) following the manufacturer's protocol. The resultant RNA pellets were resuspended in diethyl pyrocarbonate-treated water in the presence of RNase inhibitor (Invitrogen, Carlsbad CA) and treated with DNase I (Invitrogen, Carlsbad CA) to remove any contaminating DNA. The resulting RNA was quantified on a Nanodrop spectrophotometer (Thermo Scientific, Wilmington, DE). First-strand cDNA was then synthesized by incubating 2mg of total RNA per sample in a 96-well plate with master mix containing 50 U Superscript II (Invitrogen, Carlsbad, CA), 2 nmol dNTP mix, 2 nmol poly(dT)18, and 0.1 nmol poly (dT) (12) (13) (14) (15) (16) (17) (18) at 42uC for 50 minutes followed by 15 minutes at 70uC as described previously [39] . The cDNA was diluted 1:5 with molecular-grade water." ] },{ "paper_id": "1843389daffca2a8b5e04048821ce881eb068269", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The datasets generated during and/or analysed during the current study are available from the corresponding author on reasonable request." ] },{ "paper_id": "184c8c4637d343cd81dddd0d3f5e6c922f538afe", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The dichotomous analysis by identified virus is displayed in " ] },{ "paper_id": "18592fbe580d07f487157c4f81de8baecd9700e9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "chromatograms. These data show the existence of different populations of viruses (quasispecies) in tissues and clinical isolates.", "Vero cells (ATCC #CCL81) and human primary fetal fibroblasts WI-38 (Coriell Institute, Camden, NJ) were maintained in DMEM supplemented with 5% and 10% Fetal Bovine Serum (FBS, Atlanta Biologicals), respectively.", "Rubella IgG titers were measured by an enzyme-linked immunosorbent assay (EIA) with the ZEUS ELISA Rubella IgG Test System (ZEUS Scientific, Branchburg, NJ) according to the manufacturer's instructions and expressed as IU/ml. Rubella IgM testing was performed with a Rubella IgM Capture EIA Kit (Diamedix, Miami, FL). Measles and mumps IgM testing was performed using in-house capture IgM EIA assays [74, 75] .", "The structures of the rubella E1 protein (PDB entries 4ADG, 4ADI and 4ADJ) were used as templates for computer modeling. The mutations were modeled as described earlier using the software package ECMMS (Energy Calculations for Macro Molecular Systems) for molecular mechanics modeling [83, 84] . The illustrations of protein structures were prepared using DS Visualizer (http://accelrys.com/products/collaborative-science/biovia-discovery-studio/ visualization.html; Accelrys Inc., CA).", "Primary immunodeficiency diseases (PID) are a group of hereditary disorders affecting different arms of the immune system [11] . PID patients usually have increased susceptibility to infections and have difficulties eliminating pathogens. Live vaccines, including rubella vaccine, are contraindicated for individuals with severe antibody deficiency, T-cell deficiencies or innate immune defects because they may cause severe or chronic disease [12] . Unfortunately, PID diagnosis often occurs after vaccination with MMR (usually given at the age of 12-15 months). Nevertheless, adverse outcomes related to MMR vaccination of children who are diagnosed with PID are thought to be rare [13] .", "Cell monolayers in 48-well plates were mock infected or infected with RV strains as described above (two experiments with two replicate wells per each virus strain). After virus adsorption and HBSS washes, the initial medium samples (0 hpi) were collected 10 minutes after fresh medium addition and subsequent medium samples were collected at 3-6-day intervals. Virus in the collected medium samples was titered on Vero cells in duplicate. At 36 dpi, phase contrast images were taken with a fluorescent inverted microscope AxioImager.A1 (Zeiss, Oberkochen, Germany). Then the remaining cells in mock infected and infected well were collected by trypsinization and counted using a Scepter cell counter (Millipore, Billerica, MA)." ] },{ "paper_id": "185b7ddc439bc3490a0c97ecc00861497c6bd481", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cells were washed twice with cold phosphate-buffered saline (PBS), and lysate samples were prepared in 350 \u00b5L T-PER Tissue Protein Extraction Reagent (Thermo Scientific Pierce, Rockford, IL, USA) in the presence of a protease inhibitor cocktail (Roche, Indianapolis, IN, USA) and centrifuged at 20,000\u00d7 g for 20 min at 4 \u2022 C.", "The following are available online at http://www.mdpi.com/2073-4409/7/11/222/s1, Figure S1 : Sequencing analysis of cell clones 1-10#, 1-19#, 1-22#, 2-3# and 6-18#, Figure S2 : Amino acid sequences alignment for wild-type, 1-10# and 1-19# cell clones. ", "The authors declare no conflicts of interest.", "Statistical analyses were performed with GraphPad Prism 5.0 (GraphPad software, La Jolla, CA, USA). An unpaired t-test was used to compare values (means \u00b1 standard error means (SEMs)) between wild-type and mutant cells as described in the figure legends. * p < 0.05, ** p < 0.01 and *** p < 0.001 were considered statistically significant." ] },{ "paper_id": "185bc5c5addfa50d75d15b288537d11bd4a4aa5d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "PCR fragments were generated using 2X phusion master mix (M0531S, NEB, Ipswich, MA) and insert-specific primers that appended a 30 bp overlap with target DNA. Vector backbones were linearized by restriction enzyme and dephosphorylated by calf intestinal phosphatase (M0290S, NEB, Ipswich, MA). Prior to assembly, all DNA fragments were gel purified (D4002, Zymo Research, Irvine, CA). Linearized vector DNA (50 ng) was combined with isomolar amounts of purified insert(s); 5 ul of the resulting DNA mix was added to isothermal assembly master mix and incubated at 50\u02daC for 20 min [68] . Assembled product was transformed into NEB Stable competent cells (C3040H, NEB, Ipswich, MA) and plated on LB + agar plates (plus appropriate antibiotics) to isolate single isolates. Single isolates were grown in LB broth + antibiotics, and plasmid DNA was purified using a Qiagen miniprep kit (#27106, Qiagen, Hilden, Germany). Sequences were verified by Sanger sequencing (Eton Bioscience, San Diego, CA).", "Fluorescent images were obtained using a confocal microscope with Airyscan detectors (LSM880 with Airyscan, Zeiss) and a 63X PlanAPO oil-immersion objective lens (Zeiss, Oberkochen, Germany) and were processed with Zeiss Blue software (Zeiss, Oberkochen, Germany).", "sgRNA oligonucleotides (oligos) were ordered from Eton Bioscience (San Diego, CA). Oligo sequences are listed in S1 Table. To generate the necessary overhangs, all oligos were in the form: Forward: 5 0 -CACCGNNNNNNNNNNNNNNNNNNNN-3 0 ; Reverse: 5 0 -AAA CNNNNNNNNNNNNNNNNNNNNC-3 0 . Oligos were diluted to 10 uM in distilled water. A total of 50 pmol each of forward and reverse oligo was combined in a 25 ul reaction and phosphorylated with T4 polynucleotide kinase (M0201S, NEB, Ipswich, MA) in 1X T4 DNA ligase buffer (B0202S, NEB, Ipswich, MA) for 30 min at 37\u02daC. Phosphorylated oligos were boiled for 5 min at 95\u02daC and slow cooled (0.1\u02daC/s) to facilitate annealing. Annealed oligos were diluted 1:100, and 2 \u03bcl of insert was ligated into 20 ng digested vector (pLentiuGuidepuro, BsmBI site; pLentiCRIPSR version 2, BbsI site; pX330-derivatives, BbsI site) using T4 DNA ligase (M0202S, NEB, Ipswich, MA). Ligation was allowed to proceed for 15 min at room temperature. Ligated products were transformed into NEB Stable cells (NEB, Ipswich, MA)." ] },{ "paper_id": "185e505daa1da8ee7ece18212693b2550410a190", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "African green monkey kidney epithelial Vero cells (ATCC, CCL-81) were grown in Dulbecco's modified Eagle's medium (DMEM; Mediatech, Inc) supplemented with 5% fetal bovine serum (FBS), 2 mM L-glutamine, 100 U/ml penicillin and 100 \u03bcg/ml streptomycin at 37 \u00b0C with 5% CO 2 ." ] },{ "paper_id": "1868242435edf92a6b0018f2569c2012f672ddf7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Corticosteroids have been used in some patients with HPAI H5N1, but no definitive role for steroids has been determined [25] [26] . The evidence for corticosteroid use in other severe viral pneumonias, including varicella-zoster virus infection and severe acute respiratory syndrome (SARS), is also insufficient [7] [8] .", "The isolated spleen cells (1610 6 per well) were seeded into 96well tissue culture plates and stimulated with LPS at different concentrations (10, 20 or 50 mg) or PBS for 12 or 24 h at 37uC and 5% CO 2 ; 2-[2-methoxy-4-nitrophenyl]-3-[4-nitrophenyl]-5-[2,4-disulfophenyl]-2H-tetrazolium monosodium salt (WST-8, Cell-Counting Kit-8H (Dojindo Molecular Technologies, Inc., Gaithersburg, MD) 10 ml per well) was added as described previously [50] . The plates were incubated for 4 h, and the optical density (OD) at 450 nm was measured using a microplate reader (BioRad, Hercules, CA). Each sample was analysed in three replicates, and the injury index was calculated using the following formula: injury index = (mean OD of control group-LPS-stimulated group)/(mean OD of control group).", "Comparisons among treatment groups were performed with a one-way-ANOVA test. A P value less than 0.05 was considered statistically significant." ] },{ "paper_id": "187062df058ff8a8110c008bc1f489986423ea1e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The cytomegaloviruses, classified within the Betherpesvirinae subfamily, are a group of species-specific herpes viruses that establish life-long infection of their hosts. Human cytomegalovirus (HCMV) can cause devastating disease and death in congenitallyinfected infants, and long-term neurological complications in survivors. In adults, HCMV can cause a spectrum of diseases in immune compromised patients involving multiple organs and tissues and is a primary cause of graft loss in transplant patients [1, 2] . In recent years, HCMV has been linked to lung injury in trauma patients [3] and is also postulated to act as a cofactor in atherosclerosis and some cancers [4, 5] . For these reasons, there is an urgent need for an effective vaccine and new antiviral intervention strategies that mitigate the toxicity and drug resistance shortcomings of current antiviral drugs [1, 6] .", "Ccl5 chemokine (C-C motif) ligand 5, RANTES 8.5", "Trank1 tetratricopeptide repeat and ankyrin repeat containing 1 8.4" ] },{ "paper_id": "187607fca4b1dc4e30fe91d36520432aec36f795", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "in childhood, it was clear that chickenpox was what he now had. No national alert was necessary, with all the widespread anxiety that would have followed. The speed and certainty of the diagnosis by EM offered a lesson that still has relevance.", "Herpes varicella zoster (VZV)", "Viruses 2018, 10, x 9 of 30" ] },{ "paper_id": "188337e43aa524493372f8769b6bac8b366850ca", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Excessive environmental and industrial development has created hazardous conditions, such as viral diseases (e.g., Middle East respiratory syndrome (MERS)) [1] and particulate matter air pollution, which has been classified as carcinogenic to humans (IARC Group 1) [2] . Thus, the importance of building a strong immune system is becoming more important for good health, and the demand for health supplements that can help improve the immune system has been rapidly increasing. There is a close correlation between immune responses and inflammation. When immunity decreases, the body is easily exposed to infectious and noninfectious inflammatory diseases.", "Cynanchum is a genus that includes approximately 300 species that are distributed worldwide, including east Africa, the Mediterranean, the tropical zone of Europe, and the subtropical and temperate zones of Asia [11] . Many Cynanchum species have been used as traditional medicines in Korea toprevent and treat various diseases such as rheumatic arthritis and geriatric, vascular, and ischemia-induced diseases [12] [13] [14] .", "In spite of advances in modern medical science, traditional herbal medicine has continued to be widely used for health maintenance, disease prevention, and even disease treatment in China, Japan, and Korea for thousands of years. Previous studies have shown that 1 out of 2 IBD patients turns to complementary and alternative medicine [7] [8] [9] [10] ." ] },{ "paper_id": "188a2e1351ceae0aa8347e1a1d7af1e3b7b66a02", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "RSV-positive samples were tested simultaneously for the following 17 respiratory pathogens: InfA, InfB, PIV1-4, ADV, EV, HMPV, HCoV-229E, HCoV-OC43, HCoV-NL63, HCoV-HKU1, RV, HBoV, MP and CP. The testing procedure, using kits from Guangzhou HuYanSuo Medical Technology Co., Ltd, has been described in a previous report [17] .", "The study was approved by The First Affiliated Hospital of Guangzhou Medical University Ethics Committee for research on human beings, and the next of kin, caretakers, or guardians on behalf of the minors/children gave signed informed consent for participation in the study.", "As described in detail previously [17] , all statistical analyses were performed with the SPSS statistical software (version 19.0; SPSS Inc., Chicago, IL, USA). To compare categorical data, the \u03c7 2 test and Fisher's exact test were used, as appropriate. All tests were two-tailed, and p < 0.05 was considered statistically significant.", "doi:10.1371/journal.pone.0165108.t003 observed for the three target genes. Parallel standard curves (with almost the same slopes) increased the quality of the CVL calculation." ] },{ "paper_id": "18910856b917289b6bb3cc2cef0f78ff82ad4b02", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Winter and annual influenza-associated excess elderly mortalities", "Model selection was based on Akaike's information criterion (AIC) and likelihood ratio test [11] . When modeling P&I mortality, both mean temperature and relative humidity were found to be without statistical significance and were thus excluded from the full model (Table 1) . The model was implemented by SAS (version 9.1; SAS Institute Inc, Cary, NC). The final model for ''influenza-associated deaths'' was devised as follows:", "To better understand why 2001-2002 exhibited the highest winter and annual excess P&I mortality rates, HA1 sequences of the 2002 epidemic influenza virus A (H3N2) Fujian strain (A/ Fujian/411/2002 (H3N2)), vaccine strains (red squared symbol) from 1999 to 2007, and other Taiwanese H3N2 isolates (circular symbol) from 1996 to 2008 were gathered from the National Center for Biotechnology Information (NCBI) for genetic comparison. We then constructed a phylogenetic tree of HA1 amino acids among Taiwanese A (H3N2) virus strains using the Neighbor-Joining method. This tree was bootstrapped 1,000 times with Mega 4.0 software [12] ." ] },{ "paper_id": "1894cac8794748c11482c059bc5a2c6d4f1e9527", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Viral nucleic acid from samples was extracted using an automated MagNa Pure LC 2.0 system (Roche Diagnostic Systems, Branchburg, NJ). HSV (2) Keratitis (2) HPV (2) Warts (2) CMV (8) Viremia (4), Pneumonia (6) Adenovirus (3) Viremia (2), Pneumonia (1)", "Enterovirus (3) Hemophagocytosis (1), Viremia (1), Pneumonia (1) Norovirus (1) ", "Immunodeficiency with centromeric instability and facial anomalies (2) Sapovirus (2) Enteritis (2) Adenovirus (2) Enteritis (1), Viremia (1) PREDOMINANTLY ANTIBODY DEFICIENCIES (n = 6)" ] },{ "paper_id": "18a116d870bd24c96d95317418946ce0873f2180", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Four-to six-week-old wild-type C57BL/6 mice were purchased from the South Medical University Animal Center (Guangzhou, China). Animal husbandry and experimental procedures were approved by the Animal Research Committee of the Zhongshan Ophthalmic Center, Sun Yatsen University (Guangzhou, China). All animals were housed in a specific pathogen-free biohazard level-2 facility maintained by the Zhongshan Ophthalmic Center in accordance with the Association for Assessment and Accreditation of Laboratory Animal Care guidelines.", "pathogenesis and immune reaction after intravitreal dispase injection in mice. In the present study, we analyzed these outcomes after intravitreal dispase injection during an 8 week observation period.", "Dispase, a proteolytic enzyme able to harvest and culture cells due to its ability to cleave the basal membrane in various tissues, can be used as an intravitreal injection material to induce proliferative vitreoretinopathy (PVR) in the eyes of mice [1, 2] and rabbits [3] [4] [5] [6] [7] [8] [9] . PVR is the most common cause of recurrent retinal detachment after retinal detachment repair, occurring in 5%-11% of patients [10, 11] . Basic research has indicated that PVR is characterized by the formation of scarlike fibrous tissue containing myofibroblasts derived from transdifferentiated retinal pigment epithelial (RPE) cells and other cell types, such as glial cells, that have entered the vitreous cavity and induced the contraction of cellular membranes within the vitreous cavity on both detached retinal surfaces [12] [13] [14] ." ] },{ "paper_id": "18a8af7a7be62a2ccc66a4f65c94ac94bf2f8639", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Abbreviations: CI = confidence interval, HWE = Hardy-Weinberg equilibrium, MMPs = matrix metalloproteinases, OA = osteoarthritis, ONFH = osteonecrosis of the femoral head, OR = odds ratio, SNPs = single-nucleotide polymorphisms, TIMPs = tissue inhibitors of metalloproteinases. P values were calculated from 2-sided chi-squared test adjusted for age. \u2020 P values were calculated from Wald test. \u2021 P < 0.05 indicates statistical significance.", "Our study protocol adhered to the principles of the Declaration of Helsinki and was reviewed and approved by the Ethical Committee of Zhengzhou Traditional Chinese Medicine Traumatology Hospital. Informed consent was obtained from all candidate subjects." ] },{ "paper_id": "18c1ceb51b621792118f18381b9b3606b46717a9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "18c21db94a22f1358057c6d797164ffe1585b395", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Note: Some patients do not show initial symptoms of fever, especially those who have had recent surgery or those having chronic diseases.", "(3) Routine laboratory examinations White blood cell counts are generally normal or below normal, with decreased absolute lymphocyte counts.", "Suspected cases: In accordance with 1.1+2+3, 1.2+2+4 or 2+3+4." ] },{ "paper_id": "18d519cf1ea884ddf381067f0733c18d8ad94c7a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Further investigation is needed to establish a link between these observations and the correct activation of the immune system in ZIKV infection and to identify different intracellular signals induced by different ZIKV strains, responsible for different cytokine response.", "Zika virus (ZIKV) is an emerging mosquito-borne flavivirus, transmitted by different Aedes mosquito species, including Aedes aegypti. ZIKV tropism is various, and in addition to both skin fibroblasts and epidermal keratinocytes, dendritic cells (DCs) were found to be permissive to infection [1] . ZIKV was originally identified in Uganda in 1947 [2] and over the years limited ZIKV outbreaks were reported, especially in the Pacific islands [3, 4] . Phylogenetic studies have revealed that Zika virus has evolved into 3 distinct genotypes: West African (Nigerian cluster), East African (MR766 prototype cluster), and Asian [5] . In 2015, the largest ZIKV epidemic has begun in Brazil, spreading throughout the Americas and infecting nearly two million people; the virus that caused this epidemic was found to be most closely related to a 2013 isolate from French Polynesia, within the Asian clade [6] . Although ZIKV-associated illness was initially described as self-limiting mild illness characterized by rash, fever, conjunctivitis, arthralgia, and arthritis [7] , it is now generally accepted that ZIKV is responsible for neurological birth defects, including microcephaly in newborns [8] .", "In this paper, we analyze the ability of ZIKV to activate immune response in human PBMC, since it is well known that these cells represent the gatekeeper of virus spread in the body during systemic viral infections and include several subpopulations that may cooperate in the activation process [21, 22] ." ] },{ "paper_id": "18d6b41f2b9f5cad93519eb39f422f7f008a4ed3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The 16S rRNA gene sequence data supporting the conclusions of this article are available by request to M.M. Pettigrew. The relevant de-identified raw sequence data will be made available to researchers wishing to use them for non-commercial purposes.", "Btrim software was used to sort, trim, and filter low quality sequences [10, 29] . Cleaned and filtered sequences were processed using customized analytic pipelines and open source packages available through the Ribosomal Database Project (RDP) [10, 11, 30] . Sequence reads were aligned using the RDP alignment tool. The command line RDP classifier tool was used for taxonomic assignment [30] . Sequences were classified in an iterative process. Taxa were defined by grouping together all sequences belonging to the same genus. Sequences that were unclassified at the genus level were classified and then grouped at the next lowest taxonomic level." ] },{ "paper_id": "18e4bf7e0c2d81caa5795174a4f25d5a035e09b1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling (TUNEL) staining", "The frozen tumor tissue sections were incubated with terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling reaction mixture (Roche Diagnostics) at 37uC for an hour. The slides were counterstained with mounting medium with DAPI (Vector Laboratories). The slides were then visualized under a fluorescent microscope.", "Tissues were removed from treated mice, fixed with 4% paraformaldehyde and embedded with paraffin. Blood vessels were detected by staining of Lycopersicon esculentum (tomato) lectin conjugated to biotin (Vector, CA, USA). The biotinylated lectin was visualized with streptavidin-conjugated rhodamine (Pierce, IL, USA)." ] },{ "paper_id": "18efb24780930c0ee4343fd31b37b39ce3c3b315", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Optical aptasensors for virus detection can be classified into six categories based on the optical principles used for material detection. These categories are surface plasmon resonance (SPR) aptasensors, colorimetric aptasensors, chemiluminescence (CL) aptasensors, fluorescence aptasensors, surface-enhanced Raman scattering (SERS) aptasensors, and interferometry aptasensors.", "FUNDING Bai, C., Lu, Z., Jiang, H., Yang, Z., Liu, X., Ding, H., et al. (2018 ", "XZ, JW, JG, and LS conceived the work and discussed the content. XZ drafted the manuscript. JW, JG, and LS were responsible for revising it. LM critically reviewed, edited, and finalized the manuscript for submission.", "To mitigate HIV-associated cardiomyopathy, Lopes de Campos et al. (2014) employed an anti-gp120 aptamer UCLA1. By directly binding to HIV-1 and neutralizing the virus, the aptamer protected cardiomyocytes from apoptosis and indirectly prevented infection of monocyte-derived macrophages. Aptamers applied in antiviral therapy are summarized in Table 3 .", "The multifunctional regulatory protein pUL84 is fundamental in the early phase of human cytomegalovirus replication. By mediating the cellular importin-\u03b1/\u03b2 pathway, nuclear localization signal is involved in the nuclear trafficking of pUL84. In Kaiser's research, peptide aptamers aimed at the nuclear localization signal domain of pUL84 abrogated the nuclear translocation of this viral replication factor by restraining the interaction between importin-\u03b1 proteins and pUL84 (Kaiser et al., 2009) ." ] },{ "paper_id": "18f11e6900b1a76027c33f5e61ae9cb66d7d2370", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "18f3146e3ad376486f1ade8e5c89c086d434620a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Given the critical role played by EPAC in multiple pathologies, several EPAC-specific modulators have been screened to target EPAC proteins (vide infra). Despite their wide commercial availability and seemingly ubiquitous use in experimental studies, for several EPAC inhibitors, the molecular basis of their interactions with EPAC and the related mechanism of action are currently not fully understood, thus limiting further improvement on existing inhibitor design, lead optimization and EPAC-targeted drug development.", "EPAC regulates several critical cAMP-related signaling pathways, including cardiac calcium homeostasis, vascular remodeling, tissue homeostasis, regulation of smooth muscle contraction, insulin secretion from pancreatic \u03b2 cells, integrin-dependent cell adhesion, neuronal excitability and memory consolidation in the hippocampus [8, [18] [19] [20] [21] [22] [23] . Thus, EPAC inhibition has been recognized as a promising therapeutic route for a wide spectrum of diseases, including pancreatic cancer [24], breast cancer [25], cardiac hypertrophy [26], vascular inflammation [27], Alzheimer's disease [28], as well as infections, e.g., Coronavirus' [29] and malaria [30] . For further details about the physiological role of EPAC and subsequent disease implications, we refer to excellent reviews, which have been published in recent years [18, [31] [32] [33] .", "The existence of two ubiquitously expressed cAMP-dependent sensors, EPAC and PKA, necessitates the development of selective pharmacological interventions to modulate their discrete functions. Such EPAC vs. PKA selectivity was obtained for the first time through structure-based design, which led to the identification of a cAMP analog that functions as an activator for EPAC but not PKA [59] . However, in contrast to EPAC agonists, identifying EPAC selective antagonists has proven much more challenging, as cyclic nucleotide analogues often interfere with phosphodiesterase activities, which increases cellular cyclic nucleotide levels and counters the intended antagonistic effects.", "involved in sperm function (CRIS), underscoring the complexity of cAMP-related signaling [14, 15] . Importantly, in 1998, a new cAMP receptor was discovered after observing cAMP-dependent activation for the small GTPase Rap1, which was independent of PKA [16] . The new cAMP receptor, now known as the exchange protein directly activated by cAMP (EPAC), was then identified through a database screen for putative cAMP-binding domains [16] . There are two isoforms of EPAC (EPAC1 and EPAC2) that serve as guanine exchange factors for Ras-like GTPases, primarily Rap1 and Rap2 [16, 17] . EPAC1 is more broadly expressed, e.g., in the circulatory, excretory, reproductive and digestive systems, whereas EPAC2 is more abundant in the central nervous system (CNS), pancreas and adrenal gland [16, 17] ." ] },{ "paper_id": "18f3b3f9f77227f4941079cdb605af4e5777c061", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "18fa3d1a5503e1943ce8e657416f9da8fe2cb475", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "cytoskeleton, calcium ion binding, the stress response, anti-oxidative stress, and macromolecular metabolism.", "A magnified comparison of eleven differentially expressed protein spots, representing ANXA1, HSPB1, MYLPF, TRIM27.2, EXFABP, ANXA5, PRDX1, TPM1, ENO1, ANXA2 and CALB, is shown in Figure 5 .", "the possible functional roles of some proteins identified during IBV infection in ovo.", "Avian infectious bronchitis (IB) is one of the most serious diseases of chickens. It is of economic importance in the poultry industry worldwide and is associated with respiratory disease, reduction in weight gain, poor egg production and quality, and decreased feed conversion efficiency. Its etiologic agent is the avian infectious bronchitis coronavirus (IBV), which is a Gamma coronavirus of the coronavirus genus and replicates primarily in the upper respiratory tract, kidney, and oviduct of chickens [1] [2] [3] ." ] },{ "paper_id": "18fb0cf6fba22d9478d4f5774f37f6b6bf09f3b0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The intra-and interassay reproducibility were evaluated using three replicates of 10 6 , 10 4 , and 10 2 copies/ L plasmid standards of both pMD20-GD and pMD20-CH1a. Mean and coefficient of variation (CV) for the value were calculated. The results showed that neither the CVs of intra-assay nor the CVs of interassay were more than 5% (Table 2) , indicating the reproducibility of the two assays.", "Plasmid DNA. The conventional RT-PCR was performed by using the NSP2-F and NSP2-R primers described in Table 1 . 10 L reaction mixture contains 0.5 L cDNA, 5.0 L 2 \u00d7 PCR reaction mix, 0.4 L NSP2-F (10 M) primer, 0.4 L NSP2-R (10 M) primer, 0.1 L Taq DNA polymerase (2.5 U/ L), and 3.6 L H 2 O. The negative controls included the reagents without cDNA template. The reaction mixtures were performed at the amplification condition: 95 \u2218 C for 3 min, followed by 30 cycles of 94 \u2218 C for 30 s, 60 \u2218 C for 30 s, and 72 \u2218 C for 1 min, and a final extension step of 5 min at 72 \u2218 C. The PCR products were detected by 1.5% agarose gel electrophoresis in 1 \u00d7 TAE. Then the PCR products were cloned into the plasmid pMD20-T (TaKaRa) and propagated in competent Escherichia coli DH5 cells according to the manufacturer's instructions. Plasmid DNA was purified using the E.Z.N.A. Plasmid Mini Kit I (Omega) and quantified by measuring OD 260 using spectrophotometer ND-1000 (Wilmington, USA).", "531 serum samples showed that the TaqMan probe real-time PCR had the highest detection rate, whereas the conventional RT-PCR had the lowest detection rate. To evaluate comprehensively the practicality of this assay, clinical samples that span a broader geographical origin should be tested in the future." ] },{ "paper_id": "1904cb0e767c673c78ac5d6ebf6260c1d83bea13", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "High vaccination rates have helped to prevent many infectious diseases and resulted in less sickness and millions of lives saved (reviewed by Rappuoli et al.) [38] . Among the greatest success stories are the eradication of smallpox virus, rinderpest, and the polio eradication program, where poliovirus type 2 was already eradicated in 1999 [39] [40] [41] .", "The overall aim of this study is to generate data that will facilitate decision making on which substrate may be the best for the production of novel vaccine strains. As a first step for this, we investigated whether poliovirus, as a representative of the Picornaviridae family of viruses, can be propagated in the human suspension cell lines.", ", or K562 with a Low MOI. For vaccine production purposes it is important that, after infection of cells with a low MOI, a high viral yield in the culture medium can be achieved." ] },{ "paper_id": "190505ad74408b21fea8434a44a2f43b1ef198b7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "All the commercially available reagents and solvents were used without further purification. 1,2-Diaza-1,3-diene (DD, 13) was synthesized as a mixture of E/Z isomers as previously reported [27] [28] [29] . Column chromatography was performed with Merck silica gel 230-400 mesh ASTM or with a B\u00fcchi Sepacor chromatography module (a prepacked cartridge system). TLC analysis was performed on pre-loaded (0.25 mm) glass-supported silica gel plates (Kieselgel 60); compounds were visualized by exposure to UV light and by dipping the plates in 1% Ce(SO 4 )\u00b74H 2 O, 2.5% (NH 4 ) 6 Mo 7 O 24 \u00b74H 2 O in 10% sulfuric acid followed by heating on a hot plate. 1 H-NMR and 13 C-NMR spectra were recorded in DMSO-d 6 or CDCl 3 solution on 200 (Bruker AC) or 400 (Varian Mercury) MHz instruments. Proton and carbon spectra were referenced internally to solvent signals, using values of \u03b4 = 2.49 ppm for proton (middle peak) and \u03b4 = 39.50 ppm for carbon (middle peak) in DMSO-d 6 and \u03b4 = 7.26 ppm for proton and \u03b4 = 77.00 ppm for carbon (middle peak) in CDCl 3 . The following abbreviations are used to describe peak patterns where appropriate: s = singlet, d = doublet, t = triplet q = quartet and m = multiplet. All coupling constants (J) are given in Hz. All melting points were taken on a B\u00fcchi-Tottoli capillary apparatus and are uncorrected; IR spectra were determined in bromoform or nujol with a Jasco FT/IR 5300 spectrophotometer. Mass spectra were recorded in the EI mode (70eV) on a Shimadzu GC-MS QP5050A spectrometer. Elemental analyses (C, H, N) were within \u00b10.4% of the theoretical values.", "3.1.1.1. General Procedure for the Preparation of 1,3-bis(Indol-3-yl)propane-1,3-diones 12a-e A solution of malonyl dichloride (1 mL, 10 mmol) in DCM (10 mL) was added dropwise to a cold solution of the appropriate N-methylindole 11a-e (20 mmol) in DCM (20 mL). The reaction mixture was stirred for 2 h at room temperature. The mixture was then added to 5% aqueous sodium carbonate and shaken for 2 min. This was extracted with DCM, dried and evaporated. The residue was purified by chromatography eluting with DCM/Ethyl acetate 9/1 to give derivatives 12a-e. Analytical and spectroscopic data are reported elsewhere [12] .", "To a solution of the appropriate 1,3-bis(indol-3-yl)propane-1,3-dione 12a-e (1.0 mmol) in THF (5 mL), 1,2-diaza-1,3-diene (DD, 13) as a mixture of E/Z isomers (1.0 mmol) and CuCl 2 \u00b72H 2 O (0.5 mmol) were added. The reaction was stirred under magnetic stirring at room temperature for 12 h, until the disappearance of the DD (as monitored by TLC). The crude mixture was concentrated under reduced pressure and the products 10a-e were purified by column chromatography on silica gel (eluent: ethyl acetate/cyclohexane = 1:1). " ] },{ "paper_id": "190bc9d8aadbfb5c848ccdb9f4fa98610780ba56", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Saikosaponin-d (Ssd) is one of the major triterpenoid saponins derived from Bupleurum falcatum L. (Umbelliferae), which is commonly prescribed for inflammatory and infectious diseases by Chinese and Japanese medical doctors, while its active component Ssd was reported to have immunemodulatory, anti-inflammatory, antibacterial, antiviral, and anticancer activities [18] . Recently, we have identified that saikosaponin-d (Ssd) could exhibit antiproliferative effect on the activated T lymphocyte via suppression of NF-B, NF-AT, and AP-1 signaling [19] .", "where = 0 is the area of wound measured immediately after scratching, and = end-point is the area of wound measured 16 or 24 h after scratching.", "Analysis. The data are expressed as means \u00b1 SD as indicated. The difference was considered statistically significant when the value was less than 0.05. Student'stest or one-way ANOVA analysis was used for comparison among different groups." ] },{ "paper_id": "191480bd880b13cbec0b421f7689e7d3f0fdc120", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "DLSP current activities take place in three KEMRI laboratories, one in Kisumu and two in Nairobi (Fig. 1) . The KEMRI Kisumu facility houses zoonotic, biological safety level 3 (BSL3), respiratory and enteric laboratories. The Nairobi KEMRI facility has a BSL3 laboratory where Taqman Array Card (TAC), Next Generation Sequencing (NGS) and cell culture are performed. The KEMRI Kisumu and Nairobi laboratories also include HIV, malaria and TB laboratories. A third satellite microbiology laboratory is located in Kibera, an informal urban settlement in Nairobi. This microbiology laboratory supports population-based surveillance at the Tabitha Clinic, operated jointly with Carolina for Kibera, a non-governmental organization (NGO) providing health and other services for the people of Kibera.", "Lastly, DLSP provides laboratory capacity by mentoring interns and sponsoring training courses in coordination with pathogen specific subject matter experts from CDC. Over the last decade DLSP trained technical staff from Kenya and neighboring countries in PCR, ELISA and microbiology diagnostic techniques to detect multiple pathogens (Fig. 2 ). In addition, 6-10 interns from various local universities are accepted annually to train from 6 months to 1 year. These students then move on to other local or regional institutes to continue their careers as scientists and strengthen this capacity in Kenya and beyond.", "Other zoonotic studies that DLSP has supported include those on brucellosis in humans and animals and risk factors for brucellosis transmission such as ingestion of raw milk, exposure to goats, and handling of animal hides, as well as the risk of transmission of other enteric pathogens from animals to humans [17, 18] . DLSP has also evaluated serologic evidence of human exposure to Bacillus anthracis, Brucella spp., spotted fever group rickettsioses, and typhus group rickettsioses from persons aged 15-64 years and determined a high seropositivity suggesting frequent exposure to these pathogens in the Kenyan population. These studies allowed a recent prioritization of zoonotic diseases of public health importance in Kenya [19, 20] ." ] },{ "paper_id": "1926a717f92225eb7539c0fe190cefe1b067f08e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Rice (Oryza sativa L. cv. Nipponbare) seeds were used throughout the experiments. After the disinfection with 0.1 % HgCl 2 for 1 h and thorough washing with RO (reverse-osmosis) water, seeds were soaked overnight in RO water and incubation at 25\u00b0C for 1 day. Seedlings were then grown on plastic chambers using Kimura B nutrient solution [48] , with a 14/10 h (day/night) regimes at 28 \u00b1 1\u00b0C.", "Using the RSV CP, SP gene and RBSDV P5-1, P9-1 gene, the dynamics of viral infection in rice plants was measured by reverse-transcription real-time PCR. The primer and products were shown in Table 2 .", "In our experimental conditions, geNorm analysis showed that GAPDH and UBQ 10 were ranked as the " ] },{ "paper_id": "192e7d37cf521798de0394c2ad593f2bb77f5a77", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data collection was done by using a questionnaire including 3 parts:" ] },{ "paper_id": "193361dba84bf8c443b6ebd5ead3b3eb54d49379", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A total of 13 tissues samples including skin, muscle, fat, heart, liver, spleen, kidney, lung, dudens, jejunum, ileum, cecum, rectum from 5 healthy swines (Crossbred: Duroc \u00d7 Landrace \u00d7 Yorkshire) were collected, washed three times in phosphate buffered saline (PBS, pH 7.2) and immediately snap-frozen in liquid nitrogen before being stored at -80 \u2022 C for further use.", "Using this sequence, a pair of primers (F: 5'-ACTGTCGACAT GAACTGCGCTTCCCAGCCCTTC-3'; R:", "All results are presented as the mean \u00b1 standard deviation. SPSS (Statistical Package for the Social Sciences) statistical software (version 13.0) was used to analyze data (IBM SPSS Inc., Armonk, NY, USA). One-way analysis of variance (ANOVA) was employed to analyze the differences among groups. P-values less than 0.05 were taken to indicate statistically significant differences." ] },{ "paper_id": "194e09560f46554663015f54423f7f5d7822025b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For example, optical images in Figure 1a law gives the time-dependent concentration profile as a function of the distance from the absorbing wall [9] :", "Here, the drag force (F Drag ) results from the relative motion of a spherical particle under a fluid flow in a solution:", "Re \u2202u \u2202t" ] },{ "paper_id": "1951545d70e8568083cde219d2583c1aae0c4061", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The breadth and depth of arbovirus surveillance differs regionally, and several areas lack surveillance altogether. There is also a lack of interdisciplinary expertise on arbovirus diseases and understanding their vectors, and epidemiology. In addition, only a small number of arboviral diseases can be prevented using vaccines or specific antiviral drugs, and there are few validated diagnostic reagents, with which to monitor disease progress and control. Until such disease control reagents become available, the most effective alternative is to focus on practical procedures to reduce risks of exposure to arthropods.", "More than 100 species of arbovirus that cause human/animal or zoonotic diseases have been identified. 12 Four virus families, Togaviridae, Flaviviridae, Bunyaviridae and Reoviridae, contain most of the arboviruses that cause human/animal diseases. 12 Arbovirus infections are not always clinically obvious and often resolve spontaneously after 1-2 weeks. However, some arboviral infections result in high fever, hemorrhage, meningitis, encephalitis, other serious clinical symptoms, and even death. Therefore, they cause a large social and economic burden. A summary listing the arboviruses associated with human diseases and their geographic distributions was published previously. 21 ", "Arboviruses are transmitted between arthropods (mosquitoes, ticks, sandflies, midges, bugs\u2026) and vertebrates during the life cycle of the virus. 8 Many arboviruses are zoonotic, i.e., transmissible from animals to humans. [9] [10] As far as we are aware, there are no confirmed examples of anthroponosis, i.e., transmission of arboviruses from humans to animals. 9-10 The term arbovirus is not a taxonomic indicator; it describes their requirement for a vector in their transmission cycle. [11] [12] Humans and animals infected by arboviruses, may suffer diseases ranging from sub-clinical or mild through febrile to encephalitic or hemorrhagic with a significant proportion of fatalities. In contrast, arthropods infected by arboviruses do not show detectable signs of sickness, even though the virus may remain in the arthropod for life. As of 1992, 535 species belonging to 14 virus families were registered in the International Catalogue of Arboviruses. 12 However, this estimate is continuously increasing as advances in virus isolation procedures and sequencing methods impact on virus studies. Whilst many current arboviruses do not appear to be human or animal pathogens, this large number of widely different and highly adaptable arboviruses provides an immense resource for the emergence of new pathogens in the future." ] },{ "paper_id": "1952a38871ef31c0e837ff0ee666bd0350c8b32c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Injuries caused by used needles, scalpels or knives are coded as needlestick injuries (NSIs).", "Introduction: Healthcare workers (HCW) are exposed to infectious agents. Disease surveillance is therefore needed in order to foster prevention." ] },{ "paper_id": "1968f8d8ffe3f695372d919c9966b1ca412b83d2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "EGTA, DTT, 5-aza-CdR, NS-398, and antibody against Flag were purchased from Sigma (St. Louis, MO). Antibody against COX-2 was from Cayman (Ann Arbor, MI, USA). Antibodies specific for \u03b2-actin, C/EBP\u03b2, GFP, and DNMT1 were purchased from Santa Cruz (Santa Cruz, CA, USA). Antibodies against DNMT3A and DNMT3B were purchased from Cell Signaling Technology (Beverly, MA, USA).", "Wild-type C/EBP: 5'-GCTTACGCAATTTTTT-TAAGG-3';" ] },{ "paper_id": "196d55353760e8e1ddbc2e2cce92f806351b747c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Statistical analysis was performed by using the GraphPad Prism 5.0 software (GraphPad Software Inc. USA). Data were represented as Mean \u00b1 SEM. The comparison between the groups was performed by either one-or two-way ANOVA with Tukey or Bonferroni post-hoc test, respectively. Data presented here were representative of at least three independent experiments. p < 0.05 was considered as statistically significant difference between the groups.", "Taken together, the current data depict that CHIKV may induce p-c-jun via JNK pathway whereas induction of p-IRF-3 might be dependent on both p38 and JNK MAPKs." ] },{ "paper_id": "196eaa0045b36b7c0e56594ad4fbec1e8edd3e9c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "19717b7bfa9911835e3c0085633f6dec5453da9a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This model has been previously studied and applied to problems ranging from population dynamics to astronomy [18, 19, 21] . In particular, the expected final epidemic size for this model is [18] :", "and the distribution of extinction times, from which the probability density of the duration of outbreaks is obtained as the derivative with respect to time,", "where", "This is a very general model, as we have only specified that the transmission rate b 0 is constant and that the rate of removal c(t) changes over time, consistent with the concept of societal learning." ] },{ "paper_id": "19744eafb1b8520fa460274845713451ad539e91", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Similar sequences or common structural/functional motifs are located collinearly in the carboxyl terminal glycoprotein of Sandfly fever virus and Sindbis virus envelope glycoprotein E1.", ":", ". . ." ] },{ "paper_id": "197489ce2e74e5566e1cd13fdce4a26b4eba45f6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MDCK, A549 and HEK-293T cells were purchased from the Cell Center, Institute of Basic Medical Sciences, Peking Union Medical College (Beijing, China) and cultivated in DMEM supplemented with 10% foetal bovine serum and 1% penicillin/streptomycin (all from Gibco).", "Animals. ICR mice (13-15 g) and Balb/c mice (18-22 g) were obtained from Vital River Laboratory Animal Technology Co., Ltd. in Beijing, China, and acclimated with standard feed and water in the following conditions (temperature: 20 \u00b1 2\u00b0C, humidity: 50 \u00b1 10%). All experiments were performed in compliance with the rules of the European Community Guidelines for the care and use of animals. The study was approved by the Ethics Committee at Institute of Chinese Materia Medica, China Academy of Chinese Medical Sciences.", "Disease Control and Prevention, Chinese Center for Disease Control and Prevention. The virus stock was prepared by infecting 10-day-old specific-pathogen-free embryonated chicken eggs (Merial Vital Laboratory Animal Technology Co., Ltd, Beijing, China) for 48 h at 35\u00b0C. The virus titre (expressed as 50% tissue culture infective dose, TCID 50 ) was calculated to be 10 \u22124.5 in the MDCK cells by the Reed-Muench method 64 ." ] },{ "paper_id": "19758fc382a2921a000c9d85a33300d3e3b0e2b4", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "(forward), 5\u2032-TCGTCCAGGTCGTCGTCATCC-3\u2032 (reverse).", "All results are expressed as the means and standard deviations (SD). Statistical analyses were performed using Prism 5.01 (GraphPad Software). Significance was determined by two-way ANOVA followed by Tukey's multiple comparisons test." ] },{ "paper_id": "197679559a6aa8d3f30bde60d9387f1f9f975c0a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Respiratory infections requiring hospital admission in surveillance centres in Bogot\u00e1, Colombia.", "In the group with more than one viral infection ( ", "A microarray diagnostic assay using CLART 1 PneumoVir equipment by Genomica (Madrid, Spain) was used to identify the viruses involved [6] . This assay detects and characterises viruses that most frequently cause respiratory symptoms in humans. The following viruses were analysed: Respiratory Syncytial Virus (RSV) A and B, Influenza A (H1N1, H3N2, 2009 A/H1N1 pdm), B and C virus, Parainfluenza virus subtypes 1, 2, 3, 4A and 4B, Metapneumovirus A and B, Adenovirus, Enterovirus, Rhinovirus, Coronavirus subtype 229E and Bocavirus. This kit amplifies specific fragments of the viral genome via a reverse transcription polymerase chain reaction (PCR) or via a PCR with hybridisation detection using specific capture probes [7] .", "At least one virus was identified in 63 patients (Table 3) . Influenza virus was the most common and was isolated in 28 patients (30.8%), of whom 21 (75%) had Influenza A and 7 (25%) had Influenza B (Table 3) . Of the Parainfluenza virus subtypes identified, five cases were PIV 3, and one case was PIV 1." ] },{ "paper_id": "198399348c2c6a7dafb438b3aaba23b43733b105", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "For all multivariable models, putative risk factors with P < 0.20 in univariable analyses were entered forward stepwise and retained in models if P < 0.05. Correlated variables were not included in the same model but deviance measures were used to evaluate changes in model fit to the data with each parameter independently. In all models, variables with < 3 categories were evaluated for difference in magnitude, direction, and significance of effect between categories using the likelihood ratio statistic and similar categories were collapsed. Overall model fit was evaluated using Hosmer-Lemeshow goodness-of-fit test and measures of information criteria. Incidence rate and odds ratios were estimated with 95% confidence intervals. Univariable and multivariable statistical analyses were conducted using STATA 13.1 SE (College Station, TX, USA)." ] },{ "paper_id": "1986b0795d747225509369644cec05194d09a43c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "2. Lysosome perturbants: bafilomycin A1 to inhibit the V-ATPase proton pump; chloroquine as a lysosomotropic alkalizing agent.", "The following five groups of compounds were tested:", "3. Cytoskeleton perturbants: nocodazole to depolymerize microtubules; latrunculin A to block actin polymerization; jasplakinolide to induce actin polymerization." ] },{ "paper_id": "1986e96f2be6bd012fcd4d0b731caf62c7a4dea2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Widely conserved pathways influenced by viroporin ion conductivity, and others that seem to be species-specific are now described and graphically summarized to facilitate their overview ( Figure 3 ).", "Taking into consideration the relevance of IC activity in viral production, and its direct effect in pathology and disease, ion conductivity and its pathological stimulated pathways can represent targets for combined therapeutic interventions.", "Taking into consideration the fast selection of drug-resistant viruses under drug pressure, the simultaneous inhibition of IC activity, and other signaling pathways stimulated by ion conductivity leading to pathology, may represent a better treatment option. Interfering with these pathological pathways constitutes a valuable approach, with the advantage that it is independent of the appearance of drug resistant viruses. Targeting exacerbated inflammatory responses, such as those triggered by IC activity leading to inflammasome activation in various respiratory infections, may reduce disease worsening and progression [23] . Novel specific inhibitors of NLRP3 inflammasome showing promising results for inflammatory diseases could be applied for these purposes [119] .", "Besides modifying cellular processes to favor virus propagation, the loss of ion homeostasis triggered by viral IC activity may have deleterious consequences for the cell, from stress responses to apoptosis [2, 14, 15] . That is why cells have evolved mechanisms to sense the ion imbalances caused by infections and elaborate immune responses to counteract viruses. Interestingly, the IC activity of several viroporins triggers the activation of a macromolecular complex called the inflammasome, key in the stimulation of innate immunity [16] [17] [18] [19] [20] [21] . Inflammasomes control pathways essential in the resolution of viral infections. However, its disproportionate stimulation can lead to disease. In fact, disease worsening in several respiratory viruses infections is associated with inflammasome-driven immunopathology [22, 23] ." ] },{ "paper_id": "198bdc284caeafc6bbff6f925f36eec10d3d033c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "for DIP entry with subsequent DIP replication in case of a co-infection.", "All datasets generated for this study are included in the manuscript/Supplementary Files.", "Cells total = T + I s + I d + I c" ] },{ "paper_id": "198ed53d956a2707716d175cc6516bb720f52d82", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "An instance of a class that contains unique properties" ] },{ "paper_id": "19a804b052b806f48b58c353d70c4bda178ad87f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The nucleotide sequences were first aligned in MAFFT v7.013 42 with published MERS-CoV sequences retrieved from GenBank. Phylogenetic trees were then inferred using the maximum likelihood method available PhyML version 3.0 43 assuming a general time-reversible model with a discrete gamma distributed rate variation among sites (Gamma 4 ) and a SPR tree swapping algorithm and visualized using MEGA version 6. 44", "The number of base differences per lineage and within lineage from averaging overall sequence pairs between groups were determined in MEGA6. The analysis involved 254 nucleotide sequences. Codon positions included were 1st+2nd+3rd+Noncoding. All positions containing gaps and missing data were eliminated. There were a total of 25 193 positions in the final data set. Evolutionary analyses were conducted in MEGA6. 44 ", "Next-generation sequencing data were analyzed using a custom workflow in CLC Genomics Workbench 8.5. Sequencing adapters were trimmed, then 26 bp were trimmed from each end to remove any residual PCR primer sequence. Remaining reads were trimmed from the 3\u2032-end using a CLC cumulative quality score of 0.05. Trimmed reads were aligned to a reference, either Jordan-N3/2012 (KC776174.1) or AbuDhabi_UAE_8 (KP209306.1). Consensus sequence was called based on regions that had 10 \u00d7 or greater coverage. Variants were called using the CLC consensus caller with cutoff values of 5, 10, 15 and 35%, with a minimum count of five reads. Further analysis of these sequences was performed with custom scripts written in-house at the CDC." ] },{ "paper_id": "19b9ee3dcd89f01eea3e48b333888b1ce70b296f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Second, there is a unique RNA replication mechanism using the TRS motif that is known as the ''copy choice'' mechanism, which induces homologous RNA recombination in CoVs [3] , [6] . Third, CoV possesses the largest genome (26-32 kb) among RNA viruses. Furthermore, heterologous recombination that Betacoronavirus subgroup A has the hemagglutinin esterase gene originated from influenza C virus [7] , [8] . These mutation and/or recombination events change viral properties, host range and pathogenicity.", "All animal procedures were conducted according to the Yamaguchi University Animal Care and Use guidelines and were approved by the Institutional Animal Care and Use Committee of Yamaguchi University. All efforts were made to minimize pain and suffering.", "CoVs frequently undergo mutation and recombination, and there are three reasons for this [4] . First, CoV RdRp has low fidelity. Although CoV encodes nsp14, which possesses 39R59 exonuclease activity for proofreading, the mutation rate approaches 2.0610 26 mutations per site per round of replication [5] ." ] },{ "paper_id": "19babdefd145a5becbc2a0b189eabdafa697de75", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "As the human population expands and societal changes occur, human contact with wildlife will continue to increase. This increases the risk that emerging zoonotic viruses, including CoVs, pose to human and animal health. Surveillance combined with scientific studies to better understand zoonotic CoVs and spillover will enable us to stay a step ahead of the next epidemic. ", "Ecological and epidemiological studies to identify landscape changes and human practices that could enable a coronavirus to spillover from bats are also necessary [103] . Such studies enabled researchers to decipher the transmission cycle of Nipah virus in Malaysia and Bangladesh, which led to public health policies to change farming practices to control the spillover of Nipah virus from bats [104] [105] [106] .", "Coronavirus accessory proteins are dispensable for replication but they play an important role in pathogenesis and virus fitness under the natural environment of a host [13, 91] . Multiple studies with PEDV, SARS-and MERS-CoVs have identified accessory proteins that can effectively inhibit an IFN response in mammalian cells [12] [13] [14] [91] [92] [93] [94] [95] . However, to date, there have been no published studies looking at the role of these accessory proteins in modulating antiviral responses in bat cells." ] },{ "paper_id": "19bbeefa3a126f32fe8339a1fb11e3d9a1c7881c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Citation: Warren CJ, Sawyer SL (2019) How host genetics dictates successful viral zoonosis. PLoS Biol 17(4): e3000217. https://doi.", "nature, there are just too many protein-protein interactions to master by chance in a random encounter with humans.", "in a remote part of the world with low population density, then the virus may falter very quickly." ] },{ "paper_id": "19d93173c328e9ca42bd4238ccb39aa8da818422", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The data underwent a quality assurance process and outlying or inconsistent data points were verified with the contributing investigators. All data were assessed for normality, with subsequent analyses performed using t-tests, non-parametric equivalents or analysis of variance.", "Over 100,000 patients are admitted to intensive care units (ICUs) in the United Kingdom (UK) per year." ] },{ "paper_id": "19dcbc62263225d430f506aa5745d23a66543de8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Preparation of monocyte-derived DC and treatment with recombinant gp120 treatment (gp120-DC)", "Table S1 Viral RNA copy numbers in the sera of HIV-1 infected individuals used for this study. Patient viral RNA copy numbers were retrieved from archived information. The following individual or pooled patient (#) samples were used to obtain the data shown in the respective figures: Figures ", "HIV-1 envelope protein gp120 binds to CD4 and chemokine receptors CCR5 or CXCR4 which are expressed by dendritic cells (DC) and which facilitate viral entry into the cells [1] . HIV-1 gp120 is also readily shed from the maturing virions [2] and forms immune complexes in the plasma of HIV-infected [HIV(+)] individuals [3, 4] ; consequently only a tiny portion (,0.1%) of circulating virions are actually infectious [5, 6] . HIV-1 gp120 additionally binds to DC-specific ICAM-grabbing non-integrin (DC-SIGN), initiating an intracellular signalling cascade that promotes viral infection and dissemination to T cells [7, 8] . A subset of CD14(+)DC-SIGN(+) DC has been identified in blood, which can bind HIV-1 and to transmit infectious virus to T cells [9] . The virus then actively replicates in activated CD4 T cells, which are chronically induced during HIV infection by various mechanisms [10, 11] ." ] },{ "paper_id": "19ddf65d65d5e172ac3ceda4662b68769633dbe6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ ", for i = 1, . . . , K ,", ", for i, j = 1, . . . , K .", "where" ] },{ "paper_id": "19df6a2ae9a9070dd15404465eed98ad222b27f0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The protease activity of cathepsins L, B and S in cells with or without GILT induction was determined by a fluorescence-based assay with selective substrate peptide conjugated with AFC according to the manufacturer's protocol (Bio-Vision Mountain View, CA, USA) as described previously [18] .", "In recent decades, cross-species transmission of numerous zoonotic viruses causes severe diseases in infected individuals and poses formidable threats to public health globally [1] [2] [3] . For example, outbreak of severe acute respiratory syndrome (SARS) in 2002/ 2003, caused by SARS coronavirus (SARS-CoV) transmitted from wildlife animal reservoirs, was associated with 774 deaths in 8096 infected individuals [4] . Ebola virus (EBOV) and Lassa virus (LASV) that cause Ebola disease and Lassa fever diseases, which are characterized with severe haemorrhagic fever, multi-organ failure, and high mortality rate, are currently circulating in West Africa and remain to be big challenges to medical community [5, 6] .", "All experiments were repeated at least three times with similar results achieved. For most figures, representative data or images were shown. Differences between control sample and tests were statistically analysed using oneway analysis of variance (ANOVA) with a Bonferroni adjustment for multiple comparisons. p-values less than 0.05 were considered statistically significant." ] },{ "paper_id": "19e45f3e51ee8f9151f7f3e901b2a579366abfd0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The current outbreak of ZIKV shows new modes of transmission with mother-to-fetus transmission and sexual transmission. Furthermore, infectious ZIKV has been detected in breast milk, and there are concerns of ZIKV transmission by blood products obtained from asymptomatic viremic persons or by organ transplantation.", "Given the time needed to develop and approve new antiviral drugs, clinicians are currently left empty handed in terms of targeted antiviral treatment for ZIKV infection. A major lesson from this outbreak and previous (re-)emerging RNA virus outbreaks is that we need safe, broad spectrum antiviral drugs that can be tested rapidly in phase III clinical trials during outbreaks to gain the time needed for the development of other control and prevention measures, particularly vaccines. " ] },{ "paper_id": "19e9c8796df362aa81ecfabf7730cfa4df5e5be6", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ethical approval for all of the capturing and sampling were confirmed by the competent authorities in the respective Federal Republic of Germany and Czech Republic. The Czech Academy of Sciences Ethics Committee reviewed and approved the animal use protocol No. 169/2011 in compliance with Law No. 312/ ", "A single M. myotis male was captured in Sloupsko-Sosuvske caves of the Moravian Karst (Czech Republic, coordinates 49u 249 40.880 and 16u 449 20.540). The bat was kept to minimize stress and handling between capture and euthanasia in a clean plastic box with soft mesh to enable roosting under temperature of hibernation torpor of 6uC and transferred to our laboratory at Veterinary and Pharmaceutical Sciences Brno (Czech Republic) within a day. It was anesthetized to insensitiveness using isofluranum (Isofluran, Piramal Healthcare, UK), and then transcription PCR (RT-PCR) using SV40T specific primers [35] . The protein expression was controlled by the immunofluorescence and western blot as described below. Briefly, cells were first fixed with 3% paraformaldehyde and permeabilized with 0.5% triton X. After washing with PBS, cells were stained with mouse anti-SV40T monoclonal antibody (Santa Cruz Biotechnology) and goat anti-mouse IgG Alexa Fluor (Invitrogen) as second antibody and visualized by fluorescence microscope. For western blot, the same mouse antibody was used as primary antibody and bound antibody was detected with goat anti-mouse IgG peroxidase (Sigma). Images were developed using the ECL kit (Thermo Scientific Pierce) according to the manufacturer's instructions.", "All data were presented as means 6 S.D. Statistical significant differences were analysed by one-way ANOVA using the SPSS software package. " ] },{ "paper_id": "19ebb3ea64083a71dcf7b9c2cd53bc49ec1a90ca", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "19eed2e91c17ea20e9cbda665e19fad13a948ecf", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supplementary Materials: The following are available online at www.mdpi.com/1999-4915/9/12/365/s1.", "The following plasmids were used: CD147 pLKO.1 lentiviral shRNA (A6) and non-target shRNA control plasmid (pLKO.1-NTC) were purchased from Open Biosystems (GE Healthcare, Little Chalfont, UK).", "CD147 " ] },{ "paper_id": "19f5eb39de2aef11b4e3b8c0fa4b92f048057d83", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The results indicate that cross ventilation by outdoor wind in central corridor inpatient ward could cause dispersion of infectious aerosols to indoor through airflow.", "Precautions are essential for every mode of unknown or known infectious diseases, especially in their early stages of outbreak. For example, the MERS-confirmed and MERS-suspected patients were quarantined in the negative pressure isolation wards that were primarily intended for airborne infection patients. The findings in this study can be used in initial epidemiological investigations and precautions, with respect to outbreaks of MERS or similar unknown infectious diseases.", "1." ] },{ "paper_id": "19ff77e874c0706f794908e9b6878314671d385a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1a0304e5340ef8d016dd2f73d730072c2559acbb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Protocols for animal experiments were approved by the Animal Experiment Committee of Nagoya University (The approval number: 13122).", "Cxcl2, Mm00436450_m1; Ccl2, Mm00411241_m1;" ] },{ "paper_id": "1a07962f8472f03e5159e01b742cf39295db17f5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The operating conditions of the mass spectrometer were dry gas temperature, 350\u00b0C, flow rate, 50 L/min; nebulizer pressure, 30 psi; sheath gas temperature, 250\u00b0C, flow rate, 10 L/min; fragmenter voltage, 100 V; capillary voltage, 3,500 V; mass range, 50 -1,100 D.", "All datasets generated for this study are included in the article/ Supplementary Material.", "statistical Analysis" ] },{ "paper_id": "1a12f8004e57cbdc497edada74fdfd8431f4a9eb", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: During respiratory viral infections host injury occurs due in part to inappropriate host responses. In this study we sought to uncover the host transcriptional responses underlying differences between high-and lowpathogenic infections.", "We assembled a compendium of microarray data from 12 studies that measured host transcription in mouse lungs following infection with respiratory viruses ( Table 1) . Six of these studies contained experiments where 100% of the animals succumbed to infection; these involved influenza A subtype H5N1 (\"avian influenza\"), reconstructed 1918 influenza A, or SARS-CoV strain icHC/SZ/61/03 (Table 1) . After merging technical replicates the compendium comprised 733 individual transcriptome measurements with similar numbers of arrays associated with LPIs, MPIs, and HPIs ( Figure 1 ). Data were quality-controlled, further pre-processed, and converted to genelevel data.", "Additional file 4: Table S2 . Digital signature genes by modulemapping." ] },{ "paper_id": "1a19bed3bfcb373626804c55b111ca79e812efd1", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The animal experiments in this study were approved by the Animal Ethics Committee (ACE) of the College of Life Sciences, Sichuan University (license: SYXK-Chuan-2013-185). All experiment procedures and animal welfare standards strictly followed the guidelines of Animal Management at Sichuan University.", "Purified VLPs were analyzed by SDS-PAGE, and three distinct protein bands were observed: An about 90 kDa band corresponded to rS, a 60 kDa band corresponded to rF, and a 25-35 kDa band corresponded to M (Figure 2A) .", "All the qPCRs were carried out quadruplicately." ] },{ "paper_id": "1a19e1b8f4e8c0fe67b2cab9eef2c95cfc44f5ed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In 2014 the World", "of the limitations of these assessment systems and the flaws in biosecurity regimes and pandemic triage systems built on such entanglements of knowledge and practice.", "De Cock, a former director of the WHO's Department of HIV/AIDS and an expert on neglected tropical diseases with more than thirty years experience in the field, believes it was the evacuation of the American missionaries to Emory Hospital, coupled with the presentation in late September of a Liberian national infected with Ebola at Dallas Presbyterian Hospital, Texas, that finally shifted global perceptions of Ebola as 'some kind of obscure virus that you read about from time to time. . . [to being] an issue for global health security'. 100 292" ] },{ "paper_id": "1a29f97fc037ea6456b41d054e5603fbd4f76e94", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Supporting Information S1 " ] },{ "paper_id": "1a2c3991a18171055b98f12c29a2c1f5d5fef1bd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A gene pool of bat SARS-related coronaviruses PLOS Pathogens | https://doi.", "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111" ] },{ "paper_id": "1a383f04a8ddfeba2113f27e82c41d0582feb276", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "EI is a highly contagious virus and outbreaks of influenza may necessitate the cancellation of race meetings and other equestrian events [2] . However, in 1981, mandatory vaccination against EI was introduced for Thoroughbred racehorsesin Ireland and since then, no race meetings have been cancelled due to EI. However, outbreaks continue to occur in vaccinated horses, and young racehorses are particularly susceptible [3] [4] [5] . The return to athletic normality can be prolonged by damage to the mucociliary clearance mechanism and secondary bacterial infections [6] .", "A Chi-squared test was used to test the association of seroconversion with subsequent failure to race. The data was summarised in 2 \u00d7 2 contingency tables and an analysis was conducted in the R statistical software package version 3.5.1. The statistical significance was set at \u03b1 = 0.05.", "EHV-1 and -4 circulate in horse populations worldwide and are associated with respiratory disease in horses, immunosuppression, reduced performance, abortion and occasionally, neurological disease [7] [8] [9] . Although there is no mandatory vaccination programme for EHV-1 and -4 in Ireland, some trainers vaccinate their horses in an effort to reduce the virus challenge in their yards.", "There is a need for serological surveys to identify the viruses associated with economic loss in the racing industry. Longitudinal surveillance studies contribute to our understanding of the epidemiology of equine respiratory diseases in different countries and in different populations of horses. The aim of this serological study was to identify respiratory viruses circulating amongst elite racehorses of different ages in a training yard in Ireland and to determine their impact on health status and ability to race." ] },{ "paper_id": "1a465d982030d8f361dc914ff2defa359fdbe5f9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "demonstrated largely among camels and people in the Middle East 12 and travellers who visited the region could occasionally seed the virus to long-distance destinations in the Europe, Southeast Asia, and North America 9,13,14 .", "To detect putative recombinant regions in the MERS-CoV genome, we used the RDP4 program (v.4.39) 36 with a default (window size: 30 bp) and a higher window size of 1,000 bp, and the results obtained were confirmed by a manual bootscan method. Using the recombination breakpoints detected in the KOR002 strain by the default setting, we compiled new sequence datasets by dividing the complete genome sequences into five non-recombinant fragments. We subsequently reconstructed the phylogenetic relationships in each region using a maximum likelihood method (GTR+ I+ \u0393 , 500 bootstrap replication) implemented in MEGA5 37 . The trees were visualized using FigTree (v1.4.2)." ] },{ "paper_id": "1a485210a47a7eb2d39964a350d68ae52368c1df", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Additional file 1: Table S1 . Predicted genes of WIV19 and comparison to those of known adenoviruses. (DOCX 20 kb)", "Homologous recombination has been demonstrated to be an important evolutionary mechanism for AdVs, especially for HAdV-D members [20] . However, no signals of recombination were identified in the WIV19 genome, using RPD4 and SimPlot software [21, 22] .", "The potential host range of WIV19 was evaluated using cell infectivity assays. Seven cell lines were tested: A549 (human lung, ATCC CRM-CCL-185), HEK-293 T (human embryonic kidney, ATCC CRL-11268), NCI-H292 (human lung, ATCC CRL-1848), LLC-MK2 (Macaca mulatta kidney, ATCC CCL-7), MsIn (Miniopterus schreibersi intestine), RlKi (Rousettus leschenaulti kidney), and RsKi (Rhinolophus sinicus kidney) [24] . Cytopathic effects were observed in LLC-MK2, RsKi, and all three human cell lines, indicating that WIV19 has a wide host range." ] },{ "paper_id": "1a485fe46f5c18e940782aa60bb756d6ae2a6c0b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1a52cac849bdb5840d115cf513ec8cc63dc2d56c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "https://doi.org/10.1371/journal.pone.0186034.g002", "https://doi.org/10.1371/journal.pone.0186034.t003" ] },{ "paper_id": "1a5bdcd1c259d4b40800f9e96219641aafd5f6b9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Coronaviruses are enveloped, plus-stranded RNA viruses that cause widespread disease in humans and animals. They tend to infect just one or a few closely related species and in their natural host exhibit marked tissue tropism. Often, the respiratory or gut epithelia are specifically targeted, causing localized infection, but disseminated infections leading to systemic disease are also seen. Together with toroviruses, arteriviruses and roniviruses, coronaviruses are members of the order Nidovirales .", "The species specificity of coronaviruses is, to a large extent, determined by the recognition of a functional receptor on the surface of the host cell (Kuo et al., 2000) ." ] },{ "paper_id": "1a5c7512b0e842a7b5f1d1511d0f035a0dbc3c25", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "RUNX1b plays a crucial role in development of myeloid and lymphoid lineage cells. It was originally identified at a break point on human chromosome 21 in the t(8;21) translocation. It is a most common target of chromosomal translocation in human leukaemias [16, 27] including acute myeloid leukaemia, B-cell acute lymphoblastic leukaemia and T-cell lymphoblastic leukaemia [28, 29] . Importantly, RUNX1b is involved in transcriptional regulation of several genes including cytokines and chemokines like IL2, IL3, GM-CSF, MIP-1a, CSFR etc. [19, 23, 30, 31, 32, 33, 34, 35] . It synergises with other transcription factors to activate transcription [36, 37, 38] and acts as a transcriptional activator or repressor depending upon its association with co-activators such as CBP, p300, MOZ [39, 40] and co-repressors, mSin3A [41] , TLE1 [42, 43] and NCoR [28] ." ] },{ "paper_id": "1a5f2c3f99d3607bf9170dcda0c54bc1b4400f6a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Implementation of analytical methods. All statistical and network analyses were implemented in the R computing environment 51 . Network analyses were implemented using the Network Analysis and Visualization (igraph) package 52 . Linear regression and descriptive statistics were calculated using base functions in R. Standard deviations and confidence intervals of proportions were calculated using the score interval approximation method 53 ." ] },{ "paper_id": "1a7751b196054ed357f5a0f16eeac17ad2def269", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Animal studies were reviewed and approved by the ", "\"Contrat de Plan Etat-R\u00e9gion\" (CPER) grant named \"Infectio\"; and the \"Fondation pour la Recherche M\u00e9dicale\" (FRM, https://www.frm.org/). M.F. was supported by a PhD fellowship from the Government of Pakistan (Higher Education Commission). A.F. was supported by a PhD fellowship from the \"R\u00e9gion Bretagne\". M.S.E. was supported by a PhD fellowship from \"R\u00e9gion Bretagne\" and \"Minist\u00e8re de l'Enseignement Sup\u00e9rieur et de la Recherche\".", "Data were expressed as means \u00b1 SEM for all mice treated similarly. Mean differences between experimental groups were assessed using the non-parametric Mann-Whitney U-test. Statistical analysis for the in vitro experiments were performed using the unpaired Student's t-test. All statistical analysis was achieved with the GraphPad Prism5 software. Significance is shown as follows: *P < 0.05, **P < 0.01, ***P < 0.001." ] },{ "paper_id": "1a7d600387654c0315c076f74d8479adb4403d75", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The authors declare no conflict of interest." ] },{ "paper_id": "1a8daad89d2701b4cf603e668f6aab1209b6237e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1a9fdd51745b132ee92107b4e9c68597d3767b7e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "In 2002, the Uganda Ministry of Health piloted a new district level monitoring system in the southwestern highlands. Incoming clinical data from health centers are collated and entered onto a district level computer and compared with a baseline of historical illness data. An anomaly measure is used to provide the index of deviation, followed by electronic reporting. This simple system detected two malaria outbreaks in Kabale, in 2005 and 2006, more than two weeks before case numbers began to peak [20] .", "Syndromic surveillance often involves automated electronic reporting and statistical algorithms that sometimes require a complex information technology infrastructure. However, syndromic surveillance does not need to be highly computerized or technical; its tools can be simple, using few technological or human resources, and can complement existing surveillance programs [5] ." ] },{ "paper_id": "1aa091c222e1c37ab245b60ed6432ab597480149", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This study was approved by the UW IRB (Study No. 00002488).", "Metadata such as the setting of care can potentially be gleaned from the type of microbiological organism sequenced. Pathogens of high public health importance-for which much high impact phylodynamic analysis has recently been performed-are likely to be tested for early in admission and may show higher correlations with admission date. For instance, both Ebola virus tests sent to our clinical laboratory in 2014 were sent the day of admission.", "The original identifiers obtained included name, medical record number, date of birth, sex, location of patient when the sample was collected, the classification of patient encounter (inpatient, outpatient, emergency room, or outside), sample collection date, patient admission date, patient discharge date, accession number, order code, order name, test code, test name, test result, and result time. All identifiers except sex, location, classification, admit date, discharge date, and collection date were expunged from the working dataset, although the original dataset was retained for chart review of select cases to ensure data validity.", "The degree of identifiability of a given patient or case can be fundamentally unknowable, especially when there exists a continuum of other metadata sources either on the Internet or in the community (Sweeney 2013) . Genomic sequences in NCBI's Genbank also frequently feature other sample collection information, like sex, age, and sampling hospital which can be combined with other information inherent in the sequence to reduce the statistical obscurity of these data by a very large degree. Different organisms, from Ebola virus and Pandoraea apista to human herpesvirus 2, may have different degrees of identifiability and different degrees of stigma associated with them. All of these give a strong rationale for the growing role and importance of Expert Determination for de-identification of data (Meyers et al. 2017 )." ] },{ "paper_id": "1ab0742b23affe5d2f9a5adc6b98e3f89defd930", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Bacterial, fungal, and mycobacterial cultures of endotracheal aspirates and BAL fluid were performed. Respiratory viruses were tested by a multiplex reverse-transcription polymerase chain reaction (PCR) assay using a Seeplex RV15 ACE Detection kit (Seegene Inc., Seoul, Korea) and/or shell vial culture. PCR to detect Mycoplasma pneumoniae, Chlamydophila pneumoniae, and Legionella pneumophila, and a urinary antigen test to detect Streptococcus pneumoniae and L. pneumophilia serogroup 1 species were also performed.", "Pneumonia was defined as the presence of an acute infiltrate on a chest radiograph and at least one of the following: fever (temperature $38.0uC) or hypothermia (temperature ,35.0uC), cough, pleuritic chest pain, dyspnea, and altered breath sounds on auscultation [15] . Pneumonia was categorized as communityacquired pneumonia (CAP), healthcare-associated pneumonia (HCAP), or hospital-acquired pneumonia (HAP), as defined previously [16, 17] ." ] },{ "paper_id": "1ac9aac4ecdf40363f1377cc08484db3dc4abf93", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Sample collection. Blood samples were collected on \u03ea7, 0, 3, 7, 10, 14, 17, 21, 28, 35 , and 42 days postinoculation (dpi) from the jugular vein or cranial vena cava using a single-use blood collection system (Becton Dickinson, Franklin Lakes, NJ) and serum separation tubes (Kendall, Mansfield, MA). Serum was separated by centrifugation at 1,500 \u03eb g for 5 min, aliquoted into 2-ml cryogenic tubes (Greiner Bio-One GmbH, Frickenhausen, Germany), and stored at \u03ea80\u00b0C until use.", "tality in piglets in TGEV/PRCV-naive herds. The virus was first described by Doyle and Hutchings in 1946 in the United States and subsequently reported worldwide (1) (2) (3) . Porcine respiratory coronavirus is a naturally occurring spike gene deletion (170 to 190 kDa) mutant of TGEV first isolated in Belgium in 1984 (4) . It infects the upper respiratory tract, tonsils, or lungs, with limited intestinal replication (4, 5) . Porcine respiratory coronavirus itself does not appear to be an important primary pathogen, with the exception of its contribution to the porcine respiratory disease complex (6) ." ] },{ "paper_id": "1adab26eb1167a39014dc503174f7d34f9087664", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Rabbit polyclonal antibodies against Bax, Bcl-X L (B-cell lymphoma-extra large), caspase-3, caspase-8, cavoelin-1, CD4, CD28, cytochrome c, FADD (Fas-associated protein with death domain), Fas, FLIP ((FADD-like IL-1\u03b2-converting enzyme)-inhibitory protein), p53, Zap-70 (zeta-chain-associated protein kinase 70), and GAPDH (Glyceraldehyde 3-phosphate dehydrogenase were from Santa Cruz Biotechnology (Santa Cruz, CA, USA). AP-1, ERK (extracellular-signal-regulated kinases), JNK (c-Jun N-terminal kinases), p38, NFAT, and NF-kB p65 were bought from Cell Signaling Technology, Inc. (Danvers, MA, USA). All other chemicals were from Sigma (St. Louis, MO, USA).", "The data are expressed as copy numbers/mL. Known concentrations of HIV-1 (MN) viral RNA (serially diluted: 10 8 to 100 copies) were used as templates and quantitative RT-PCR performed to generate a standard curve. Each value represents the average concentration of six reactions in triple isolated repeats based on the standard curve.", "Cell viability was determined by Trypan blue exclusion analysis (Life Technologies, Waltham, MA, USA).", "Proteins were isolated from the culture of Jurkat cells with RIPA buffer (1\u02c6PBS, 1% (v/v) NP-40, 0.5% (w/v) sodium deoxycholate, 0.1% (w/v) SDS, 0.1 mg/mL PMSF, 30 \u00b5L/mL aprotinin, 1 mM sodium orthovanadate). Equal amounts of protein were boiled in the loading buffer (100 mM Tris-HCl, 200 mM DTT, 4% SDS, 0.2% bromphenol blue, 20% glycerol) and separated on SDS-PAGE and blotted onto polyvinylidene difluoride membranes. For immunoprecipitation (IP), 1 \u00b5g of antibody was added to 500 \u00b5g of total protein in 500 \u00b5L, rotated for 2 h at 4\u02ddC, then incubated with 20 \u00b5L of protein A-sucrose beads (Santa Cruz Biotechnology) for another 2 h, spun down at 500\u02c6g, and washed three times with RIPA buffer. The data represented are from three independent experiments." ] },{ "paper_id": "1adf578fb1c7019c2293b2e9c7cc3f036f9bc15b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "poor immunogenicity of candidate vaccines. For practical and compliant purposes, a single immunization with the highest immunogenicity in animals and humans will be preferred.", "As summarized in Table 2 , most of the aforementioned strategies require multiple immunizations which may pose additional logistic hurdles at the end point use. It is unclear whether these immunization strategies were empirically designed or due to relatively # Abbreviations for animal models: human DPP4 transgenic (hDPP4-Tg) mice with global/epithelial hDPP4 expression, human DPP4 knock-in (hDPP4-KI) mice with hDPP4 replacing mDPP4 in situ, mice transduced with human adenovirus 5 vector expressing hDPP4 (Ad5-hDPP4 mice), and non-human primates (NHPs).", "\u2191 indicates more, while \u2193 indicates less.", "* Efficacy in the specific animal model listed in the previous column. If studies are conducted in multi-animal models, only results in the highest-level model are shown. Neutralizing antibody (nAb)." ] },{ "paper_id": "1aea04847a4f34625beaf937ca06ff039a5d3a2e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Macrocystis pyrifera (Linnaeus) C. Agardh was collected in Bah\u00eda de Ensenada (Manto Jantay) in front of the Salsipuedes beach (31. ", "The discovery of antivirals with high efficacy, low cost, and low cytotoxicity is a long-pursued goal in drug discovery. The marine environment is a wealthy source of biological and chemical diversity of natural antivirals; the investigation of natural antivirals isolated from marine sources is an interesting approach in the development of new antiviral agents [1] .", "The strategy of simultaneously attacking multiple targets is a studied approach in the control of viral diseases [11] . Combining targeted therapies have demonstrated multiples advantages in this field, such the reduction of individual drug doses, the decrease in the side effects of antiviral agents, and the prevention of the emergence of drug-resistant viruses [12] ." ] },{ "paper_id": "1aeb1b6c5213c80ebd33f69021776928ee1fc315", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The MHC-B region was examined in an Australorp population for an influence in avian leukosis virus (ALV) group-specific (gs) antigen shedding related to virus infection. Haplotype frequencies for three MHC-B haplotypes were B8a = 66.7%, B9a = 15.6, and B21 = 17.8% in a base population. The data supported differential susceptibility to horizontal virus transmission based on MHC-B complex type but no MHC-B effect on vertical transmission (Yoo and Sheldon, 1992) .", "Investigations into disease responses have been carried out in various ways. Some compare responses in inbred congenic and sometimes MHC-B recombinant lines. Others examine populations in which MHC-B types are segregating either in selected lines or, occasionally in natural or semi-natural populations. Here we attempt to provide a very brief overview of investigations into MD as well as diseases caused by Rous sarcoma virus (RSV), v-src DNA, other viruses, several bacterial infections, coccidiosis, and an infestation with avian ectoparasites. More information is available for the role of MHC-B in MD and RSV than in other diseases.", "This finding further highlights the resistance conferred by B2 haplotype." ] },{ "paper_id": "1aec943a21b8dc9decd07bd0039e10e5bd87ef00", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The samples were fixed in 4% neutral formalin for 72 h at room temperature and subsequently dehydrated through a graded ethanol series and then cleared with xylene and finally embedded in paraffin. Serial tissue sections were cut at 4 lm thickness and six non-successive sections mounted on each slide (Fisher Scientific, USA). The sections were deparaffinized, rehydrated and rinsed in distilled water. Finally, they were stained with haematoxylin for 5 min and then eosin for 40 s, dehydrated and mounted.", "a,b", "Different letter superscripts mean significant difference (P < 0.05). " ] },{ "paper_id": "1aef4c8a0b31ddf10ab37a448fc90808218fa9d8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1af8d169cf2d572b46f2b94b1e83c66686973297", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Ramachandran plot also supported the quality of monomeric MBL protein model.", "Deleterious and damaging effect of nsSNP was predicted using web based tools SIFT (Sorting Intolerant from Tolerant) and Polyphen-2 (Polymorphism Phenotyping v2).", "Muster v1.0 (http://zhanglab.ccmb.med.umich.edu/ MUSTER/) provides the Z-score and complete full length models by using Modeller v8.2 (Wu and Zhang 2008) . The corresponding template is considered good if the calculated Z-score is greater than 7.5." ] },{ "paper_id": "1af9746ea8f584f3f58da4f59d6dba8185f8be4b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "( Then," ] },{ "paper_id": "1b02698e082376846f59c99c449161a7a7eb737f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Mice B6.Drak2 -/mice were previously described and backcrossed 19 generations to C57BL/6 [1] . OT-II mice were obtained from Kristin Hogquist, TGF-\u03b2DNRII mice were obtained from Hongbo Chi, C57BL/6, CD451/1, and OT-I mice were purchased from Jackson Laboratories. Mice were held under specific pathogen-free conditions at St. Jude Children's Research Hospital.", "Drak2 is a serine/threonine kinase expressed highest in T cells and B cells.", "All studies were reviewed and approved by the St. Jude Animal Ethics Committee under protocol number 486-100303-05/14. St. Jude is AAALAC accredited and complies with all federal, state, and local laws." ] },{ "paper_id": "1b050ba5ac020c50042f89a5f4936404ab2f507f", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Basic reproduction number R 0" ] },{ "paper_id": "1b08674379f9805e1ab55ce13c056b716433b8a2", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "https://doi.org/10.1371/journal.pcbi.1006554.g005 the performance of the method (mean average between sensitivity and specificity greater than 93%, Fig 5C) ." ] },{ "paper_id": "1b1b133fc211d0bf8af604d58bedafd5fac7cde9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "DF1 cells seeded onto Thermanox coverslips were transfected and processed as before. Sections 250 or 300 nm thick were cut from the resin-embedded blocks and collected on 50 mesh copper hexagonal grids coated in formvar or pioloform-coated copper slot grids. Ten or 15 nm gold particles were applied to the grids to serve as fiducial markers for subsequent alignments. Data was recorded on a JEOL 2100 F TEM (Jeol, Welwyn Garden City, UK) used at 200 kV with a TVIPS F416 digital camera, or on a Tecnai 20 TEM (FEI) used at 200 kV with a FEI 4 k \u00d7 4 k Eagle CCD camera. Samples were mounted in a JEOL high angle tilt holder or a Fischione double tilt tomography holder, respectively. A single axis tilt series was collected using Serial EM or FEI software. Each single axis tilt series was collected over 100 \u2022 to 130 \u2022 in increments of between 1 \u2022 and 2.5 \u2022 and subsequently aligned and reconstructed in IMOD [43] .", "BeauR. DF1 cells were infected with BeauR for 24 h, fixed, and processed for electron microscopy (EM). Viral particles are indicated with arrowheads, double membrane vesicles (DMVs) with asterisks, and zippered endoplasmic reticulum (zER) and associated spherules with arrows. Scale bar represents 500 nm.", "Supplementary Materials: The following are available online at http://www.mdpi.com/1999-4915/10/9/477/s1, Table S1 : Cells expressing each nsp compared to the total number of cells counted, Video S1: Electron tomographic reconstruction of paired membranes in an nsp4-expressing cell, Video S2: Electron tomographic reconstruction of paired membranes in an nsp3 and nsp4-expressing cell. " ] },{ "paper_id": "1b2079db92924c2ee758d437394789b4822d0327", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Informed consent was originally obtained by the National Health Research Institutes in Taiwan. To avoid the potential for ethical violations related to the data, the privacy of each individual's information was protected by de-identifying the data. Thus, informed consent was not required, and an exemption was obtained from the institutional review board of Chi Mei Medical Center (IRB No. 10402-E01).", "The categorical variables that are presented as frequencies and percentages were compared using Pearson's \u03c7 2 test. Continuous variables, presented as means \u00b1 standard deviation (SD) or medians with an interquartile range, were compared using Student's t test or the Wilcoxon rank-sum test. The Cochran-Armitage trend test was used for categorical data analysis to test the association of trends in proportions over specific periods. Cumulative mortality during the first 90 days of each patient's hospital stay was characterized using Kaplan-Meier plots, with the log-rank test used for the comparisons between genders and between different age groups. SAS 9.3 (SAS Institute, Cary, NC) was used for all statistical analyses but the Kaplan-Meier curves, which were plotted using STATA 12 (Stata Corp., College Station, TX). Significance was set at p < 0.05 (two-tailed).", "Based on their first two ICD-9-CM discharge diagnosis codes, six major comorbid diseases for hospitalized patients treated with IABP were identified: acute coronary syndrome (ACS), " ] },{ "paper_id": "1b21437159e00cfbc7a48cfb1cc4c27a818e2157", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Conceptualization: Mario Recker.", "OPEN ACCESS" ] },{ "paper_id": "1b248ec38c2c12737c005fd38db1bec556675707", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "File S1 Supporting Tables. Table S1 , List of 403 cytotoxic siRNAs which caused significant cell death. ", "Six wells of a 96 well plate were transfected with a siRNA SMARTpool and, 48 h later, infected with VACV-A5eGFP as described above. At 24, 36 and 48 h post infection cells were scraped into the overlying media, collected and then frozen and thawed three times and sonicated for 30 seconds (Misonix sonicator 3000). The resultant lysate was titrated on BS-C-1 cell monolayers and virus titre quantified as plaque forming units (PFU) per ml [19] .", "VACV, like all other viruses, harnesses the cell to enable its replication. It turns off or subverts multiple crucial anti-viral pathways including cytokine production, Toll-like receptor pathways, NF-kB activation and the dsRNA PKR response [2] [3] [4] [5] [6] [7] [8] . In addition VACV suppresses both intrinsic and extrinsic proapoptotic pathways [9] and activates numerous anti-apoptotic, pro-survival pathways including the PI3K/Akt pathway [10, 11] , the MEK/ERK pathway [12, 13] , the p38 MAPK pathway [14] and the MAPK/JNK pathway [14, 15] . Modulation of so many different signalling pathways prevents viral-induced premature cell death and contributes to the ability of poxviruses to replicate in a wide range of cell types.", "The AMP-activated kinase complex (AMPK) is a key regulator of energy metabolism. It is activated by a reduction in ATP which prompts phosphorylation of many target proteins, resulting in the activation of catabolic pathways and inhibition of anabolic pathways [73] . It has also been linked to regulation of the actin cytoskeleton [74] . AMPK is a heterotrimer comprising a catalytic a subunit and regulatory b and c subunits. In mammals each subunit has several isoforms (PRKAA1, PRKAA2, PRKAB1, PRKAB2, PRKAG1, PRKAG2, and PRKAG3) [73] . The druggable RNAi screen reported here screened all seven genes and identified three (PRKAA2, PRKAB1, and PRKAB2) as promoters of VACV replication whose depletion led to fewer and dimmer accumulations of cytoplasmic eGFP (Figure 6d ). This result is in broad agreement with a recently published RNAi screen of 440 cellular kinases and phosphatases in a nonpermissive Drosophila cell model of VACV infection [36] , which identified seven hits including three AMPK subunits." ] },{ "paper_id": "1b2d0c795271b2dffeba58396e52cca462185d78", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1b3ea086b81a5e0c4dd22aa41653befc358d7163", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Data from multiple timepoints was analyzed by ANOVA and Dunnett's multiple comparisons post test, using GraphPad Prism version 5. Microarray data was analyzed by one-way ANOVA, and Benjamini and Hochberg FDR method was used for multiple testing correction. p,0.05 was considered statistically significant.", "The Kikwit 95 isolate of ZEBOV was produced and titrated on Vero E6 cells as previously described [6] .", "ZEBOVForward -CAGCCAGCAATTTCTTCCAT; ZEBOVReverse-TTTCGGTTGCTGTTTCTGTG; ZEBOVProbe FAM-ATCATTGGCGTACTGGAGGAG-CAG-NFQ.", "Gross pathology was most prominent in the lungs. The pneumonia was distributed primarily in the dorso-caudal lobes and was characterized by consolidation and haemorrhage affecting more than 70% of the lung tissue." ] },{ "paper_id": "1b41bb775aaf552e944aceaa31f52814e264c78d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Treatment of a variety of human ailments using mAbs is revolutionizing our ability to ameliorate human suffering. For infectious disease, the Ebola epidemic highlighted the potential utility of a cocktail of three neutralizing (n)mAbs that block infection by the Ebola virus [29] . Most convincingly, the administration of a single nmAb up to five days post infectious virus exposure prevents the development of disease in Ebola-infected macaques [30] . Because mAbs can be engineered to prevent antibody-dependent enhancement by incorporating the L234A and L235A (LALA) mutations which reduce Fc\u03b3R binding [31] , they are a promising intervention in flaviviral therapies. Our long-term goal is to use a cocktail of LALA-mutated nmAbs to prevent ZIKV infection in at-risk individuals, primarily pregnant women.", "Unfortunately, despite our efforts, we were unable to map P1F12's binding site. We first employed an in vitro escape assay [65] , which did not result in a single mutated consensus sequence. Also, P1F12 did not bind to the prM/E proteins expressed in cells, precluding our ability to map this interaction using an Ala-mutated envelope panel [66, 67] . Characterizing this interaction will, thus, require a significant effort that is beyond the scope of the current manuscript. Because the P1F12 mAb retains the ability to bind virions, our conclusion is that it binds to a conformational epitope.", "Therapeutic nmAbs must be potent in order to be clinically viable, and most nmAb isolation strategies are based on the identification of high-titer, antigen-selected repertoires. Somatic hypermutation (SHM) in germinal center (GC) B cells provides the basis for selection of B cells producing Abs with increased affinity-a hallmark of the adaptive humoral response. This feature is conserved among mammals, highlighting the importance of Ab affinity enhancement for evolutionary fitness [32] . Thus, it is unsurprising that the vast majority of human Abs in the memory immunoglobulin (Ig)G pool have undergone affinity maturation and have, on average, 10-26 nucleotide substitutions from precursor genes [33] . The contribution of SHM to Ab-mediated viral neutralization is particularly clear for the chronicallyinduced broadly neutralizing antibodies to HIV [34] [35] [36] [37] . Reversion of these anti-HIV nmAbs to precursor germline antibodies results in a drastic reduction or complete loss of viral neutralization [38] [39] [40] [41] . Although mutated mAbs are found after secondary DENV infection, the role of these mutations in acute virus-neutralization and clearance is less clear [42] [43] [44] [45] . Still, the prevalent thought is that antiviral Ab response involves the engagement of poor-or non-neutralizing germline clones generated by V(D)J rearrangement, followed by SHM-mediated refinement in germinal centers to enhance neutralization potency.", "Cerebrospinal fluid analysis and an electroneuromyogram were performed on fourth (D10) and fifth (D11) days after neurological symptom onset, respectively; the results were within normal limits. The electroneuromyogram was repeated on the 15 th day of neurological symptoms, but no significant abnormalities were noted despite the persisting weakness in the patient's left leg and arm. During the treatment with IVIG, the patient presented with transient worsening of her hemiparesis, but progressively recovered over the course of weeks after discharge from the hospital. At 32 days post-neurological symptom onset (D38), a physical exam revealed significant improvement of muscular strength and abolished deep tendon reflexes in the lower limbs. The remittent skin rash cleared completely 10 days after its initial emergence. Blood, cerebrospinal fluid and urine samples were collected on the 5 th day of neurological symptoms (D11) for detection of ZIKV by RT-PCR. The urine sample was ZIKV-positive by PCR, while blood and cerebrospinal fluid were negative. A saliva sample collected on D15 was negative for ZIKV." ] },{ "paper_id": "1b42f78eee63e2f5c5a58a59759dc119ef1f73da", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Additional file 1: Table S1 . Physical-chemical characteristics of PAMAMs used in this study.", "The development of nanotechnology has rapidly accelerated, with an estimated market of approximately one trillion US dollars within the next few years [43] . Safety problems associated with nanomaterials have recently attracted attention, highlighting the urgent need for protocols that protect workers, consumers, and the environment [44] . We propose here a valuable strategy using ARB drug to address potential acute lung injury might be induced by application of PAMAMs.", "mouse \u03b2-actin forward primer: 5'-CTCTCCCTCAC GCCATCC-3' mouse \u03b2-actin reverse primer: 5'-CGCACGATTT CCCTCTCAG-3' mACE2 forward primer: 5'-GGCTACAACTATAAC CGTAAC-3' mACE2 reverse primer: 5'-TATCCATCAACTTCC TCCTC-3'.", "All PAMAM dendrimers, carbon nanotubes, and inorganic nanoparticle powders were purchased from Sigma-Aldrich PAMAM nanoparticles were air-dried on a super-clean bench for 24 hrs to remove the methanol before an equal volume of PBS was added to the tube. The samples were mixed and stored at 4\u00b0C before use. The anti-ACE antibody (2E2) was purchased from Santa Cruz Biotechnology, Inc. The anti-ACE2 antibody (clone 460502) and recombinant human ACE2 protein were purchased from R&D systems. The anti-\u03b2-actin antibody (clone AC-15), angiotensin II (human), losartan and Evans blue were purchased from Sigma-Aldrich. HS-PEG-COOH (Mw = 2000 Da), HS-PEG-NH2 (Mw = 2000 Da), and HS-(CH2)11-EG6-OH (Mw = 468 Da) were purchased from Shanghai Yare Biotechnology, Inc. 1-(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride (EDC), N-hydroxysuccinimide (NHS), ethanol, NaOH, and ethanolamine were purchased from Sigma-Aldrich. All these reagents were used without further purification. Milli-Q water was obtained from a Millipore \u2212 ELIX water purification system. All buffers and reagents used were degassed and filtered prior to use in the SPR experiments." ] },{ "paper_id": "1b482a5e57ac1d83844e7204c907109483603516", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Coronaviruses (CoVs) are found in a wide variety of animals in which they can cause respiratory, enteric, hepatic, and neurological disease of varying severity. In humans, CoVs cause a large fraction of common colds [1] , as well as more rare, but serious disease such as the outbreak of Severe Acute Respiratory Syndrome (SARS, caused by SARS-CoV) in 2003, and the polymerase (RdRp) were generated using methods described in [14] or [15] , and sequences generated in this study have been deposited in GenBank under accession numbers KT882615-28. Resulting sequences were aligned using the MAFFT algorithm [16] implemented in Geneious R7 (Biomatters, New Zealand). The nucleotide substitution model was determined in MEGA 5.2 [17] and maximum likelihood trees were constructed using PhyML [18] with aLRT branch support in SeaView [19] . Trees were projected using FigTree v1.4 [20] .", "A total of 764 birds from 11 species of Anserifomes (ducks, geese, swans, n = 691) and 11 species of Charadriiformes (gulls, terns, shorebirds, n = 143) were sampled in this study. Overall, the prevalence of CoV was high, at 18.7%, but species, groups and orders were unevenly represented. Diving ducks had the highest prevalence (39%), driven by high prevalence in Greater Scaup (Aythya marila; 51.5%), however the sample size was small (n = 37). Dabbling ducks of the genus Anas also had high prevalence; Mallard, in particular, had a prevalence of 19.2%. While Anseriformes had the highest prevalence, in the order Charadriiformes, CoV was detected in a Black-headed Gull (Chroicocephalus ridibundus), but absent in tern and wader species sampled (Table 1) . Eleven sequenced Mallard CoV and three sequenced Scaup CoV were gammacoronaviruses.", "Despite few studies, small samples sizes and differences in prevalence, what is clear, is that in the Northern Hemisphere waterfowl species, especially dabbling and diving ducks are important in the epidemiology of avian CoVs. It is interesting to note that these patterns are very similar to those found in low pathogenic influenza A viruses: high prevalence in waterfowl and gulls in the Northern Hemisphere [30] , and little host species and temporal structuring within waterfowl derived viruses in the conserved polymerase genes (such as PB2, PB1) [31] . Further, detection in fecal or cloacal samples suggest these viruses may also replicate in the gastrointestinal tract, which is the true for Turkey Coronavirus [9] . As demonstrated by years of influenza sampling [32] , to better understand the eitiology, epidemiology and ecology of these viruses more systematic surveillance needs to be undertaken and more viruses need to be sequenced, particularly full genomes. Given the importance of coronaviruses as human pathogens, as exemplified by SARS and MERS-CoV and the potential for wild birds as reservoirs, spreaders and mixing vessels, further studies of coronaviruses in wild birds are warranted. " ] },{ "paper_id": "1b5d310d0656503b1d2fbc612625496a3266ae16", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Week 12 (Panels E and F). Signal strength against 141 and 327 increased in sera from Week 5 post-infection (Panel C), but returned to pre-immune levels by Week 9 (Panel D).", "Although the samples were boiled in SDS-buffer containing 2-mercaptoethanol, putative dimeric and trimeric forms of the HA protein are apparent as slower-migrating species.", "Week 26 following the final HA immunization at Week 10." ] },{ "paper_id": "1b62107420aac57e1b7e2d496183036dec1ab905", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "From the AirPath point of view, to carry out an exposure assessment -that is, to estimate and measure the amount of infectious pathogens entering our bodies through inhalation -is already a complex and multidisciplinary science without the added component of using exposure data and disease outcomes to predict risk factors. We think that Air-Path has contributed towards forming a technical network, as shown in the output in Table 1 , as well as a medical network to further clarify a comprehensive and systematic exposure assessment. ", "Detection and identification of pathogens has changed since the development of different molecular methods and innovative approaches other than culture methods [5] . The existing detection methods can be divided into two levels: generic and specific. Generic detection gives information about whether the particles are biological materials, microbes or living cells, e.g. bioluminescent measurement of ATP using continuous flow luminometer and mass-spectrometry. Specific methods such as micro-arrary and immuno-assays can tell us what kind of microbes are detected and identified. Other new techniques have been proposed for bio-detection, for instance, by characterising the size and shape of bioaerosols, pollens and fungal spores under microscope [18] and analysing fluorescence spectrum of bacteria [5] .", "Transport/Transmission models Epidemiology studies can link disease cases together and develop a disease transport and transmission model [8] ." ] },{ "paper_id": "1b64709bd4f9ba56a4209bd32c07a89d1beec6c7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Smallpox is a category A bioterrorism agent, despite being declared eradicated in 1980 [1] . The virus is retained in high security biosafety level 4 laboratories in the United States and Russia [2] . The variola genome is fully sequenced and could be synthesized in a laboratory [3] . This a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "Results showed for 95% of new infected isolated.", "https://doi.org/10.1371/journal.pone.0217704.g005" ] },{ "paper_id": "1b64cf541af6560335b092dc63f67dd4cd81691a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Nucleic acid was extracted from swabs or respiratory samples using EZ1 Virus mini kit (Cat No. 955134, Qiagen, Germany) performed on a semi-automated system (EZ1, Qiagen, Germany), and stored at -70\u00b0C for more detailed molecular testing. Besides routine standard clinical testing, additional multiplex real-time PCR testing was performed for each extracted sample.", "Abbreviations APACHE II: Acute Physiology and Chronic Health Evaluation II; CAP: Community-acquired pneumonia; PCR: Polymerase chain reaction", "Anyplex ", "Patients with shock requiring vasopressor support, mechanically ventilated or who have 3 out of 9 minor criteria for pneumonia severity as defined by the Infectious Diseases Society of America/American Thoracic Society, are considered to have severe CAP [15] . The 9 minor criteria include: respiratory rate of 30 breaths per minute or greater; PaO 2 /FiO 2 ratio equal or less than 250; multi-lobar pulmonary infiltrates; confusion or disorientation; blood urea nitrogen equal or greater than 20 mg/dL; leukopenia with white blood cell count of less than 100,000 cells/mm 3 ; hypothermia indicated by core body temperature less than 36\u00b0C; hypotension requiring aggressive fluid resuscitation." ] },{ "paper_id": "1b7c700ee3a33c0a675a5f7e71a20ce62467b900", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "described here, and also its immunogenicity, if it is to be used as a candidate HIV-1 vaccine.", "Approximately 50 to 100 ng of recombinant plasmid was electroporated into host A. tumefaciens GV3101::pMP90RK cells as described by Maclean et al. [52] Recombinant A. tumefaciens colonies were selected on plates incubated at 27\u00b0C containing kanamycin (30 \u03bcg/ml), rifampicin (50 \u03bcg/ml) and carbenicillin (50 \u03bcg/ ml).", "This work was carried out using 2-4 week-old Nicotiana tabacum cv. Petite Havana SRI plants grown in a greenhouse under a 16 hr light and 8 hr dark photoperiod at light intensity of 60-80 \u03bcE/m 2 /s and 22\u00b0C." ] },{ "paper_id": "1b8a085682d10dad4baf90417a8cbcde144cc8c9", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Analysis of residues is performed, and the ACF model must show the nonexistence of a significant autocorrelation or a partial autocorrelation between residues. The Portmanteau test could be applied as a complementary means to evaluate the adjustment; a positive test might indicate an inadequate model (15) .", "Some parameters can present no statistically significant values (p\u22650.05); in such cases, these parameters could be taken away from the study in order to improve the arrangement of data.", "A avalia\u00e7\u00e3o do gerenciamento de doen\u00e7as infecciosas e n\u00e3o infecciosas pode ser realizada por meio da an\u00e1lise de s\u00e9ries temporais. Com isso, espera-se que sejam medidos os resultados e previstos os efeitos da interven\u00e7\u00e3o sobre a doen\u00e7a. Os estudos cl\u00ednicos t\u00eam se beneficiado do uso dessas t\u00e9cnicas, visto a grande aplicabilidade do modelo ARIMA. Esse texto apresenta de maneira resumida o processo de uso do modelo ARIMA. O uso dessa ferramenta anal\u00edtica oferece grande contribui\u00e7\u00e3o para os investigadores e gestores de sa\u00fade na avalia\u00e7\u00e3o das interven\u00e7\u00f5es de sa\u00fade em dadas popula\u00e7\u00f5es.", "A stationary series has a \"white noise\" when mistakes consist of a sequence of uncorrelated random variables. One can understand white noise in errors as the inexistence of patterns, which is equivalent to establishing that mistakes are not correlated. The partial ACF (PACF) is used to measure the associative degree between an observation ( ) and an observation made in two periods before ( ) removing the intermediate period ( ) (15) . PACF enables the evaluation of the correctness degree of current variables with its previous values, whereas other constant values are kept." ] },{ "paper_id": "1b8bd44173742cd254617aabc5fdf20fb98f4072", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Background: Lower respiratory tract infection (LRTI) is a major cause of pediatric morbidity and mortality, especially among non-affluent communities. In this study we determine the impact of respiratory viruses and how viral co-detections/infections can affect clinical LRTI severity in children in a hospital setting.", "Demographics were summarized as mean or median and range according to their distribution. Characteristics among groups were compared, accordingly, using twosample t-test, Mann-Whitney, Chi-square or Fisher's exact test.", "This study was approved by the local Institutional Ethics Committees (06/03467 -Pontif \u00edcia Universidade Cat\u00f3lica do Rio Grande do Sul and 4856/2004 -Universidade de S\u00e3o Paulo). Parents or legal guardians read and signed an informed consent approved for this study." ] },{ "paper_id": "1b92fda04723ae9d30a58f10b054cc1b7971e870", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cell lysates were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (BioRad, Hercules, CA), and were transferred onto a PVDF membrane (Millipore, Billerica, MA). The membrane was treated with an anti-cystatin C or anti-actin antibody (Santa Cruz Biotechnology, Santa Cruz, CA), and then with a horseradish peroxidase-conjugated protein G (BioRad). Protein G-bound polypeptides were visualized by ECL Western blotting detection reagents (GE Healthcare, Buckinghamshire, UK).", "Total RNA was isolated from cells by using TRIsol reagent (Invitrogen). First strand cDNA was synthesized from the total RNA with random hexamers by means of a reverse transcriptase (TaKaRa). Semi-quantitative PCR was performed using the first strand cDNA as a template to detect cystatin C, cathepsin B, and GAPDH mRNAs. The nucleotide sequences of the PCR primers (Genenet) for the cystatin C mRNA were 59-TCC TAG CCG ACC ATG GCC-39 and 59-CGG TAC AGA CCC CTA GGC-39, those for cathepsin B mRNA were 59-GTG TAC CAA CAC GTC ACC GGA-39 and 59-CAG GCC CAC GGC AGA TTA-39 [19] , and those for the GAPDH mRNA were 59-AGG TCG GAG TCA ACG GAT TTG GT-39 and 59-GTG GGC CAT GAG GTC CAC CAC-39.", "Target cells were pretreated with inhibitors for 4 h, and then starved in presence of inhibitors for 1 h. Cy3-conjugated transferin (4 mg/ml) (Jackson Laboratories) was added, and incubated for 10 min. Surface-bound transferin was removed by trypsin treatment of the cells for 15 min. Fluorescence intensities of the cells were measured by a flow cytometer (BD Biosciences)." ] },{ "paper_id": "1ba33d95f798c3f591766786b165215875278bc7", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Raw sequences were analyzed and edited in Geneious Pro v5.1.7 and MEGA 5.03. Multiple sequence alignments were constructed using ClustalW and phylogenetic comparisons made using Neighbor-Joining (NJ) and maximum likelihood (ML) algorithms. ModelTest was used to select the most appropriate nucleotide substitution model. Support for branching order was evaluated using 1,000 nonparametric bootstrap support. Sequence identity was calculated using uncorrected p-distances in PAUP* and BLAST.", "The USFWS specimens from 2006 included an additional 20 NHP tissues from 16 individual animals including 10 baboons (Papio sp.) and 6 African green monkeys (AGMs; Chlorocebus sp.) all confirmed by phylogenetic analysis.", "Nucleic acids were extracted from 10-30 mg of tissue using mechanical disruption (Qiagen tissue lyser II or Next Advance Inc Bullet Blender), followed by proteinase K treatment until complete digestion of the tissue was achieved. Purification of subsequent homogenates was performed using the Qiagen All-Prep DNA and RNA extraction kit or DNeasy Blood and Tissue kits according to the manufacturer's instructions. Nucleic acid quality was determined using the Agilent BioAnalyser (Agilent RNA nano 6000) or \u00df-actin PCR as previously described [16] .", "New SFV, herpesvirus, and mtDNA sequences identified in the current study have been deposited at GenBank with the following accession numbers: JF810903-JF810914 and JF828317-JF828329. Sequences less than 200 bp are available upon request." ] },{ "paper_id": "1bab633e4d3ab1ed30599369e8654c235256c5cd", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Hematology. For monitoring of hematological parameters, hearts were punctured and blood was collected in EDTA tubes. Numbers of lymphocytes (Lym), granulocytes (Gr), and monocytes (Mon) in the blood were determined immediately by using a VetScan HM5 hematologic system (Abaxis)." ] },{ "paper_id": "1bb908e3833b1882de4b7a04593005dbe9e5cd1e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1bd1b038d7ed985902aeef21bc1493eda76cdab5", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Human erythrocytes were separated from whole blood of healthy donors. After isolation and washing, 50 \u00b5l of a 0.75% human red blood cell (RBC) suspension was added to 50 \u00b5l volumes of 2-fold serial dilutions of purified rHA proteins in a U-bottom 96well plate (BD Falcon, USA; total volume, 100 \u00b5l). Agglutination was read after incubation for 60 min at room temperature. As a control, phosphate-buffered saline (PBS) was used instead of rHA.", "All data are presented as the means \u00b1 SEMs. Measurements at single time points were analyzed using ANOVA, and if these measurements demonstrated significance, they were further analyzed by a two-tailed t-test. Survival data were subjected to Kaplan-Meier survival analysis. All statistical tests were performed with GraphPad Prism 5.0 (GraphPad Software, San Diego, CA, USA). P < 0.05 indicates statistical significance.", "Western blotting following viral infection. Data are presented as the means \u00b1 SEMs. *P < 0.05, **P < 0.01 and ***P < 0.001, Student's t-test.", "Tenfold dilutions of the virus were used to inoculate MDCK cells in a 96-well plate, and infected cells were maintained in culture for 72 h. Viral titers were calculated using the Reed-Muench method and are expressed as the tissue culture infectious dose (TCID50) per milliliter of supernatant." ] },{ "paper_id": "1bd2f6497996fc0fccd8dffd7f84846d3d36f964", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "F laviviruses are taxonomically classified in the genus Flavivirus and family Flaviviridae.", "These viruses comprise over 70 different pathogens, such as Japanese encephalitis virus (JEV), Zika virus (ZIKV), dengue virus (DENV), West Nile virus (WNV), and yellow fever virus (YFV). Most flaviviruses are arthropod borne and cause public health problems worldwide (1) . The development and usage of vaccines against some flaviviruses, such as JEV, YFV, and tick-borne encephalitis virus (TBEV), have decreased the rates of morbidity and mortality from infections caused by these viruses (2) ; however, flavivirus-induced diseases are still pandemic, and few therapies beyond intensive supportive care are currently available.", "Flaviviruses have an approximately 11-kb positive-stranded RNA genome containing a single open reading frame (ORF) flanked by untranslated regions (UTRs) at both termini. The ORF encodes three structural proteins, including the capsid (C), membrane (premembrane [prM] and membrane [M] ), and envelope (E), and seven nonstructural proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) (3) . These seven nonstructural proteins participate in viral replication, virion assembly, and virus escape from immune surveillance." ] },{ "paper_id": "1be8f67d3b7d2730be96799adfc38746474b0a3b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Total RNA was extracted from AMs using TRIzol reagent (Life Technologies, Paisley, Scotland, UK), reversetranscribed to cDNA, and amplified by PCR with the following primers: porcine Fas (sense: ", "The terminal deoxynucleotidyl transferase (TdT)mediated dUTP nick end-labeling (TUNEL) assay was performed according to the manufacturer's instructions (in situ cell death detection kit, fluorescein; Boehringer Mannheim, Mannheim, Germany) and counterstained with 1% Hoechst 33258 (Sigma) as described previously [14] . " ] },{ "paper_id": "1bebd833b3535712b5d13f9ed985e3491d3c96c8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Vero cells (continuous cell lineage originated from the kidney of African green monkeys) were grown in Leibovitz-15 (L-15) culture medium (Invitrogen, New York, USA) supplemented with 10% Fetal Bovine Serum (FBS), 1% L-glutamine 200 mM, 1% penicillin G (100 U/mL), streptomycin (100 g/mL) and 10% triptose 2", "2.6. Viral RNA Extraction. Viral RNA was extracted from 140 L of each supernatant sample using the QIAamp Viral RNA kit (QIAGEN, USA) according to manufacturer's directions.", "Thus, as chloroquine is considered a safe and effective drug, used to treatment many diseases, including malaria, their therapeutic use is promising because it was shown in this study that the drug has significant antiviral effect on the replication of dengue-2 virus in cells culture.", "The Scientific World Journal phosphate. Vero cells were maintained at 37 \u2218 C and 5% CO 2 . C6/36, an Aedes albopictus cell line, was cultured in L-15 medium supplemented with 10% FBS, L-glutamine, 10% triptose phosphate, 1% penicillin G (100 U/mL), streptomycin (100 g/mL), at 28 \u2218 C in the absence of CO 2 ." ] },{ "paper_id": "1bef85a33a74c3d1765752da0e715fc3a46e00d8", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Concept, design, data acquisition, data analysis and data interpretation. AL, PB, PC: Concept, design, data analysis and data interpretation. YSL, RH, JB: Concept, design, data interpretation. AR: Concept, design, data acquisition. AT, MB, ALQ, YK, VD: Data acquisition; data analysis and data interpretation. Drafting or revising manuscript. PC, AT, AL, PB, JB, YSL: Drafting and revising. AR, MB, RH, ALQ, YK, VD: Revising. All authors read and approved the final manuscript.", "Not applicable.", "Author details" ] },{ "paper_id": "1c07f420a5a01bec7481025a89f2621596a99782", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "V.M. and R.B. wrote the paper.", "The authors declare no conflict of interest.", "Viruses 2015, 7 4462" ] },{ "paper_id": "1c0ae4beee003ecb59ff15f81ed8f22cd9451353", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Finally, another open-format item asked about habitual actions taken when sick or dead poultry was found on the farm.", "If Nepal were hit by pandemic flu as a consequence of re-assortment or adaptive mutation of the virus and ensuing full human-to-human transmissibility, consequences could be severe. Depending on the planning scenario, fatality numbers are estimated between 15,000 and 130,000 and large numbers of people in need of clinical care might be faced with a severe shortage of hospital beds [4] . Beside the expected toll on human life, a pandemic is bound to incur disastrous economic losses in a country where sectors like farming and tourism, which make a significant contribution to the overall economy, are expected to be particularly hard hit [5, 6] .", "In January 2009 Nepal faced the first localized outbreak of highly pathogenic avian influenza (AI) among poultry, followed by a second outbreak in another area in February of the same year [1, 2] , but no human cases were registered [3] ." ] },{ "paper_id": "1c2e5c34faa703640900893c58254c63361bd29b", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Epitope-based immunizing agents are often an inexpensive choice to thwart enteric Shigella infection. The identification of specific epitopes derived from infectious pathogens has considerably advanced the event of epitopebased vaccines (EVs). Higher understanding of the molecular basis of substance recognition and human leukocyte antigen-(HLA-) binding motifs has resulted in the advancement of rationally designed vaccines that solely depends on algorithms predicting the peptide's binding to human HLA.", "Y K S N NQ Y K S N NQ Y K S N NQ Y K S N NQ Y K S N NQ Y K S N NQ", "Transporter of antigenic peptide SMM:" ] },{ "paper_id": "1c363c20418dda4f6c674f6d7af16f92b5dce974", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1c39727d1bf8a4e67e43fccecf8dafcd9b960b70", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Unless otherwise noted, statistical analyses were performed using Student's two-tailed t test. Difference was considered statistically significant at P < 0.05. Data Availability. The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request." ] },{ "paper_id": "1c3e28d4bd170a986bb5566cb9f9616410f67763", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1c5b9b791b402f44f6229f9d420d6a10dc173d39", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Yu Ping Feng (YPF) decoction, a classic herbal formula, has been used in clinics to treat various diseases, such as respiratory tract infection 8,9 , nosocomial pneumonia 10 , chronic bronchitis 11 , and perennial allergic rhinitis 12,13 .", "Understanding the scientific basis and therapeutic mechanisms of herbal formulas from traditional Chinese medicines (TCMs) is essential since they play a vital role in complementary and alternative therapies in clinical practice to cure diseases or restore the whole-body balance; additionally, they provide a rich source for drug discovery. Owing to the complexity of the constituents in TCMs, reductionism, which individually considers each ingredient, cannot adequately explain the effects generated by an entire formula, and therefore faces several challenges comprehending and illustrating the mechanisms of herbal formulas. With the rapid development of bioinformatics, a combined attempt based on system/network biology and polypharmacology has created a new paradigm called network pharmacology (NP).", "In recent years, NP has been proposed as a promising approach for understanding herbal formulas 1,2 and predicting potential new drugs or targets 3-5 . To some extent, NP-based research on the underlying therapeutic mechanisms of herbal formulas has been well-accepted 6,7 and accounts for the strong compatibility of different scales of systems. A distinct advantage of network analysis is that it can excavate underlying information from multilevel interactions, especially when dealing with big data." ] },{ "paper_id": "1c5f2a7a584371461fa19a49e49c99ecd0ef7743", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "A total of 70 rectal swab samples were collected from 70 piglets infected with PEDV from October 2010 to March 2012. These infected piglets were chosen from 16 different swine farms located in 6 different provinces in China. Samples were subgrouped according to the geographic regions ( Table 1 ). The rectal swabs were soaked in PBS buffer supplemented with penicillin G (10,000 IU/mL) and streptomycin (2 mg/mL) and centrifuged at 1,500 \u00d7g for 15 min to collect the supernatant fluids. The supernatant fluids were stored at -80 \u2218 C until used.", "RNA was extracted from the supernatant using TRIzol Reagent (Invitrogen Corp., Carlsbad, CA, USA) following the manufacturer's instructions. Briefly, the supernatant (200 L) containing PEDV was mixed with 1 mL of TRIzol Reagent. Then, 200 L of chloroform was added to the mixture, and the suspension was centrifuged for 15 min at 12,000 \u00d7g. The RNA-containing aqueous phase was precipitated with the same volume isopropanol, maintained at -20 \u2218 C for 1 h, and centrifuged for 10 min at 12,000 \u00d7g. The resulted RNA pellet was washed with 1 mL of 75% ethanol, centrifuged for 10 min at 12,000 \u00d7g and dried, and resuspended in 30 L of diethyl-pyrocarbonate-(DEPC-) treated deionized water.", "Step Buffer, 2 L each specific primer (10 pmol), 2 L PrimeScript 1", "were performed with reverse transcription at 50 \u2218 C for 30 min and predenaturation at 95 \u2218 C for 5 min, followed by 35 cycles of denaturation at 95 \u2218 C for 1 min, annealing at 50 \u2218 C for 1 min, and extension at 72 \u2218 C for 1 min, and a final extension step of 72 \u2218 C for 10 min. For the M gene, the amplification conditions were the same as above; however, the annealing temperature used was 56 \u2218 C for 1 min. RT-PCR products were visualized via electrophoresis in a 1.5% agarose gel containing ethidium bromide. Bands of the correct size were excised and purified using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 3.0 (TaKaRa Biotechnology Co., Ltd., Dalian, China) following the manufacturer's instructions. The purified products were sequenced by BGI Biological Engineering Technology & Services Co., Ltd. (China, Shenzhen).", "PED, caused by PEDV, is a highly contagious, enteric disease of swine. The main symptoms are vomiting, dehydration, and a high mortality in piglets [1] . PED is a serious health problem in suckling and nursing pigs that are typically 1-2 weeks of age. The mortality rate can be as high as 100% in 10-day-old or younger piglets. Pigs of all ages are susceptible to PEDV infection [2, 3] . PED occurrence has been reported in many countries, including Japan, Korea, France, Belgium, and Switzerland [4] [5] [6] ; it was first reported in China in 1976 [7] . Since late 2010, millions of piglets have been killed in China during PED outbreaks, which significantly affected the pork meat supply and price [8] . PED becomes a severe disease and has led to a significant loss in the swine industry." ] },{ "paper_id": "1c60d93cd686bb14fac65510ad3de47cf8b9332c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Although C31 is not more potent against all Flaviviridae than against HCV, this compound represents a good candidate for further chemical optimizations.", "Drugs. Alisporivir (ALV) and ledipasvir (LDV) were purchased from AGV Discovery (Clapiers, France), while cyclosporine (CsA) was purchased from Sigma-Aldrich (St. Louis, MO, USA).", "(This work was presented as an oral communication at HCV2016, the 23rd International Symposium on Hepatitis C Virus and Related Viruses, Kyoto, Japan, 11 to 15 October 2016.)" ] },{ "paper_id": "1c7230a768a9650c409a13c25b42dcf5f7f3392c", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Step 3: The emulsion is broken and double stranded library beads are magnetically collected.", "Step 2: PCR is conducted within the droplets.", "The dissociation constant of the novel structure switching aptamers was slightly stronger (4.1 \u00b5M) than that of the aptamer on which the initial library was based (5 \u00b5M) [16] . These relatively high K d are understandable given the size and hydrophobicity of steroid molecules and the fact that simple unmodified DNA aptamers were used.", "The developments in ePCR, described in the section above, have allowed for the generation " ] },{ "paper_id": "1c7b536966e355206379e97fd0e8ef71d71fb143", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Re-use of this article is permitted in accordance with the Creative Commons Deed, Attribution 2\u00b75, which does not permit commercial exploitation. R. A. Velarde et al.", "Sequences (N = 35) representing the diversity of NR2E, 2B, and C/D subfamily proteins were aligned using CLUSTALX (Jeanmougin et al., 1998; Hall, 2001) . The multiple sequence alignments were then inspected and manually refined with JalView (Clamp et al., 2004) . Only complete sites were used for the phylogenetic analysis. Phylogenetic tree reconstruction was performed using the minimum distance heuristic algorithm in PAUP* v4.0b10 (Swofford, 2003) .", "In addition to identifying and/or reconstructing orthologs for each of the Drosophila receptors, we also identified a nuclear receptor not present in any Drosophila sequence database. This receptor has relatively high sequence similarity to the photoreceptor-specific nuclear receptor (PNR) of vertebrates, and will be discussed in detail in a subsequent section." ] },{ "paper_id": "1c7c9d9c03f404119c5cc1dd98e0ebe17ea3bb3e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "a1111111111 a1111111111 a1111111111 a1111111111 a1111111111", "For RNA sequencing (RNAseq) quality and integrity of total RNA was controlled on Agilent Technologies 2100 Bioanalyzer (Agilent Technologies; Waldbronn, Germany). The RNAseq library was generated from 500 ng total RNA using Dynabeads mRNA DIRECT Micro Purification Kit (ThermoFisher) for mRNA purification followed by ScriptSeqv2 RNA-SeqLibrary Preparation Kit (Epicentre) according to manufacture\u00b4s protocols. The libraries were sequenced on Illumina HiSeq2500 using TruSeqSBS Kit v3-HS (50 cycles, single ended run) with an average of 3 x10 7 reads per RNA sample.", "Human subject research. Human primary hepatocytes were isolated from liver specimens obtained after partial hepatectomy of adult patients, following written informed consent of the patients (approved by the ethic commission of Hannover Medical School/Ethik-Kommission der MHH, #252-2008)." ] },{ "paper_id": "1c7d1097a0fc23516fc084e127333ec4bbf9ca94", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Chlorpromazine is an anti-psychotic drug that interferes with EBOV infection [86] , probably by inhibiting the internalization of virions [87] ." ] },{ "paper_id": "1c7db6e51155dadaaffd563ef1e560011b25ae92", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Prob(sustained transmission | m imported cases, \u03b3 i ) (4)", "The risk of sustained transmission given multiple imported cases was calculated by considering the possibility that none of those cases led to sustained transmission. Consequently,", "The infectious agent driving the ongoing pneumonia outbreak (the 2019-nCoV) appears to have transitioned from animals into humans, with the Huanan seafood wholesale market in Wuhan, China, representing the most likely source [1] [2] [3] [4] [5] . Since then, cases have been recorded in other countries, and initial estimates suggest a hospital fatality risk of around 14% [6] , although estimates of disease severity early in an outbreak are often imprecise [7] [8] [9] . Even countries without confirmed cases have been on high alert. For example, even prior to the two cases in the United Kingdom on 31 January 2020, officials were reported to be attempting to trace as many as 2000 visitors that had travelled to that country from Wuhan [10] ." ] },{ "paper_id": "1c857d4493720168ac6eba2bbeb2fbfa31433d91", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Table S1 Distribution of FCGR2A SNP (rs1801274) in atopy + and atopysubjects. (DOC) ", "Conclusions: FccRIIA and FccRIIB functional polymorphisms may have a role in the pathogenesis of allergy." ] },{ "paper_id": "1c8a0fb2f60c243f71d16d5fefb5b51d7978869e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Venom allergen acid phosphatase (Api m 3)", "Major royal jelly protein 9 precursor (Api m 11)", "The " ] },{ "paper_id": "1c8afcb822dac8e8e5b33a85c2c2e9c7cc24a25a", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The GenBank accession number for the MD27 sequence is FJ008695. The accession numbers for other IBV gene sequences used in this study are as follows: (a) complete structural genomes: ", "DNA from various clones was sequenced by dideoxy chain termination method using an automated DNA sequencer (Applied Biosystems Inc., Foster City, CA). At least three independent clones were sequenced for each amplicon to exclude errors that can occur from RT and PCR reactions. The assembly of contiguous sequences was performed with the GeneDoc software [32] . Comparative sequence analyses of MD27 with other IBVs and coronaviruses were conducted using the BLAST search, NCBI, and Vector NTI Advance 10. Phylogenetic analyses were carried out using the MEGA4 program [33] . The phylogenetic tree was constructed from aligned nucleotide and amino acid sequences using the neighbor-joining method with 1000 bootstraps.", "Virus isolation was done in Dr. Marquardt's laboratory by passaging tissue (trachea or kidney) homogenates into 9-10-day-old chicken embryos by the allantoic cavity route of inoculation and at S1 S2 3a 3b E M 5 N 3'UTR X X X X SE17-like SE17/JMK-like Conn -like Ark99/ Gray/? Conn-like Putative recombination site least three passages were done before declaring samples as negative. Two of the isolates were named as Md27, and these were propagated by inoculating into 9-day-old embryonated specific-pathogen-free (SPF) chicken eggs and allantoic fluid was collected 72 h post-inoculation. The fluid was clarified by low speed centrifugation and clear supernatant was stored at -80 \u00baC until further use.", "Numerous IBV serotypes, such as Arkansas, Massachusetts, Connecticut, Florida, Georgia and others, referred to as variants, exist in the United States of America (USA). These variants have practical significance for controlling the disease because immunity following infection or vaccination with one serotype often is not protective against subsequent infections with heterologous serotypes [7, 8] . Many serotypes have been described for IBV, probably due to the frequent point mutations that occur in RNA viruses and also due to recombination events [9] [10] [11] . It is essential to characterize field isolates for the selection of appropriate vaccine strains." ] },{ "paper_id": "1c956bc94ce590a7ca6c2ace2c0766bbbbfaa0e3", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Keywords: hepatitis A virus; soybean agglutinin linked-magnetic bead separation; lectin; oyster", "All statistical analyses was carried out using SPSS software (IBM Corp., Somers, NY, USA) [51] and Excel software (Microsoft Corp., Redmond, WA, USA) [52] . All samples were analyzed in triplicate and represent three independent experiments to ensure assay consistency. Analysis of variance was used to compare groups. Significant differences among means were determined using Tukey's HSD test. Values of p < 0.05 were considered significant.", "Viruses are a major cause of foodborne illness, due in large part to the contamination of shellfish by hepatitis A virus (HAV) [1] . HAV, the prototype of the Hepatovirus genus within the Piconaviridae family, is composed of an icosahedral capsid that contains a positive sense single-stranded RNA genome [2, 3] . HAV infection is associated with the consumption of virus-contaminated bivalves, including oysters, clams, cockles and mussels, which accumulate the virus from seawater as they filter-feed [4] . Moreover, the increasingly widespread incidence of oyster-related HAV infection is attracting greater attention to the mechanisms underlying the interaction between HAV and oyster [5] ." ] },{ "paper_id": "1c995ac4ae70bbcc5da53211e20df4398d1ce55d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Cleavage of the caspase substrate was monitored using a spectrofluorimeter (Hitachi F-2000 fluorimeter, Hitachi LTD, Tokyo, Japan) at excitation/emission wavelengths of 380/460 nm. Activity was expressed as fluorescence units per milligram of protein per min of incubation.", "Autophagy vesicles were detected in RHDV-infected hepatocytes by transmision electron microscopy", "For transmission electron microscopy (TEM) analysis, liver tissues were dissected into 1-mm 3 pieces for good penetration of the fixative, and then immersed in a modified Karnovsky fixative (2% glutaraldehyde + 4% buffered formalin (0.1 mol/L phosphate buffer)) overnight. The samples were post-fixed in 2% osmium tetroxide for 2 h at 4\u00b0C and dehydrated with ascending grades of alcohol. The tissue block was then infiltrated and embedded in epon resin at 60\u00b0C for 72 h. Ultrathin sections (70 nm) were cut with an automatic ultra-microtome (Reichert Ultracut E, Vienna, Austria) using a diamond knife. The sections were collected on copper grids (200 meshes) and stained with uranyl acetate and lead citrate solutions. TEM images were obser ved under a transmission electron microscope (JEOL Ltd, Tokyo, Japan) operating at an accelerating voltage of 80 kV." ] },{ "paper_id": "1ca045bd7724943ce8c268353153bd522358625d", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "normalized positions showed no systematic effects (supplementary Fig. S3 ).", "We then grouped the epitopes retrieved with the query by viral species. As described below, we want to map all epitopes from one species to a single reference proteome. Therefore, we excluded all viruses for which we do not have reference proteomes available, resulting in a total of 93 different viruses.", "To derive a measure of epitope position that is independent of protein length, a normalized position, x, is defined as follows:" ] },{ "paper_id": "1cb0c02329d10e7513faabdc57113172591d5406", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The sequencing data has been deposited to NCBI Sequence Read Archive (SRA) under accession numbers: SRR10292736 to SRR10292741." ] },{ "paper_id": "1cbc073d7288259db8f24cd19ee27052c1eece02", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "UPR-Cytokine Intersection Impacts Infection and Autoimmunity", "Frontiers in Immunology | www.frontiersin.org March 2018 | Volume 9 | Article 422 acute phase response (37) . For a basic summary of the three UPR pathways, see Figure 2 .", "Overall, the precise role of UPR pathways in supporting or limiting IFN or other cytokine production during viral infection, and the ultimate effect on pathogenesis remain important areas for further investigation.", "Spondyloarthritis encompasses a group of genetically and pathologically related inflammatory diseases which manifest with axial (spinal) arthritis, enthesitis, uveitis, gut inflammation, and psoriasis (219) . SpA is highly linked to an MHC protein HLA-B27 that misfolds during biogenesis: in patients with the prototypic SpA, ankylosing spondylitis, 80-90% of subjects are HLA-B27 positive vs 6% of the United States population (220, 221) . Although ankylosing spondylitis is a polygenic disease, the presence of HLA-B27 accounts for the preponderance (67%) of the currently identified heritability, conferring an odds ratio of >50 (222, 223) . This misfolding propensity and prolonged association with BiP in the ER results from specific amino acids in its peptide-binding B pocket and unpaired cysteines (224) (225) (226) . The subtypes of B27 with differential disease association also exhibit variance in biochemical features including thermos-stability, folding rates, and intracellular aggregation (227) (228) (229) .", "The \"danger\" hypothesis was initially conceived to address issues with adaptive immune (T and B cell) self-non-selfdiscrimination. However, this same conceptual requirement for damage that provides context for dendritic cell activation and T cell stimulation may also help with several other specificity issues in innate immunity. Consider the microbiome: humans are widely covered on external and internal surfaces with trillions of microbes that constitute our natural microflora. Microbialassociated molecular patterns (MAMPs) also stimulate PRRs. For instance, theoretically, the same TLR4 that recognizes LPS on an invading pathogen could also be triggered by gut gram-negative bacteria. However, in the absence of tissue damage or stress, the healthy steady-state microbiome does not normally trigger inflammatory responses." ] },{ "paper_id": "1ccc635c4d6c62091bbf7df3f8e4f36803ea1a32", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The Reoviridae family consists of two subfamilies: Spinareovirinae and Sedoreovirinae, including 9 and 6 genera, respectively. These are icosahedric non-enveloped viruses with a segmented genome of 10 to 12 doublestranded RNA (dsRNA) segments [1] . Viruses belonging to this highly diverse family infect a variety of host species including mammals, reptiles, fish, birds, protozoa, fungi, plants, and insects.", "MRVs have long been considered non-pathogenic, although mild respiratory and enteric diseases have occasionally been reported in young animals and children. Several evidences have recently shown that MRVs can cause severe diseases. Cases of neonatal diarrhea and neurological symptoms in children were associated both with MRV2 and MRV3 in Europe and North America [3] [4] [5] . These findings highlight the zoonotic potential of MRVs, though the mechanisms of their pathogenicity are not fully understood [5] .", "Full genome sequencing was conducted using an Illumina MiSeq platform from the isolated virus. Briefly, 100 \u03bcl of cell culture supernatants were treated with 250 units of Omnicleave endonuclease (Epicentre, Tebu-bio, Milan, Italy) at 37\u00b0C for 2 h. Viral RNA was extracted from treated supernatants using One for all Vet kit (QIAGEN, Milan, Italy). Sequencing libraries were prepared using TruSeq RNA sample preparation kit v2 (Illumina Inc. San Diego, CA, USA) and sequencing was performed on a Miseq Instrument with MiSeq Reagent Nano Kit v2, 300 cycles (Illumina Inc. San Diego, CA, USA). Sequencing reads were de-novo assembled by Seqman NGen DNASTAR application (version 11.2.1) (DNASTAR, Madison, WI, USA). Genome sequences were available into GenBank under accession numbers KX343200-KX343209." ] },{ "paper_id": "1ccf19a7957dd88ddcce92605007ad16f26d28ed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "doi:10.1371/journal.ppat.1005373.g008 system are probably promoting expansion of the fusion pore connecting an envelope and endosomal membrane." ] },{ "paper_id": "1cd1d321b575ccec089326f7b5d66d44e5c99bed", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1cdf5f7fb665c7d9efaf8562af501d3b3bdd9273", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1ce01bfd8909920c3da397b92d9803389f043268", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "3D EcoRI-R AAT TAA TTC ATC GAT GAA TTC GGG CC 3D BglII-F GGC AAA GAA GTG GAG ATC TTG GAT GC" ] },{ "paper_id": "1cedf8c2a09236302e9b5717604bdb98bae977ff", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Accession number(s). The metatranscriptomic data were deposited at NCBI GenBank SRA under BioProject accession no. PRJNA320636. The metagenomic libraries were deposited in iMicrobe under project code CAM_P_0001109.", "Support is acknowledged from Science for Life Laboratory, the Knut and Alice Wallenberg Foundation, the National Genomics Infrastructure (funded by the Swedish Research Council), and Uppsala Multidisciplinary Center for Advanced Computational Science for assistance with massively parallel sequencing and access to the UPPMAX computational infrastructure. Support by BILS (Bioinformatics Infrastructure for Life Sciences) is also gratefully acknowledged. The Ask\u00f6 Laboratory (Ask\u00f6, Stockholm Archipelago, Sweden) is acknowledged for permission to use their field and laboratory facilities. We thank Mark D. Adams for providing feedback on data interpretation and the manuscript and the Sorcerer II staff and crew for sample collection.", "Supplemental material for this article may be found at https://doi.org/10.1128/ mSystems.00125-16. " ] },{ "paper_id": "1cf0ff471514dc73eaa490d65d0d4a35f1345f6e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This research protocol was approved by the Departmental (IFR48) Ethic Committee and did not require patient consent. Only biological archival material was used (no specific sampling, no modification of sampling procedures). All information contained in databases was de-identified. ", "Sequences were analysed and compared with H1N1sw 2009 HA and NA sequences available in databases at mid-October 2009. Complete HA and NA amino-acid sequences were aligned with ClustalX [18] and phylogenetic trees were built using nucleotide or amino-acids alignments with MEGA version 4.1 [19] using various methods (Neighbor-Joining, Maximum Parsimony and UPGMA) with 1,000 bootstrap replicates. ", "The biological material studied here was used only for standard diagnostic procedures following physicians' prescriptions (no specific sampling, no modification of the sampling protocol). Analysis of data was performed using an anonymized database. Following local regulations, this procedure did not require a specific consent from patients.", "All 94 children (6 to 14 years old, median: 10) had arrived in the summer camp on July 20 th . They were supervised by 28 adults (16 counsellors or members of the management team and 12 technical agents, i.e. kitchen and cleaning staff)." ] },{ "paper_id": "1d034e288cb8c4eb1f407a4f61d9c553ea30a670", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [] },{ "paper_id": "1d05dbf38f98918269d71020f0c9ff616548c2df", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Human rhinovirus (HRV) is the predominant cause of upper respiratory tract infections (URTIs) referred to as the common cold [1] [2] [3] [4] . The virus has also been associated with lower respiratory tract illnesses, including exacerbation of asthma and chronic obstructive pulmonary disease 5,6 . HRVs have also been identified in mild and asymptomatic cases 7 . HRV is globally ubiquitous and infections usually occur all year-round, although peaking in the early autumn and late spring in many temperate or subtropical countries, and in the rainy season in tropical countries [8] [9] [10] . Despite most HRV infections being mild, they pose a considerable social and economic burden due to time lost from work or school, medical attendance and reduced performance of regular duties 11 . HRV transmission, infection patterns and diversity have been rarely studied in low-income settings despite bearing the majority burden of acute respiratory illnesses (ARI).", "Hence it might be hypothesized that at the population level the virus types spread in a manner independent of each other. However, the statistical evidence to support this assertion has yet to be undertaken. This would require spatially structured study designs to capture temporal-spatial HRV transmission. Data of this sort could improve understanding on the nature of spread of these viruses at the population level in relation to homotypic and heterotypic immunity.", "Raw sequence reads were assembled into contigs using Sequencher software (version 5, Gene Codes Corporation, Ann Arbor, USA). Multiple sequence alignments (MSA) were prepared using MAFFT v7.220 36 . Phylogenetic trees were constructed in MEGA v.6.0 37 with maximum likelihood methods under the GTR model and branch support was assessed using 1000 bootstrap iterations. Types were assigned based on >90% nucleotide similarity to rhinovirus prototype sequences (also referred to as reference sequences) 13,14 and phylogenetic clustering with the reference sequences (with a bootstrap support value above 70%)." ] },{ "paper_id": "1d0c8b03f2da34c55161d6205a97d06d373762c0", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "The weighted trachea specimen was ground (parameter: 30 tps) into a homogenate with a beveller (type: QIAGEN, Spoorstraat, Netherlands), and then the products were ground for 3 minutes (parameter: 30 tps) again, to which serum-free MEM was added. The supernatant obtained from a 5-minute centrifugation (at 4 \u00b0C and 5000 rpm) was fractionated into two centrifuge tubes for later tests.", "The cultured cells were harvested and fixed in 2.5% glutaraldehyde for transmission electron microscopy (TEM) examination (JEM-1200, Tokyo, Japan).", "Viruses 2014, 6" ] },{ "paper_id": "1d105041da2d3a6e6e16cd0dce1f0a672066d407", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This work was supported by the National Key R&D Program (2017YFD0500600) of China and the Key Program for Natural Science Foundation of Heilongjiang Province (ZD2017007).", "After infecting the MDCK cells with CAdV-2 at a multiplicity of infection (MOI) of 10 and incubating them at 37 \u2022 C for 24 h, the infected and uninfected cells were fixed with 4% paraformaldehyde for 15 min and probed with different mAb supernatants (SP2/0 supernatants as control) for 1 h at 37 \u2022 C. Bound antibodies were visualized using fluorescent-conjugated antibodies against mouse IgG (TIANGEN, Beijing, China) on a fluorescence microscope.", "XC and KY conceived the study and designed the experimental procedures. SW, YW, GD, and XL performed the experiments. YW, GD, MS, and JG acquired the data. SW, YW, TA, and XL analyzed the data. SW, MS, XL, and JG contributed reagents and materials. SW, TA, KY, and XC wrote the manuscript. SW, TA, GD, MS, KY, and XC approved the version to be published.", "samples was detected as positive and 19 of the 20 tested serum samples were detected as negative. Identical results can be seen for strips from the same batch and different batches after different times in storage. Table 3 ). The positive rates of the PCR and ICS tests were Times 1 2 3 4 1 2 3 4 1 2 3 4 1 2 3 4", "All datasets generated for this study are included in the article/Supplementary Material." ] },{ "paper_id": "1d13029ab155210da6e202f8cb5d902d7eabe226", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "MB, SKP, PKS, APA and RCP designed the experiments. MB, SD and SP carried out the experimental work. SKP, PKS and MB were involved in scientific discussion and analysis of the data. MB, SKP, ******** PKS and APA drafted and revised the manuscript. All authors read and approved the final manuscript.", "Ethical approval was not necessary. All the animals under this research were clinical cases and were examined, diagnosed and treated as per standard treatment and examination procedure." ] },{ "paper_id": "1d14e19f66d1a9c36b98aa2365aab80e9845616e", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "This is an immunodiffusion-based approach used to measure antibody responses to influenza virus internal proteins NP and M, following vaccination or infection [22] . Due to lower sensitivity, complement fixation has been replaced by HAI, VN, and EIA assays.", "Serological assays most commonly used to detect influenza virus-specific antibody responses include hemagglutination inhibition assay (HAI), microneutralization or virus neutralization assay (VN), single radial hemolysis (SRH), complement fixation assay, enzyme linked immunoabsorbant assay (ELISA) and Western blotting.", "SRH is a technique commonly used to determine the induction of antibodies following natural infection or vaccination. It is used to measure complement-mediated hemolysis induced by antigen-antibody complexes. SRH is considered more sensitive than the HAI assay and does not require pretreatment of the serum to inactivate non-specific inhibitors." ] },{ "paper_id": "1d14fd3be698da4aa12b91523c9d099f76775604", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "C57/B6 mice were purchased from Charles River. All animal procedures were approved by the University of North Texas Health Science Center Animal Care and Use Committee.", "Neutrophils were lysed and proteins were separated by Tris-Glycine polyacrylamide gel. The proteins were transferred to a nitrocellulose membrane, and the membrane were blocked for 1 hour with 5% non-fat dry milk in PBS and incubated over night at 4\u00b0C with primary antibodies. The membranes were repeatedly washed with PBS prior to incubation with secondary horseradish peroxidase-conjugated secondary antibodies. The blots were developed with an enhanced chemiluminescence reagent. The images were acquired and analyzed by a Western blot imaging system (UVP, upland, CA).", "CXCL2: Forward 5' gccaagggttgacttcaagaac 3' Reverse 5' aggtcagttagccttgcctttg 3' TNF-\u03b1: Forward 5' gcctcttctcattcctgcttgt 3' Reverse 5' caggcttgtcactcgaattttg 3' IL-1\u03b2: Forward 5' ggtgtgtgacgttcccattaga 3' Reverse 5' tcgttgcttggttctccttgta 3' IL-6: Forward 5' gacttccatcgagttgccttct 3' Reverse 5' ttgggagtggtatcctctgtga 3'" ] },{ "paper_id": "1d2a06d34c1ae369008931acca5000233e246011", "task": 3, "abstract": "HELP US UNDERSTAND HOW GEOGRAPHY AFFECTS VIRALITY?", "body_text": [ "Tobacco or cigarette smoke regulates airway gene expression via two main mechanisms, by altering the status of (i) chromatin remodeling, and (ii) DNA methylation of the target genes (Figure 1 ) (52-54).", "The First Line of Defense in the Lung-The Innate Immunity and Inflammasome", "The lu