{
  "cells": [
    {
      "cell_type": "markdown",
      "metadata": {},
      "source": [
        "# Longest common substring\n",
        "\n",
        "<hr>"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {},
      "source": [
        "Write a function that takes two sequences and returns the longest common substring. A substring is a contiguous portion of a string.  For example:\n",
        "\n",
        "Substrings of `ATGCATAT`:\n",
        "\n",
        "    TGCA\n",
        "    T\n",
        "    TAT\n",
        "    \n",
        "Not substrings of `ATGCATAT`:\n",
        "\n",
        "    AGCA              # Skipped T\n",
        "    CCATA             # Added another C\n",
        "    Hello, world.     # Has nothing to do with the input sequence\n",
        "    \n",
        "There may be more than one longest common substring; you only need to return one of them.\n",
        "\n",
        "The call signature of the function should be\n",
        "\n",
        "```python\n",
        "longest_common_substring(s1, s2)\n",
        "```\n",
        "\n",
        "Here are some return values you should get.\n",
        "\n",
        "|Function call|Result |\n",
        "|:---|---:|\n",
        "|`longest_common_substring('ATGC', 'ATGCA')` | `'ATGC'`|\n",
        "|`longest_common_substring('GATGCCATGCA', 'ATGCC')` | `'ATGCC'`|\n",
        "|`longest_common_substring('ACGTGGAAAGCCA', 'GTACACACGTTTTGAGAGACAC')   `|`'ACGT'`|"
      ]
    },
    {
      "cell_type": "markdown",
      "metadata": {},
      "source": [
        "<br />"
      ]
    }
  ],
  "metadata": {
    "anaconda-cloud": {},
    "kernelspec": {
      "display_name": "Python 3 (ipykernel)",
      "language": "python",
      "name": "python3"
    },
    "language_info": {
      "codemirror_mode": {
        "name": "ipython",
        "version": 3
      },
      "file_extension": ".py",
      "mimetype": "text/x-python",
      "name": "python",
      "nbconvert_exporter": "python",
      "pygments_lexer": "ipython3",
      "version": "3.13.5"
    }
  },
  "nbformat": 4,
  "nbformat_minor": 4
}