--- name: "viennarna-structure-prediction" description: "Predict RNA secondary structure, MFE folding, base-pair probabilities, RNA-RNA interactions via ViennaRNA Python bindings. Pipeline: sequence → MFE → partition function and pair-probability matrix → dot-bracket → duplex. Use for siRNA/sgRNA targeting, ribozyme design, RNA accessibility. Use RNAfold CLI for batch use without Python." license: "MIT" --- # ViennaRNA Structure Prediction ## Overview ViennaRNA is the gold-standard toolkit for RNA secondary structure prediction based on thermodynamic nearest-neighbor parameters. It predicts the minimum free energy (MFE) structure and dot-bracket notation for a given RNA sequence, computes the full partition function to obtain base pair probabilities, and models RNA-RNA interactions via co-folding and duplex prediction. The Python bindings (`import RNA`) expose the full ViennaRNA C library with sequence-level and fold-compound APIs. Command-line programs (`RNAfold`, `RNAalifold`, `RNAduplex`) are also available and demonstrated here. ## When to Use - Predicting the minimum free energy secondary structure of an RNA sequence (mRNA, lncRNA, miRNA precursor, aptamer) - Computing base pair probability matrices to assess structural uncertainty and identify well-defined stem-loops - Designing or evaluating siRNA accessibility by folding the target mRNA region and checking for double-stranded structure - Assessing sgRNA targeting efficiency by predicting guide RNA secondary structure that may reduce on-target activity - Modeling RNA-RNA interactions (co-folding or duplex prediction) for miRNA-target binding or antisense oligonucleotide design - Calculating folding free energies for a set of sequences to compare thermodynamic stability - Use `mfold` (web server) or `RNAstructure` instead when you need Mfold algorithm predictions specifically or need the Efold partition function; ViennaRNA uses the Turner 2004 nearest-neighbor parameters and is the standard for research-grade thermodynamic prediction ## Prerequisites - **Python packages**: `ViennaRNA` (Python bindings), `matplotlib`, `numpy` - **Data requirements**: RNA sequences as strings (ACGU alphabet; T is auto-converted to U by ViennaRNA) - **Environment**: Python 3.8+; conda installation strongly recommended (handles C library dependencies) ```bash # Install via conda (recommended) conda install -c conda-forge -c bioconda viennarna # Verify installation python -c "import RNA; print(RNA.__version__)" # 2.6.4 # Install additional Python dependencies pip install matplotlib numpy pandas # Optional: verify CLI tools are available RNAfold --version # RNAfold 2.6.4 ``` ## Quick Start ```python import RNA # Predict MFE structure for an RNA sequence sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" structure, mfe = RNA.fold(sequence) print(f"Sequence: {sequence}") print(f"Structure: {structure}") print(f"MFE: {mfe:.2f} kcal/mol") # Sequence: GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA # Structure: (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... # MFE: -31.30 kcal/mol ``` ## Workflow ### Step 1: Sequence Preparation and MFE Folding Load an RNA sequence and compute its minimum free energy secondary structure using `RNA.fold()`. Validate the input and inspect the dot-bracket output. ```python import RNA def prepare_sequence(seq: str) -> str: """Normalize sequence: uppercase, replace T→U, validate alphabet.""" seq = seq.upper().replace("T", "U").strip() invalid = set(seq) - set("ACGUNX") if invalid: raise ValueError(f"Invalid characters in sequence: {invalid}") return seq # E. coli tRNA-Phe (GenBank: M10217) raw_seq = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" sequence = prepare_sequence(raw_seq) structure, mfe = RNA.fold(sequence) print(f"Sequence length: {len(sequence)} nt") print(f"Structure: {structure}") print(f"MFE: {mfe:.2f} kcal/mol") # Validate: structure length must equal sequence length assert len(structure) == len(sequence), "Structure and sequence length mismatch" # Count stems (paired bases) n_paired = structure.count("(") + structure.count(")") n_unpaired = structure.count(".") print(f"Paired bases: {n_paired} | Unpaired bases: {n_unpaired}") print(f"Stem fraction: {n_paired/len(sequence):.2f}") ``` ### Step 2: Create a Fold Compound for Advanced Analysis The `RNA.fold_compound` object is the central API for partition function, base pair probabilities, and constrained folding. ```python import RNA sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" # Create fold compound (wraps the sequence with model parameters) fc = RNA.fold_compound(sequence) # Compute MFE structure via the fold compound API structure, mfe = fc.mfe() print(f"MFE structure: {structure}") print(f"MFE: {mfe:.2f} kcal/mol") # Evaluate free energy of an alternative structure alt_structure = "." * len(sequence) # fully unfolded energy = fc.eval_structure(alt_structure) print(f"Fully unfolded energy: {energy:.2f} kcal/mol") print(f"Folding stabilization: {energy - mfe:.2f} kcal/mol") ``` ### Step 3: Partition Function and Base Pair Probabilities Compute the thermodynamic partition function to obtain ensemble-level base pair probabilities. High-probability pairs indicate well-defined structural elements. ```python import RNA import numpy as np sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" n = len(sequence) fc = RNA.fold_compound(sequence) # Step 1: MFE folding (required before pf for proper initialization) structure_mfe, mfe = fc.mfe() # Step 2: Rescale Boltzmann factors for numerical stability (optional but recommended) fc.exp_params_rescale(mfe) # Step 3: Compute partition function structure_pf, gibbs_free_energy = fc.pf() print(f"Gibbs free energy (ensemble): {gibbs_free_energy:.2f} kcal/mol") print(f"MFE structure: {structure_mfe}") print(f"Centroid (pf): {structure_pf}") # Step 4: Retrieve base pair probability matrix bpp = fc.bpp() # returns (n+1)x(n+1) matrix; 1-indexed # Convert to 0-indexed numpy array for analysis probs = np.zeros((n, n)) for i in range(1, n + 1): for j in range(i + 1, n + 1): if bpp[i][j] > 0.0: probs[i - 1][j - 1] = bpp[i][j] probs[j - 1][i - 1] = bpp[i][j] # Identify high-confidence pairs (p > 0.9) high_conf = [(i, j, probs[i, j]) for i in range(n) for j in range(i + 1, n) if probs[i, j] > 0.9] print(f"\nHigh-confidence base pairs (p > 0.9): {len(high_conf)}") for i, j, p in high_conf[:5]: print(f" {sequence[i]}{i+1} — {sequence[j]}{j+1}: p={p:.3f}") ``` ### Step 4: Visualize Base Pair Probability Matrix Plot the base pair probability matrix as a heatmap to visualize structural regions. ```python import RNA import numpy as np import matplotlib.pyplot as plt import matplotlib.colors as mcolors sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" n = len(sequence) fc = RNA.fold_compound(sequence) structure_mfe, mfe = fc.mfe() fc.exp_params_rescale(mfe) fc.pf() bpp = fc.bpp() # Build matrix probs = np.zeros((n, n)) for i in range(1, n + 1): for j in range(i + 1, n + 1): if bpp[i][j] > 0.0: probs[i - 1][j - 1] = bpp[i][j] probs[j - 1][i - 1] = bpp[i][j] fig, ax = plt.subplots(figsize=(8, 7)) im = ax.imshow(probs, cmap="hot_r", vmin=0, vmax=1, origin="upper", aspect="equal") plt.colorbar(im, ax=ax, label="Base pair probability") ax.set_xlabel("Nucleotide position") ax.set_ylabel("Nucleotide position") ax.set_title(f"Base Pair Probability Matrix\n(n={n} nt, MFE={mfe:.2f} kcal/mol)") plt.tight_layout() plt.savefig("bpp_matrix.png", dpi=150, bbox_inches="tight") print("Saved: bpp_matrix.png") ``` ### Step 5: RNA-RNA Duplex Prediction (Co-folding) Use `RNA.cofold()` to predict the interaction between two RNA sequences by concatenating them with an `&` separator. ```python import RNA # miRNA (hsa-miR-21-5p) and its target sequence in mRNA (PTEN 3'UTR region) mirna_seq = "UAGCUUAUCAGACUGAUGUUGA" target_seq = "UCAACAUCAGUCUGAUAAGCUA" # approximate complementary target # Co-fold: concatenate with & separator cofold_seq = mirna_seq + "&" + target_seq structure, mfe = RNA.cofold(cofold_seq) print(f"miRNA: {mirna_seq}") print(f"Target: {target_seq}") print(f"Co-fold MFE: {mfe:.2f} kcal/mol") # Parse the structure — & is retained in output n1, n2 = len(mirna_seq), len(target_seq) struct_mirna = structure[:n1] struct_ampersand = structure[n1] struct_target = structure[n1 + 1:] print(f"miRNA structure: {struct_mirna}") print(f"Target structure: {struct_target}") paired_in_duplex = struct_mirna.count("(") + struct_mirna.count(")") print(f"Bases paired across the duplex: {paired_in_duplex}") ``` ### Step 6: RNA Accessibility Analysis for siRNA Design Compute the accessibility of a target region within a longer mRNA sequence — critical for siRNA and antisense oligonucleotide efficiency. ```python import RNA import numpy as np def compute_accessibility(mrna_seq: str, window: int = 40) -> list: """ Compute per-position probability of being unpaired (accessible) using a sliding-window approach on the partition function. Returns list of (position, accessibility) tuples. """ n = len(mrna_seq) fc = RNA.fold_compound(mrna_seq) _, mfe = fc.mfe() fc.exp_params_rescale(mfe) fc.pf() bpp = fc.bpp() # Probability of being paired at each position p_paired = np.zeros(n) for i in range(1, n + 1): for j in range(1, n + 1): if i != j: p = bpp[min(i,j)][max(i,j)] p_paired[i - 1] += p p_unpaired = 1.0 - np.clip(p_paired, 0, 1) return p_unpaired # Example: 80-nt mRNA segment with a known accessible region mrna = "AUGCUAGCUAGCUAGCUAUGCUAGCUAGCUUUUUUUUUUUUAUGCUAGCUAGCUAGCUAGCUAGCUAGCUAGCUAGC" p_unpaired = compute_accessibility(mrna) import matplotlib.pyplot as plt fig, ax = plt.subplots(figsize=(10, 3)) ax.bar(range(1, len(mrna) + 1), p_unpaired, color="#2166ac", alpha=0.8) ax.axhline(0.5, color="red", lw=1, ls="--", label="50% unpaired") ax.set_xlabel("Position (nt)") ax.set_ylabel("P(unpaired)") ax.set_title("RNA Accessibility Profile") ax.legend() plt.tight_layout() plt.savefig("rna_accessibility.png", dpi=150, bbox_inches="tight") print("Saved: rna_accessibility.png") # Top 5 most accessible positions (siRNA target candidates) best = sorted(enumerate(p_unpaired, 1), key=lambda x: -x[1])[:5] print("\nMost accessible positions:") for pos, prob in best: print(f" Position {pos}: P(unpaired) = {prob:.3f} ({mrna[pos-1]})") ``` ### Step 7: Command-Line RNAfold and Output Parsing Use the `RNAfold` CLI for batch folding via subprocess, then parse the output. ```bash # Fold a single sequence from stdin echo "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" | RNAfold # Output: # GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA # (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))).... (-31.30) # Batch fold from FASTA file RNAfold < sequences.fasta > structures.txt # Generate base pair probability dot plot (PostScript) RNAfold --noPS < sequences.fasta # suppress PostScript output RNAfold -p < sequences.fasta # save dot plot as rna.ps ``` ```python # Python: run RNAfold via subprocess and parse output import subprocess import re def run_rnafold(sequence: str) -> tuple: """Run RNAfold CLI and return (structure, mfe) tuple.""" result = subprocess.run( ["RNAfold", "--noPS"], input=sequence, capture_output=True, text=True, timeout=30 ) if result.returncode != 0: raise RuntimeError(f"RNAfold failed: {result.stderr}") lines = result.stdout.strip().split("\n") # Last line: structure and energy, e.g. "((....)) (-5.40)" match = re.match(r"^([.()\[\]{}<>|]+)\s+\((-?\d+\.\d+)\)$", lines[-1]) if not match: raise ValueError(f"Could not parse RNAfold output: {lines[-1]}") structure = match.group(1) mfe = float(match.group(2)) return structure, mfe sequences = [ ("tRNA-Phe", "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA"), ("miR-21", "UAGCUUAUCAGACUGAUGUUGA"), ] for name, seq in sequences: struct, mfe = run_rnafold(seq) print(f"{name}: {mfe:.2f} kcal/mol | {struct}") ``` ### Step 8: Constrained Folding and Suboptimal Structures Apply hard constraints (force or forbid specific base pairs) and enumerate suboptimal structures. ```python import RNA sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" # --- Constrained folding: force specific pairs --- fc = RNA.fold_compound(sequence) # Add hard constraint: force positions 1-7 to be paired (known stem) hc = RNA.hc_add_bp(fc, 1, 72) # force pair between position 1 and 72 (0-indexed in C API) structure_c, mfe_c = fc.mfe() print(f"Constrained MFE: {mfe_c:.2f} kcal/mol") print(f"Constrained struct: {structure_c}") # --- Enumerate suboptimal structures (delta_mfe threshold) --- fc_sub = RNA.fold_compound(sequence) _, mfe_opt = fc_sub.mfe() # Get suboptimal structures within 5 kcal/mol of MFE delta = 5.0 # kcal/mol window subopt_list = RNA.subopt(sequence, int(delta * 100)) # energy in 10-cal units print(f"\nSuboptimal structures within {delta} kcal/mol of MFE:") print(f"Total suboptimal structures: {len(subopt_list)}") for s in subopt_list[:3]: e = s.energy / 100.0 # convert from 10-cal to kcal/mol print(f" {s.structure} ({e:.2f} kcal/mol)") ``` ## Key Parameters | Parameter | Default | Range / Options | Effect | |-----------|---------|-----------------|--------| | `sequence` (RNA.fold) | — | ACGU string | Input RNA sequence; T is auto-converted to U | | `temperature` (model detail) | `37.0` °C | `0`–`100` °C | Folding temperature; lower temp stabilizes structures | | `dangles` (model detail) | `2` | `0`, `1`, `2`, `3` | Dangling end treatment; 2=average, 0=none, use 2 for most applications | | `noGU` (model detail) | `False` | `True`/`False` | Disallow G-U wobble pairs when True | | `noLP` (model detail) | `False` | `True`/`False` | Disallow lonely base pairs (single-bp stems); reduces noise | | `delta` (RNA.subopt) | — | float kcal/mol | Energy window above MFE for suboptimal structure enumeration | | `window` (sliding window) | — | int nt | Sliding window size for long-sequence accessibility analysis | ## Common Recipes ### Recipe: Batch MFE Folding from a FASTA File When to use: Fold a library of RNA sequences (e.g., candidate aptamers, guide RNAs) and compare energies. ```python import RNA from pathlib import Path def read_fasta(fasta_path: str) -> list: """Parse FASTA file, return list of (name, sequence) tuples.""" records = [] name, seq = None, [] for line in Path(fasta_path).read_text().splitlines(): if line.startswith(">"): if name: records.append((name, "".join(seq).upper().replace("T", "U"))) name, seq = line[1:].split()[0], [] else: seq.append(line.strip()) if name: records.append((name, "".join(seq).upper().replace("T", "U"))) return records # Example: fold sequences from a FASTA file sequences = [ ("aptamer_1", "GGGUUUUGAAACUAAACUAGGCUCUAGCGCUGGUGUCCCUUCCCGGCUCUAGCCUCAGCAGAAGCUUGAAAAAACCC"), ("aptamer_2", "GGGAGACAAGAAUAAACGCUCAACGUCUACCAUGAUCGAAUGCUAGCCUUCUAGCUUGCUUCGGCAGCACUAUAGGG"), ("aptamer_3", "GGGCGACCCUGAUGAGUCCCAAGUCGAAACGAUUCCUUUUUAAACUCAUGGUGCCCAGCCUCGCUCAGCA"), ] print(f"{'Name':<15} {'Length':>8} {'MFE':>10} {'Structure'}") print("-" * 80) for name, seq in sequences: struct, mfe = RNA.fold(seq) print(f"{name:<15} {len(seq):>8} {mfe:>10.2f} {struct[:50]}...") ``` ### Recipe: Check sgRNA Secondary Structure When to use: Evaluate whether a CRISPR sgRNA guide sequence folds into secondary structures that reduce Cas9 binding efficiency. ```python import RNA def assess_sgrna(guide_seq: str, scaffold: str = None) -> dict: """ Assess sgRNA secondary structure. guide_seq: 20-nt spacer sequence (RNA) scaffold: constant sgRNA scaffold sequence (default: SpCas9) """ if scaffold is None: # SpCas9 sgRNA scaffold (Addgene standard) scaffold = "GUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU" full_sgrna = guide_seq.upper().replace("T", "U") + scaffold fc = RNA.fold_compound(full_sgrna) structure, mfe = fc.mfe() fc.exp_params_rescale(mfe) fc.pf() bpp = fc.bpp() n_guide = len(guide_seq) # Check if any guide bases are paired (bad for targeting) guide_paired = sum( bpp[min(i, j)][max(i, j)] for i in range(1, n_guide + 1) for j in range(1, n_guide + 1) if i != j ) guide_accessibility = 1.0 - min(1.0, guide_paired / n_guide) return { "guide_seq": guide_seq, "mfe": mfe, "structure": structure[:n_guide], "guide_access": guide_accessibility, "predicted_ok": guide_accessibility > 0.7, } guides = ["GCACUAGUGACGCAUGGCAC", "GGGCAUAGCUAGCUAGCUAU", "AAAUUCGCACUAGUGACGCA"] for g in guides: result = assess_sgrna(g) status = "OK" if result["predicted_ok"] else "WARN (self-paired)" print(f"{g}: accessibility={result['guide_access']:.2f}, MFE={result['mfe']:.1f} kcal/mol [{status}]") ``` ### Recipe: Mountain Plot Visualization of RNA Structure When to use: Create a mountain plot — a classic RNA structure visualization showing stem height along the sequence. ```python import RNA import matplotlib.pyplot as plt def dot_bracket_to_mountain(structure: str) -> list: """Convert dot-bracket structure to mountain plot heights.""" heights = [] level = 0 for c in structure: if c == "(": level += 1 heights.append(level) if c == ")": level -= 1 return heights sequence = "GCGGAUUUAGCUCAGUUGGGAGAGCGCCAGACUGAAGAUCUGGAGGUCCUGUGUUCGAUCCACAGAAUUCGCACCA" structure, mfe = RNA.fold(sequence) heights = dot_bracket_to_mountain(structure) fig, axes = plt.subplots(2, 1, figsize=(12, 5), sharex=True, gridspec_kw={"height_ratios": [1, 3]}) # Top: sequence text axes[0].text(0.5, 0.5, "tRNA-Phe | E. coli", ha="center", va="center", fontsize=10, transform=axes[0].transAxes) axes[0].axis("off") # Bottom: mountain plot axes[1].fill_between(range(len(sequence)), heights, step="mid", color="#2c7bb6", alpha=0.7, label=f"MFE = {mfe:.2f} kcal/mol") axes[1].set_xlabel("Nucleotide position") axes[1].set_ylabel("Stem height") axes[1].set_title("Mountain Plot") axes[1].legend() plt.tight_layout() plt.savefig("mountain_plot.png", dpi=150, bbox_inches="tight") print(f"Saved: mountain_plot.png (MFE structure: {structure[:40]}...)") ``` ## Expected Outputs | Output | Type | Description | |--------|------|-------------| | `structure` | string | Dot-bracket notation of MFE secondary structure; `(` and `)` for paired bases, `.` for unpaired | | `mfe` | float (kcal/mol) | Minimum free energy of the predicted structure; more negative = more stable | | `bpp` | (n+1)×(n+1) matrix | Base pair probability matrix from partition function; element `[i][j]` = P(i paired with j), 1-indexed | | `bpp_matrix.png` | PNG | Heatmap visualization of base pair probabilities | | `rna_accessibility.png` | PNG | Per-position probability of being unpaired | | `mountain_plot.png` | PNG | Mountain plot of stem heights along the sequence | ## Troubleshooting | Problem | Cause | Solution | |---------|-------|----------| | `ImportError: No module named 'RNA'` | ViennaRNA Python bindings not installed | Install via `conda install -c conda-forge viennarna`; `pip install` alone may fail to link C library | | `RuntimeError: RNAfold not found` | ViennaRNA CLI not in PATH | Confirm with `which RNAfold`; if using conda env, activate it before running scripts | | MFE is unexpectedly positive (> 0) | Very short or repetitive sequence with no favorable pairs | Short sequences (< 10 nt) often have positive MFE; check sequence length and composition | | `bpp` matrix all zeros after `fc.pf()` | `fc.mfe()` must be called before `fc.pf()` on the same fold compound | Always call `fc.mfe()` first, then `fc.exp_params_rescale(mfe)`, then `fc.pf()` | | Suboptimal enumeration returns thousands of structures | Window too large for long sequences | Reduce delta to 2–3 kcal/mol for long sequences; very stable sequences have dense suboptimal ensembles | | Co-fold (`RNA.cofold`) shows unexpected pairing | Intramolecular folding dominates in one strand | Inspect each strand separately first; low individual-strand MFE indicates strong self-structure interfering with duplex | ## References - [ViennaRNA documentation](https://www.tbi.univie.ac.at/RNA/) — official documentation, parameter files, and Python API reference - [Lorenz et al., Algorithms Mol Biol 2011](https://doi.org/10.1186/1748-7188-6-26) — ViennaRNA Package 2.0 paper (primary citation for structure prediction) - [Turner & Mathews, Nucleic Acids Res 2010](https://doi.org/10.1093/nar/gkp892) — Nearest-neighbor thermodynamic parameters used by ViennaRNA - [ViennaRNA GitHub: ViennaRNA/ViennaRNA](https://github.com/ViennaRNA/ViennaRNA) — source code, issue tracker, Python tutorial notebooks