name: NMDC description: The NMDC Schema is a foundational framework designed to standardize metadata for the National Microbiome Data Collaborative (NMDC) and collaborating data providors. By establishing a structured approach to metadata, the NMDC Schema enables researchers to organize, share, and interpret complex datasets with consistency and clarity. The NMDC Schema is critical substrate used to facilitate interoperability and collaboration, as it provide a common language for data exchange across systems and disciplines. In the context of the NMDC, this schema supports the integration of microbiome data from medicine, agriculture, bioenergy, and environmental science into a cohesive platform. title: NMDC Schema notes: - not importing any MIxS terms where the relationship between the name (SCN) and the id isn't 1:1 id: https://w3id.org/nmdc/nmdc version: 0.0.0 license: https://creativecommons.org/publicdomain/zero/1.0/ prefixes: BFO: prefix_prefix: BFO prefix_reference: http://purl.obolibrary.org/obo/BFO_ CATH: prefix_prefix: CATH prefix_reference: 'https://bioregistry.io/cath:' CHEBI: prefix_prefix: CHEBI prefix_reference: http://purl.obolibrary.org/obo/CHEBI_ CHEMBL.COMPOUND: prefix_prefix: CHEMBL.COMPOUND prefix_reference: 'https://bioregistry.io/chembl.compound:' CHMO: prefix_prefix: CHMO prefix_reference: http://purl.obolibrary.org/obo/CHMO_ COG: prefix_prefix: COG prefix_reference: 'https://bioregistry.io/cog:' Contaminant: prefix_prefix: Contaminant prefix_reference: http://example.org/contaminant/ DRUGBANK: prefix_prefix: DRUGBANK prefix_reference: 'https://bioregistry.io/drugbank:' EC: prefix_prefix: EC prefix_reference: 'https://bioregistry.io/eccode:' EFO: prefix_prefix: EFO prefix_reference: http://www.ebi.ac.uk/efo/ EGGNOG: prefix_prefix: EGGNOG prefix_reference: 'https://bioregistry.io/eggnog:' ENVO: prefix_prefix: ENVO prefix_reference: http://purl.obolibrary.org/obo/ENVO_ FBcv: prefix_prefix: FBcv prefix_reference: http://purl.obolibrary.org/obo/FBcv_ GENEPIO: prefix_prefix: GENEPIO prefix_reference: http://purl.obolibrary.org/obo/GENEPIO_ GO: prefix_prefix: GO prefix_reference: http://purl.obolibrary.org/obo/GO_ HMDB: prefix_prefix: HMDB prefix_reference: 'https://bioregistry.io/hmdb:' ISA: prefix_prefix: ISA prefix_reference: http://example.org/isa/ KEGG.COMPOUND: prefix_prefix: KEGG.COMPOUND prefix_reference: 'https://bioregistry.io/kegg.compound:' KEGG.MODULE: prefix_prefix: KEGG.MODULE prefix_reference: 'https://bioregistry.io/kegg.module:' KEGG.ORTHOLOGY: prefix_prefix: KEGG.ORTHOLOGY prefix_reference: 'https://bioregistry.io/kegg.orthology:' KEGG.REACTION: prefix_prefix: KEGG.REACTION prefix_reference: 'https://bioregistry.io/kegg.reaction:' KEGG_PATHWAY: prefix_prefix: KEGG_PATHWAY prefix_reference: 'https://bioregistry.io/kegg.pathway:' MASSIVE: prefix_prefix: MASSIVE prefix_reference: 'https://bioregistry.io/reference/massive:' MCO: prefix_prefix: MCO prefix_reference: http://purl.obolibrary.org/obo/MICRO_ MESH: prefix_prefix: MESH prefix_reference: 'https://bioregistry.io/mesh:' MISO: prefix_prefix: MISO prefix_reference: http://purl.obolibrary.org/obo/MISO_ MIXS: prefix_prefix: MIXS prefix_reference: https://w3id.org/mixs/ MS: prefix_prefix: MS prefix_reference: http://purl.obolibrary.org/obo/MS_ MetaCyc: prefix_prefix: MetaCyc prefix_reference: 'https://bioregistry.io/metacyc.compound:' MetaNetX: prefix_prefix: MetaNetX prefix_reference: http://example.org/metanetx/ NCBI: prefix_prefix: NCBI prefix_reference: http://example.org/ncbitaxon/ NCBITaxon: prefix_prefix: NCBITaxon prefix_reference: http://purl.obolibrary.org/obo/NCBITaxon_ NCIT: prefix_prefix: NCIT prefix_reference: http://purl.obolibrary.org/obo/NCIT_ OBI: prefix_prefix: OBI prefix_reference: http://purl.obolibrary.org/obo/OBI_ OMIT: prefix_prefix: OMIT prefix_reference: http://purl.obolibrary.org/obo/OMIT_ ORCID: prefix_prefix: ORCID prefix_reference: https://orcid.org/ PANTHER.FAMILY: prefix_prefix: PANTHER.FAMILY prefix_reference: 'https://bioregistry.io/panther.family:' PATO: prefix_prefix: PATO prefix_reference: http://purl.obolibrary.org/obo/PATO_ PFAM.CLAN: prefix_prefix: PFAM.CLAN prefix_reference: 'https://bioregistry.io/pfam.clan:' PFAM: prefix_prefix: PFAM prefix_reference: 'https://bioregistry.io/pfam:' PO: prefix_prefix: PO prefix_reference: http://purl.obolibrary.org/obo/PO_ PR: prefix_prefix: PR prefix_reference: http://purl.obolibrary.org/obo/PR_ PUBCHEM.COMPOUND: prefix_prefix: PUBCHEM.COMPOUND prefix_reference: 'https://bioregistry.io/pubchem.compound:' RHEA: prefix_prefix: RHEA prefix_reference: 'https://bioregistry.io/rhea:' RO: prefix_prefix: RO prefix_reference: http://purl.obolibrary.org/obo/RO_ RetroRules: prefix_prefix: RetroRules prefix_reference: http://example.org/retrorules/ SEED: prefix_prefix: SEED prefix_reference: 'https://bioregistry.io/seed:' SIO: prefix_prefix: SIO prefix_reference: http://semanticscience.org/resource/SIO_ SO: prefix_prefix: SO prefix_reference: http://purl.obolibrary.org/obo/SO_ SUPFAM: prefix_prefix: SUPFAM prefix_reference: 'https://bioregistry.io/supfam:' TIGRFAM: prefix_prefix: TIGRFAM prefix_reference: 'https://bioregistry.io/tigrfam:' UBERON: prefix_prefix: UBERON prefix_reference: http://purl.obolibrary.org/obo/UBERON_ UO: prefix_prefix: UO prefix_reference: http://purl.obolibrary.org/obo/UO_ UniProtKB: prefix_prefix: UniProtKB prefix_reference: 'https://bioregistry.io/uniprot:' biolink: prefix_prefix: biolink prefix_reference: https://w3id.org/biolink/vocab/ bioproject: prefix_prefix: bioproject prefix_reference: 'https://bioregistry.io/bioproject:' biosample: prefix_prefix: biosample prefix_reference: 'https://bioregistry.io/biosample:' cas: prefix_prefix: cas prefix_reference: 'https://bioregistry.io/cas:' dcterms: prefix_prefix: dcterms prefix_reference: http://purl.org/dc/terms/ doi: prefix_prefix: doi prefix_reference: 'https://bioregistry.io/doi:' edam.data: prefix_prefix: edam.data prefix_reference: http://edamontology.org/data_ edam.format: prefix_prefix: edam.format prefix_reference: http://edamontology.org/format_ emsl.project: prefix_prefix: emsl.project prefix_reference: 'https://bioregistry.io/emsl.project:' emsl: prefix_prefix: emsl prefix_reference: http://example.org/emsl_in_mongodb/ emsl_uuid_like: prefix_prefix: emsl_uuid_like prefix_reference: http://example.org/emsl_uuid_like/ generic: prefix_prefix: generic prefix_reference: http://example.org/generic/ gnps.task: prefix_prefix: gnps.task prefix_reference: 'https://bioregistry.io/gnps.task:' gold: prefix_prefix: gold prefix_reference: 'https://bioregistry.io/gold:' gtpo: prefix_prefix: gtpo prefix_reference: http://example.org/gtpo/ igsn: prefix_prefix: igsn prefix_reference: https://app.geosamples.org/sample/igsn/ img.taxon: prefix_prefix: img.taxon prefix_reference: 'https://bioregistry.io/img.taxon:' insdc.sra: prefix_prefix: insdc.sra prefix_reference: 'https://bioregistry.io/insdc.sra:' insdc.run: prefix_prefix: insdc.run prefix_reference: 'https://bioregistry.io/insdc.run:' jgi.analysis: prefix_prefix: jgi.analysis prefix_reference: https://data.jgi.doe.gov/search?q= jgi.proposal: prefix_prefix: jgi.proposal prefix_reference: 'https://bioregistry.io/jgi.proposal:' jgi: prefix_prefix: jgi prefix_reference: http://example.org/jgi/ kegg: prefix_prefix: kegg prefix_reference: 'https://bioregistry.io/kegg:' linkml: prefix_prefix: linkml prefix_reference: https://w3id.org/linkml/ mgnify.analysis: prefix_prefix: mgnify.analysis prefix_reference: 'https://bioregistry.io/mgnify.analysis:' mgnify.proj: prefix_prefix: mgnify.proj prefix_reference: 'https://bioregistry.io/mgnify.proj:' my_emsl: prefix_prefix: my_emsl prefix_reference: https://release.my.emsl.pnnl.gov/released_data/ neon.identifier: prefix_prefix: neon.identifier prefix_reference: http://example.org/neon/identifier/ neon.schema: prefix_prefix: neon.schema prefix_reference: http://example.org/neon/schema/ nmdc: prefix_prefix: nmdc prefix_reference: https://w3id.org/nmdc/ owl: prefix_prefix: owl prefix_reference: http://www.w3.org/2002/07/owl# prov: prefix_prefix: prov prefix_reference: http://www.w3.org/ns/prov# qud: prefix_prefix: qud prefix_reference: http://qudt.org/1.1/schema/qudt# rdf: prefix_prefix: rdf prefix_reference: http://www.w3.org/1999/02/22-rdf-syntax-ns# rdfs: prefix_prefix: rdfs prefix_reference: http://www.w3.org/2000/01/rdf-schema# ror: prefix_prefix: ror prefix_reference: 'https://bioregistry.io/ror:' schema: prefix_prefix: schema prefix_reference: http://schema.org/ skos: prefix_prefix: skos prefix_reference: http://www.w3.org/2004/02/skos/core# wgs84: prefix_prefix: wgs84 prefix_reference: http://www.w3.org/2003/01/geo/wgs84_pos# wikidata: prefix_prefix: wikidata prefix_reference: http://www.wikidata.org/entity/ xsd: prefix_prefix: xsd prefix_reference: http://www.w3.org/2001/XMLSchema# pubmed: prefix_prefix: pubmed prefix_reference: 'https://bioregistry.io/pubmed:' shex: prefix_prefix: shex prefix_reference: http://www.w3.org/ns/shex# COB: prefix_prefix: COB prefix_reference: http://purl.obolibrary.org/obo/COB_ IAO: prefix_prefix: IAO prefix_reference: http://purl.obolibrary.org/obo/IAO_ atcc: prefix_prefix: atcc prefix_reference: https://www.atcc.org/products/ bcrc: prefix_prefix: bcrc prefix_reference: https://catalog.bcrc.firdi.org.tw/BcrcContent?bid= ccug: prefix_prefix: ccug prefix_reference: https://www.ccug.se/strain?id= dsmz: prefix_prefix: dsmz prefix_reference: https://www.dsmz.de/collection/catalogue/details/culture/ jcm: prefix_prefix: jcm prefix_reference: http://www.jcm.riken.go.jp/cgi-bin/jcm/jcm_number?JCM= lmg: prefix_prefix: lmg prefix_reference: https://bccm.belspo.be/catalogues/lmg-strain-details?NUM= nbrc: prefix_prefix: nbrc prefix_reference: http://www.nbrc.nite.go.jp/NBRC2/NBRCCatalogueDetailServlet?ID=NBRC&CAT= TAXRANK: prefix_prefix: TAXRANK prefix_reference: http://purl.obolibrary.org/obo/TAXRANK_ emit_prefixes: - KEGG.ORTHOLOGY - MASSIVE - biosample - cas - doi - gnps.task - gold - img.taxon - jgi.proposal - kegg - rdf - rdfs - skos - xsd default_prefix: nmdc default_range: string subsets: jgi_isolate: name: jgi_isolate description: 'Slots that map to a field on the JGI Isolate (NA) v19 submission form, identified by a structured_alias whose literal_form is the exact form field name. Membership is the alias: a slot is in this subset if and only if it carries a JGI Isolate v19 structured_alias. Most members are new NMDC slots for organism identity, strain verification, purity assessment, and biosafety classification; a few are reused MIxS slots (for example host_taxid, source_mat_id, estimated_size) whose JGI mapping is recorded via the alias rather than by a new slot.' comments: - The form template itself is access-restricted; each alias source points to the public JGI submission overview. To keep this subset exhaustive, add in_subset jgi_isolate wherever a JGI Isolate v19 structured_alias is added, at the same scope the alias lives (global slot or class slot_usage). from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2803 types: string: name: string description: A character string notes: - In RDF serializations, a slot with range of string is treated as a literal or type xsd:string. If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "string". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:Text base: str uri: xsd:string integer: name: integer description: An integer notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "integer". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:Integer base: int uri: xsd:integer boolean: name: boolean description: A binary (true or false) value notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "boolean". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:Boolean base: Bool uri: xsd:boolean repr: bool float: name: float description: A real number that conforms to the xsd:float specification notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "float". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:Float base: float uri: xsd:float double: name: double description: A real number that conforms to the xsd:double specification notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "double". from_schema: https://w3id.org/nmdc/nmdc close_mappings: - schema:Float base: float uri: xsd:double decimal: name: decimal description: A real number with arbitrary precision that conforms to the xsd:decimal specification notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "decimal". from_schema: https://w3id.org/nmdc/nmdc broad_mappings: - schema:Number base: Decimal uri: xsd:decimal time: name: time description: A time object represents a (local) time of day, independent of any particular day notes: - URI is dateTime because OWL reasoners do not work with straight date or time - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "time". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:Time base: XSDTime uri: xsd:time repr: str date: name: date description: a date (year, month and day) in an idealized calendar notes: - URI is dateTime because OWL reasoners don't work with straight date or time - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "date". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:Date base: XSDDate uri: xsd:date repr: str datetime: name: datetime description: The combination of a date and time notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "datetime". from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:DateTime base: XSDDateTime uri: xsd:dateTime repr: str date_or_datetime: name: date_or_datetime description: Either a date or a datetime notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "date_or_datetime". from_schema: https://w3id.org/nmdc/nmdc base: str uri: linkml:DateOrDatetime repr: str uriorcurie: name: uriorcurie description: a URI or a CURIE notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "uriorcurie". from_schema: https://w3id.org/nmdc/nmdc base: URIorCURIE uri: xsd:anyURI repr: str curie: name: curie conforms_to: https://www.w3.org/TR/curie/ description: a compact URI notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "curie". comments: - in RDF serializations this MUST be expanded to a URI - in non-RDF serializations MAY be serialized as the compact representation from_schema: https://w3id.org/nmdc/nmdc base: Curie uri: xsd:string repr: str uri: name: uri conforms_to: https://www.ietf.org/rfc/rfc3987.txt description: a complete URI notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "uri". comments: - in RDF serializations a slot with range of uri is treated as a literal or type xsd:anyURI unless it is an identifier or a reference to an identifier, in which case it is translated directly to a node from_schema: https://w3id.org/nmdc/nmdc close_mappings: - schema:URL base: URI uri: xsd:anyURI repr: str ncname: name: ncname description: Prefix part of CURIE notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "ncname". from_schema: https://w3id.org/nmdc/nmdc base: NCName uri: xsd:string repr: str objectidentifier: name: objectidentifier description: A URI or CURIE that represents an object in the model. notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "objectidentifier". comments: - Used for inheritance and type checking from_schema: https://w3id.org/nmdc/nmdc base: ElementIdentifier uri: shex:iri repr: str nodeidentifier: name: nodeidentifier description: A URI, CURIE or BNODE that represents a node in a model. notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "nodeidentifier". from_schema: https://w3id.org/nmdc/nmdc base: NodeIdentifier uri: shex:nonLiteral repr: str jsonpointer: name: jsonpointer conforms_to: https://datatracker.ietf.org/doc/html/rfc6901 description: A string encoding a JSON Pointer. The value of the string MUST conform to JSON Point syntax and SHOULD dereference to a valid object within the current instance document when encoded in tree form. notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "jsonpointer". from_schema: https://w3id.org/nmdc/nmdc base: str uri: xsd:string repr: str jsonpath: name: jsonpath conforms_to: https://www.ietf.org/archive/id/draft-goessner-dispatch-jsonpath-00.html description: A string encoding a JSON Path. The value of the string MUST conform to JSON Point syntax and SHOULD dereference to zero or more valid objects within the current instance document when encoded in tree form. notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "jsonpath". from_schema: https://w3id.org/nmdc/nmdc base: str uri: xsd:string repr: str sparqlpath: name: sparqlpath conforms_to: https://www.w3.org/TR/sparql11-query/#propertypaths description: A string encoding a SPARQL Property Path. The value of the string MUST conform to SPARQL syntax and SHOULD dereference to zero or more valid objects within the current instance document when encoded as RDF. notes: - If you are authoring schemas in LinkML YAML, the type is referenced with the lower case "sparqlpath". from_schema: https://w3id.org/nmdc/nmdc base: str uri: xsd:string repr: str external_identifier: name: external_identifier description: A CURIE representing an external identifier from_schema: https://w3id.org/nmdc/nmdc see_also: - https://microbiomedata.github.io/nmdc-schema/identifiers/ typeof: uriorcurie uri: xsd:anyURI pattern: ^[a-zA-Z0-9][a-zA-Z0-9_\.]+:[a-zA-Z0-9_][a-zA-Z0-9_\-\/\.,]*$ bytes: name: bytes description: An integer value that corresponds to a size in bytes from_schema: https://w3id.org/nmdc/nmdc see_also: - UO:0000233 base: int uri: xsd:long decimal_degree: name: decimal_degree description: A decimal degree expresses latitude or longitude as decimal fractions. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://en.wikipedia.org/wiki/Decimal_degrees base: float uri: xsd:decimal language_code: name: language_code description: A language code conforming to ISO_639-1 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://en.wikipedia.org/wiki/ISO_639-1 base: str uri: xsd:language enums: CalibrationTargetEnum: name: CalibrationTargetEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: mass_charge_ratio: text: mass_charge_ratio title: m/z aliases: - Mass - m/z retention_time: text: retention_time aliases: - RT retention_index: text: retention_index aliases: - RI CalibrationStandardEnum: name: CalibrationStandardEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: fames: text: fames aliases: - FAMES alkanes: text: alkanes aliases: - Alkanes srfa: text: srfa comments: - Reference standard Suwannee River Fulvic Acid Standard II (2S101F) from International Humic Substances Society see_also: - https://humic-substances.org/source-materials-for-ihss-samples/ aliases: - Suwannee River fulvic acid StrandedOrientationEnum: name: StrandedOrientationEnum description: This enumeration specifies information about stranded RNA library preparations. from_schema: https://w3id.org/nmdc/nmdc permissible_values: antisense orientation: text: antisense orientation description: Orientation that is complementary (non-coding) to a sequence of messenger RNA. comments: - See https://www.genome.gov/genetics-glossary/antisense exact_mappings: - SO:0000077 sense orientation: text: sense orientation description: Orientation that corresponds to the coding sequence of messenger RNA. MassSpectrometryAcquisitionStrategyEnum: name: MassSpectrometryAcquisitionStrategyEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: data_independent_acquisition: text: data_independent_acquisition description: Data independent mass spectrometer acquisition method wherein the full mass range is fragmented. Examples of such an approach include MS^E, AIF, and bbCID. aliases: - DIA - data independent acquisition from dissociation of full mass range exact_mappings: - MS:1003227 data_dependent_acquisition: text: data_dependent_acquisition description: Mass spectrometer data acquisition method wherein MSn spectra are triggered based on the m/z of precursor ions detected in the same run. aliases: - DDA exact_mappings: - MS:1003221 full_scan_only: text: full_scan_only description: Mass spectrometer data acquisition method wherein only MS1 data are acquired. aliases: - MS ResolutionCategoryEnum: name: ResolutionCategoryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: high: text: high description: higher than unit resolution low: text: low description: at unit resolution MassAnalyzerEnum: name: MassAnalyzerEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: time_of_flight: text: time_of_flight description: Instrument that separates ions by m/z in a field-free region after acceleration to a fixed acceleration energy. aliases: - TOF exact_mappings: - MS:1000084 quadrupole: text: quadrupole description: A mass spectrometer that consists of four parallel rods whose centers form the corners of a square and whose opposing poles are connected. The voltage applied to the rods is a superposition of a static potential and a sinusoidal radio frequency potential. The motion of an ion in the x and y dimensions is described by the Matthieu equation whose solutions show that ions in a particular m/z range can be transmitted along the z axis. aliases: - Quad - Q exact_mappings: - MS:1000081 Orbitrap: text: Orbitrap description: An ion trapping device that consists of an outer barrel-like electrode and a coaxial inner spindle-like electrode that form an electrostatic field with quadro-logarithmic potential distribution. The frequency of harmonic oscillations of the orbitally trapped ions along the axis of the electrostatic field is independent of the ion velocity and is inversely proportional to the square root of m/z so that the trap can be used as a mass analyzer. aliases: - Orbi exact_mappings: - MS:1000484 ion_cyclotron_resonance: text: ion_cyclotron_resonance description: A mass spectrometer based on the principle of ion cyclotron resonance in which an ion in a magnetic field moves in a circular orbit at a frequency characteristic of its m/z value. Ions are coherently excited to a larger radius orbit using a pulse of radio frequency energy and their image charge is detected on receiver plates as a time domain signal. Fourier transformation of the time domain signal results in a frequency domain signal which is converted to a mass spectrum based in the inverse relationship between frequency and m/z. aliases: - ICR exact_mappings: - MS:1000079 ion_trap: text: ion_trap description: A device for spatially confining ions using electric and magnetic fields alone or in combination. aliases: - LTQ - Ion Trap - Paul Trap exact_mappings: - MS:1000264 IonizationSourceEnum: name: IonizationSourceEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: electrospray_ionization: text: electrospray_ionization aliases: - ESI matrix_assisted_laser_desorption_ionization: text: matrix_assisted_laser_desorption_ionization aliases: - MALDI atmospheric_pressure_photo_ionization: text: atmospheric_pressure_photo_ionization aliases: - APPI atmospheric_pressure_chemical_ionization: text: atmospheric_pressure_chemical_ionization aliases: - APCI electron_ionization: text: electron_ionization aliases: - EI MassSpectrumCollectionModeEnum: name: MassSpectrumCollectionModeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: full_profile: text: full_profile reduced_profile: text: reduced_profile centroid: text: centroid PolarityModeEnum: name: PolarityModeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: positive: text: positive negative: text: negative EluentIntroductionCategoryEnum: name: EluentIntroductionCategoryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: liquid_chromatography: text: liquid_chromatography description: The processed sample is introduced into the mass spectrometer through a liquid chromatography process. title: liquid chromatography aliases: - LC gas_chromatography: text: gas_chromatography description: The processed sample is introduced into the mass spectrometer through a gas chromatography process. title: gas chromatography aliases: - GC direct_infusion_syringe: text: direct_infusion_syringe description: The processed sample is introduced into the mass spectrometer through a direct infusion process using a syringe. title: direct infusion syringe direct_infusion_autosampler: text: direct_infusion_autosampler description: The processed sample is introduced into the mass spectrometer through a direct infusion process using an autosampler. title: direct infusion autosampler LibraryTypeEnum: name: LibraryTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: DNA: text: DNA RNA: text: RNA ContainerCategoryEnum: name: ContainerCategoryEnum description: The permitted types of containers used in processing metabolomic samples. from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 permissible_values: v-bottom_conical_tube: text: v-bottom_conical_tube falcon_tube: text: falcon_tube SeparationMethodEnum: name: SeparationMethodEnum description: The tool/substance used to separate or filter a solution or mixture. from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 permissible_values: ptfe_96_well_filter_plate: text: ptfe_96_well_filter_plate syringe: text: syringe StationaryPhaseEnum: name: StationaryPhaseEnum description: The type of stationary phase used in a chromatography process. from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-4504-1039 permissible_values: BEH-HILIC: text: BEH-HILIC description: Hydrophilic Interaction Chromatography (HILIC) employing BEH (Bridged Ethylene Hybrid) particles as the stationary phase. is_a: HILIC C18: text: C18 description: A stationary phase consisting of octadecyl chains (C18) bonded to silica particles. C8: text: C8 description: A stationary phase consisting of octyl chains (C8) bonded to silica particles. C4: text: C4 description: A stationary phase consisting of butyl chains (C4) bonded to silica particles. C2: text: C2 description: A stationary phase consisting of ethyl chains (C2) bonded to silica particles. C1: text: C1 description: A stationary phase consisting of methyl chains (C1) bonded to silica particles. C30: text: C30 description: A stationary phase consisting of triacontyl chains (C30) bonded to silica particles. C60: text: C60 description: A stationary phase consisting of hexatriacontyl chains (C60) bonded to silica particles. CNT: text: CNT description: Carbon Nanotube stationary phase. CN: text: CN description: Cyano (CN) bonded stationary phase. Diol: text: Diol description: A stationary phase with diol (1,2-diol) functional groups. HILIC: text: HILIC description: Hydrophilic Interaction Chromatography (HILIC) stationary phase. HLB: text: HLB description: Hydrophilic-Lipophilic-Balance (HLB) stationary phase. NH2: text: NH2 description: Amino (NH2) bonded stationary phase. Phenyl: text: Phenyl description: Phenyl bonded stationary phase. Polysiloxane: text: Polysiloxane description: A stationary phase made of polysiloxane, usually used in gas chromatography. PS-DVB: text: PS-DVB description: Polystyrene-divinylbenzene stationary phase, often used in solid-phase extraction, including proprietary Priority PolLutant (PPL). SAX: text: SAX description: Strong Anion Exchange (SAX) stationary phase. SCX: text: SCX description: Strong Cation Exchange (SCX) stationary phase. Silica: text: Silica description: A stationary phase made of silica, commonly used in chromatography. WCX: text: WCX description: Weak Cation Exchange (WCX) stationary phase. WAX: text: WAX description: Weak Anion Exchange (WAX) stationary phase. ZIC-HILIC: text: ZIC-HILIC description: Zwitterionic Hydrophilic Interaction Chromatography (ZIC-HILIC) stationary phase. is_a: HILIC ZIC-pHILIC: text: ZIC-pHILIC description: Zwitterionic pH-Responsive Hydrophilic Interaction Chromatography (ZIC-pHILIC) stationary phase. is_a: ZIC-HILIC ZIC-cHILIC: text: ZIC-cHILIC description: Zwitterionic Charged Hydrophilic Interaction Chromatography (ZIC-cHILIC) stationary phase. is_a: ZIC-HILIC ProtocolCategoryEnum: name: ProtocolCategoryEnum description: The possible protocols that may be followed for an assay. from_schema: https://w3id.org/nmdc/nmdc permissible_values: mplex: text: mplex derivatization: text: derivatization filter_clean_up: text: filter_clean_up organic_matter_extraction: text: organic_matter_extraction solid_phase_extraction: text: solid_phase_extraction phosphorus_extraction: text: phosphorus_extraction ph_measurement: text: ph_measurement respiration_measurement: text: respiration_measurement texture_measurement: text: texture_measurement dna_extraction: text: dna_extraction phenol_chloroform_extraction: text: phenol_chloroform_extraction ChromatographicCategoryEnum: name: ChromatographicCategoryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: liquid_chromatography: text: liquid_chromatography aliases: - LC gas_chromatography: text: gas_chromatography aliases: - GC solid_phase_extraction: text: solid_phase_extraction aliases: - SPE SamplePortionEnum: name: SamplePortionEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: supernatant: text: supernatant aliases: - top_layer pellet: text: pellet aliases: - bottom_layer organic_layer: text: organic_layer description: The portion of a mixture containing dissolved organic material title: Organic layer aqueous_layer: text: aqueous_layer description: The portion of a mixture containing molecules dissolved in water title: Aqueous layer aliases: - water layer interlayer: text: interlayer description: The layer of material between liquid layers of a separated mixture title: Interlayer chloroform_layer: text: chloroform_layer description: The portion of a mixture containing molecules dissolved in chloroform is_a: organic_layer title: Chloroform layer methanol_layer: text: methanol_layer description: The portion of a mixture containing molecules dissolved in methanol is_a: organic_layer title: Methanol layer UnitEnum: name: UnitEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: '%': text: '%' description: The Unified Code for Units of Measure (UCUM) representation of percent. aliases: - percent - Percent J/K: text: J/K description: The Unified Code for Units of Measure (UCUM) representation of joule per kelvin. title: J/degree Celsius comments: - UCUM-compliant unit for energy per temperature. J/Cel deprecated due to non-ratio temperature unit. aliases: - joule per kelvin - joules per kelvin - J/Kelvin - J/Celvin - J/Cel - J/C Cel: text: Cel description: The Unified Code for Units of Measure (UCUM) representation of degrees Celsius; a SI unit of temperature equal to one unit Kelvin. title: degrees Celsius aliases: - Celsius - C - Celcius - degreeCelsius - degree Celsius exact_mappings: - UO:0000027 - wikidata:Q25267 - qud:DEG_C - OM:degreeCelsius cm: text: cm description: The Unified Code for Units of Measure (UCUM) representation of centimeter. cP: text: cP description: The Unified Code for Units of Measure (UCUM) representation of centipoise. aliases: - centipoise - centiPoise d: text: d description: The Unified Code for Units of Measure (UCUM) representation of day. aliases: - days g: text: g description: The Unified Code for Units of Measure (UCUM) representation of gram. h: text: h description: The Unified Code for Units of Measure (UCUM) representation of hour. kPa: text: kPa description: The Unified Code for Units of Measure (UCUM) representation of kilopascal. m: text: m description: The Unified Code for Units of Measure (UCUM) representation of meter. aliases: - meter - meters m/s: text: m/s description: The Unified Code for Units of Measure (UCUM) representation of meters per second. mg/kg: text: mg/kg description: The Unified Code for Units of Measure (UCUM) representation of milligrams per kilogram. mg/L: text: mg/L description: The Unified Code for Units of Measure (UCUM) representation of milligrams per liter. min: text: min description: The Unified Code for Units of Measure (UCUM) representation of minute. aliases: - minutes - minute mL: text: mL description: The Unified Code for Units of Measure (UCUM) representation of milliliter. mm: text: mm description: The Unified Code for Units of Measure (UCUM) representation of millimeter. mL/L: text: mL/L description: The Unified Code for Units of Measure (UCUM) representation of milliliters per liter. aliases: - ml/L - milliliters per liter mmol/L: text: mmol/L description: The Unified Code for Units of Measure (UCUM) representation of millimolar. aliases: - mM mS/cm: text: mS/cm description: The Unified Code for Units of Measure (UCUM) representation of millisiemens per centimeter. aliases: - mS/cm - millisiemens/cm - millisiemens per centimeter - milliSiemens/cm - milliSiemens/cm '[ppm]': text: '[ppm]' description: The Unified Code for Units of Measure (UCUM) representation of parts per million. see_also: - https://terminology.hl7.org/5.1.0/ValueSet-v3-UnitsOfMeasureCaseSensitive.html - https://ucum.org/ucum aliases: - ppm - 1*10-6 uS/cm: text: uS/cm description: The Unified Code for Units of Measure (UCUM) representation of microsiemens per centimeter. aliases: - μS/cm - microsiemens/cm - microsiemens per centimeter - microSiemens/cm W/m2: text: W/m2 description: The Unified Code for Units of Measure (UCUM) representation of watts per square meter. a: text: a description: The Unified Code for Units of Measure (UCUM) representation of year. title: years aliases: - years ug/L: text: ug/L description: The Unified Code for Units of Measure (UCUM) representation of micrograms per liter. aliases: - μg/L - microg/L ug/uL: text: ug/uL description: The Unified Code for Units of Measure (UCUM) representation of micrograms per microliter. aliases: - μg/μL uL: text: uL description: The Unified Code for Units of Measure (UCUM) representation of microliter. aliases: - μL - µL mol/L: text: mol/L description: The Unified Code for Units of Measure (UCUM) representation of moles per liter. mol/L/h: text: mol/L/h description: The Unified Code for Units of Measure (UCUM) representation of moles per liter per hour. ug/L/h: text: ug/L/h description: The Unified Code for Units of Measure (UCUM) representation of micrograms per liter per hour. umol/L: text: umol/L description: The Unified Code for Units of Measure (UCUM) representation of micromoles per liter. aliases: - μmol/L - micromol/L umol/kg: text: umol/kg description: The Unified Code for Units of Measure (UCUM) representation of micromoles per kilogram. umol/m2/s: text: umol/m2/s description: The Unified Code for Units of Measure (UCUM) representation of micromoles per square meter per second. title: micromoles per square meter per second aliases: - μmol/m2/s - micromol/m2/s - u[E]/m2/s - micro Einsteins mg/m3: text: mg/m3 description: The Unified Code for Units of Measure (UCUM) representation of milligrams per cubic meter. m2/s: text: m2/s description: The Unified Code for Units of Measure (UCUM) representation of square meters per second. kg/m3: text: kg/m3 description: The Unified Code for Units of Measure (UCUM) representation of kilograms per cubic meter. g/m3: text: g/m3 description: The Unified Code for Units of Measure (UCUM) representation of grams per cubic meter. m2: text: m2 description: The Unified Code for Units of Measure (UCUM) representation of square meters. atm: text: atm description: The Unified Code for Units of Measure (UCUM) representation of atmosphere. V: text: V description: The Unified Code for Units of Measure (UCUM) representation of volt. mV: text: mV description: The Unified Code for Units of Measure (UCUM) representation of millivolt. L: text: L description: The Unified Code for Units of Measure (UCUM) representation of liter. um: text: um description: The Unified Code for Units of Measure (UCUM) representation of micrometer. aliases: - μm - µm '1': text: '1' description: The Unified Code for Units of Measure (UCUM) representation of dimensionless quantity. title: ratio/unitless comments: - Used for ratios, counts, and dimensionless measurements (e.g., number of people, pets, plants). aliases: - ratio - unitless - dimensionless - people - pets - plants uL/kg: text: uL/kg description: The Unified Code for Units of Measure (UCUM) representation of microliters per kilogram. kg: text: kg description: The Unified Code for Units of Measure (UCUM) representation of kilogram. '[ppth]': text: '[ppth]' description: The Unified Code for Units of Measure (UCUM) representation of parts per thousand. aliases: - ppt - parts per thousand g/g: text: g/g description: The Unified Code for Units of Measure (UCUM) representation of gram per gram. aliases: - g/g lx: text: lx description: The Unified Code for Units of Measure (UCUM) representation of lux. title: lux aliases: - lx mg/m3/d: text: mg/m3/d description: The Unified Code for Units of Measure (UCUM) representation of milligrams per cubic meter per day. aliases: - mg/m3/d ng/h: text: ng/h description: The Unified Code for Units of Measure (UCUM) representation of nanograms per hour. aliases: - ng/h mm[Hg]: text: mm[Hg] description: The Unified Code for Units of Measure (UCUM) representation of millimeters of mercury. aliases: - mm[Hg] - mmHg '[ppb]': text: '[ppb]' description: The Unified Code for Units of Measure (UCUM) representation of parts per billion. aliases: - ppb g/kg: text: g/kg description: The Unified Code for Units of Measure (UCUM) representation of grams per kilogram. aliases: - g/kg deg: text: deg description: The Unified Code for Units of Measure (UCUM) representation of degree (angle). aliases: - deg - degree - degrees mg/g: text: mg/g description: The Unified Code for Units of Measure (UCUM) representation of milligrams per gram. aliases: - mg/g ug/g: text: ug/g description: The Unified Code for Units of Measure (UCUM) representation of micrograms per gram. aliases: - ug/g - μg/g ng/g: text: ng/g description: The Unified Code for Units of Measure (UCUM) representation of nanograms per gram. aliases: - ng/g pg/g: text: pg/g description: The Unified Code for Units of Measure (UCUM) representation of picograms per gram. aliases: - pg/g ng/L: text: ng/L description: The Unified Code for Units of Measure (UCUM) representation of nanograms per liter. aliases: - ng/L pg/L: text: pg/L description: The Unified Code for Units of Measure (UCUM) representation of picograms per liter. aliases: - pg/L ug/mL: text: ug/mL description: The Unified Code for Units of Measure (UCUM) representation of micrograms per milliliter. aliases: - ug/mL - μg/mL ng/mL: text: ng/mL description: The Unified Code for Units of Measure (UCUM) representation of nanograms per milliliter. aliases: - ng/mL pg/mL: text: pg/mL description: The Unified Code for Units of Measure (UCUM) representation of picograms per milliliter. aliases: - pg/mL mol: text: mol description: The Unified Code for Units of Measure (UCUM) representation of mole. aliases: - mol - mole - moles mmol: text: mmol description: The Unified Code for Units of Measure (UCUM) representation of millimole. aliases: - mmol - millimole - millimoles umol: text: umol description: The Unified Code for Units of Measure (UCUM) representation of micromole. aliases: - umol - μmol - micromole - micromoles nmol: text: nmol description: The Unified Code for Units of Measure (UCUM) representation of nanomole. aliases: - nmol - nanomole - nanomoles pmol: text: pmol description: The Unified Code for Units of Measure (UCUM) representation of picomole. aliases: - pmol - picomole - picomoles U: text: U description: The Unified Code for Units of Measure (UCUM) representation of enzyme unit. aliases: - U - unit - units mU: text: mU description: The Unified Code for Units of Measure (UCUM) representation of millienzyme unit. aliases: - mU - milliunit - milliunits uU: text: uU description: The Unified Code for Units of Measure (UCUM) representation of microenzyme unit. aliases: - uU - μU - microunit - microunits nU: text: nU description: The Unified Code for Units of Measure (UCUM) representation of nanoenzyme unit. aliases: - nU - nanounit - nanounits Bq: text: Bq description: The Unified Code for Units of Measure (UCUM) representation of becquerel. aliases: - Bq - becquerel - becquerels kBq: text: kBq description: The Unified Code for Units of Measure (UCUM) representation of kilobecquerel. aliases: - kBq - kilobecquerel - kilobecquerels MBq: text: MBq description: The Unified Code for Units of Measure (UCUM) representation of megabecquerel. aliases: - MBq - megabecquerel - megabecquerels GBq: text: GBq description: The Unified Code for Units of Measure (UCUM) representation of gigabecquerel. aliases: - GBq - gigabecquerel - gigabecquerels Ci: text: Ci description: The Unified Code for Units of Measure (UCUM) representation of curie. aliases: - Ci - curie - curies mCi: text: mCi description: The Unified Code for Units of Measure (UCUM) representation of millicurie. aliases: - mCi - millicurie - millicuries uCi: text: uCi description: The Unified Code for Units of Measure (UCUM) representation of microcurie. aliases: - uCi - μCi - microcurie - microcuries nCi: text: nCi description: The Unified Code for Units of Measure (UCUM) representation of nanocurie. aliases: - nCi - nanocurie - nanocuries pCi: text: pCi description: The Unified Code for Units of Measure (UCUM) representation of picocurie. aliases: - pCi - picocurie - picocuries rad: text: rad description: The Unified Code for Units of Measure (UCUM) representation of radian. aliases: - rad sr: text: sr description: The Unified Code for Units of Measure (UCUM) representation of steradian. aliases: - sr - steradian - steradians Hz: text: Hz description: The Unified Code for Units of Measure (UCUM) representation of hertz. aliases: - Hz - hertz 1/d: text: 1/d description: The Unified Code for Units of Measure (UCUM) representation of per day (frequency). aliases: - per day - daily frequency 1/[sft_i]: text: 1/[sft_i] description: The Unified Code for Units of Measure (UCUM) representation of per square foot. title: per square foot aliases: - per square foot - occupants per square foot kHz: text: kHz description: The Unified Code for Units of Measure (UCUM) representation of kilohertz. aliases: - kHz - kilohertz MHz: text: MHz description: The Unified Code for Units of Measure (UCUM) representation of megahertz. aliases: - MHz - megahertz GHz: text: GHz description: The Unified Code for Units of Measure (UCUM) representation of gigahertz. aliases: - GHz - gigahertz N: text: N description: The Unified Code for Units of Measure (UCUM) representation of newton. aliases: - N - newton - newtons kN: text: kN description: The Unified Code for Units of Measure (UCUM) representation of kilonewton. aliases: - kN - kilonewton - kilonewtons J: text: J description: The Unified Code for Units of Measure (UCUM) representation of joule. aliases: - J - joule - joules kJ: text: kJ description: The Unified Code for Units of Measure (UCUM) representation of kilojoule. aliases: - kJ - kilojoule - kilojoules MJ: text: MJ description: The Unified Code for Units of Measure (UCUM) representation of megajoule. aliases: - MJ - megajoule - megajoules W: text: W description: The Unified Code for Units of Measure (UCUM) representation of watt. aliases: - W - watt - watts kW: text: kW description: The Unified Code for Units of Measure (UCUM) representation of kilowatt. aliases: - kW - kilowatt - kilowatts mbar: text: mbar description: The Unified Code for Units of Measure (UCUM) representation of millibar. kW/m2: text: kW/m2 description: The Unified Code for Units of Measure (UCUM) representation of kilowatts per square meter. umol/s/m2: text: umol/s/m2 description: The Unified Code for Units of Measure (UCUM) representation of micromoles per second per square meter. aliases: - umol{photon}/s/m2 m3/d: text: m3/d description: The Unified Code for Units of Measure (UCUM) representation of cubic meters per day. L/h: text: L/h description: The Unified Code for Units of Measure (UCUM) representation of liters per hour. '[pH]': text: '[pH]' description: The Unified Code for Units of Measure (UCUM) representation of pH units. aliases: - pH kW/m2/d: text: kW/m2/d description: The Unified Code for Units of Measure (UCUM) representation of kilowatts per square meter per day. '[NTU]': text: '[NTU]' description: The Unified Code for Units of Measure (UCUM) representation of Nephelometric Turbidity Units. title: Nephelometric Turbidity Units aliases: - NTU '[FNU]': text: '[FNU]' description: The Unified Code for Units of Measure (UCUM) representation of Formazin Nephelometric Units. title: Formazin Nephelometric Units aliases: - FNU m3/min: text: m3/min description: The Unified Code for Units of Measure (UCUM) representation of cubic meters per minute. km/h: text: km/h description: The Unified Code for Units of Measure (UCUM) representation of kilometers per hour. '[lb_av]': text: '[lb_av]' description: The Unified Code for Units of Measure (UCUM) representation of pound (avoirdupois). title: pounds (avoirdupois) aliases: - pound - lb kg/kg: text: kg/kg description: The Unified Code for Units of Measure (UCUM) representation of kilogram per kilogram. aliases: - kilogram per kilogram ug/m3: text: ug/m3 description: The Unified Code for Units of Measure (UCUM) representation of micrograms per cubic meter. aliases: - μg/m3 - micrograms per cubic meter meq/L: text: meq/L description: The Unified Code for Units of Measure (UCUM) representation of milliequivalents per liter. aliases: - milliequivalents per liter lm/m2: text: lm/m2 description: The Unified Code for Units of Measure (UCUM) representation of lumens per square meter. aliases: - lumens per square meter mg: text: mg description: The Unified Code for Units of Measure (UCUM) representation of milligram. aliases: - milligram - milligrams umol/L/h: text: umol/L/h description: The Unified Code for Units of Measure (UCUM) representation of micromoles per liter per hour. comments: - For example, micromoles of oxygen created by photosynthesis per liter of water per hour. aliases: - micromoles per liter per hour g/cm3: text: g/cm3 description: The Unified Code for Units of Measure (UCUM) representation of grams per cubic centimeter. aliases: - grams per cubic centimeter g/L: text: g/L description: The Unified Code for Units of Measure (UCUM) representation of grams per liter. aliases: - grams per liter wk: text: wk description: The Unified Code for Units of Measure (UCUM) representation of week. aliases: - week - weeks '[g]': text: '[g]' description: The Unified Code for Units of Measure (UCUM) representation of standard gravity. title: standard gravity aliases: - standard gravity - g-force m/s2: text: m/s2 description: The Unified Code for Units of Measure (UCUM) representation of meters per second squared. aliases: - meters per second squared mol/g: text: mol/g description: The Unified Code for Units of Measure (UCUM) representation of moles per gram. aliases: - moles per gram g/m2/d: text: g/m2/d description: The Unified Code for Units of Measure (UCUM) representation of grams per square meter per day. aliases: - grams per square meter per day Gy: text: Gy description: The Unified Code for Units of Measure (UCUM) representation of gray (absorbed dose). aliases: - gray RAD: text: RAD description: The Unified Code for Units of Measure (UCUM) representation of rad (radiation absorbed dose). title: rad (radiation absorbed dose) aliases: - radiation absorbed dose '[sft_i]': text: '[sft_i]' description: The Unified Code for Units of Measure (UCUM) representation of square feet. title: square feet aliases: - square feet - sq ft '[cft_i]': text: '[cft_i]' description: The Unified Code for Units of Measure (UCUM) representation of cubic feet. title: cubic feet aliases: - cubic feet - cu ft m3: text: m3 description: The Unified Code for Units of Measure (UCUM) representation of cubic meter. aliases: - cubic meter - cubic meters ug: text: ug description: The Unified Code for Units of Measure (UCUM) representation of microgram. aliases: - μg - microgram - micrograms mm/a: text: mm/a description: The Unified Code for Units of Measure (UCUM) representation of millimeters per year. title: millimeters per year aliases: - millimeters per year cm2: text: cm2 description: The Unified Code for Units of Measure (UCUM) representation of square centimeter. aliases: - square centimeter - square centimeters erg/cm2/s: text: erg/cm2/s description: The Unified Code for Units of Measure (UCUM) representation of ergs per square centimeter per second. aliases: - ergs per square centimeter per second g/m2: text: g/m2 description: The Unified Code for Units of Measure (UCUM) representation of grams per square meter. aliases: - grams per square meter L/s: text: L/s description: The Unified Code for Units of Measure (UCUM) representation of liters per second. aliases: - liters per second cm3/cm3: text: cm3/cm3 description: The Unified Code for Units of Measure (UCUM) representation of cubic centimeters per cubic centimeter. aliases: - cubic centimeters per cubic centimeter '[kn_i]': text: '[kn_i]' description: The Unified Code for Units of Measure (UCUM) representation of knot (nautical miles per hour). title: knots aliases: - knot - knots m3/s: text: m3/s description: The Unified Code for Units of Measure (UCUM) representation of cubic meters per second. aliases: - cubic meters per second '[in_i]': text: '[in_i]' description: The Unified Code for Units of Measure (UCUM) representation of inch. title: inches aliases: - inch - inches LibraryStrategyEnum: name: LibraryStrategyEnum description: Sequencing strategy used for library preparation comments: - NMDC intentionally supports a curated subset of the INSDC library strategy vocabulary. The complete controlled vocabulary is defined in the referenced SRA.experiment.xsd; values can be added as needed. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/enasequence/webin-xml/blob/2.1.0/src/main/resources/uk/ac/ebi/ena/sra/schema/SRA.experiment.xsd permissible_values: WGA: text: WGA description: Whole genome amplification followed by random sequencing. title: Whole Genome Amplification see_also: - pubmed:1631067 - pubmed:8962113 WGS: text: WGS description: Random sequencing of the whole genome. title: Whole Genome Sequencing see_also: - pubmed:10731132 RNA-Seq: text: RNA-Seq description: Random sequencing of whole transcriptome see_also: - pubmed:18611170 aliases: - Whole Transcriptome Shotgun Sequencing - WTSS AMPLICON: text: AMPLICON description: Sequencing of overlapping or distinct PCR or RT-PCR products comments: - metagenomic community profiling using SSU rRNA, for example LibrarySourceEnum: name: LibrarySourceEnum description: Molecular source of the sequencing library from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/enasequence/webin-xml/blob/2.1.0/src/main/resources/uk/ac/ebi/ena/sra/schema/SRA.experiment.xsd permissible_values: GENOMIC: text: GENOMIC description: Genomic DNA (includes PCR products from genomic DNA) TRANSCRIPTOMIC: text: TRANSCRIPTOMIC description: Transcription products or non-genomic DNA comments: - for example EST cDNA, RT-PCR, or screened libraries METAGENOMIC: text: METAGENOMIC description: Mixed material from metagenome METATRANSCRIPTOMIC: text: METATRANSCRIPTOMIC description: Transcription products from community targets SYNTHETIC: text: SYNTHETIC description: Synthetic DNA VIRAL RNA: text: VIRAL RNA description: Viral RNA GENOMIC SINGLE CELL: text: GENOMIC SINGLE CELL description: Single cell genomic DNA source TRANSCRIPTOMIC SINGLE CELL: text: TRANSCRIPTOMIC SINGLE CELL description: Single cell transcriptomic source OTHER: text: OTHER description: 'Other, unspecified, or unknown library source material ' LibrarySelectionEnum: name: LibrarySelectionEnum description: Library selection or enrichment method comments: - NMDC intentionally supports a curated subset of the INSDC library selection vocabulary. The complete controlled vocabulary is defined in the referenced SRA.experiment.xsd; values can be added as needed. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/enasequence/webin-xml/blob/2.1.0/src/main/resources/uk/ac/ebi/ena/sra/schema/SRA.experiment.xsd permissible_values: RANDOM: text: RANDOM description: Random selection by shearing or other method PCR: text: PCR description: Source material was selected by designed primers MDA: text: MDA description: Multiple displacement amplification other: text: other description: Other library enrichment, screening, or selection process (please include additional info in the design description) PolyA: text: PolyA description: PolyA selection or enrichment for messenger RNA (mRNA) size fractionation: text: size fractionation description: Physical selection of size appropriate targets ExecutionResourceEnum: name: ExecutionResourceEnum from_schema: https://w3id.org/nmdc/nmdc see_also: - nmdc:DoiProviderEnum - nmdc:ProcessingInstitutionEnum - nmdc:ExecutionResourceEnum permissible_values: NERSC-Cori: text: NERSC-Cori description: NERSC Cori supercomputer aliases: - Cori NERSC-Perlmutter: text: NERSC-Perlmutter description: NERSC Perlmutter supercomputer aliases: - Perlmutter - Saul EMSL-RZR: text: EMSL-RZR description: Environmental Molecular Sciences Laboratory RZR cluster aliases: - RZR EMSL-Tahoma: text: EMSL-Tahoma description: Environmental Molecular Sciences Laboratory RZR Tahoma cluster aliases: - Tahoma FileTypeEnum: name: FileTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Virus Summary: text: Virus Summary description: Tab separated file listing the viruses found by geNomad. annotations: file_name_pattern: tag: file_name_pattern value: ^_virus_summary\.tsv?$ see_also: - https://portal.nersc.gov/genomad/ Plasmid Summary: text: Plasmid Summary description: Tab separated file listing the plasmids found by geNomad. annotations: file_name_pattern: tag: file_name_pattern value: ^_plasmid_summary\.tsv?$ see_also: - https://portal.nersc.gov/genomad/ GeNomad Aggregated Classification: text: GeNomad Aggregated Classification description: Tab separated file which combines the results from neural network-based classification and marker-based classification for virus and plasmid detection with geNomad. annotations: file_name_pattern: tag: file_name_pattern value: ^_aggregated_classification\.tsv?$ see_also: - https://portal.nersc.gov/genomad/ Reference Calibration File: text: Reference Calibration File description: A file that contains data used to calibrate a natural organic matter or metabolomics analysis. Metagenome Raw Reads: text: Metagenome Raw Reads description: Interleaved paired-end raw metagenome sequencing data annotations: file_name_pattern: tag: file_name_pattern value: ^\.fastq(\.gz)?$ Metagenome Raw Read 1: text: Metagenome Raw Read 1 description: Read 1 raw metagenome sequencing data, aka forward reads annotations: file_name_pattern: tag: file_name_pattern value: ^.+_R1\.fastq(\.gz)?$ examples: - value: BMI_H25VYBGXH_19S_31WellG1_R1.fastq.gz Metagenome Raw Read 2: text: Metagenome Raw Read 2 description: Read 2 raw metagenome sequencing data, aka reverse reads annotations: file_name_pattern: tag: file_name_pattern value: ^.+_R2\.fastq(\.gz)?$ examples: - value: BMI_H25VYBGXH_19S_31WellG1_R2.fastq.gz Metatranscriptome Raw Reads: text: Metatranscriptome Raw Reads description: Interleaved paired-end raw metatranscriptome sequencing data annotations: file_name_pattern: tag: file_name_pattern value: ^\.fastq(\.gz)?$ Metatranscriptome Raw Read 1: text: Metatranscriptome Raw Read 1 description: Read 1 raw metatranscriptome sequencing data, aka forward reads annotations: file_name_pattern: tag: file_name_pattern value: ^.+_R1\.fastq(\.gz)?$ examples: - value: BMI_H25VYBGXH_19S_31WellG1_R1.fastq.gz Metatranscriptome Raw Read 2: text: Metatranscriptome Raw Read 2 description: Read 2 raw metatranscriptome sequencing data, aka reverse reads annotations: file_name_pattern: tag: file_name_pattern value: ^.+_R2\.fastq(\.gz)?$ examples: - value: BMI_H25VYBGXH_19S_31WellG1_R2.fastq.gz Unpaired raw sequencing data: text: Unpaired raw sequencing data description: Reads from a single-end sequencing library (not forward/reverse pairs). comments: - Use when the analyte category is not part of the value, for example amplicon or isolate data. For metagenome or metatranscriptome reads, prefer the analyte-specific values above. - Oxford Nanopore and PacBio runs commonly have a single (unpaired) library layout. see_also: - https://www.ebi.ac.uk/ena/browser/about/read-formats Paired interleaved raw sequencing data: text: Paired interleaved raw sequencing data description: Paired-end reads with forward and reverse mates interleaved in a single file. comments: - Use when the analyte category is not part of the value, for example amplicon or isolate data. For metagenome or metatranscriptome interleaved reads, prefer "Metagenome Raw Reads" or "Metatranscriptome Raw Reads" above. see_also: - https://github.com/ncbi/sra-tools/wiki/HowTo:-fasterq-dump Raw sequencing data read 1: text: Raw sequencing data read 1 description: Read 1 (forward) of a paired-end run, as a separate file. comments: - Use when the analyte category is not part of the value, for example amplicon or isolate data. For metagenome or metatranscriptome forward reads, prefer "Metagenome Raw Read 1" or "Metatranscriptome Raw Read 1" above. see_also: - https://github.com/ncbi/sra-tools/wiki/HowTo:-fasterq-dump Raw sequencing data read 2: text: Raw sequencing data read 2 description: Read 2 (reverse) of a paired-end run, as a separate file. comments: - Use when the analyte category is not part of the value, for example amplicon ingest or isolate data. For metagenome or metatranscriptome reverse reads, prefer "Metagenome Raw Read 2" or "Metatranscriptome Raw Read 2" above. see_also: - https://github.com/ncbi/sra-tools/wiki/HowTo:-fasterq-dump SRA toolkit-accessible sequence data: text: SRA toolkit-accessible sequence data description: Files that are available for download via SRA Toolkit by providing an INSDC accession comments: - File format will depend on options specified to SRA Toolkit see_also: - https://github.com/ncbi/sra-tools/wiki Direct Infusion FT-ICR MS Analysis Results: text: Direct Infusion FT-ICR MS Analysis Results description: FT-ICR MS based molecular formula assignment results table Direct Infusion FT-ICR MS QC Plots: text: Direct Infusion FT-ICR MS QC Plots description: Quality control plots for FT-ICR MS raw data acquired by direct infusion LC FT-ICR MS Analysis Results: text: LC FT-ICR MS Analysis Results description: LC FT-ICR MS-based molecular formula assignment results tables LC FT-ICR MS QC Plots: text: LC FT-ICR MS QC Plots description: Quality control plots for FT-ICR MS raw data acquired with liquid chromatography GC-MS Metabolomics Results: text: GC-MS Metabolomics Results description: GC-MS-based metabolite assignment results table LC-MS Metabolomics Results: text: LC-MS Metabolomics Results description: LC-MS-based metabolite assignment results table Mass Spectrometry Reference Spectral Library: text: Mass Spectrometry Reference Spectral Library description: Spectral library used for mass spectrometry based metabolite identification Metaproteomics Workflow Statistics: text: Metaproteomics Workflow Statistics description: Aggregate workflow statistics file Protein Report: text: Protein Report description: Filtered protein report file Peptide Report: text: Peptide Report description: Filtered peptide report file Unfiltered Metaproteomics Results: text: Unfiltered Metaproteomics Results description: MSGFjobs and MASIC output file Read Count and RPKM: text: Read Count and RPKM description: Annotation read count and RPKM per feature JSON QC non-rRNA R2: text: QC non-rRNA R2 description: QC removed rRNA reads (R2) fastq QC non-rRNA R1: text: QC non-rRNA R1 description: QC removed rRNA reads (R1) fastq Metagenome HQMQ Bins Compression File: text: Metagenome HQMQ Bins Compression File description: Compressed file containing high quality and medium quality metagenome bins and associated files annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_hqmq_bin.zip' Metagenome LQ Bins Compression File: text: Metagenome LQ Bins Compression File description: Compressed file containing low quality metagenome bins and associated files annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_lq_bin.zip' Metagenome Bins Info File: text: Metagenome Bins Info File description: File containing version information on the binning workflow annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_bin.info' CheckM Statistics: text: CheckM Statistics description: CheckM statistics report Metagenome Bins Heatmap: text: Metagenome Bins Heatmap description: The Heatmap presents the pdf file containing the KO analysis results for metagenome bins annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_heatmap.pdf' Metagenome Bins Barplot: text: Metagenome Bins Barplot description: The Bar chart presents the pdf file containing the KO analysis results for metagenome bins annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_barplot.pdf' Metagenome Bins Krona Plot: text: Metagenome Bins Krona Plot description: The Krona plot presents the HTML file containing the KO analysis results for metagenome bins annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_kronaplot.html' Read Based Analysis Info File: text: Read Based Analysis Info File description: File containing reads based analysis information annotations: file_name_pattern: tag: file_name_pattern value: profiler.info GTDBTK Bacterial Summary: text: GTDBTK Bacterial Summary description: GTDBTK bacterial summary GTDBTK Archaeal Summary: text: GTDBTK Archaeal Summary description: GTDBTK archaeal summary GTDBTK Summary JSON: text: GTDBTK Summary JSON description: GTDBTK bacterial and archaeal summary in JSON format annotations: file_name_pattern: tag: file_name_pattern value: '[mag_wf_activity_id]_gtdbtk.json' examples: - value: nmdc_wfmag-11-0abycm66.1_gtdbtk.json see_also: - https://ecogenomics.github.io/GTDBTk/ GOTTCHA2 Krona Plot: text: GOTTCHA2 Krona Plot description: GOTTCHA2 krona plot HTML file GOTTCHA2 Classification Report: text: GOTTCHA2 Classification Report description: GOTTCHA2 classification report file GOTTCHA2 Report Full: text: GOTTCHA2 Report Full description: GOTTCHA2 report file Kraken2 Krona Plot: text: Kraken2 Krona Plot description: Kraken2 krona plot HTML file Centrifuge Krona Plot: text: Centrifuge Krona Plot description: Centrifuge krona plot HTML file Centrifuge output report file: text: Centrifuge output report file description: Centrifuge output report file Kraken2 Classification Report: text: Kraken2 Classification Report description: Kraken2 output report file Kraken2 Taxonomic Classification: text: Kraken2 Taxonomic Classification description: Kraken2 output read classification file Centrifuge Taxonomic Classification: text: Centrifuge Taxonomic Classification description: Centrifuge output read classification file SingleM Taxonomic Classification: text: SingleM Taxonomic Classification description: SingleM taxonomic classification file SingleM Krona Plot: text: SingleM Krona Plot description: SingleM krona plot HTML file SingleM Clustered Report: text: SingleM Clustered Report description: SingleM taxonomic classification results, clustered by OTU Structural Annotation GFF: text: Structural Annotation GFF description: GFF3 format file with structural annotations annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_structural_annotation.gff' Structural Annotation Stats Json: text: Structural Annotation Stats Json description: Structural annotations stats json annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_structural_annotation_stats.json' Functional Annotation GFF: text: Functional Annotation GFF description: GFF3 format file with functional annotations annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_functional_annotation.gff' Annotation Info File: text: Annotation Info File description: File containing annotation info annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_imgap.info' Annotation Amino Acid FASTA: text: Annotation Amino Acid FASTA description: FASTA amino acid file for annotated proteins annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_proteins.faa' Annotation Enzyme Commission: text: Annotation Enzyme Commission description: Tab delimited file for EC annotation annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_ec.tsv' Annotation KEGG Orthology: text: Annotation KEGG Orthology description: Tab delimited file for KO annotation annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_ko.tsv' Assembly Info File: text: Assembly Info File description: File containing assembly info annotations: file_name_pattern: tag: file_name_pattern value: README.txt Assembly Coverage BAM: text: Assembly Coverage BAM description: Sorted bam file of reads mapping back to the final assembly annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_pairedMapped.sam.gz' Assembly AGP: text: Assembly AGP description: An AGP format file that describes the assembly Assembly Scaffolds: text: Assembly Scaffolds description: Final assembly scaffolds fasta annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_assembly.contigs.fasta' Assembly Contigs: text: Assembly Contigs description: Final assembly contigs fasta annotations: file_name_pattern: tag: file_name_pattern value: assembly.contigs.fasta Assembly Coverage Stats: text: Assembly Coverage Stats description: Assembled contigs coverage information annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_pairedMapped_sorted.bam.cov' Contig Mapping File: text: Contig Mapping File description: Contig mappings between contigs and scaffolds annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_contig_names_mapping.tsv' Error Corrected Reads: text: Error Corrected Reads description: Error corrected reads fastq annotations: file_name_pattern: tag: file_name_pattern value: input.corr.fastq.gz Filtered Sequencing Reads: text: Filtered Sequencing Reads description: Reads QC result fastq (clean data) annotations: file_name_pattern: tag: file_name_pattern value: /.+?(?=filter)/filter-METAGENOME.fastq.gz Read Filtering Info File: text: Read Filtering Info File description: File containing read filtering information annotations: file_name_pattern: tag: file_name_pattern value: '[rqc_wf_activity_id]_readsQC.info' QC Statistics Extended: text: QC Statistics Extended description: Extended report including methods and results for read filtering annotations: file_name_pattern: tag: file_name_pattern value: /.+?(?=filter)/filtered-report.txt QC Statistics: text: QC Statistics description: Reads QC summary statistics annotations: file_name_pattern: tag: file_name_pattern value: '[rqc_wf_activity_id]_filterStats2.txt' TIGRFam Annotation GFF: text: TIGRFam Annotation GFF description: GFF3 format file with TIGRfam annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_tigrfam.gff' CRT Annotation GFF: text: CRT Annotation GFF description: GFF3 format file with CRT annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_crt.gff' Genemark Annotation GFF: text: Genemark Annotation GFF description: GFF3 format file with Genemark annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_genemark.gff' Prodigal Annotation GFF: text: Prodigal Annotation GFF description: GFF3 format file with Prodigal annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_prodigal.gff' TRNA Annotation GFF: text: TRNA Annotation GFF description: GFF3 format file with TRNA annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_trna.gff' Misc Annotation GFF: text: Misc Annotation GFF description: GFF3 format file with Misc annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_rfam_misc_bind_misc_feature_regulatory.gff' RFAM Annotation GFF: text: RFAM Annotation GFF description: GFF3 format file with RFAM annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_rfam.gff' TMRNA Annotation GFF: text: TMRNA Annotation GFF description: GFF3 format file with TMRNA annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_rfam_ncrna_tmrna.gff' Crispr Terms: text: Crispr Terms description: Crispr Terms annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_crt.crisprs' Product Names: text: Product Names description: Product names file annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_product_names.tsv' Gene Phylogeny tsv: text: Gene Phylogeny tsv description: Gene Phylogeny tsv annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_gene_phylogeny.tsv' Scaffold Lineage tsv: text: Scaffold Lineage tsv description: phylogeny at the scaffold level annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_scaffold_lineage.tsv' Clusters of Orthologous Groups (COG) Annotation GFF: text: Clusters of Orthologous Groups (COG) Annotation GFF description: GFF3 format file with COGs annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_cog.gff' KO_EC Annotation GFF: text: KO_EC Annotation GFF description: GFF3 format file with KO_EC annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_ko_ec.gff' CATH FunFams (Functional Families) Annotation GFF: text: CATH FunFams (Functional Families) Annotation GFF description: GFF3 format file with CATH FunFams annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_cath_funfam.gff' SUPERFam Annotation GFF: text: SUPERFam Annotation GFF description: GFF3 format file with SUPERFam annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_supfam.gff' SMART Annotation GFF: text: SMART Annotation GFF description: GFF3 format file with SMART annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_smart.gff' Pfam Annotation GFF: text: Pfam Annotation GFF description: GFF3 format file with Pfam annotations: file_name_pattern: tag: file_name_pattern value: '[GOLD-AP]_pfam.gff' Annotation Statistics: text: Annotation Statistics description: Annotation statistics report Direct Infusion FT ICR-MS Raw Data: text: Direct Infusion FT ICR-MS Raw Data description: Direct infusion Fourier transform ion cyclotron resonance mass spectrometry raw data LC FT-ICR MS Raw Data: text: LC FT-ICR MS Raw Data description: Fourier transform ion cyclotron resonance mass spectrometry raw data acquired with liquid chromatography LC-DDA-MS/MS Raw Data: text: LC-DDA-MS/MS Raw Data description: Liquid chromatographically separated MS1 and Data-Dependent MS2 binary instrument file GC-MS Raw Data: text: GC-MS Raw Data description: Gas chromatography-mass spectrometry raw data, full scan mode. Configuration toml: text: Configuration toml description: A configuration toml file used by various programs to store settings that are specific to their respective software. broad_mappings: - edam.format:4005 LC-MS Lipidomics Results: text: LC-MS Lipidomics Results description: LC-MS-based lipidomics analysis results table LC-MS Lipidomics Processed Data: text: LC-MS Lipidomics Processed Data description: Processed data for the LC-MS-based lipidomics analysis in hdf5 format LC-MS Metabolomics Processed Data: text: LC-MS Metabolomics Processed Data description: Processed data for the LC-MS-based metabolomics analysis in hdf5 format Contaminants Amino Acid FASTA: text: Contaminants Amino Acid FASTA description: FASTA amino acid file for contaminant proteins commonly observed in proteomics data. Analysis Tool Parameter File: text: Analysis Tool Parameter File description: A configuration file used by a single computational software tool that stores settings that are specific to that tool. Workflow Operation Summary: text: Workflow Operation Summary description: A human readable record of analysis steps applied during an instance of a workflow operation. Metatranscriptome Expression: text: Metatranscriptome Expression description: Metatranscriptome expression values and read counts for gene features predicted on contigs annotations: file_name_pattern: tag: file_name_pattern value: '*.rnaseq_gea.txt' Metatranscriptome Expression Intergenic: text: Metatranscriptome Expression Intergenic description: Metatranscriptome expression values and read counts for intergenic regions. annotations: file_name_pattern: tag: file_name_pattern value: '*.rnaseq_gea.intergenic.txt' Metatranscriptome Expression Info File: text: Metatranscriptome Expression Info File description: File containing version information on the expression workflow annotations: file_name_pattern: tag: file_name_pattern value: '*_readcount.info' rRNA Filtered Sequencing Reads: text: rRNA Filtered Sequencing Reads description: File containing ribosomal reads from the read qc filtering step. annotations: file_name_pattern: tag: file_name_pattern value: '*.rRNA.fastq.gz' BAI File: text: BAI File description: An index file found in the same directory as the binary alignment map (BAM) file, a compressed binary version of a sequence alignment/map (SAM) file. annotations: file_name_pattern: tag: file_name_pattern value: '*.pairedMapped_sorted.bam.bai' exact_mappings: - NCIT:C190163 DoiProviderEnum: name: DoiProviderEnum from_schema: https://w3id.org/nmdc/nmdc see_also: - nmdc:DoiProviderEnum - nmdc:ProcessingInstitutionEnum - nmdc:ExecutionResourceEnum permissible_values: emsl: text: emsl meaning: ror:04rc0xn13 title: EMSL aliases: - Environmental Molecular Sciences Laboratory - EMSL jgi: text: jgi meaning: ror:04xm1d337 title: JGI aliases: - Joint Genome Institute - JGI kbase: text: kbase meaning: ror:01znn6x10 title: KBase aliases: - KBase osti: text: osti meaning: ror:031478740 title: OSTI aliases: - Office of Scientific and Technical Information - OSTI ess_dive: text: ess_dive meaning: ror:01t14bp54 title: ESS-DIVE aliases: - ESS-DIVE - Environmental System Science Data Infrastructure for a Virtual Ecosystem massive: text: massive title: MassIVE aliases: - MassIVE - Mass Spectrometry Virtual Environment gsc: text: gsc title: GSC aliases: - GSC - Genomic Standards Consortium zenodo: text: zenodo title: Zenodo aliases: - Zenodo edi: text: edi meaning: ror:0330j0z60 title: EDI aliases: - EDI - Environmental Data Initiative figshare: text: figshare meaning: ror:041mxqs23 title: Figshare DoiCategoryEnum: name: DoiCategoryEnum comments: - See especially the resourceTypeGeneral section of the DataCite PDF, on pp48-53 as of 2023-07-19 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://schema.datacite.org/meta/kernel-4.4/doc/DataCite-MetadataKernel_v4.4.pdf - https://api.crossref.org/types permissible_values: award_doi: text: award_doi description: A type of DOI that resolves to a funding authority. dataset_doi: text: dataset_doi description: A type of DOI that resolves to generated data. publication_doi: text: publication_doi description: A type of DOI that resolves to a publication. data_management_plan_doi: text: data_management_plan_doi description: A type of DOI that resolves to a data management plan. StatusEnum: name: StatusEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: pass: text: pass fail: text: fail NucleotideSequencingEnum: name: NucleotideSequencingEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: metagenome: text: metagenome title: Metagenome aliases: - metaG metatranscriptome: text: metatranscriptome title: Metatranscriptome aliases: - metaT amplicon_sequencing_assay: text: amplicon_sequencing_assay meaning: OBI:0002767 title: Amplicon MassSpectrometryEnum: name: MassSpectrometryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: metaproteome: text: metaproteome title: Metaproteome aliases: - metaP metabolome: text: metabolome title: Metabolome aliases: - metaB lipidome: text: lipidome title: Lipidome nom: text: nom title: Natural Organic Matter aliases: - natural organic matter ExtractionTargetEnum: name: ExtractionTargetEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: DNA: text: DNA RNA: text: RNA metabolite: text: metabolite protein: text: protein lipid: text: lipid natural organic matter: text: natural organic matter ProcessingInstitutionEnum: name: ProcessingInstitutionEnum notes: - use ROR meanings like ror:0168r3w48 for UCSD from_schema: https://w3id.org/nmdc/nmdc permissible_values: NMDC: text: NMDC meaning: ror:05cwx3318 title: National Microbiome Data Collaborative UCSD: text: UCSD meaning: ror:0168r3w48 title: University of California, San Diego JGI: text: JGI meaning: ror:04xm1d337 title: Joint Genome Institute EMSL: text: EMSL meaning: ror:04rc0xn13 title: Environmental Molecular Sciences Laboratory aliases: - Environmental Molecular Science Laboratory - Environmental Molecular Sciences Lab Battelle: text: Battelle meaning: ror:01h5tnr73 title: Battelle Memorial Institute ANL: text: ANL meaning: ror:05gvnxz63 title: Argonne National Laboratory UCD_Genome_Center: text: UCD_Genome_Center meaning: https://genomecenter.ucdavis.edu/ title: University of California, Davis Genome Center Azenta: text: Azenta meaning: https://www.azenta.com/ title: Azenta Life Sciences DataCategoryEnum: name: DataCategoryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: instrument_data: text: instrument_data description: Data generated by a DataGeneration PlannedProcess processed_data: text: processed_data description: Data generated by a WorkflowExecution PlannedProcess workflow_parameter_data: text: workflow_parameter_data description: Data used as input into a workflow providing workflow specification. related_mappings: - edam.data:0949 SourceSystemEnum: name: SourceSystemEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: NMDC_Submission_Portal: text: NMDC_Submission_Portal description: The National Microbiome Data Collaborative's Submission Portal see_also: - https://data.microbiomedata.org/submission/home GOLD: text: GOLD description: JGI's GOLD system see_also: - https://gold.jgi.doe.gov/ NEON_Data_Portal: text: NEON_Data_Portal description: National Science Foundation National Ecologial Observatory Network's Data Portal see_also: - https://data.neonscience.org/ NCBI: text: NCBI description: National Center for Biotechnology Information database see_also: - https://www.ncbi.nlm.nih.gov/biosample custom: text: custom description: Metadata was generated by custom methods such as an offline spreadsheet provided by a user or staff member. see_also: - https://github.com/microbiomedata/nmdc_mass_spectrometry_metadata_generation CreditEnum: name: CreditEnum comments: - CreditEnums come from https://casrai.org/credit/ from_schema: https://w3id.org/nmdc/nmdc permissible_values: Conceptualization: text: Conceptualization description: Conceptualization Data curation: text: Data curation description: Data curation Formal Analysis: text: Formal Analysis description: Formal Analysis Funding acquisition: text: Funding acquisition description: Funding acquisition Investigation: text: Investigation description: Investigation Methodology: text: Methodology description: Methodology Project administration: text: Project administration description: Project administration Resources: text: Resources description: Resources Software: text: Software description: Software Supervision: text: Supervision description: Supervision Validation: text: Validation description: Validation Visualization: text: Visualization description: Visualization Writing original draft: text: Writing original draft description: Writing – original draft Writing review and editing: text: Writing review and editing description: Writing – review & editing Principal Investigator: text: Principal Investigator description: principal investigator role meaning: OBI:0000103 Submitter: text: Submitter description: the person(s) who enter study and biosample metadata into the NMDC submission portal meaning: EFO:0001741 StudyCategoryEnum: name: StudyCategoryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: research_study: text: research_study description: A detailed examination, analysis, or critical inspection of a hypothesis-driven experiment. exact_mappings: - SIO:001066 - NCIT:C63536 - ISA:Study close_mappings: - OBI:0000355 consortium: text: consortium description: A group formed to undertake a venture that is beyond the capabilities of the individual members. Each member of the consortium brings a high level of expertise in a specific area to ensure the successful completion of the project. comments: - A consortium has collections of data, but those data do not come from a hypothesis-driven experiment. exact_mappings: - NCIT:C61538 ManifestCategoryEnum: name: ManifestCategoryEnum description: A list of contexts in which some DataObjects can be analyzed together. from_schema: https://w3id.org/nmdc/nmdc permissible_values: instrument_run: text: instrument_run description: A collection of data objects from a single run of an instrument. poolable_replicates: text: poolable_replicates description: A collection of data objects that can be pooled for downstream analyses. fractions: text: fractions description: A collection of data objects that represent fractions of a single sample. InstrumentModelEnum: name: InstrumentModelEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: exploris_21T: text: exploris_21T aliases: - Exploris 21T exploris_240: text: exploris_240 aliases: - Orbitrap Exploris 240 exploris_480: text: exploris_480 aliases: - Orbitrap Exploris 480 ltq_orbitrap_velos: text: ltq_orbitrap_velos aliases: - LTQ Orbitrap Velos - LTQ Orbitrap Velos ETD - Velos orbitrap_fusion_lumos: text: orbitrap_fusion_lumos aliases: - Orbitrap Fusion Lumos - Fusion orbitrap_eclipse_tribid: text: orbitrap_eclipse_tribid aliases: - Orbitrap Eclipse Tribid - Eclipse orbitrap_q_exactive: text: orbitrap_q_exactive aliases: - Orbitrap Q-Exactive HF - Orbitrap Q-Exactive HF-X orbitrap_iqx_tribrid: text: orbitrap_iqx_tribrid aliases: - Orbitrap IQ-X Tribrid - Thermo Orbitrap IQ-X Tribrid orbitrap_idx_tribrid: text: orbitrap_idx_tribrid aliases: - Orbitrap ID-X Tribrid - Thermo Orbitrap ID-X Tribrid orbitrap_exploris_120: text: orbitrap_exploris_120 aliases: - Orbitrap Exploris 120 - Thermo Orbitrap Exploris 120 solarix_7T: text: solarix_7T aliases: - 7T Solarix - 7T FT-ICR MS - 7T MRMS solarix_12T: text: solarix_12T aliases: - 12T Solarix - 12T FT-ICR MS - 12T MRMS solarix_15T: text: solarix_15T aliases: - 15T Solarix - 15T FT-ICR MS - 15T MRMS agilent_8890A: text: agilent_8890A aliases: - 8890A GC-MS - Agilent GC MS agilent_7980A: text: agilent_7980A aliases: - 7980A GC-MS - Agilent GC MS vortex_genie_2: text: vortex_genie_2 aliases: - VortexGenie2 novaseq: text: novaseq meaning: OBI:0003685 aliases: - NovaSeq - Illumina NovaSeq novaseq_6000: text: novaseq_6000 meaning: OBI:0002630 is_a: novaseq comments: - Possible flowcell versions are SP, S1, S2, S4. see_also: - https://www.illumina.com/systems/sequencing-platforms/novaseq/specifications.html aliases: - NovaSeq 6000 - Illumina NovaSeq 6000 structured_aliases: - literal_form: Illumina NovaSeq S2 predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ - literal_form: Illumina NovaSeq S4 predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ - literal_form: Illumina NovaSeq SP predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ novaseq_x: text: novaseq_x is_a: novaseq comments: - Possible flowcell versions are 1.5B, 10B, 25B. Only difference between X and X Plus is 2 flowcells for X Plus versus 1 flowcell for X. see_also: - https://www.illumina.com/systems/sequencing-platforms/novaseq-x-plus/specifications.html aliases: - Illumina NovaSeq X - Illumina NovaSeq X Plus structured_aliases: - literal_form: Illumina NovaSeq X 25B predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ exact_mappings: - OBI:0003663 narrow_mappings: - OBI:0003664 hiseq: text: hiseq meaning: OBI:0003683 aliases: - Illumina HiSeq hiseq_1000: text: hiseq_1000 meaning: OBI:0002022 is_a: hiseq aliases: - Illumina HiSeq 1000 hiseq_1500: text: hiseq_1500 meaning: OBI:0003386 is_a: hiseq aliases: - Illumina HiSeq 1500 hiseq_2000: text: hiseq_2000 meaning: OBI:0002001 is_a: hiseq aliases: - Illumina HiSeq 2000 hiseq_2500: text: hiseq_2500 meaning: OBI:0002002 is_a: hiseq aliases: - Illumina HiSeq 2500 structured_aliases: - literal_form: Illumina HiSeq 2500-1TB predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ - literal_form: Illumina HiSeq 2500-Rapid predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ hiseq_3000: text: hiseq_3000 meaning: OBI:0002048 is_a: hiseq aliases: - Illumina HiSeq 3000 hiseq_4000: text: hiseq_4000 meaning: OBI:0002049 is_a: hiseq aliases: - Illumina HiSeq 4000 hiseq_x_ten: text: hiseq_x_ten meaning: OBI:0002129 is_a: hiseq aliases: - Illumina HiSeq X Ten miniseq: text: miniseq meaning: OBI:0003114 aliases: - Illumina MiniSeq miseq: text: miseq meaning: OBI:0002003 aliases: - MiSeq - Illumina MiSeq structured_aliases: - literal_form: Illumina MiSeq predicate: EXACT_SYNONYM contexts: - https://gold.jgi.doe.gov/ nextseq_1000: text: nextseq_1000 meaning: OBI:0003606 is_a: nextseq aliases: - Illumina NextSeq 1000 nextseq: text: nextseq meaning: OBI:0003684 aliases: - NextSeq - Illumina NextSeq structured_aliases: - literal_form: Illumina NextSeq-HO predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ - literal_form: Illumina NextSeq-MO predicate: NARROW_SYNONYM contexts: - https://gold.jgi.doe.gov/ nextseq_500: text: nextseq_500 meaning: OBI:0002021 is_a: nextseq aliases: - NextSeq 500 - Illumina NextSeq 500 nextseq_550: text: nextseq_550 meaning: OBI:0003387 is_a: nextseq aliases: - NextSeq 550 - Illumina NextSeq 550 gridion: text: gridion meaning: OBI:0002751 aliases: - Oxford Nanopore GridION Mk1 minion: text: minion meaning: OBI:0002750 aliases: - Oxford Nanopore MinION promethion: text: promethion meaning: OBI:0002752 aliases: - Oxford Nanopore PromethION rs_II: text: rs_II meaning: OBI:0002012 aliases: - PacBio RS II sequel: text: sequel meaning: OBI:0002632 aliases: - PacBio Sequel sequel_II: text: sequel_II meaning: OBI:0002633 aliases: - PacBio Sequel II sequel_IIe: text: sequel_IIe is_a: sequel_II aliases: - PacBio Sequel IIe revio: text: revio aliases: - PacBio Revio - Revio InstrumentVendorEnum: name: InstrumentVendorEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: waters: text: waters aliases: - Waters Corporation agilent: text: agilent aliases: - Agilent Technologies bruker: text: bruker aliases: - Bruker Corporation - Bruker Daltonics thermo_fisher: text: thermo_fisher aliases: - ThermoFisher - Thermo Fisher Scientific vwr: text: vwr perkin_elmer: text: perkin_elmer gilson: text: gilson scientific_industries: text: scientific_industries illumina: text: illumina meaning: OBI:0000759 aliases: - Illumina pacbio: text: pacbio meaning: OBI:0001856 aliases: - PacBio - Pacific Biosciences oxford_nanopore: text: oxford_nanopore meaning: OBI:0002755 aliases: - Oxford Nanopore Technologies pnnl: text: pnnl aliases: - PNNL FailureWhatEnum: name: FailureWhatEnum description: The permitted values for describing where a failure occurred during processing in the lab during analysis workflows. from_schema: https://w3id.org/nmdc/nmdc permissible_values: low_read_count: text: low_read_count description: Number of output reads is not sufficient to continue to the next analysis step. malformed_data: text: malformed_data description: Workflow failure reading input or writing the output file(s). assembly_size_too_small: text: assembly_size_too_small description: The size of the metagenome or metatranscriptome assembly is too small to proceed to the next analysis workflow. no_valid_data_generated: text: no_valid_data_generated description: A process ran but did not produce any output. Ie binning ran but did not produce any medium or high quality bins. other: text: other description: A lab process or analysis workflow has failed in a way that has not been captured by the available values yet. Please use slot 'qc_comment' to specify details. low_molecular_formula_assignment: text: low_molecular_formula_assignment description: Number of peaks with assigned molecular formulas during the workflow is not sufficient. low_metabolite_assignment: text: low_metabolite_assignment description: Number of metabolites identified during the Metabolomics or Lipidomics workflow is not sufficient. low_c13_isotopologue_assignment: text: low_c13_isotopologue_assignment description: Number of 13C isotopologues identified during the Metabolomics or Lipidomics workflow is not sufficient. low_peptide_to_spectrum_match_rate: text: low_peptide_to_spectrum_match_rate description: Rate of peptide assignment during the analysis is not sufficient. FailureWhereEnum: name: FailureWhereEnum description: The permitted values for describing where in the process, either a lab or analysis workflow step, the failure occurred. comments: - At Chris' recommendation permissible values for this enumeration are the same as Class names. from_schema: https://w3id.org/nmdc/nmdc permissible_values: NucleotideSequencing: text: NucleotideSequencing description: A failure has occurred during nucleotide sequencing, a data generation process. MassSpectrometry: text: MassSpectrometry description: A failure has occurred during mass spectrometry, a data generation process. Pooling: text: Pooling description: A failure has occurred in pooling, a lab process. Extraction: text: Extraction description: A failure has occurred in extraction, a lab process. LibraryPreparation: text: LibraryPreparation description: A failure has occurred in library preparation, a lab process. MetagenomeAssembly: text: MetagenomeAssembly description: A failure has occurred in metagenome assembly, a workflow process. MetatranscriptomeExpressionAnalysis: text: MetatranscriptomeExpressionAnalysis description: A failure has occurred in metatranscriptome expression analysis, a workflow process. MagsAnalysis: text: MagsAnalysis description: A failure has occurred in binning, a workflow process to generate metagenome-assembled genomes (MAGS). ReadQcAnalysis: text: ReadQcAnalysis description: A failure has occurred in read qc, a workflow process. ReadBasedTaxonomyAnalysis: text: ReadBasedTaxonomyAnalysis description: A failure has occurred in reads based taxonomy, a workflow process. MetagenomeAnnotation: text: MetagenomeAnnotation description: A failure has occurred in annotation, a workflow process. MetatranscriptomeAssembly: text: MetatranscriptomeAssembly description: A failure has occurred in assembly, a workflow process. MetatranscriptomeAnnotation: text: MetatranscriptomeAnnotation description: A failure has occurred in annotation, a workflow process. MetabolomicsAnalysis: text: MetabolomicsAnalysis description: A failure has occurred in analyzing metabolomics data. MetaproteomicsAnalysis: text: MetaproteomicsAnalysis description: A failure has occurred in analyzing metaproteomics data. NomAnalysis: text: NomAnalysis description: A failure has occurred in analyzing NOM data. ProtocolForEnum: name: ProtocolForEnum description: The permitted values for describing the type of planned process that a protocol describes. comments: - These are the non-abstract class descendants of PlannedProcess. from_schema: https://w3id.org/nmdc/nmdc permissible_values: AnnotatingWorkflow: text: AnnotatingWorkflow ChemicalConversionProcess: text: ChemicalConversionProcess ChromatographicSeparationProcess: text: ChromatographicSeparationProcess CollectingBiosamplesFromSite: text: CollectingBiosamplesFromSite Culturing: text: Culturing DataEmitterProcess: text: DataEmitterProcess DataGeneration: text: DataGeneration DissolvingProcess: text: DissolvingProcess Extraction: text: Extraction FiltrationProcess: text: FiltrationProcess Isolation: text: Isolation LibraryPreparation: text: LibraryPreparation MagsAnalysis: text: MagsAnalysis MassSpectrometry: text: MassSpectrometry MaterialProcessing: text: MaterialProcessing MetabolomicsAnalysis: text: MetabolomicsAnalysis MetagenomeAnnotation: text: MetagenomeAnnotation MetagenomeAssembly: text: MetagenomeAssembly MetaproteomicsAnalysis: text: MetaproteomicsAnalysis MetatranscriptomeAnnotation: text: MetatranscriptomeAnnotation MetatranscriptomeAssembly: text: MetatranscriptomeAssembly MetatranscriptomeExpressionAnalysis: text: MetatranscriptomeExpressionAnalysis MixingProcess: text: MixingProcess NomAnalysis: text: NomAnalysis NucleotideSequencing: text: NucleotideSequencing PlannedProcess: text: PlannedProcess Pooling: text: Pooling ReadBasedTaxonomyAnalysis: text: ReadBasedTaxonomyAnalysis ReadQcAnalysis: text: ReadQcAnalysis StorageProcess: text: StorageProcess SubSamplingProcess: text: SubSamplingProcess WorkflowExecution: text: WorkflowExecution PloidyEnum: name: PloidyEnum description: The ploidy state of an organism's genome, drawn from the ploidy classes of the Phenotypic Quality Ontology (PATO). notes: - 'How this enum was built: each value is a PATO ploidy (PATO:0001374) subclass observed in the GOLD field dw_sample_taxonomy_info.ploidy_comments (queried 2026-04-29), or added to complete the series, with GOLD literal forms as structured aliases. Alias `source` URLs cite the public GOLD portal because that field is access-restricted. This is the range of the `ploidy` slot, narrowing MIxS `ploidy` (MIXS:0000021) from free text.' - 'PATO term requests needed before these can become permissible values: octoploid (eight homologous sets; PATO''s polyploidy ladder stops at hexaploid) and the allopolyploidy subtypes allotetraploid, allohexaploid, and segmental allotetraploid. All were observed in GOLD and are recorded here as narrow synonyms of `polyploid` / `allopolyploidy` until PATO classes exist. Tracked in https://github.com/pato-ontology/pato/issues/605.' - 'Deliberately out of scope: dikaryon / dikaryotic / polykaryotic describe the number of nuclei per cell (a fungal life-cycle state), not chromosome-set ploidy, and have no PATO ploidy class; if needed they belong in a separate slot. Cytogenetic counts (e.g. 2n=38), bare integers, hedged phrases (e.g. "Likely haploid"), and free-text identifiers seen in the source field are left to this optional slot being unset rather than forced into a value.' from_schema: https://w3id.org/nmdc/nmdc permissible_values: haploid: text: haploid description: A single set of homologous chromosomes. meaning: PATO:0001375 structured_aliases: - literal_form: Haploid predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 1n predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 1N predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: haploide predicate: EXACT_SYNONYM notes: - French-language spelling observed in GOLD. source: https://gold.jgi.doe.gov/ diploid: text: diploid description: Two homologous sets of chromosomes. meaning: PATO:0001394 structured_aliases: - literal_form: Diploid predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 2n predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 2N predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 2x predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: Diploïde predicate: EXACT_SYNONYM notes: - French-language spelling observed in GOLD. source: https://gold.jgi.doe.gov/ triploid: text: triploid description: Three homologous sets of chromosomes. meaning: PATO:0001381 structured_aliases: - literal_form: Triploid predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 3n predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 3x predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ tetraploid: text: tetraploid description: Four homologous sets of chromosomes. meaning: PATO:0001382 structured_aliases: - literal_form: Tetraploid predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: tetraploidy predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 4n predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 4x predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ pentaploid: text: pentaploid description: Five homologous sets of chromosomes. meaning: PATO:0001383 notes: - Not observed in the 2026-04-29 GOLD snapshot; included so the triploid–hexaploid ladder is not arbitrarily gapped. hexaploid: text: hexaploid description: Six homologous sets of chromosomes. meaning: PATO:0001384 structured_aliases: - literal_form: Hexaploid predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 6n predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: 6x predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ polyploid: text: polyploid description: More than two homologous sets of chromosomes; use a more specific value when the level is known. meaning: PATO:0001377 structured_aliases: - literal_form: octoploid predicate: NARROW_SYNONYM notes: - Eight homologous sets; observed in GOLD (also as "octaploid", "octapolid"). No PATO class exists, so it is recorded as a narrow synonym of polyploid pending a PATO term request. source: https://gold.jgi.doe.gov/ - literal_form: octaploid predicate: NARROW_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: octapolid predicate: NARROW_SYNONYM notes: - Misspelling of octoploid retained as observed in GOLD. source: https://gold.jgi.doe.gov/ allopolyploidy: text: allopolyploidy description: Polyploid whose chromosome sets derive from two or more different species. meaning: PATO:0001379 structured_aliases: - literal_form: Allopolyploid predicate: EXACT_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: Allotetraploid predicate: NARROW_SYNONYM notes: - Allopolyploid at the tetraploid level; observed in GOLD (also "segmental allotetraploid"). No PATO class exists, so it is recorded as a narrow synonym pending a PATO term request. source: https://gold.jgi.doe.gov/ - literal_form: segmental allotetraploid predicate: NARROW_SYNONYM source: https://gold.jgi.doe.gov/ - literal_form: allohexaploid predicate: NARROW_SYNONYM notes: - Allopolyploid at the hexaploid level; observed in GOLD. No PATO class exists, so it is recorded as a narrow synonym pending a PATO term request. source: https://gold.jgi.doe.gov/ autopolyploid: text: autopolyploid description: Polyploid whose chromosome sets derive from a single species. meaning: PATO:0001378 notes: - Not observed in the 2026-04-29 GOLD snapshot; included as the origin-counterpart of `allopolyploidy`. aneuploid: text: aneuploid description: A chromosome number that is not an exact multiple of the haploid set (extra or missing chromosomes). meaning: PATO:0001385 AeroStrucEnum: name: AeroStrucEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: glider: text: glider plane: text: plane ArchStrucEnum: name: ArchStrucEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: building: text: building home: text: home shed: text: shed BiolStatEnum: name: BiolStatEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: breeder's line: text: breeder's line clonal selection: text: clonal selection hybrid: text: hybrid inbred line: text: inbred line mutant: text: mutant natural: text: natural semi-natural: text: semi-natural wild: text: wild BioticRelationshipEnum: name: BioticRelationshipEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: commensalism: text: commensalism free living: text: free living mutualism: text: mutualism parasitism: text: parasitism symbiotic: text: symbiotic BuildDocsEnum: name: BuildDocsEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: building information model: text: building information model commissioning report: text: commissioning report complaint logs: text: complaint logs contract administration: text: contract administration cost estimate: text: cost estimate janitorial schedules or logs: text: janitorial schedules or logs maintenance plans: text: maintenance plans schedule: text: schedule sections: text: sections shop drawings: text: shop drawings submittals: text: submittals ventilation system: text: ventilation system windows: text: windows BuildOccupTypeEnum: name: BuildOccupTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: airport: text: airport commercial: text: commercial health care: text: health care high rise: text: high rise low rise: text: low rise market: text: market office: text: office residence: text: residence residential: text: residential restaurant: text: restaurant school: text: school sports complex: text: sports complex wood framed: text: wood framed BuildingSettingEnum: name: BuildingSettingEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: exurban: text: exurban rural: text: rural suburban: text: suburban urban: text: urban BuiltStrucSetEnum: name: BuiltStrucSetEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: rural: text: rural urban: text: urban CeilFinishMatEnum: name: CeilFinishMatEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: PVC: text: PVC drywall: text: drywall fiberglass: text: fiberglass metal: text: metal mineral fibre: text: mineral fibre mineral wool/calcium silicate: text: mineral wool/calcium silicate plasterboard: text: plasterboard stucco: text: stucco tiles: text: tiles wood: text: wood CeilStrucEnum: name: CeilStrucEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: concrete: text: concrete wood frame: text: wood frame CeilTypeEnum: name: CeilTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: barrel-shaped: text: barrel-shaped cathedral: text: cathedral coffered: text: coffered concave: text: concave cove: text: cove dropped: text: dropped stretched: text: stretched CeilingWallTextureEnum: name: CeilingWallTextureEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Santa-Fe texture: text: Santa-Fe texture crows feet: text: crows feet crows-foot stomp: text: crows-foot stomp double skip: text: double skip hawk and trowel: text: hawk and trowel knockdown: text: knockdown orange peel: text: orange peel popcorn: text: popcorn rosebud stomp: text: rosebud stomp skip trowel: text: skip trowel smooth: text: smooth stomp knockdown: text: stomp knockdown swirl: text: swirl CompassDirections8Enum: name: CompassDirections8Enum from_schema: https://w3id.org/nmdc/nmdc permissible_values: east: text: east north: text: north northeast: text: northeast northwest: text: northwest south: text: south southeast: text: southeast southwest: text: southwest west: text: west DamagedEnum: name: DamagedEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: damaged: text: damaged needs repair: text: needs repair new: text: new rupture: text: rupture visible wear: text: visible wear DamagedRupturedEnum: name: DamagedRupturedEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: damaged: text: damaged needs repair: text: needs repair new: text: new rupture: text: rupture visible wear: text: visible wear DeposEnvEnum: name: DeposEnvEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Continental - Aeolian: text: Continental - Aeolian Continental - Alluvial: text: Continental - Alluvial Continental - Fluvial: text: Continental - Fluvial Continental - Lacustrine: text: Continental - Lacustrine Marine - Deep: text: Marine - Deep Marine - Reef: text: Marine - Reef Marine - Shallow: text: Marine - Shallow Other - Evaporite: text: Other - Evaporite Other - Glacial: text: Other - Glacial Other - Volcanic: text: Other - Volcanic Transitional - Beach: text: Transitional - Beach Transitional - Deltaic: text: Transitional - Deltaic Transitional - Lagoonal: text: Transitional - Lagoonal Transitional - Lake: text: Transitional - Lake Transitional - Tidal: text: Transitional - Tidal other: text: other DoorCompTypeEnum: name: DoorCompTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: metal covered: text: metal covered revolving: text: revolving sliding: text: sliding telescopic: text: telescopic DoorDirectEnum: name: DoorDirectEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: inward: text: inward outward: text: outward sideways: text: sideways DoorMatEnum: name: DoorMatEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: aluminum: text: aluminum cellular PVC: text: cellular PVC engineered plastic: text: engineered plastic fiberboard: text: fiberboard fiberglass: text: fiberglass metal: text: metal thermoplastic alloy: text: thermoplastic alloy vinyl: text: vinyl wood: text: wood wood/plastic composite: text: wood/plastic composite DoorMoveEnum: name: DoorMoveEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: collapsible: text: collapsible folding: text: folding revolving: text: revolving rolling shutter: text: rolling shutter sliding: text: sliding swinging: text: swinging DoorTypeEnum: name: DoorTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: composite: text: composite metal: text: metal wooden: text: wooden DoorTypeMetalEnum: name: DoorTypeMetalEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: collapsible: text: collapsible corrugated steel: text: corrugated steel hollow: text: hollow rolling shutters: text: rolling shutters steel plate: text: steel plate DrainageClassEnum: name: DrainageClassEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: excessively drained: text: excessively drained moderately well: text: moderately well poorly: text: poorly somewhat poorly: text: somewhat poorly very poorly: text: very poorly well: text: well DrawingsEnum: name: DrawingsEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: as built: text: as built bid: text: bid building navigation map: text: building navigation map construction: text: construction design: text: design diagram: text: diagram operation: text: operation sketch: text: sketch FaoClassEnum: name: FaoClassEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Acrisols: text: Acrisols Alisols: text: Alisols Andosols: text: Andosols Anthrosols: text: Anthrosols Arenosols: text: Arenosols Calcisols: text: Calcisols Cambisols: text: Cambisols Chernozems: text: Chernozems Cryosols: text: Cryosols Durisols: text: Durisols Ferralsols: text: Ferralsols Fluvisols: text: Fluvisols Gleysols: text: Gleysols Greyzems: text: Greyzems deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 Gypsisols: text: Gypsisols Histosols: text: Histosols Kastanozems: text: Kastanozems Lithosols: text: Lithosols deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 Leptosols: text: Leptosols Lixisols: text: Lixisols Luvisols: text: Luvisols Nitosols: text: Nitosols Phaeozems: text: Phaeozems Planosols: text: Planosols Plinthosols: text: Plinthosols Podzols: text: Podzols Podzoluvisols: text: Podzoluvisols deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 Rankers: text: Rankers deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 Regosols: text: Regosols deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 Rendzinas: text: Rendzinas deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 Solonchaks: text: Solonchaks Solonetz: text: Solonetz Stagnosols: text: Stagnosols Technosols: text: Technosols Umbrisols: text: Umbrisols Vertisols: text: Vertisols Yermosols: text: Yermosols deprecated: true, value no longer recognized by FAO, https://github.com/GenomicsStandardsConsortium/mixs/issues/696 FilterTypeEnum: name: FilterTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: HEPA: text: HEPA chemical air filter: text: chemical air filter electrostatic: text: electrostatic gas-phase or ultraviolet air treatments: text: gas-phase or ultraviolet air treatments low-MERV pleated media: text: low-MERV pleated media particulate air filter: text: particulate air filter FireplaceTypeEnum: name: FireplaceTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: gas burning: text: gas burning wood burning: text: wood burning FloorStrucEnum: name: FloorStrucEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: balcony: text: balcony concrete: text: concrete floating floor: text: floating floor glass floor: text: glass floor raised floor: text: raised floor sprung floor: text: sprung floor wood-framed: text: wood-framed FloorWaterMoldEnum: name: FloorWaterMoldEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: bulging walls: text: bulging walls ceiling discoloration: text: ceiling discoloration condensation: text: condensation floor discoloration: text: floor discoloration mold odor: text: mold odor peeling paint or wallpaper: text: peeling paint or wallpaper wall discoloration: text: wall discoloration water stains: text: water stains wet floor: text: wet floor FreqCleanEnum: name: FreqCleanEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Annually: text: Annually Daily: text: Daily Monthly: text: Monthly Quarterly: text: Quarterly Weekly: text: Weekly other: text: other FurnitureEnum: name: FurnitureEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: cabinet: text: cabinet chair: text: chair desks: text: desks GenderRestroomEnum: name: GenderRestroomEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: all gender: text: all gender female: text: female gender neutral: text: gender neutral male: text: male male and female: text: male and female unisex: text: unisex GeolAgeEnum: name: GeolAgeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Archean: text: Archean Cambrian: text: Cambrian Carboniferous: text: Carboniferous Cenozoic: text: Cenozoic Cretaceous: text: Cretaceous Devonian: text: Devonian Jurassic: text: Jurassic Mesozoic: text: Mesozoic Neogene: text: Neogene Ordovician: text: Ordovician Paleogene: text: Paleogene Paleozoic: text: Paleozoic Permian: text: Permian Precambrian: text: Precambrian Proterozoic: text: Proterozoic Silurian: text: Silurian Triassic: text: Triassic other: text: other GrowthHabitEnum: name: GrowthHabitEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: erect: text: erect prostrate: text: prostrate semi-erect: text: semi-erect spreading: text: spreading HandidnessEnum: name: HandidnessEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: ambidexterity: text: ambidexterity left handedness: text: left handedness mixed-handedness: text: mixed-handedness right handedness: text: right handedness HcProducedEnum: name: HcProducedEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Bitumen: text: Bitumen Coalbed Methane: text: Coalbed Methane Gas: text: Gas Gas-Condensate: text: Gas-Condensate Oil: text: Oil other: text: other HcrEnum: name: HcrEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Coalbed: text: Coalbed Gas Reservoir: text: Gas Reservoir Oil Reservoir: text: Oil Reservoir Oil Sand: text: Oil Sand Shale: text: Shale Tight Gas Reservoir: text: Tight Gas Reservoir Tight Oil Reservoir: text: Tight Oil Reservoir other: text: other HeatCoolTypeEnum: name: HeatCoolTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: forced air system: text: forced air system heat pump: text: heat pump radiant system: text: radiant system steam forced heat: text: steam forced heat wood stove: text: wood stove HeatSysDelivMethEnum: name: HeatSysDelivMethEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: conductive: text: conductive radiant: text: radiant IndoorSpaceEnum: name: IndoorSpaceEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: bathroom: text: bathroom bedroom: text: bedroom elevator: text: elevator foyer: text: foyer hallway: text: hallway kitchen: text: kitchen locker room: text: locker room office: text: office IndoorSurfEnum: name: IndoorSurfEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: cabinet: text: cabinet ceiling: text: ceiling counter top: text: counter top door: text: door shelving: text: shelving vent cover: text: vent cover wall: text: wall window: text: window LibLayoutEnum: name: LibLayoutEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: other: text: other paired: text: paired single: text: single vector: text: vector LightTypeEnum: name: LightTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: desk lamp: text: desk lamp electric light: text: electric light fluorescent lights: text: fluorescent lights natural light: text: natural light none: text: none LithologyEnum: name: LithologyEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Basement: text: Basement Chalk: text: Chalk Chert: text: Chert Coal: text: Coal Conglomerate: text: Conglomerate Diatomite: text: Diatomite Dolomite: text: Dolomite Limestone: text: Limestone Sandstone: text: Sandstone Shale: text: Shale Siltstone: text: Siltstone Volcanic: text: Volcanic other: text: other MechStrucEnum: name: MechStrucEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: boat: text: boat bus: text: bus car: text: car carriage: text: carriage coach: text: coach elevator: text: elevator escalator: text: escalator subway: text: subway train: text: train MoldVisibilityEnum: name: MoldVisibilityEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: no presence of mold visible: text: no presence of mold visible presence of mold visible: text: presence of mold visible OccupDocumentEnum: name: OccupDocumentEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: automated count: text: automated count estimate: text: estimate manual count: text: manual count videos: text: videos OxyStatSampEnum: name: OxyStatSampEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: aerobic: text: aerobic anaerobic: text: anaerobic other: text: other PlantSexEnum: name: PlantSexEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Androdioecious: text: Androdioecious Androecious: text: Androecious Androgynomonoecious: text: Androgynomonoecious Androgynous: text: Androgynous Andromonoecious: text: Andromonoecious Bisexual: text: Bisexual Dichogamous: text: Dichogamous Diclinous: text: Diclinous Dioecious: text: Dioecious Gynodioecious: text: Gynodioecious Gynoecious: text: Gynoecious Gynomonoecious: text: Gynomonoecious Hermaphroditic: text: Hermaphroditic Imperfect: text: Imperfect Monoclinous: text: Monoclinous Monoecious: text: Monoecious Perfect: text: Perfect Polygamodioecious: text: Polygamodioecious Polygamomonoecious: text: Polygamomonoecious Polygamous: text: Polygamous Protandrous: text: Protandrous Protogynous: text: Protogynous Subandroecious: text: Subandroecious Subdioecious: text: Subdioecious Subgynoecious: text: Subgynoecious Synoecious: text: Synoecious Trimonoecious: text: Trimonoecious Trioecious: text: Trioecious Unisexual: text: Unisexual ProfilePositionEnum: name: ProfilePositionEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: backslope: text: backslope footslope: text: footslope shoulder: text: shoulder summit: text: summit toeslope: text: toeslope QuadPosEnum: name: QuadPosEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: East side: text: East side North side: text: North side South side: text: South side West side: text: West side RelSampLocEnum: name: RelSampLocEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: center of car: text: center of car edge of car: text: edge of car under a seat: text: under a seat RoomCondtEnum: name: RoomCondtEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: damaged: text: damaged needs repair: text: needs repair new: text: new rupture: text: rupture visible signs of mold/mildew: text: visible signs of mold/mildew visible wear: text: visible wear RoomConnectedEnum: name: RoomConnectedEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: attic: text: attic bathroom: text: bathroom closet: text: closet conference room: text: conference room elevator: text: elevator examining room: text: examining room hallway: text: hallway kitchen: text: kitchen mail room: text: mail room office: text: office stairwell: text: stairwell RoomLocEnum: name: RoomLocEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: corner room: text: corner room exterior wall: text: exterior wall interior room: text: interior room RoomSampPosEnum: name: RoomSampPosEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: center: text: center east corner: text: east corner north corner: text: north corner northeast corner: text: northeast corner northwest corner: text: northwest corner south corner: text: south corner southeast corner: text: southeast corner southwest corner: text: southwest corner west corner: text: west corner SampCaptStatusEnum: name: SampCaptStatusEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: active surveillance in response to an outbreak: text: active surveillance in response to an outbreak active surveillance not initiated by an outbreak: text: active surveillance not initiated by an outbreak farm sample: text: farm sample market sample: text: market sample other: text: other SampCollectPointEnum: name: SampCollectPointEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: drilling rig: text: drilling rig other: text: other separator: text: separator storage tank: text: storage tank test well: text: test well well: text: well wellhead: text: wellhead SampDisStageEnum: name: SampDisStageEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: dissemination: text: dissemination growth and reproduction: text: growth and reproduction infection: text: infection inoculation: text: inoculation other: text: other penetration: text: penetration SampSubtypeEnum: name: SampSubtypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: biofilm: text: biofilm not applicable: text: not applicable oil phase: text: oil phase other: text: other water phase: text: water phase SampWeatherEnum: name: SampWeatherEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: clear sky: text: clear sky cloudy: text: cloudy foggy: text: foggy hail: text: hail rain: text: rain sleet: text: sleet snow: text: snow sunny: text: sunny windy: text: windy SeasonEnum: name: SeasonEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: autumn [NCIT:C94733]: text: autumn [NCIT:C94733] meaning: NCIT:C94733 spring [NCIT:C94731]: text: spring [NCIT:C94731] meaning: NCIT:C94731 summer [NCIT:C94732]: text: summer [NCIT:C94732] meaning: NCIT:C94732 winter [NCIT:C94730]: text: winter [NCIT:C94730] meaning: NCIT:C94730 SeasonUseEnum: name: SeasonUseEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Fall: text: Fall Spring: text: Spring Summer: text: Summer Winter: text: Winter SedimentTypeEnum: name: SedimentTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: biogenous: text: biogenous cosmogenous: text: cosmogenous hydrogenous: text: hydrogenous lithogenous: text: lithogenous SeqQualityCheckEnum: name: SeqQualityCheckEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: manually edited: text: manually edited none: text: none ShadingDeviceLocEnum: name: ShadingDeviceLocEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: exterior: text: exterior interior: text: interior ShadingDeviceTypeEnum: name: ShadingDeviceTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: bahama shutters: text: bahama shutters exterior roll blind: text: exterior roll blind gambrel awning: text: gambrel awning hood awning: text: hood awning porchroller awning: text: porchroller awning sarasota shutters: text: sarasota shutters slatted aluminum: text: slatted aluminum solid aluminum awning: text: solid aluminum awning sun screen: text: sun screen tree: text: tree trellis: text: trellis venetian awning: text: venetian awning SoilHorizonEnum: name: SoilHorizonEnum from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.nrcs.usda.gov/resources/education-and-teaching-materials/a-soil-profile - https://www.ffa.org/ag-101/ag-101-soil-horizons/ - https://soil.evs.buffalo.edu/index.php/Soil_Horizons - https://en.wikipedia.org/wiki/Soil_horizon - https://en.wikipedia.org/wiki/Permafrost permissible_values: A horizon: text: A horizon description: The surface horizon, also called topsoil. It has a defined soil structure, and is mostly made up of humus (decayed organic matter). B horizon: text: B horizon description: Also known as the subsoil. It is greatly composed of material illuviated (washed in from) layers above it. It is typically denser than the A horizon and has a clayey texture. C horizon: text: C horizon description: Also known as the substratum is unconsolidated material deepest in the pit and closest to the bedrock. E horizon: text: E horizon description: Used to refer to subsurface horizons that have undergone a significant loss of minerals, also known as Eluviation (or leaching). O horizon: text: O horizon description: The organic horizon. Typically at the top of the soil structure and is made up of mostly organic matter. meaning: http://purl.obolibrary.org/obo/ENVO_03600018 Permafrost: text: Permafrost description: Soil that continuously remains below 0 °C (32 °F) for two years or more. R layer: text: R layer description: Hard bedrock, which is usually the lowest layer. It is characterized by tightly bound and unbreakable materials. aliases: - R horizon M horizon: text: M horizon SpaceTypStateEnum: name: SpaceTypStateEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: typically occupied: text: typically occupied typically unoccupied: text: typically unoccupied SpecificEnum: name: SpecificEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: as built: text: as built bid: text: bid construction: text: construction design: text: design operation: text: operation photos: text: photos SrDepEnvEnum: name: SrDepEnvEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Fluvioldeltaic: text: Fluvioldeltaic Fluviomarine: text: Fluviomarine Lacustine: text: Lacustine Marine: text: Marine other: text: other SrKerogTypeEnum: name: SrKerogTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Type I: text: Type I Type II: text: Type II Type III: text: Type III Type IV: text: Type IV other: text: other SrLithologyEnum: name: SrLithologyEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Biosilicieous: text: Biosilicieous Carbonate: text: Carbonate Clastic: text: Clastic Coal: text: Coal other: text: other SubstructureTypeEnum: name: SubstructureTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: basement: text: basement crawlspace: text: crawlspace slab on grade: text: slab on grade SurfAirContEnum: name: SurfAirContEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: biocides: text: biocides biological contaminants: text: biological contaminants dust: text: dust nutrients: text: nutrients organic matter: text: organic matter particulate matter: text: particulate matter radon: text: radon volatile organic compounds: text: volatile organic compounds SurfMaterialEnum: name: SurfMaterialEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: adobe: text: adobe carpet: text: carpet cinder blocks: text: cinder blocks concrete: text: concrete glass: text: glass hay bales: text: hay bales metal: text: metal paint: text: paint plastic: text: plastic stainless steel: text: stainless steel stone: text: stone stucco: text: stucco tile: text: tile vinyl: text: vinyl wood: text: wood TidalStageEnum: name: TidalStageEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: ebb tide: text: ebb tide flood tide: text: flood tide high tide: text: high tide low tide: text: low tide TillageEnum: name: TillageEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: chisel: text: chisel cutting disc: text: cutting disc disc plough: text: disc plough drill: text: drill mouldboard: text: mouldboard ridge till: text: ridge till strip tillage: text: strip tillage tined: text: tined zonal tillage: text: zonal tillage TrainLineEnum: name: TrainLineEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: green: text: green orange: text: orange red: text: red TrainStatLocEnum: name: TrainStatLocEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: forest hills: text: forest hills riverside: text: riverside south station above ground: text: south station above ground south station amtrak: text: south station amtrak south station underground: text: south station underground TrainStopLocEnum: name: TrainStopLocEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: downtown: text: downtown end: text: end mid: text: mid WallConstTypeEnum: name: WallConstTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: fire resistive: text: fire resistive frame construction: text: frame construction joisted masonry: text: joisted masonry light noncombustible: text: light noncombustible masonry noncombustible: text: masonry noncombustible modified fire resistive: text: modified fire resistive WallFinishMatEnum: name: WallFinishMatEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: acoustical treatment: text: acoustical treatment gypsum board: text: gypsum board gypsum plaster: text: gypsum plaster masonry: text: masonry metal: text: metal plaster: text: plaster stone facing: text: stone facing terrazzo: text: terrazzo tile: text: tile veneer plaster: text: veneer plaster wood: text: wood WallSurfTreatmentEnum: name: WallSurfTreatmentEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: fabric: text: fabric no treatment: text: no treatment painted: text: painted paneling: text: paneling stucco: text: stucco wall paper: text: wall paper WaterFeatTypeEnum: name: WaterFeatTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: fountain: text: fountain pool: text: pool standing feature: text: standing feature stream: text: stream waterfall: text: waterfall WeekdayEnum: name: WeekdayEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: Friday: text: Friday Monday: text: Monday Saturday: text: Saturday Sunday: text: Sunday Thursday: text: Thursday Tuesday: text: Tuesday Wednesday: text: Wednesday WindowCoverEnum: name: WindowCoverEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: blinds: text: blinds curtains: text: curtains none: text: none WindowHorizPosEnum: name: WindowHorizPosEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: left: text: left middle: text: middle right: text: right WindowMatEnum: name: WindowMatEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: clad: text: clad fiberglass: text: fiberglass metal: text: metal vinyl: text: vinyl wood: text: wood WindowStatusEnum: name: WindowStatusEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: closed: text: closed open: text: open WindowTypeEnum: name: WindowTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: fixed window: text: fixed window horizontal sash window: text: horizontal sash window single-hung sash window: text: single-hung sash window WindowVertPosEnum: name: WindowVertPosEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: bottom: text: bottom high: text: high low: text: low middle: text: middle top: text: top HostSexEnum: name: HostSexEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: female: text: female hermaphrodite: text: hermaphrodite non-binary: text: non-binary male: text: male transgender: text: transgender transgender (female to male): text: transgender (female to male) transgender (male to female): text: transgender (male to female) undeclared: text: undeclared CurLandUseEnum: name: CurLandUseEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: badlands: text: badlands cities: text: cities conifers: text: conifers annotations: originally: tag: originally value: conifers (e.g. pine,spruce,fir,cypress) examples: - value: cypress - value: fir - value: pine - value: spruce crop trees: text: crop trees annotations: originally: tag: originally value: crop trees (nuts,fruit,christmas trees,nursery trees) examples: - value: christmas trees - value: fruit - value: nursery trees - value: nuts farmstead: text: farmstead gravel: text: gravel hardwoods: text: hardwoods annotations: originally: tag: originally value: hardwoods (e.g. oak,hickory,elm,aspen) examples: - value: aspen - value: elm - value: hickory - value: oak hayland: text: hayland horticultural plants: text: horticultural plants annotations: originally: tag: originally value: horticultural plants (e.g. tulips) examples: - value: tulips industrial areas: text: industrial areas intermixed hardwood and conifers: text: intermixed hardwood and conifers marshlands: text: marshlands annotations: originally: tag: originally value: marshlands (grass,sedges,rushes) examples: - value: grass - value: rushes - value: sedgees meadows: text: meadows annotations: originally: tag: originally value: meadows (grasses,alfalfa,fescue,bromegrass,timothy) examples: - value: alfalfa - value: bromegrass - value: fescue - value: grasses - value: timothy mines/quarries: text: mines/quarries mudflats: text: mudflats oil waste areas: text: oil waste areas pastureland: text: pastureland annotations: originally: tag: originally value: pastureland (grasslands used for livestock grazing) comments: - grasslands used for livestock grazing permanent snow or ice: text: permanent snow or ice rainforest: text: rainforest annotations: originally: tag: originally value: rainforest (evergreen forest receiving greater than 406 cm annual rainfall) comments: - evergreen forest receiving greater than 406 cm annual rainfall rangeland: text: rangeland roads/railroads: text: roads/railroads rock: text: rock row crops: text: row crops saline seeps: text: saline seeps salt flats: text: salt flats sand: text: sand shrub crops: text: shrub crops annotations: originally: tag: originally value: shrub crops (blueberries,nursery ornamentals,filberts) examples: - value: blueberries - value: filberts - value: nursery ornamentals shrub land: text: shrub land annotations: originally: tag: originally value: shrub land (e.g. mesquite,sage-brush,creosote bush,shrub oak,eucalyptus) examples: - value: creosote bush - value: eucalyptus - value: mesquite - value: sage-brush - value: shrub oak small grains: text: small grains successional shrub land: text: successional shrub land annotations: originally: tag: originally value: successional shrub land (tree saplings,hazels,sumacs,chokecherry,shrub dogwoods,blackberries) examples: - value: blackberries - value: chokecherry - value: hazels - value: shrub dogwoods - value: sumacs - value: tree saplings swamp: text: swamp annotations: originally: tag: originally value: swamp (permanent or semi-permanent water body dominated by woody plants) comments: - permanent or semi-permanent water body dominated by woody plants tropical: text: tropical annotations: originally: tag: originally value: tropical (e.g. mangrove,palms) examples: - value: mangrove - value: palms tundra: text: tundra annotations: originally: tag: originally value: tundra (mosses,lichens) examples: - value: lichens - value: mosses vegetable crops: text: vegetable crops vine crops: text: vine crops annotations: originally: tag: originally value: vine crops (grapes) examples: - value: grapes TargetGeneEnum: name: TargetGeneEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: 16S_rRNA: text: 16S_rRNA description: the small subunit of the bacterial/archean ribosome aliases: - 16S rRNA - 16S ribosomal RNA related_mappings: - OBI:0002763 23S_rRNA: text: 23S_rRNA description: the large subunit of the bacterial/archean ribosome aliases: - 23S rRNA - 23S ribosomal RNA 18S_rRNA: text: 18S_rRNA description: the small subunit of the eukaryotic ribosome aliases: - 18S rRNA - 18S ribosomal RNA 28S_rRNA: text: 28S_rRNA description: the large subunit of the eukaryotic ribosome aliases: - 28S rRNA - 28S ribosomal RNA BinQualityEnum: name: BinQualityEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: HQ: text: HQ description: Metagenome-assembled genome is high quality based on MIMAG standards (https://doi.org/10.1038/nbt.3893) aliases: - high quality MQ: text: MQ description: Metagenome-assembled genome is medium quality based on MIMAG standards (https://doi.org/10.1038/nbt.3893) aliases: - medium quality LQ: text: LQ description: Metagenome-assembled genome is low quality based on MIMAG standards (https://doi.org/10.1038/nbt.3893) aliases: - low quality ChemicalConversionCategoryEnum: name: ChemicalConversionCategoryEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: addition: text: addition substitution: text: substitution acid_base: text: acid_base reduction_oxidation: text: reduction_oxidation combustion: text: combustion decomposition: text: decomposition protease_cleavage: text: protease_cleavage description: an enzymatic cleavage which relies on an enzyme with protease activity to act on proteins and to produce polypeptides (protein fragments). meaning: OBI:0600056 BiosampleCategoryEnum: name: BiosampleCategoryEnum description: Funding-based, sample location-based, or experimental method-based defined categories notes: - Currently, these values can associated with biosamples via the biosample_categories slot - They might also be applicable to other classes - They are intended to enable metadata search and or filtering, for example in the NMDC data portal, https://data.microbiomedata.org/ from_schema: https://w3id.org/nmdc/nmdc aliases: - category tag permissible_values: LTER: text: LTER meaning: https://lternet.edu/ title: National Science Foundation's Long Term Ecological Research Network SIP: text: SIP SFA: text: SFA description: Science Focus Area projects funded through the Department of Energy Office of Science Biological and Environmental Research Program meaning: https://science.osti.gov/ber/funding-opportunities/laboratory-scientific-focus-area-guidance title: Department of Energy Office of Science Biological and Environmental Research Program Laboratory Science Focus Areas FICUS: text: FICUS meaning: https://jgi.doe.gov/user-programs/program-info/ficus-overview title: Facilities Integrating Collaborations for User Science NEON: text: NEON meaning: https://www.neonscience.org title: National Science Foundation's National Ecological Observatory Network BRC: text: BRC description: Bioenergy Research Centers funded by the Biological Systems Science Division of the U.S. Department of Energy's Biological and Environmental Research Program. meaning: https://www.genomicscience.energy.gov/bioenergy-research-centers/ title: Bioenergy Research Centers SubstanceRoleEnum: name: SubstanceRoleEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: buffer: text: buffer description: Maintains the pH of the solution within a specific range to stabilize analytes or reactions. meaning: CHEBI:35225 acid: text: acid description: Donates a proton or accepts an electron pair in a chemical reaction. meaning: CHEBI:37527 base: text: base description: Accepts a proton or donates an electron pair in a chemical reaction. meaning: CHEBI:22695 ms_proteolytic_enzyme: text: ms_proteolytic_enzyme description: Enzyme that catalyzes the hydrolysis of proteins and is used in mass spectrometry based proteomics meaning: MS:1002986 solvent: text: solvent description: Dissolves the sample or reagents to facilitate reactions or extraction. meaning: CHEBI:46787 surfactant: text: surfactant description: Reduces surface tension and aids in the solubilization of substances. meaning: CHEBI:35195 derivatizing_agent: text: derivatizing_agent description: Chemically modifies analytes to improve detection or separation. solubilizing_agent: text: solubilizing_agent SampleStateEnum: name: SampleStateEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: solid: text: solid liquid: text: liquid gas: text: gas ChemicalEntityEnum: name: ChemicalEntityEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: acetonitrile: text: acetonitrile meaning: CHEBI:38472 acetic_acid: text: acetic_acid meaning: CHEBI:15366 acetone: text: acetone meaning: CHEBI:15347 alphaLP: text: alphaLP meaning: EC:3.4.21.12 comments: - A serine protease that hydrolyzes peptide bonds at the C-terminus of threonine, alanine, serine, and valine. see_also: - https://commonchemistry.cas.org/detail?cas_rn=37288-76-9&title= ammonium_acetate: text: ammonium_acetate meaning: CHEBI:62947 ammonium_bicarbonate: text: ammonium_bicarbonate meaning: CHEBI:184335 ammonium_formate: text: ammonium_formate meaning: CHEBI:63050 amitriptyline: text: amitriptyline meaning: CHEBI:2666 Arg-C: text: Arg-C meaning: MS:1001303 comments: - A cysteine protease that hydrolyzes peptide, ester, and amide bonds at the C-terminus of arginine and with lower efficiency, lysine. Asp-N: text: Asp-N meaning: MS:1001304 comments: - A zinc metalloendopeptidase that hydrolyzes peptide bonds at the N-terminus of aspartic acid. chloroform: text: chloroform meaning: CHEBI:35255 chymotrypsin: text: chymotrypsin meaning: MS:1001306 comments: - A serine protease that hydrolyzes peptide bonds at the C-terminus of tryptophan, leucine, tyrosine, and phenylalanine. disodium_hydrogenphosphate_dihydrate: text: disodium_hydrogenphosphate_dihydrate meaning: CHEBI:91258 ethanol: text: ethanol meaning: CHEBI:16236 formic_acid: text: formic_acid meaning: CHEBI:30751 comments: - A carboxylic acid that is the simplest aliphatic carboxylic acid, comprising a hydrogen atom joined to the methyl group of methanol. glucose: text: glucose meaning: CHEBI:17234 comments: - Generally considered the most abundant monosaccharide in nature. Glu-C: text: Glu-C meaning: MS:1001917 comments: - A serine protease that hydrolyzes peptide and ester bonds at the C-terminus of aspartic acid or glutamic acid. hydrochloric_acid: text: hydrochloric_acid meaning: CHEBI:17883 isopropyl_alcohol: text: isopropyl_alcohol meaning: CHEBI:17824 Lys-C: text: Lys-C meaning: MS:1001309 comments: - A serine protease that hydrolyzes peptide, ester, and amide bonds at the C-terminus of lysine. Lys-N: text: Lys-N meaning: MS:1003093 comments: - A metalloendopeptidase that hydrolyzes peptide bonds at the C-terminus of lysine. N-methyl-N-trimethylsilyltrifluoroacetamide: text: N-methyl-N-trimethylsilyltrifluoroacetamide meaning: CHEBI:85064 methanol: text: methanol meaning: CHEBI:17790 methoxyamine: text: methoxyamine meaning: CHEBI:192842 medronic_acid: text: medronic_acid meaning: CHEBI:43945 comments: - A 1,1-bis(phosphonic acid) consisting of methane substituted by two phosphonic acid groups, also known as methylenediphosphonic acid potassium_chloride: text: potassium_chloride meaning: CHEBI:32588 potassium_dihydrogen_phosphate: text: potassium_dihydrogen_phosphate meaning: CHEBI:63036 phosphoric_acid: text: phosphoric_acid meaning: CHEBI:26078 sodium_chloride: text: sodium_chloride meaning: CHEBI:26710 trichloroacetic_acid: text: trichloroacetic_acid meaning: CHEBI:30956 trimethylchlorosilane: text: trimethylchlorosilane meaning: CHEBI:85069 trypsin: text: trypsin meaning: MS:1001251 comments: - A serine protease that hydrolyzes peptide bonds at the C-terminus of arginine and lysine. water: text: water meaning: CHEBI:15377 comments: - Any form of water used in an experiment including deionized water, distilled water, and ultrapure water. Protocol or materials and methods should be consulted for exact type of water used in an experiment. MetaproteomicsAnalysisCategoryEnum: name: MetaproteomicsAnalysisCategoryEnum description: The category of metaproteomics analysis being performed. from_schema: https://w3id.org/nmdc/nmdc permissible_values: matched_metagenome: text: matched_metagenome description: A metaproteomics analysis that is matched to a metagenome derived from the same biosample. in_silico_metagenome: text: in_silico_metagenome description: A metaproteomics analysis that is matched to an in silico generated metagenome. MetabolomicsAnalysisCategoryEnum: name: MetabolomicsAnalysisCategoryEnum description: The category of metabolomics analysis being performed. from_schema: https://w3id.org/nmdc/nmdc permissible_values: gc_ms_metabolomics: text: gc_ms_metabolomics description: A metabolomics analysis that is performed on gas chromatography mass spectrometry data. lc_ms_lipidomics: text: lc_ms_lipidomics description: A metabolomics analysis that is performed on liquid chromatography mass spectrometry data for lipidomics annotation. lc_ms_metabolomics: text: lc_ms_metabolomics description: A metabolomics analysis that is performed on liquid chromatography mass spectrometry data. SampleTypeEnum: name: SampleTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: soil: text: soil soil - water extract: text: soil - water extract plant associated: text: plant associated sediment: text: sediment water: text: water YesNoEnum: name: YesNoEnum description: replaces DnaDnaseEnum and DnaseRnaEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: 'no': text: 'no' 'yes': text: 'yes' AnalysisTypeEnum: name: AnalysisTypeEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: metabolomics: text: metabolomics description: Mass spectrometry-based analysis of metabolites. lipidomics: text: lipidomics description: Mass spectrometry-based analysis of lipids. metagenomics: text: metagenomics description: Standard short-read metagenomic sequencing title: Metagenomics metagenomics_long_read: text: metagenomics_long_read description: Long-read metagenomic sequencing title: Metagenomics (long read) metaproteomics: text: metaproteomics description: Mass spectrometry-based analysis of proteins from a mixed community. metatranscriptomics: text: metatranscriptomics description: Short-read metatranscriptomic sequencing of RNA from a mixed community. natural organic matter: text: natural organic matter description: Analysis of natural organic matter (NOM), such as by Fourier-transform ion cyclotron resonance mass spectrometry (FTICR-MS). bulk chemistry: text: bulk chemistry description: Analysis of bulk chemical properties of a sample, such as pH, conductivity, total carbon, total nitrogen, etc. amplicon sequencing assay: text: amplicon sequencing assay meaning: OBI:0002767 title: Amplicon sequencing assay isolate genome sequencing: text: isolate genome sequencing description: Sequencing of DNA from an isolated organism, such as a pure culture. title: Isolate genome sequencing broad_mappings: - OBI:0002117 isolate transcriptome sequencing: text: isolate transcriptome sequencing description: Sequencing of RNA from an isolated organism, such as a pure culture. title: Isolate transcriptome sequencing broad_mappings: - OBI:0001177 SubmissionStatusEnum: name: SubmissionStatusEnum from_schema: https://w3id.org/nmdc/nmdc permissible_values: InProgress: text: InProgress description: The submitter is currently working on the submission. title: In Progress SubmittedPendingReview: text: SubmittedPendingReview description: Submission is ready for NMDC review, the submitter cannot edit. title: Submitted - Pending Review ApprovedHeld: text: ApprovedHeld description: Submission has been reviewed and approved. Information is complete, but not yet shared on the data portal. The submitter cannot edit. title: Approved - Held ApprovedPendingUserFacility: text: ApprovedPendingUserFacility description: Submission has been reviewed and approved by NMDC. Sample information has been shared with designated user facility and is ready for their review. The submitter cannot edit. title: Approved - Sent to User Facility UpdatesRequired: text: UpdatesRequired description: Submission has been reviewed and submitter edits are required for approval. The submitter can edit the submission. title: Updates Required Denied: text: Denied description: Submission has been reviewed and denied. The submitter cannot edit. title: Denied Released: text: Released description: Submission has been reviewed and approved and data is released on the data portal. The submitter cannot edit. title: Released slots: host_family_relation: name: host_family_relation annotations: Expected_value: tag: Expected_value value: relationship type;arbitrary identifier description: Familial relationships to other hosts in the same study; can include multiple relationships. title: host family relationship comments: - Legacy MIxS slot removed from GSC MIxS v6.2.2. Retained for submission-schema compatibility. examples: - value: offspring;Mussel25 from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000872 range: string multivalued: true salinity_meth: name: salinity_meth annotations: Expected_value: tag: Expected_value value: PMID,DOI or url description: Reference or method used in determining salinity. title: salinity method comments: - Legacy MIxS slot removed from GSC MIxS v6.2.2. Retained for submission-schema compatibility. examples: - value: doi:10.1016/j.ecss.2011.11.024 - value: https://doi.org/10.1016/j.ecss.2011.11.024 from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000341 range: string multivalued: false pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true soil_text_measure: name: soil_text_measure annotations: Expected_value: tag: Expected_value value: measurement value description: The relative proportion of different grain sizes of mineral particles in a soil, as described using a standard system; express as % sand (50 um to 2 mm), silt (2 um to 50 um), and clay (<2 um) with textural name (e.g., silty clay loam) optional. title: soil texture measurement comments: - Legacy MIxS slot removed from GSC MIxS v6.2.2. Retained for submission-schema compatibility. - Old MIxS used 'quantity value' range but this is clearly structured text, not a single quantity. examples: - value: ite loam; 20% sand; 40% silt; 40% clay from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000335 range: string multivalued: false biomaterial_purity: name: biomaterial_purity description: A measure of the purity of a biomaterial sample from_schema: https://w3id.org/nmdc/nmdc abstract: true range: QuantityValue generates_calibration: name: generates_calibration description: calibration information is generated a process comments: - A gas chromatography mass spectromery run generates data to calibrate the retention index from_schema: https://w3id.org/nmdc/nmdc range: CalibrationInformation pattern: ^(nmdc):calib-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:calib-{id_shoulder}-{id_blade}$' interpolated: true uses_calibration: name: uses_calibration description: calibration information is used by a process comments: - Retenion index calibration data generated by a gas chromatography mass spectromery run is used when analyzing metabolomics data from_schema: https://w3id.org/nmdc/nmdc range: CalibrationInformation multivalued: true pattern: ^(nmdc):calib-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:calib-{id_shoulder}-{id_blade}$' interpolated: true calibration_object: name: calibration_object description: the file containing the calibration data object from_schema: https://w3id.org/nmdc/nmdc range: DataObject pattern: ^(nmdc):dobj-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:dobj-{id_shoulder}-{id_blade}$' interpolated: true internal_calibration: name: internal_calibration description: whether internal calibration was used, if false, external calibration was used from_schema: https://w3id.org/nmdc/nmdc range: boolean calibration_target: name: calibration_target description: the target measurement of the calibration from_schema: https://w3id.org/nmdc/nmdc range: CalibrationTargetEnum calibration_standard: name: calibration_standard description: the reference standard(s) used for calibration from_schema: https://w3id.org/nmdc/nmdc range: CalibrationStandardEnum polarity_mode: name: polarity_mode description: the polarity of which ions are generated and detected from_schema: https://w3id.org/nmdc/nmdc range: PolarityModeEnum mass_spectrum_collection_modes: name: mass_spectrum_collection_modes description: Indicates whether mass spectra were collected in full profile, reduced profile, or centroid mode during acquisition. from_schema: https://w3id.org/nmdc/nmdc range: MassSpectrumCollectionModeEnum multivalued: true eukaryotic_evaluation: name: eukaryotic_evaluation description: Contains results from evaluating if a Metagenome-Assembled Genome is of eukaryotic lineage. from_schema: https://w3id.org/nmdc/nmdc range: EukEval ncbi_lineage_tax_ids: name: ncbi_lineage_tax_ids description: Dash-delimited ordered list of NCBI taxonomy identifiers (TaxId) examples: - value: 1-131567-2759-2611352-33682-191814-2603949 from_schema: https://w3id.org/nmdc/nmdc range: string pattern: ^\d+(-\d+)*$ ncbi_lineage: name: ncbi_lineage description: Comma delimited ordered list of NCBI taxonomy names. examples: - value: root,cellular organisms,Eukaryota,Discoba,Euglenozoa,Diplonemea,Diplonemidae from_schema: https://w3id.org/nmdc/nmdc range: string has_failure_categorization: name: has_failure_categorization from_schema: https://w3id.org/nmdc/nmdc range: FailureCategorization multivalued: true inlined_as_list: true ionization_source: name: ionization_source description: The ionization source used to introduce processed samples into a mass spectrometer from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - MS:1000008 range: IonizationSourceEnum mass_analyzers: name: mass_analyzers description: The kind of mass analyzer(s) used during the spectra collection. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - MS:1000443 range: MassAnalyzerEnum multivalued: true resolution_categories: name: resolution_categories description: The relative resolution at which spectra were collected. examples: - value: high - value: low from_schema: https://w3id.org/nmdc/nmdc range: ResolutionCategoryEnum multivalued: true mass_spectrometry_acquisition_strategy: name: mass_spectrometry_acquisition_strategy description: Mode of running a mass spectrometer method by which m/z ranges are selected and ions possibly fragment. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - MS:1003213 range: MassSpectrometryAcquisitionStrategyEnum eluent_introduction_category: name: eluent_introduction_category description: A high-level categorization for how the processed sample is introduced into a mass spectrometer. examples: - value: liquid_chromatography - value: direct_infusion_syringe from_schema: https://w3id.org/nmdc/nmdc range: EluentIntroductionCategoryEnum has_mass_spectrometry_configuration: name: has_mass_spectrometry_configuration description: The identifier of the associated MassSpectrometryConfiguration. from_schema: https://w3id.org/nmdc/nmdc range: MassSpectrometryConfiguration has_chromatography_configuration: name: has_chromatography_configuration description: The identifier of the associated ChromatographyConfiguration, providing information about how a sample was introduced into the mass spectrometer. from_schema: https://w3id.org/nmdc/nmdc range: ChromatographyConfiguration gene_function_id: name: gene_function_id description: The identifier for the gene function. examples: - value: KEGG.ORTHOLOGY:K00627 from_schema: https://w3id.org/nmdc/nmdc range: uriorcurie required: true count: name: count from_schema: https://w3id.org/nmdc/nmdc range: integer required: true functional_annotation_agg: name: functional_annotation_agg description: This property links a database object to a set of functional annotation aggregation (agg) results. from_schema: https://w3id.org/nmdc/nmdc range: FunctionalAnnotationAggMember multivalued: true inlined: true inlined_as_list: true sample_collection_year: name: sample_collection_year from_schema: https://w3id.org/nmdc/nmdc range: integer sample_collection_month: name: sample_collection_month from_schema: https://w3id.org/nmdc/nmdc library_preparation_kit: name: library_preparation_kit from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - GENEPIO:0001450 range: string pcr_cycles: name: pcr_cycles from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - OBI:0002475 range: integer is_stranded: name: is_stranded description: Is the (RNA) library stranded or non-stranded (unstranded). comments: - A value of true means the library is stranded, flase means non-stranded. from_schema: https://w3id.org/nmdc/nmdc range: boolean stranded_orientation: name: stranded_orientation description: Lists the strand orientiation for a stranded RNA library preparation. from_schema: https://w3id.org/nmdc/nmdc range: StrandedOrientationEnum input_mass: name: input_mass annotations: storage_units: tag: storage_units value: g description: Total mass of sample used in activity. title: sample mass used from_schema: https://w3id.org/nmdc/nmdc aliases: - sample mass - sample weight exact_mappings: - MS:1000004 broad_mappings: - MIXS:0000111 range: QuantityValue library_type: name: library_type title: library type examples: - value: DNA from_schema: https://w3id.org/nmdc/nmdc range: LibraryTypeEnum date_created: name: date_created description: from database class from_schema: https://w3id.org/nmdc/nmdc etl_software_version: name: etl_software_version description: from database class from_schema: https://w3id.org/nmdc/nmdc object_set: name: object_set description: Applies to a property that links a database object to a set of objects. This is necessary in a json document to provide context for a list, and to allow for a single json object that combines multiple object types from_schema: https://w3id.org/nmdc/nmdc mixin: true multivalued: true inlined_as_list: true ontology_class_set: name: ontology_class_set description: This property links a database object to the set of ontology classes within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: OntologyClass biosample_set: name: biosample_set description: This property links a database object to the set of samples within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: Biosample study_set: name: study_set description: This property links a database object to the set of studies within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: Study field_research_site_set: name: field_research_site_set from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: FieldResearchSite collecting_biosamples_from_site_set: name: collecting_biosamples_from_site_set from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: CollectingBiosamplesFromSite data_object_set: name: data_object_set description: This property links a database object to the set of data objects within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: DataObject genome_feature_set: name: genome_feature_set description: This property links a database object to the set of all features from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: GenomeFeature functional_annotation_set: name: functional_annotation_set description: This property links a database object to the set of all functional annotations from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: FunctionalAnnotation workflow_execution_set: name: workflow_execution_set description: This property links a database object to the set of workflow executions. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: WorkflowExecution data_generation_set: name: data_generation_set description: This property links a database object to the set of data generations within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: DataGeneration processed_sample_set: name: processed_sample_set description: This property links a database object to the set of processed samples within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: ProcessedSample instrument_set: name: instrument_set description: This property links a database object to the set of instruments within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: Instrument calibration_set: name: calibration_set description: This property links a database object to the set of calibrations within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: CalibrationInformation configuration_set: name: configuration_set description: This property links a database object to the set of configurations within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: Configuration manifest_set: name: manifest_set description: This property links a database object to the set of manifests within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: Manifest storage_process_set: name: storage_process_set description: This property links a database object to the set of storage processes within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: StorageProcess material_processing_set: name: material_processing_set description: This property links a database object to the set of material processing within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: MaterialProcessing organism_sample_set: name: organism_sample_set description: This property links a database object to the set of organism samples within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: OrganismSample organism_set: name: organism_set description: This property links a database object to the set of organisms within it. from_schema: https://w3id.org/nmdc/nmdc mixins: - object_set range: Organism sample_collection_day: name: sample_collection_day from_schema: https://w3id.org/nmdc/nmdc range: integer sample_collection_hour: name: sample_collection_hour from_schema: https://w3id.org/nmdc/nmdc range: integer sample_collection_minute: name: sample_collection_minute from_schema: https://w3id.org/nmdc/nmdc range: integer biogas_temperature: name: biogas_temperature from_schema: https://w3id.org/nmdc/nmdc range: string soil_annual_season_temp: name: soil_annual_season_temp from_schema: https://w3id.org/nmdc/nmdc range: string biogas_retention_time: name: biogas_retention_time from_schema: https://w3id.org/nmdc/nmdc range: string completion_date: name: completion_date from_schema: https://w3id.org/nmdc/nmdc range: string container_size: name: container_size annotations: storage_units: tag: storage_units value: mL description: The volume of the container an analyte is stored in or an activity takes place in from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 range: QuantityValue filter_material: name: filter_material description: A porous material on which solid particles present in air or other fluid which flows through it are largely caught and retained. comments: - 'Filters are made with a variety of materials: cellulose and derivatives, glass fibre, ceramic, synthetic plastics and fibres. Filters may be naturally porous or be made so by mechanical or other means. Membrane/ceramic filters are prepared with highly controlled pore size in a sheet of suitable material such as polyfluoroethylene, polycarbonate or cellulose esters. Nylon mesh is sometimes used for reinforcement. The pores constitute 80–85% of the filter volume commonly and several pore sizes are available for air sampling (0.45−0.8 μm are commonly employed).' from_schema: https://w3id.org/nmdc/nmdc range: string filter_pore_size: name: filter_pore_size annotations: storage_units: tag: storage_units value: um description: A quantitative or qualitative measurement of the physical dimensions of the pores in a material. from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue conditionings: name: conditionings description: Preliminary treatment of either phase with a suitable solution of the other phase (in the absence of main extractable solute(s)) so that when the subsequent equilibration is carried out changes in the (volume) phase ratio or in the concentrations of other components are minimized. from_schema: https://w3id.org/nmdc/nmdc list_elements_ordered: true range: string multivalued: true separation_method: name: separation_method description: The method that was used to separate a substance from a solution or mixture. from_schema: https://w3id.org/nmdc/nmdc range: SeparationMethodEnum filtration_category: name: filtration_category description: The type of conditioning applied to a filter, device, etc. from_schema: https://w3id.org/nmdc/nmdc range: string material_component_separation: name: material_component_separation description: A material processing in which components of an input material become segregated in space from_schema: https://w3id.org/nmdc/nmdc range: string value: name: value annotations: units_alignment_excuse: tag: units_alignment_excuse value: pending_analysis from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue modifier_substance: name: modifier_substance description: The type of modification being done from_schema: https://w3id.org/nmdc/nmdc range: string is_pressurized: name: is_pressurized description: Whether or not pressure was applied to a thing or process. from_schema: https://w3id.org/nmdc/nmdc range: boolean contained_in: name: contained_in description: A type of container. examples: - value: test tube - value: falcon tube - value: whirlpak from_schema: https://w3id.org/nmdc/nmdc range: ContainerCategoryEnum input_volume: name: input_volume annotations: storage_units: tag: storage_units value: mL description: The volume of the input sample. from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue ordered_mobile_phases: name: ordered_mobile_phases description: The solution(s) that moves through a chromatography column. from_schema: https://w3id.org/nmdc/nmdc list_elements_ordered: true range: MobilePhaseSegment multivalued: true inlined_as_list: true stationary_phase: name: stationary_phase description: The material the stationary phase is comprised of used in chromatography. from_schema: https://w3id.org/nmdc/nmdc range: StationaryPhaseEnum chromatographic_category: name: chromatographic_category description: The type of chromatography used in a process. from_schema: https://w3id.org/nmdc/nmdc range: ChromatographicCategoryEnum sampled_portion: name: sampled_portion description: The portion of the sample that is taken for downstream activity. from_schema: https://w3id.org/nmdc/nmdc range: SamplePortionEnum multivalued: true feature_category: name: feature_category description: A Sequence Ontology term that describes the category of a feature from_schema: https://w3id.org/nmdc/nmdc range: ControlledIdentifiedTermValue subject: name: subject from_schema: https://w3id.org/nmdc/nmdc range: GeneProduct has_function: name: has_function notes: - the range for has_function was asserted as functional_annotation_term/FunctionalAnnotationTerm, - but is actually taking string arguments in MongoDB, - and those are frequently fulltext, not CURIEs. MAM 2021-06-23 from_schema: https://w3id.org/nmdc/nmdc range: string pattern: ^(KEGG_PATHWAY:\w{2,4}\d{5}|KEGG.REACTION:R\d+|RHEA:\d{5}|MetaCyc:[A-Za-z0-9+_.%:\-]+|EC:\d{1,2}(\.\d{0,3}){0,3}|GO:\d{7}|MetaNetX:(MNXR\d+|EMPTY)|SEED:\w+|KEGG\.ORTHOLOGY:K\d+|EGGNOG:\w+|PFAM:PF\d{5}|TIGRFAM:TIGR\d+|SUPFAM:\w+|CATH:[1-6]\.[0-9]+\.[0-9]+\.[0-9]+|PANTHER.FAMILY:PTHR\d{5}(\:SF\d{1,3})?)$ gff_coordinate: name: gff_coordinate description: A positive 1-based integer coordinate indicating start or end comments: - For features that cross the origin of a circular feature (e.g. most bacterial genomes, plasmids, and some viral genomes), the requirement for start to be less than or equal to end is satisfied by making end = the position of the end + the length of the landmark feature. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 1 seqid: name: seqid description: The ID of the landmark used to establish the coordinate system for the current feature. todos: - change range from string to a object like uriorcurie? from_schema: https://w3id.org/nmdc/nmdc range: string strand: name: strand description: The strand on which a feature is located. Has a value of '+' (sense strand or forward strand) or '-' (anti-sense strand or reverse strand). todos: - set the range to an enum? from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - biolink:strand encodes: name: encodes description: The gene product encoded by this feature. Typically this is used for a CDS feature or gene feature which will encode a protein. It can also be used by a nc transcript ot gene feature that encoded a ncRNA todos: - If we revert Reaction back into the schema, that would be a reasonable domain for this slot from_schema: https://w3id.org/nmdc/nmdc range: GeneProduct end: name: end description: The end of the feature in positive 1-based integer coordinates comments: - 'unenforced constraint: end > start' - For features that cross the origin of a circular feature, end = the position of the end + the length of the landmark feature. from_schema: https://w3id.org/nmdc/nmdc close_mappings: - biolink:end_interbase_coordinate is_a: gff_coordinate range: integer feature_type: name: feature_type description: 'TODO: Yuri to write' from_schema: https://w3id.org/nmdc/nmdc range: string phase: name: phase description: The phase for a coding sequence entity. For example, phase of a CDS as represented in a GFF3 with a value of 0, 1 or 2. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - biolink:phase range: integer minimum_value: 0 maximum_value: 2 start: name: start description: The start of the feature in positive 1-based integer coordinates from_schema: https://w3id.org/nmdc/nmdc close_mappings: - biolink:start_interbase_coordinate is_a: gff_coordinate name: name: name description: A human readable label for an entity from_schema: https://w3id.org/nmdc/nmdc range: string term: name: term description: pointer to an ontology class from_schema: https://w3id.org/nmdc/nmdc range: OntologyClass inlined: true description: name: description description: a human-readable description of a thing from_schema: https://w3id.org/nmdc/nmdc slot_uri: dcterms:description range: string display_order: name: display_order description: When rendering information, this attribute to specify the order in which the information should be rendered. from_schema: https://w3id.org/nmdc/nmdc range: integer email: name: email description: An email address for an entity such as a person. This should be the primary email address used. from_schema: https://w3id.org/nmdc/nmdc slot_uri: schema:email range: string profile_image_url: name: profile_image_url description: A url that points to an image of a person. from_schema: https://w3id.org/nmdc/nmdc range: string orcid: name: orcid description: The ORCID of a person. from_schema: https://w3id.org/nmdc/nmdc range: string language: name: language description: Should use ISO 639-1 code e.g. "en", "fr" from_schema: https://w3id.org/nmdc/nmdc range: language_code has_raw_value: name: has_raw_value description: The value that was specified for an annotation in raw form, i.e. a string. E.g. "2 cm" or "2-4 cm" from_schema: https://w3id.org/nmdc/nmdc range: string has_unit: name: has_unit description: Links a QuantityValue to a unit from_schema: https://w3id.org/nmdc/nmdc aliases: - scale mappings: - qud:unit - schema:unitCode range: string type: name: type description: the class_uri of the class that has been instantiated notes: - makes it easier to read example data files - required for polymorphic MongoDB collections examples: - value: nmdc:Biosample - value: nmdc:Study from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/1048 - https://github.com/microbiomedata/nmdc-schema/issues/1233 - https://github.com/microbiomedata/nmdc-schema/issues/248 structured_aliases: - literal_form: workflow_execution_class predicate: NARROW_SYNONYM contexts: - https://bitbucket.org/berkeleylab/jgi-jat/macros/nmdc_metadata.yaml slot_uri: rdf:type designates_type: true range: uriorcurie required: true has_numeric_value: name: has_numeric_value description: Links a quantity value to a number from_schema: https://w3id.org/nmdc/nmdc mappings: - qud:quantityValue - schema:value range: decimal has_minimum_numeric_value: name: has_minimum_numeric_value description: The minimum value part, expressed as number, of the quantity value when the value covers a range. from_schema: https://w3id.org/nmdc/nmdc is_a: has_numeric_value has_maximum_numeric_value: name: has_maximum_numeric_value description: The maximum value part, expressed as number, of the quantity value when the value covers a range. from_schema: https://w3id.org/nmdc/nmdc is_a: has_numeric_value latitude: name: latitude description: The latitude of a location. alt_descriptions: wikipedia: source: wikipedia description: A geographic coordinate that specifies the north-south position of a point on the surface of the Earth or another celestial body. examples: - value: '-33.460524' from_schema: https://w3id.org/nmdc/nmdc mappings: - schema:latitude slot_uri: wgs84:lat range: decimal_degree longitude: name: longitude description: The longitude of a location. alt_descriptions: wikipedia: source: wikipedia description: A geographic coordinate that specifies the east-west position of a point on the surface of the Earth, or another celestial body. examples: - value: '150.168149' from_schema: https://w3id.org/nmdc/nmdc mappings: - schema:longitude slot_uri: wgs84:long range: decimal_degree url: name: url notes: - See issue 207 - this clashes with the mixs field from_schema: https://w3id.org/nmdc/nmdc range: string websites: name: websites description: A list of websites that are associated with the entity. comments: - DOIs should not be included as websites. Instead, use the associated_dois slot. - A consortium's homepage website should be included in the homepage_website slot, not in websites. - consortium is a convenience term for a Study whose study_category value is consortium - the website slot and its subproperties are virtually identical to the url slot, except that they are multivalued and url is single-valued. from_schema: https://w3id.org/nmdc/nmdc see_also: - nmdc:url range: string multivalued: true pattern: ^[Hh][Tt][Tt][Pp][Ss]?:\/\/(?!.*[Dd][Oo][Ii]\.[Oo][Rr][Gg]).*$ has_attribute_label: name: has_attribute_label description: Human-readable label for the property (e.g., MIxS label, ENVO term label). comments: - This provides a human-friendly name for the asserted property. For example, "bicarbonate ion concentration" or "total phosphorus". The label helps with readability and data discovery. from_schema: https://w3id.org/nmdc/nmdc range: string has_attribute_id: name: has_attribute_id description: CURIE or IRI for the property (MIxS slot, NMDC slot, ENVO/OBI term, etc.). comments: - This provides a resolvable identifier for the property being asserted. Examples include MIXS:0000117 for total phosphorus, or ENVO:01001357 for bicarbonate ion concentration. - Prefer using standard ontology terms (ENVO, PATO, OBI, etc.) or MIxS identifiers when available to enhance interoperability. from_schema: https://w3id.org/nmdc/nmdc range: uriorcurie has_quantity_kind_id: name: has_quantity_kind_id description: Optional CURIE or IRI for the physical quantity kind (e.g., qudt:QuantityKind). comments: - This slot enables precise semantic description of what physical quantity is being measured, independent of the specific units used. For example, qudt:MassConcentration or qudt:Temperature. - Using quantity kind identifiers from QUDT or similar vocabularies improves data integration and enables automated unit conversion. from_schema: https://w3id.org/nmdc/nmdc range: uriorcurie has_value_term_id: name: has_value_term_id description: CURIE or IRI for categorical values (ENVO, PATO, METPO, etc.). comments: - Use this slot when the value of the property is a controlled vocabulary term rather than a numeric or free-text value. For example, ENVO:00002297 for "desert ecosystem" or PATO:0001199 for "dry". from_schema: https://w3id.org/nmdc/nmdc range: uriorcurie has_datetime_value: name: has_datetime_value description: Date-time value for the property in ISO-8601 format. comments: - Use this slot for temporal properties. The value should follow ISO-8601 format (e.g., "2025-06-12T14:30:00Z"). from_schema: https://w3id.org/nmdc/nmdc range: string library_strategy: name: library_strategy description: Sequencing technique intended for this library from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/enasequence/webin-xml/blob/2.1.0/src/main/resources/uk/ac/ebi/ena/sra/schema/SRA.experiment.xsd range: LibraryStrategyEnum library_source: name: library_source description: The molecular source of the sequencing library from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/enasequence/webin-xml/blob/2.1.0/src/main/resources/uk/ac/ebi/ena/sra/schema/SRA.experiment.xsd range: LibrarySourceEnum library_selection: name: library_selection description: Library selection or enrichment method used from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/enasequence/webin-xml/blob/2.1.0/src/main/resources/uk/ac/ebi/ena/sra/schema/SRA.experiment.xsd range: LibrarySelectionEnum processing_institution_workflow_metadata: name: processing_institution_workflow_metadata description: Information about how workflow results were generated when the processing is done by an external organziation (e.g., JGI) such as software tool name and version or pipeline name and version. examples: - value: metaspades v. 3.15.2 - value: IMG Annotation Pipeline v.5.0.25 from_schema: https://w3id.org/nmdc/nmdc mappings: - NCIT:C165211 range: string qc_comment: name: qc_comment description: Slot to store additional comments about laboratory or workflow output. For workflow output it may describe the particular workflow stage that failed. (ie Failed at call-stage due to a malformed fastq file). from_schema: https://w3id.org/nmdc/nmdc range: string objective: name: objective description: The scientific objectives associated with the entity. It SHOULD correspond to scientific norms for objectives field in a structured abstract. from_schema: https://w3id.org/nmdc/nmdc mappings: - SIO:000337 range: string md5_checksum: name: md5_checksum description: MD5 checksum of file (pre-compressed) from_schema: https://w3id.org/nmdc/nmdc range: string data_object_type: name: data_object_type description: The type of file represented by the data object. examples: - value: Direct Infusion FT-ICR MS Analysis Results - value: GC-MS Metabolomics Results from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: data_object_type predicate: EXACT_SYNONYM contexts: - https://bitbucket.org/berkeleylab/jgi-jat/macros/nmdc_metadata.yaml range: FileTypeEnum data_category: name: data_category description: The category of the file, such as instrument data from data generation or processed data from a workflow execution. from_schema: https://w3id.org/nmdc/nmdc range: DataCategoryEnum compression_type: name: compression_type description: If provided, specifies the compression type todos: - consider setting the range to an enum examples: - value: gzip from_schema: https://w3id.org/nmdc/nmdc range: string started_at_time: name: started_at_time notes: - 'The regex for ISO-8601 format was taken from here: https://www.myintervals.com/blog/2009/05/20/iso-8601-date-validation-that-doesnt-suck/ It may not be complete, but it is good enough for now.' from_schema: https://w3id.org/nmdc/nmdc mappings: - prov:startedAtTime range: string pattern: ^([\+-]?\d{4}(?!\d{2}\b))((-?)((0[1-9]|1[0-2])(\3([12]\d|0[1-9]|3[01]))?|W([0-4]\d|5[0-2])(-?[1-7])?|(00[1-9]|0[1-9]\d|[12]\d{2}|3([0-5]\d|6[1-6])))([T\s]((([01]\d|2[0-3])((:?)[0-5]\d)?|24\:?00)([\.,]\d+(?!:))?)?(\17[0-5]\d([\.,]\d+)?)?([zZ]|([\+-])([01]\d|2[0-3]):?([0-5]\d)?)?)?)?$ ended_at_time: name: ended_at_time notes: - 'The regex for ISO-8601 format was taken from here: https://www.myintervals.com/blog/2009/05/20/iso-8601-date-validation-that-doesnt-suck/ It may not be complete, but it is good enough for now.' from_schema: https://w3id.org/nmdc/nmdc mappings: - prov:endedAtTime pattern: ^([\+-]?\d{4}(?!\d{2}\b))((-?)((0[1-9]|1[0-2])(\3([12]\d|0[1-9]|3[01]))?|W([0-4]\d|5[0-2])(-?[1-7])?|(00[1-9]|0[1-9]\d|[12]\d{2}|3([0-5]\d|6[1-6])))([T\s]((([01]\d|2[0-3])((:?)[0-5]\d)?|24\:?00)([\.,]\d+(?!:))?)?(\17[0-5]\d([\.,]\d+)?)?([zZ]|([\+-])([01]\d|2[0-3]):?([0-5]\d)?)?)?)?$ git_url: name: git_url description: A url that points to a software repository examples: - value: https://github.com/microbiomedata/mg_annotation/releases/tag/0.1 - value: https://github.com/microbiomedata/metaMS/blob/master/metaMS/gcmsWorkflow.py from_schema: https://w3id.org/nmdc/nmdc range: string execution_resource: name: execution_resource description: The computing resource or facility where the workflow was executed. examples: - value: NERSC-Cori from_schema: https://w3id.org/nmdc/nmdc range: ExecutionResourceEnum homepage_website: name: homepage_website description: The website address (URL) of an entity's homepage. examples: - value: https://www.neonscience.org/ from_schema: https://w3id.org/nmdc/nmdc is_a: websites maximum_cardinality: 1 has_boolean_value: name: has_boolean_value description: Links a quantity value to a boolean from_schema: https://w3id.org/nmdc/nmdc range: boolean infiltrations: name: infiltrations description: The amount of time it takes to complete each infiltration activity examples: - value: 00:01:32 - value: 00:00:53 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.protocols.io/view/field-sampling-protocol-kqdg3962pg25/v1 aliases: - infiltration_1 - infiltration_2 list_elements_ordered: true range: string multivalued: true pattern: ^(?:[0-9]|[1-9][0-9]|9[0-9]|0[0-9]|0[0-5][0-9]):[0-5][0-9]:[0-5][0-9]$ soluble_iron_micromol: name: soluble_iron_micromol from_schema: https://w3id.org/nmdc/nmdc range: string sample_collection_site: name: sample_collection_site description: 'Free-text description of the place where the sample was collected: the geographic or environmental site or named location.' in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Collection Site or Growth Conditions predicate: NARROW_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. - JGI label bundles two concepts; this slot covers only the collection-site half. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ range: string salinity_category: name: salinity_category description: 'Categorical description of the sample''s salinity. Examples: halophile, halotolerant, hypersaline, huryhaline' notes: - maps to gold:salinity from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-metadata/pull/297 range: string proport_woa_temperature: name: proport_woa_temperature from_schema: https://w3id.org/nmdc/nmdc range: string location: name: location from_schema: https://w3id.org/nmdc/nmdc range: string host_name: name: host_name from_schema: https://w3id.org/nmdc/nmdc range: string community: name: community from_schema: https://w3id.org/nmdc/nmdc range: string embargoed: name: embargoed description: If true, the data are embargoed and not available for public access. todos: - make this required? - first apply to Biosample - try to apply to all Biosamples in a particular nmdc-server SubmissionMetadata? - applying to a Study may not be granular enough from_schema: https://w3id.org/nmdc/nmdc range: boolean recommended: true habitat: name: habitat from_schema: https://w3id.org/nmdc/nmdc range: string version: name: version description: 'The version associated with a resource. ' examples: - value: v1.2.0 from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - schema:version range: string doi_value: name: doi_value description: A digital object identifier, which is intended to persistantly identify some resource on the web. examples: - value: doi:10.46936/10.25585/60000880 description: The DOI links to an electronic document. from_schema: https://w3id.org/nmdc/nmdc aliases: - DOI - digital object identifier exact_mappings: - OBI:0002110 narrow_mappings: - edam.data:1188 range: uriorcurie required: true pattern: ^doi:10\.\d{2,9}/.*$ doi_provider: name: doi_provider description: The authority, or organization, the DOI is associated with. examples: - value: ess_dive description: The corresponding DOI is associated with ESS-DIVE. from_schema: https://w3id.org/nmdc/nmdc close_mappings: - NCIT:C74932 range: DoiProviderEnum doi_category: name: doi_category description: The resource type the corresponding doi resolves to. examples: - value: dataset_doi description: The corresponding DOI is a dataset resource type. from_schema: https://w3id.org/nmdc/nmdc range: DoiCategoryEnum required: true related_identifiers: name: related_identifiers description: Identifiers assigned to a thing that is similar to that which is represented in NMDC. Related identifier are not an identical match and may have some variation. title: Related Identifiers from_schema: https://w3id.org/nmdc/nmdc notes: name: notes from_schema: https://w3id.org/nmdc/nmdc funding_sources: name: funding_sources description: A list of organizations, along with the award numbers, that underwrite financial support for projects of a particular type. Typically, they process applications and award funds to the chosen qualified applicants. comments: - Include only the name of the funding organization and the award or contract number. examples: - value: National Sciences Foundation Dimensions of Biodiversity (award no. 1342701) - value: U.S. Department of Energy, Office of Science, Office of Biological and Environmental Research (BER) under contract DE-AC05-00OR2275 from_schema: https://w3id.org/nmdc/nmdc close_mappings: - NCIT:C39409 range: string multivalued: true ecosystem_path_id: name: ecosystem_path_id description: A unique id representing the GOLD classifiers associated with a sample. examples: - value: '6026' from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/ecosystem_classification range: integer gold_path_field: name: gold_path_field annotations: tooltip: tag: tooltip value: GOLD Ecosystem Classification paths describe the surroundings from which an environmental sample or an organism is collected. annotations: source: tag: source value: https://gold.jgi.doe.gov/ecosystem_classification description: This is a grouping for any of the gold path fields from_schema: https://w3id.org/nmdc/nmdc abstract: true range: string ecosystem: name: ecosystem description: An ecosystem is a combination of a physical environment (abiotic factors) and all the organisms (biotic factors) that interact with this environment. Ecosystem is in position 1/5 in a GOLD path. comments: - The abiotic factors play a profound role on the type and composition of organisms in a given environment. The GOLD Ecosystem at the top of the five-level classification system is aimed at capturing the broader environment from which an organism or environmental sample is collected. The three broad groups under Ecosystem are Environmental, Host-associated, and Engineered. They represent samples collected from a natural environment or from another organism or from engineered environments like bioreactors respectively. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/help is_a: gold_path_field ecosystem_category: name: ecosystem_category description: Ecosystem categories represent divisions within the ecosystem based on specific characteristics of the environment from where an organism or sample is isolated. Ecosystem category is in position 2/5 in a GOLD path. comments: - The Environmental ecosystem (for example) is divided into Air, Aquatic and Terrestrial. Ecosystem categories for Host-associated samples can be individual hosts or phyla and for engineered samples it may be manipulated environments like bioreactors, solid waste etc. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/help is_a: gold_path_field ecosystem_type: name: ecosystem_type description: Ecosystem types represent things having common characteristics within the Ecosystem Category. These common characteristics based grouping is still broad but specific to the characteristics of a given environment. Ecosystem type is in position 3/5 in a GOLD path. comments: - The Aquatic ecosystem category (for example) may have ecosystem types like Marine or Thermal springs etc. Ecosystem category Air may have Indoor air or Outdoor air as different Ecosystem Types. In the case of Host-associated samples, ecosystem type can represent Respiratory system, Digestive system, Roots etc. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/help is_a: gold_path_field ecosystem_subtype: name: ecosystem_subtype description: Ecosystem subtypes represent further subdivision of Ecosystem types into more distinct subtypes. Ecosystem subtype is in position 4/5 in a GOLD path. comments: - Ecosystem Type Marine (Environmental -> Aquatic -> Marine) is further divided (for example) into Intertidal zone, Coastal, Pelagic, Intertidal zone etc. in the Ecosystem subtype category. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/help is_a: gold_path_field specific_ecosystem: name: specific_ecosystem description: Specific ecosystems represent specific features of the environment like aphotic zone in an ocean or gastric mucosa within a host digestive system. Specific ecosystem is in position 5/5 in a GOLD path. comments: - Specific ecosystems help to define samples based on very specific characteristics of an environment under the five-level classification system. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/help is_a: gold_path_field add_date: name: add_date description: The date on which information was added to a database. from_schema: https://w3id.org/nmdc/nmdc range: string mod_date: name: mod_date description: The date on which information was last modified in a database. from_schema: https://w3id.org/nmdc/nmdc range: string ncbi_taxonomy_name: name: ncbi_taxonomy_name from_schema: https://w3id.org/nmdc/nmdc range: string ncbi_project_name: name: ncbi_project_name from_schema: https://w3id.org/nmdc/nmdc range: string processing_institution: name: processing_institution description: The organization that processed the sample. from_schema: https://w3id.org/nmdc/nmdc range: ProcessingInstitutionEnum qc_status: name: qc_status description: Stores information about the result of a process (ie the process of sequencing a library may have for qc_status of 'fail' if not enough data was generated) from_schema: https://w3id.org/nmdc/nmdc range: StatusEnum file_size_bytes: name: file_size_bytes description: Size of the file in bytes from_schema: https://w3id.org/nmdc/nmdc range: bytes analyte_category: name: analyte_category description: 'The type of analyte(s) that were measured in the data generation process ' from_schema: https://w3id.org/nmdc/nmdc required: true external_database_identifiers: name: external_database_identifiers description: Link to corresponding identifier in external database comments: - The value of this field is always a registered CURIE from_schema: https://w3id.org/nmdc/nmdc close_mappings: - skos:closeMatch is_a: alternative_identifiers abstract: true range: external_identifier multivalued: true pattern: ^[a-zA-Z0-9][a-zA-Z0-9_\.]+:[a-zA-Z0-9_][a-zA-Z0-9_\-\/\.,]*$ dna_concentration: name: dna_concentration title: DNA concentration in ng/ul comments: - Units must be in ng/uL. Enter the numerical part only. Must be calculated using a fluorometric method. Acceptable values are 0-2000. examples: - value: '100' from_schema: https://w3id.org/nmdc/nmdc see_also: - nmdc:nucleic_acid_concentration rank: 5 slot_group: JGI-Metagenomics range: float recommended: true minimum_value: 0 maximum_value: 2000 extraction_targets: name: extraction_targets description: Provides the target biomolecule that has been separated from a sample during an extraction process. notes: - todos, remove nucl_acid_ext from OmicsProcessing (DataGeneration) from_schema: https://w3id.org/nmdc/nmdc narrow_mappings: - NCIT:C177560 - MIXS:0000037 rank: 1000 range: ExtractionTargetEnum multivalued: true id: name: id description: A unique identifier for a thing. Must be either a CURIE shorthand for a URI or a complete URI notes: - 'abstracted pattern: prefix:typecode-authshoulder-blade(.version)?(_seqsuffix)?' - a minimum length of 3 characters is suggested for typecodes, but 1 or 2 characters will be accepted - typecodes must correspond 1:1 to a class in the NMDC schema. this will be checked via per-class id slot usage assertions - minting authority shoulders should probably be enumerated and checked in the pattern examples: - value: nmdc:mgmag-00-x012.1_7_c1 description: https://github.com/microbiomedata/nmdc-schema/pull/499#discussion_r1018499248 from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: workflow_execution_id predicate: NARROW_SYNONYM contexts: - https://bitbucket.org/berkeleylab/jgi-jat/macros/nmdc_metadata.yaml - literal_form: data_object_id predicate: NARROW_SYNONYM contexts: - https://bitbucket.org/berkeleylab/jgi-jat/macros/nmdc_metadata.yaml identifier: true range: uriorcurie required: true pattern: ^[a-zA-Z0-9][a-zA-Z0-9_\.]+:[a-zA-Z0-9_][a-zA-Z0-9_\-\/\.,]*$ title: name: title description: A name given to the entity that differs from the name/label programmatically assigned to it. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - dcterms:title range: string alternative_titles: name: alternative_titles description: A list of alternative titles for the entity. The distinction between title and alternative titles is application-specific. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - dcterms:alternative range: string multivalued: true alternative_names: name: alternative_names description: A list of alternative names used to refer to the entity. The distinction between name and alternative names is application-specific. This should not be used for identifers which have their own slots (e.g., bioproject:PRJNA406974) from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - dcterms:alternative - skos:altLabel range: string multivalued: true alternative_descriptions: name: alternative_descriptions description: A list of alternative descriptions for the entity. The distinction between description and alternative descriptions is application-specific. from_schema: https://w3id.org/nmdc/nmdc range: string multivalued: true alternative_identifiers: name: alternative_identifiers description: A list of alternative identifiers for the entity. from_schema: https://w3id.org/nmdc/nmdc range: uriorcurie multivalued: true pattern: ^[a-zA-Z0-9][a-zA-Z0-9_\.]+:[a-zA-Z0-9_][a-zA-Z0-9_\-\/\.,\(\)\=\#]*$ start_date: name: start_date description: The date on which any process or activity was started todos: - add date string validation pattern comments: - We are using string representations of dates until all components of our ecosystem can handle ISO 8610 dates - The date should be formatted as YYYY-MM-DD from_schema: https://w3id.org/nmdc/nmdc range: string end_date: name: end_date description: The date on which any process or activity was ended todos: - add date string validation pattern comments: - We are using string representations of dates until all components of our ecosystem can handle ISO 8610 dates - The date should be formatted as YYYY-MM-DD from_schema: https://w3id.org/nmdc/nmdc range: string organism_genus: name: organism_genus description: Genus of the organism. notes: - GOLD organism_v2 Go0000189 (Shewanella loihica PV-4, queried 2026-04-21) - GOLD organism_v2 Go0000514 (Ruegeria pomeroyi DSS-3, queried 2026-04-21) - GOLD organism_v2 (Go0000058, queried 2026-04-14) comments: - Free-text submitter-provided genus name. For an ontology-grounded classification, use `classified_as` with a NcbiTaxon instance on the parent Organism class. examples: - value: Shewanella - value: Ruegeria - value: Campylobacter in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Genus predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ organism_species: name: organism_species description: Species of the organism. notes: - GOLD organism_v2 Go0000189 (Shewanella loihica PV-4, queried 2026-04-21) - GOLD organism_v2 Go0000514 (Ruegeria pomeroyi DSS-3, queried 2026-04-21) comments: - Free-text submitter-provided species name. For an ontology-grounded classification, use `classified_as` with a NcbiTaxon instance on the parent Organism class. examples: - value: loihica - value: pomeroyi - value: sp. description: use when the isolate has not yet been assigned a species name in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Species predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ strain_name: name: strain_name description: Strain or cultivar name of the organism. notes: - 'Microbial strain identifiers and plant cultivar names (governed by the International Code of Nomenclature for Cultivated Plants, ICNCP) are nomenclaturally distinct, but this slot accepts both for now to match the JGI Isolate (NA) v19 form''s combined "Strain or cultivar" field. A separate `cultivar_name` slot may be added if a plant-specific use case emerges; see #3056.' - MIxS `subspecf_gen_lin` (MIXS:0000020) covers this concept along with cultivar, serovar, biotype, ecotype, and other sub-species lineage types in a single slot using a rank-prefix encoding (e.g. "strain:PV-4"). NMDC splits the concept into separate slots; this slot covers the strain rank specifically. - Example values are strain names from GOLD organism_v2. examples: - value: PV-4 - value: DSS-3 - value: DSM 6724 in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Strain or cultivar predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ related_mappings: - MIXS:0000020 isolate_name: name: isolate_name description: Isolate or mutant name. notes: - MIxS `subspecf_gen_lin` (MIXS:0000020) covers this concept along with strain, cultivar, serovar, biotype, ecotype, and other sub-species lineage types in a single slot using a rank-prefix encoding. NMDC uses a separate slot for the isolate rank specifically. - Example values are from GOLD dw_sample_taxonomy_info.isolate; "Isolate" is a generic placeholder used when no specific mutant or isolate name is recorded. examples: - value: Bd21-3 - value: MR164 - value: Isolate in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Isolate predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ related_mappings: - MIXS:0000020 gc_content: name: gc_content description: Estimated GC content as a percentage. examples: - value: '45' - value: '60' in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: GC Content % predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ range: float minimum_value: 0 maximum_value: 100 unit: ucum_code: '%' expected_organism: name: expected_organism description: The organism that the submitter expects to be present in this sample. May be contradicted by sequencing results. examples: - value: nmdc:orgn-99-abc123 description: Reference to an Organism instance in organism_set from_schema: https://w3id.org/nmdc/nmdc range: Organism host_genus: name: host_genus description: Genus of the host organism that the sample was collected from. notes: - GOLD organism_v2 host_name "Zea mays" (n=432 records, queried 2026-04-30) - GOLD organism_v2 host_name "Escherichia coli K-12" (Go0084483 Escherichia phage JSE, queried 2026-04-30) comments: - Free-text submitter-provided host genus. For an ontology-grounded host identification, use `host_taxid` (MIXS:0000250) on the same class. examples: - value: Zea - value: Escherichia in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Host Genus predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ host_species: name: host_species description: Species of the host organism that the sample was collected from. notes: - GOLD organism_v2 host_name "Zea mays" (n=432 records, queried 2026-04-30) - GOLD organism_v2 host_name "Escherichia coli K-12" (Go0084483 Escherichia phage JSE, queried 2026-04-30) comments: - Free-text submitter-provided host species. For an ontology-grounded host identification, use `host_taxid` (MIXS:0000250) on the same class. examples: - value: mays - value: coli in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Host Species predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ host_strain: name: host_strain description: Strain of the host organism that the sample was collected from. notes: - GOLD organism_v2 host_name "Escherichia coli K-12" (Go0084483 Escherichia phage JSE, queried 2026-04-30) comments: - Free-text submitter-provided host strain. For an ontology-grounded host identification, use `host_taxid` (MIXS:0000250) on the same class. examples: - value: K-12 in_subset: - jgi_isolate from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Host Strain predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ img_identifiers: name: img_identifiers description: A list of identifiers that relate the biosample to records in the IMG database. title: IMG Identifiers todos: - add is_a or mixin modeling, like other external_database_identifiers - what class would IMG records belong to?! Are they Studies, Biosamples, or something else? from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers pattern: ^img\.taxon:[a-zA-Z0-9_][a-zA-Z0-9_\/\.]*$ igsn_identifiers: name: igsn_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers mixin: true gold_identifiers: name: gold_identifiers from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/ is_a: external_database_identifiers mixin: true emsl_identifiers: name: emsl_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers mixin: true mgnify_identifiers: name: mgnify_identifiers from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ebi.ac.uk/metagenomics/ is_a: external_database_identifiers mixin: true insdc_identifiers: name: insdc_identifiers description: Any identifier covered by the International Nucleotide Sequence Database Collaboration comments: - note that we deliberately abstract over which of the partner databases accepted the initial submission - 'the first letter of the accession indicates which partner accepted the initial submission: E for ENA, D for DDBJ, or S or N for NCBI.' from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.insdc.org/ - https://ena-docs.readthedocs.io/en/latest/submit/general-guide/accessions.html aliases: - EBI identifiers - NCBI identifiers - DDBJ identifiers is_a: external_database_identifiers mixin: true neon_identifiers: name: neon_identifiers description: identifiers for entities according to NEON from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers mixin: true jgi_portal_identifiers: name: jgi_portal_identifiers description: identifiers for entities according to JGI Portal from_schema: https://w3id.org/nmdc/nmdc see_also: - https://data.jgi.doe.gov/ is_a: external_database_identifiers mixin: true gnps_identifiers: name: gnps_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers mixin: true study_identifiers: name: study_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers abstract: true jgi_portal_study_identifiers: name: jgi_portal_study_identifiers id_prefixes: - jgi.proposal description: Identifiers that link a NMDC study to a website hosting raw and analyzed data for a JGI proposal. The suffix of the curie can used to query the GOLD API and is interoperable with an award DOI from OSTI and a GOLD study identifier. title: JGI Portal Study identifiers comments: - Could this could be considered a related identifier? - Curie suffix is the Site Award Number from an OSTI award page - Site Award Number 507130 == award doi doi:10.46936/10.25585/60000017 -- GOLD study identifier gold:Gs0154044 - bioregistry.io/jgi.proposal:507130 ==https://genome.jgi.doe.gov/portal/BioDefcarcycling/BioDefcarcycling.info.html examples: - value: jgi.proposal:507130 from_schema: https://w3id.org/nmdc/nmdc is_a: study_identifiers mixins: - jgi_portal_identifiers pattern: ^jgi.proposal:\d+$ neon_study_identifiers: name: neon_study_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: study_identifiers mixins: - neon_identifiers insdc_sra_ena_study_identifiers: name: insdc_sra_ena_study_identifiers description: identifiers for corresponding project in INSDC SRA / ENA examples: - value: insdc.sra:SRP121659 description: Avena fatua rhizosphere microbial communities - H1_Rhizo_Litter_2 metatranscriptome from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/bioregistry/bioregistry/issues/109 - https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies - https://trace.ncbi.nlm.nih.gov/Traces/sra/sra.cgi?view=studies aliases: - EBI ENA study identifiers - NCBI SRA identifiers - DDBJ SRA identifiers is_a: study_identifiers mixins: - insdc_identifiers pattern: ^insdc.sra:(E|D|S)RP[0-9]{6,}$ insdc_bioproject_identifiers: name: insdc_bioproject_identifiers description: identifiers for corresponding project in INSDC Bioproject comments: - these are distinct IDs from INSDC SRA/ENA project identifiers, but are usually(?) one to one examples: - value: bioproject:PRJNA366857 description: Avena fatua rhizosphere microbial communities - H1_Rhizo_Litter_2 metatranscriptome from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ncbi.nlm.nih.gov/bioproject/ - https://www.ddbj.nig.ac.jp/bioproject/index-e.html aliases: - NCBI bioproject identifiers - DDBJ bioproject identifiers is_a: study_identifiers mixins: - insdc_identifiers pattern: ^bioproject:PRJ[DEN][A-Z][0-9]+$ gold_study_identifiers: name: gold_study_identifiers description: identifiers for corresponding project(s) in GOLD title: GOLD Study Identifiers comments: - uses the prefix GS (but possibly in a different case) examples: - value: gold:Gs0110115 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://gold.jgi.doe.gov/studies is_a: study_identifiers mixins: - gold_identifiers pattern: ^gold:Gs[0-9]+$ mgnify_project_identifiers: name: mgnify_project_identifiers description: identifiers for corresponding project in MGnify examples: - value: mgnify.proj:MGYS00005757 from_schema: https://w3id.org/nmdc/nmdc is_a: study_identifiers mixins: - mgnify_identifiers pattern: ^mgnify.proj:[A-Z]+[0-9]+$ gnps_task_identifiers: name: gnps_task_identifiers description: identifiers that link a NMDC study to a web-based report about metabolomics analysis progress and results title: GNPS task identifiers comments: - this could be considered a related identifier, as the metabolomics progress and results aren't a study per se - this identifier was registered with bioregistry but not identifiers.org examples: - value: gnps.task:4b848c342a4f4abc871bdf8a09a60807 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://microbiomedata.github.io/nmdc-schema/MetabolomicsAnalysis/ is_a: study_identifiers mixins: - gnps_identifiers pattern: ^gnps\.task:[a-f0-9]+$ emsl_project_identifiers: name: emsl_project_identifiers description: Identifiers that link a NMDC study to the EMSL user facility website hosting the project description of an EMSL user project title: EMSL Project Identifiers todos: - elaborate on description notes: - these identifiers are all currently 5 digits long but that could change in the future examples: - value: emsl.project:60141 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/927#issuecomment-1802136437 is_a: study_identifiers mixins: - emsl_identifiers pattern: ^emsl\.project:[0-9]{5}$ biosample_identifiers: name: biosample_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers abstract: true neon_biosample_identifiers: name: neon_biosample_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: biosample_identifiers mixins: - neon_identifiers gold_biosample_identifiers: name: gold_biosample_identifiers description: identifiers for corresponding sample in GOLD examples: - value: gold:Gb0312930 from_schema: https://w3id.org/nmdc/nmdc is_a: biosample_identifiers mixins: - gold_identifiers range: uriorcurie pattern: ^gold:Gb[0-9]+$ gold_organism_identifiers: name: gold_organism_identifiers description: identifiers for corresponding organism in GOLD examples: - value: gold:Go0000058 description: GOLD organism_v2 Campylobacter concisus 13826 (queried 2026-04-14) from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2973 is_a: external_database_identifiers mixins: - gold_identifiers range: uriorcurie multivalued: true pattern: ^gold:Go[0-9]+$ insdc_biosample_identifiers: name: insdc_biosample_identifiers description: identifiers for corresponding sample in INSDC examples: - value: biosample:SAMEA5989477 - value: biosample:SAMD00212331 description: I13_N_5-10 sample from Soil fungal diversity along elevational gradients from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/bioregistry/bioregistry/issues/108 - https://www.ebi.ac.uk/biosamples/ - https://www.ncbi.nlm.nih.gov/biosample - https://www.ddbj.nig.ac.jp/biosample/index-e.html aliases: - EBI biosample identifiers - NCBI biosample identifiers - DDBJ biosample identifiers is_a: biosample_identifiers mixins: - insdc_identifiers pattern: ^biosample:SAM[NED]([A-Z])?[0-9]+$ insdc_secondary_sample_identifiers: name: insdc_secondary_sample_identifiers description: secondary identifiers for corresponding sample in INSDC comments: - ENA redirects these to primary IDs, e.g. https://www.ebi.ac.uk/ena/browser/view/DRS166340 -> SAMD00212331 - MGnify uses these as their primary sample IDs examples: - value: insdc.sra:DRS166340 description: I13_N_5-10 sample from Soil fungal diversity along elevational gradients from_schema: https://w3id.org/nmdc/nmdc is_a: biosample_identifiers mixins: - insdc_identifiers pattern: ^biosample:(E|D|S)RS[0-9]{6,}$ emsl_biosample_identifiers: name: emsl_biosample_identifiers description: A list of identifiers for the biosample from the EMSL database. This is used to link the biosample, as modeled by NMDC, to the biosample in the planned EMSL NEXUS database. title: EMSL Biosample Identifiers todos: - removed "planned" once NEXUS is online - determine real expansion for emsl prefix from_schema: https://w3id.org/nmdc/nmdc is_a: biosample_identifiers mixins: - emsl_identifiers igsn_biosample_identifiers: name: igsn_biosample_identifiers description: A list of identifiers for the biosample from the IGSN database. title: IGSN Biosample Identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: biosample_identifiers mixins: - igsn_identifiers pattern: ^igsn:[A-Za-z]{2,4}[A-Za-z0-9.-]{1,71}$ omics_processing_identifiers: name: omics_processing_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers abstract: true gold_sequencing_project_identifiers: name: gold_sequencing_project_identifiers description: identifiers for corresponding sequencing project in GOLD examples: - value: gold:Gp0108335 from_schema: https://w3id.org/nmdc/nmdc is_a: omics_processing_identifiers mixins: - gold_identifiers pattern: ^gold:Gp[0-9]+$ insdc_experiment_identifiers: name: insdc_experiment_identifiers description: INSDC identifiers for the unique sequencing result for a specific sample from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ncbi.nlm.nih.gov/sra/docs/submitmeta/#sra-metadata-experiment is_a: external_database_identifiers mixins: - insdc_identifiers pattern: ^insdc.sra:(E|D|S)RX[0-9]{6,}$ insdc_run_identifiers: name: insdc_run_identifiers description: Identifiers for the manifest of data file(s) that are derived from sequencing a library described by the associated INSDC experiment. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ncbi.nlm.nih.gov/sra/docs/submitmeta/#linking-metadata-and-data-run is_a: external_database_identifiers mixins: - insdc_identifiers pattern: ^insdc\.run:(E|D|S)RR[0-9]{6,}$ analysis_identifiers: name: analysis_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: external_database_identifiers abstract: true gold_analysis_project_identifiers: name: gold_analysis_project_identifiers description: identifiers for corresponding analysis projects in GOLD examples: - value: gold:Ga0526289 from_schema: https://w3id.org/nmdc/nmdc is_a: analysis_identifiers mixins: - gold_identifiers pattern: ^gold:Ga[0-9]+$ jgi_portal_analysis_project_identifiers: name: jgi_portal_analysis_project_identifiers id_prefixes: - jgi.analysis description: identifiers for corresponding analysis projects in JGI Portal examples: - value: jgi.analysis:1414320 description: Metagenome - Draft Assembly YELL_051-M-20210705-comp-DNA1 from_schema: https://w3id.org/nmdc/nmdc is_a: analysis_identifiers mixins: - jgi_portal_identifiers pattern: ^jgi.analysis:[0-9]+$ insdc_analysis_identifiers: name: insdc_analysis_identifiers comments: - in INSDC this is a run but it corresponds to a GOLD analysis examples: - value: insdc.sra:DRR218479 description: Illumina MiSeq paired end sequencing of SAMD00212331 - value: insdc.sra:ERR436051 from_schema: https://w3id.org/nmdc/nmdc is_a: analysis_identifiers mixins: - insdc_identifiers pattern: ^insdc.sra:(E|D|S)RR[0-9]{6,}$ mgnify_analysis_identifiers: name: mgnify_analysis_identifiers notes: - 'removed pattern: "^mgnify:MGYA[0-9]+$" ## TODO https://github.com/bioregistry/bioregistry/issues/109' examples: - value: mgnify.analysis:MGYA00002270 description: combined analyses (taxonomic, functional) of sample ERS438107 from_schema: https://w3id.org/nmdc/nmdc is_a: analysis_identifiers mixins: - mgnify_identifiers assembly_identifiers: name: assembly_identifiers from_schema: https://w3id.org/nmdc/nmdc abstract: true insdc_assembly_identifiers: name: insdc_assembly_identifiers from_schema: https://w3id.org/nmdc/nmdc is_a: assembly_identifiers mixins: - insdc_identifiers pattern: ^insdc.sra:[A-Z]+[0-9]+(\.[0-9]+)?$ classified_as: name: classified_as description: A formal classification for this entity, expressed directly as an ontology-backed class instance stored in ontology_class_set. notes: - The global range stays OntologyClass. Organism is currently the only class that narrows classified_as to NcbiTaxon, via slot_usage. Extending that narrowing to other classes is tracked in https://github.com/microbiomedata/nmdc-schema/issues/3016. comments: - Taxonomy-oriented uses (e.g. on Organism) should point to NcbiTaxon instances. OrganismSample reaches taxonomy indirectly via expected_organism.classified_as. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2959 - https://github.com/microbiomedata/nmdc-schema/issues/3016 narrow_mappings: - biolink:in_taxon range: OntologyClass multivalued: true inlined_as_list: true source_system_of_record: name: source_system_of_record description: Identifies the system of origin for a record from_schema: https://w3id.org/nmdc/nmdc range: SourceSystemEnum submission_portal_identifier: name: submission_portal_identifier description: The UUID of the NMDC Submission Portal entry that generated this record. examples: - value: c41dfeac-102e-43b2-adae-6a67f25791f0 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://data.microbiomedata.org/submission/home range: string multivalued: true pattern: ^[0-9a-f]{8}-[0-9a-f]{4}-[0-9a-f]{4}-[0-9a-f]{4}-[0-9a-f]{12}$ associated_studies: name: associated_studies description: The study associated with a resource. from_schema: https://w3id.org/nmdc/nmdc range: Study required: true multivalued: true pattern: ^(nmdc):sty-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:sty-{id_shoulder}-{id_blade}$' interpolated: true part_of: name: part_of description: Links a resource to another resource that either logically or physically includes it. from_schema: https://w3id.org/nmdc/nmdc aliases: - is part of slot_uri: dcterms:isPartOf range: NamedThing multivalued: true was_informed_by: name: was_informed_by description: The primary DataGeneration subclass that the WorkflowExecution subclass depends on. comments: - For version 1 of the proteomics workflow there are input files both from the NucleotideSequencing and MassSpectrometry, the MassSpectrometry record is considered the primary class to reference. from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: was_informed_by predicate: EXACT_SYNONYM contexts: - https://bitbucket.org/berkeleylab/jgi-jat/macros/nmdc_metadata.yaml mappings: - prov:wasInformedBy range: DataGeneration multivalued: true principal_investigator: name: principal_investigator description: Principal Investigator who led the study and/or generated the dataset. from_schema: https://w3id.org/nmdc/nmdc aliases: - PI range: PersonValue was_generated_by: name: was_generated_by from_schema: https://w3id.org/nmdc/nmdc mappings: - prov:wasGeneratedBy range: DataEmitterProcess associated_dois: name: associated_dois description: A list of DOIs associated with a resource, such as a list of DOIS associated with a Study. examples: - description: An EMSL award DOI. object: doi: doi:10.46936/intm.proj.2021.60141/60000423 doi_provider: emsl doi_category: award_doi - description: A publication DOI. object: doi: doi:10.1101/2022.12.12.520098 doi_category: publication_doi - description: A data management plan DOI. object: doi: doi:10.48321/D1Z60Q doi_category: data_management_plan_doi doi_provider: gsc from_schema: https://w3id.org/nmdc/nmdc aliases: - Associated DOIs - Associated digital object identifiers range: Doi multivalued: true inlined_as_list: true has_credit_associations: name: has_credit_associations annotations: tooltip: tag: tooltip value: Other researchers associated with this study. description: 'This slot links a study to a credit association. The credit association will be linked to a person value and to a CRediT Contributor Roles term. Overall semantics: person should get credit X for their participation in the study' from_schema: https://w3id.org/nmdc/nmdc slot_uri: prov:qualifiedAssociation range: CreditAssociation multivalued: true inlined_as_list: true protocol_link: name: protocol_link from_schema: https://w3id.org/nmdc/nmdc range: Protocol study_category: name: study_category description: The type of research initiative from_schema: https://w3id.org/nmdc/nmdc range: StudyCategoryEnum required: true study_image: name: study_image description: Links a study to one or more images. from_schema: https://w3id.org/nmdc/nmdc range: ImageValue multivalued: true inlined_as_list: true applies_to_person: name: applies_to_person from_schema: https://w3id.org/nmdc/nmdc range: PersonValue required: true applied_roles: name: applied_roles annotations: tooltip: tag: tooltip value: 'Identify all CRediT roles associated with this contributor. CRediT Information: https://info.orcid.org/credit-for-research-contribution ; CRediT: https://credit.niso.org/' from_schema: https://w3id.org/nmdc/nmdc range: CreditEnum required: true multivalued: true definition: name: definition description: The definition of the ontology term as provided by the ontology. from_schema: https://w3id.org/nmdc/nmdc range: string relations: name: relations from_schema: https://w3id.org/nmdc/nmdc range: OntologyRelation multivalued: true inlined: true inlined_as_list: true is_obsolete: name: is_obsolete description: A boolean value indicating whether the ontology term is obsolete. comments: - If true (the ontology term is declared obsolete via the ontology source itself), the term is no longer considered a valid term to use in an annotation at NMDC, and it no longer has ontology_relation_set records. from_schema: https://w3id.org/nmdc/nmdc range: boolean is_root: name: is_root description: A boolean value indicating whether the ontology term is a root term; it is not a subclass of any other term. from_schema: https://w3id.org/nmdc/nmdc range: boolean has_input: name: has_input description: An input to a process. from_schema: https://w3id.org/nmdc/nmdc aliases: - input range: NamedThing multivalued: true has_output: name: has_output description: An output from a process. from_schema: https://w3id.org/nmdc/nmdc aliases: - output range: NamedThing multivalued: true instrument_used: name: instrument_used description: What instrument was used during DataGeneration or MaterialProcessing. from_schema: https://w3id.org/nmdc/nmdc range: Instrument multivalued: true pattern: ^(nmdc):inst-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:inst-{id_shoulder}-{id_blade}$' interpolated: true instrument_instance_specifier: name: instrument_instance_specifier description: A unique value that identifies an individual instrument instance, such as a serial number or similar identifiers assigned by the manufacturer or user. from_schema: https://w3id.org/nmdc/nmdc in_manifest: name: in_manifest description: one or more combinations of other DataObjects that can be analyzed together comments: - A DataObject can be part of multiple manifests, for example, a DataObject could be part of a manifest for a single run of an instrument and a manifest for technical replicates of a single sample. from_schema: https://w3id.org/nmdc/nmdc range: Manifest multivalued: true pattern: ^(nmdc):manif-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:manif-{id_shoulder}-{id_blade}$' interpolated: true manifest_category: name: manifest_category description: The type of context in which the constituent DataObjects can be analyzed together. from_schema: https://w3id.org/nmdc/nmdc range: ManifestCategoryEnum required: true model: name: model from_schema: https://w3id.org/nmdc/nmdc range: InstrumentModelEnum vendor: name: vendor from_schema: https://w3id.org/nmdc/nmdc range: InstrumentVendorEnum qc_failure_where: name: qc_failure_where description: Describes the nmdc schema class that corresonds to where the failure occurred. Most commonly this would be the same as Class that generated the results. comments: - If the assembly size was too small to proceed to annotation failure_where would be MetagenomeAssembly. from_schema: https://w3id.org/nmdc/nmdc range: FailureWhereEnum qc_failure_what: name: qc_failure_what description: Provides a summary about what caused a lab or workflow process to fail comments: - For example, low read count from a sequencer, malformed fastq files, etc. from_schema: https://w3id.org/nmdc/nmdc range: FailureWhatEnum protocol_for: name: protocol_for description: The type of planned process that the protocol describes. from_schema: https://w3id.org/nmdc/nmdc range: ProtocolForEnum superseded_by: name: superseded_by description: Links a DataObject or WorkflowExecution record to a newer WorkflowExecution that supersedes it, marking this record as outdated. The linked WorkflowExecution or resultant DataObjects should be used in favor of this record. from_schema: https://w3id.org/nmdc/nmdc range: WorkflowExecution provenance_metadata: name: provenance_metadata description: Provides information about the provenance of a record. from_schema: https://w3id.org/nmdc/nmdc range: ProvenanceMetadata abs_air_humidity: name: abs_air_humidity annotations: Preferred_unit: tag: Preferred_unit value: gram per gram, kilogram per kilogram, kilogram, pound, gram per cubic meter, kilogram per cubic meter, percent storage_units: tag: storage_units value: '[lb_av]|g/g|kg|kg/kg' description: Actual mass of water vapor present in the air water vapor mixture. title: absolute air humidity comments: - Can be calculated via mass of water vapor divided by the volume of the air and water vapor mixture. examples: - value: 9 g/g from_schema: https://w3id.org/nmdc/nmdc keywords: - absolute - air - humidity slot_uri: MIXS:0000122 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true add_recov_method: name: add_recov_method description: Additional (i.e. Secondary, tertiary, etc.) recovery methods deployed for increase of hydrocarbon recovery from resource and start date for each one of them. If "other" is specified, please propose entry in "additional info" field title: secondary and tertiary recovery methods and start date examples: - value: Polymer Addition;2018-06-21T14:30Z from_schema: https://w3id.org/nmdc/nmdc keywords: - date - method - recover - secondary - start slot_uri: MIXS:0001009 pattern: ^(Water Injection|Dump Flood|Gas Injection|Wag Immiscible Injection|Polymer Addition|Surfactant Addition|Not Applicable|other);(\d{4})(-(0[1-9]|1[0-2])(-(0[1-9]|[12]\d|3[01])(T([01]\d|2[0-3]):([0-5]\d)(:([0-5]\d))?(\.\d+)?(Z|([+-][01]\d:[0-5]\d))?)?)?)?$ structured_pattern: syntax: ^({add_recov_methods});{date_time_stamp}$ interpolated: true partial_match: true additional_info: name: additional_info description: Information that doesn't fit anywhere else. Can also be used to propose new entries for fields with controlled vocabulary title: additional info from_schema: https://w3id.org/nmdc/nmdc keywords: - information slot_uri: MIXS:0000300 range: TextValue address: name: address description: The street name and building number where the sampling occurred title: address from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000218 pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true adj_room: name: adj_room description: List of rooms (room number, room name) immediately adjacent to the sampling room title: adjacent rooms from_schema: https://w3id.org/nmdc/nmdc keywords: - adjacent - room slot_uri: MIXS:0000219 range: TextValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+);[1-9][0-9]*$ structured_pattern: syntax: ^{room_name};{room_number}$ interpolated: true partial_match: true aero_struc: name: aero_struc description: Aerospace structures typically consist of thin plates with stiffeners for the external surfaces, bulkheads and frames to support the shape and fasteners such as welds, rivets, screws and bolts to hold the components together title: aerospace structure examples: - value: plane from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000773 range: AeroStrucEnum agrochem_addition: name: agrochem_addition annotations: Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Addition of fertilizers, pesticides, etc. - amount and time of applications title: history/agrochemical additions examples: - value: roundup;5 milligram per liter;2018-06-21 from_schema: https://w3id.org/nmdc/nmdc keywords: - history slot_uri: MIXS:0000639 range: TextValue multivalued: true inlined_as_list: true pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+);(\d{4})(-(0[1-9]|1[0-2])(-(0[1-9]|[12]\d|3[01])(T([01]\d|2[0-3]):([0-5]\d)(:([0-5]\d))?(\.\d+)?(Z|([+-][01]\d:[0-5]\d))?)?)?)?$ structured_pattern: syntax: ^{agrochemical_name};{amount} {unit};{date_time_stamp}$ interpolated: true partial_match: true air_PM_concen: name: air_PM_concen description: Concentration of substances that remain suspended in the air, and comprise mixtures of organic and inorganic substances (PM10 and PM2.5); can report multiple PM's by entering numeric values preceded by name of PM title: air particulate matter concentration examples: - value: PM2.5;10 microgram per cubic meter from_schema: https://w3id.org/nmdc/nmdc keywords: - air - concentration - particle - particulate slot_uri: MIXS:0000108 multivalued: true inlined_as_list: true pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{particulate_matter_name};{float} {unit}$ interpolated: true partial_match: true air_temp: name: air_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Temperature of the air at the time of sampling title: air temperature examples: - value: 20 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - air - temperature slot_uri: MIXS:0000124 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true air_temp_regm: name: air_temp_regm annotations: Expected_value: tag: Expected_value value: temperature value;treatment interval and duration Preferred_unit: tag: Preferred_unit value: degree Celsius description: Information about treatment involving an exposure to varying temperatures; should include the temperature, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include different temperature regimens title: air temperature regimen examples: - value: 25 degree Celsius;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - air - regimen - temperature string_serialization: '{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000551 range: TextValue multivalued: true inlined_as_list: true al_sat: name: al_sat annotations: Preferred_unit: tag: Preferred_unit value: percentage storage_units: tag: storage_units value: '%' description: Aluminum saturation (esp. For tropical soils) title: extreme_unusual_properties/Al saturation from_schema: https://w3id.org/nmdc/nmdc keywords: - extreme - properties - saturation - unusual slot_uri: MIXS:0000607 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true al_sat_meth: name: al_sat_meth description: Reference or method used in determining Al saturation title: extreme_unusual_properties/Al saturation method from_schema: https://w3id.org/nmdc/nmdc keywords: - extreme - method - properties - saturation - unusual slot_uri: MIXS:0000324 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true alkalinity: name: alkalinity annotations: Preferred_unit: tag: Preferred_unit value: milliequivalent per liter, milligram per liter storage_units: tag: storage_units value: meq/L|mg/L description: Alkalinity, the ability of a solution to neutralize acids to the equivalence point of carbonate or bicarbonate title: alkalinity examples: - value: 50 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - alkalinity slot_uri: MIXS:0000421 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true alkalinity_method: name: alkalinity_method description: Method used for alkalinity measurement title: alkalinity method examples: - value: titration from_schema: https://w3id.org/nmdc/nmdc keywords: - alkalinity - method slot_uri: MIXS:0000298 range: string alkyl_diethers: name: alkyl_diethers annotations: storage_units: tag: storage_units value: mol/L description: Concentration of alkyl diethers title: alkyl diethers examples: - value: 0.005 mol/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000490 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true alt: name: alt annotations: Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: Heights of objects such as airplanes, space shuttles, rockets, atmospheric balloons and heights of places such as atmospheric layers and clouds. It is used to measure the height of an object which is above the earth's surface. In this context, the altitude measurement is the vertical distance between the earth's surface above sea level and the sampled position in the air title: altitude examples: - value: 100 m from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000094 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true aminopept_act: name: aminopept_act annotations: Preferred_unit: tag: Preferred_unit value: mole per liter per hour storage_units: tag: storage_units value: mol/L/h description: Measurement of aminopeptidase activity title: aminopeptidase activity examples: - value: 0.269 mol/L/h from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000172 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true ammonium: name: ammonium annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L' description: Concentration of ammonium in the sample title: ammonium examples: - value: 1.5 mg/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000427 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true amount_light: name: amount_light annotations: Preferred_unit: tag: Preferred_unit value: lux, lumens per square meter storage_units: tag: storage_units value: lm/m2|lx description: The unit of illuminance and luminous emittance, measuring luminous flux per unit area title: amount of light from_schema: https://w3id.org/nmdc/nmdc keywords: - light slot_uri: MIXS:0000140 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true ances_data: name: ances_data description: Information about either pedigree or other ancestral information description (e.g. parental variety in case of mutant or selection), e.g. A/3*B (meaning [(A x B) x B] x B) title: ancestral data examples: - value: A/3*B from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000247 range: TextValue annual_precpt: name: annual_precpt annotations: Preferred_unit: tag: Preferred_unit value: millimeter storage_units: tag: storage_units value: mm description: The average of all annual precipitation values known, or an estimated equivalent value derived by such methods as regional indexes or Isohyetal maps title: mean annual precipitation examples: - value: 225 mm from_schema: https://w3id.org/nmdc/nmdc keywords: - mean slot_uri: MIXS:0000644 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true annual_temp: name: annual_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Mean annual temperature title: mean annual temperature examples: - value: 12.5 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - mean - temperature slot_uri: MIXS:0000642 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true antibiotic_regm: name: antibiotic_regm annotations: Expected_value: tag: Expected_value value: antibiotic name;antibiotic amount;treatment interval and duration Preferred_unit: tag: Preferred_unit value: milligram description: Information about treatment involving antibiotic administration; should include the name of antibiotic, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple antibiotic regimens title: antibiotic regimen examples: - value: penicillin;5 milligram;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen string_serialization: '{text};{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000553 range: TextValue multivalued: true inlined_as_list: true api: name: api annotations: Preferred_unit: tag: Preferred_unit value: degrees API units_alignment_excuse: tag: units_alignment_excuse value: non_ucum_unit description: 'API gravity is a measure of how heavy or light a petroleum liquid is compared to water (source: https://en.wikipedia.org/wiki/API_gravity) (e.g. 31.1 API)' title: API gravity examples: - value: 31.1 API from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000157 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true arch_struc: name: arch_struc description: An architectural structure is a human-made, free-standing, immobile outdoor construction title: architectural structure examples: - value: shed from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000774 range: ArchStrucEnum aromatics_pc: name: aromatics_pc annotations: Preferred_unit: tag: Preferred_unit value: percent description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)' title: aromatics wt% from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000133 range: TextValue recommended: true pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{name};{float} {unit}$ interpolated: true partial_match: true asphaltenes_pc: name: asphaltenes_pc annotations: Preferred_unit: tag: Preferred_unit value: percent description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)' title: asphaltenes wt% from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000135 range: TextValue recommended: true pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{name};{float} {unit}$ interpolated: true partial_match: true atmospheric_data: name: atmospheric_data annotations: Expected_value: tag: Expected_value value: atmospheric data name;measurement value description: Measurement of atmospheric data; can include multiple data title: atmospheric data examples: - value: wind speed;9 knots from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0001097 range: TextValue multivalued: true inlined_as_list: true avg_dew_point: name: avg_dew_point annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: The average of dew point measures taken at the beginning of every hour over a 24 hour period on the sampling day title: average dew point examples: - value: 25.5 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - average slot_uri: MIXS:0000141 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true avg_occup: name: avg_occup description: Daily average occupancy of room. Indicate the number of person(s) daily occupying the sampling room title: average daily occupancy from_schema: https://w3id.org/nmdc/nmdc keywords: - average slot_uri: MIXS:0000775 range: TextValue avg_temp: name: avg_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: The average of temperatures taken at the beginning of every hour over a 24 hour period on the sampling day title: average temperature examples: - value: 12.5 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - average - temperature slot_uri: MIXS:0000142 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true bac_prod: name: bac_prod annotations: Preferred_unit: tag: Preferred_unit value: milligram per cubic meter per day storage_units: tag: storage_units value: mg/m3/d description: Bacterial production in the water column measured by isotope uptake title: bacterial production examples: - value: 5 mg/m3/d from_schema: https://w3id.org/nmdc/nmdc keywords: - production slot_uri: MIXS:0000683 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true bac_resp: name: bac_resp annotations: Preferred_unit: tag: Preferred_unit value: milligram per cubic meter per day, micromole oxygen per liter per hour storage_units: tag: storage_units value: mg/m3/d|umol/L/h description: Measurement of bacterial respiration in the water column title: bacterial respiration examples: - value: 300 umol/L/h from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000684 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true bacteria_carb_prod: name: bacteria_carb_prod annotations: storage_units: tag: storage_units value: ng/h description: Measurement of bacterial carbon production title: bacterial carbon production examples: - value: 50 ng/h from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - production slot_uri: MIXS:0000173 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true barometric_press: name: barometric_press annotations: Preferred_unit: tag: Preferred_unit value: millibar storage_units: tag: storage_units value: mbar description: Force per unit area exerted against a surface by the weight of air above that surface title: barometric pressure examples: - value: 1013 mbar from_schema: https://w3id.org/nmdc/nmdc keywords: - pressure slot_uri: MIXS:0000096 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true basin: name: basin description: Name of the basin (e.g. Campos) title: basin name examples: - value: Campos from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000290 range: TextValue bathroom_count: name: bathroom_count description: The number of bathrooms in the building title: bathroom count examples: - value: '1' from_schema: https://w3id.org/nmdc/nmdc keywords: - count slot_uri: MIXS:0000776 range: TextValue bedroom_count: name: bedroom_count description: The number of bedrooms in the building title: bedroom count examples: - value: '2' from_schema: https://w3id.org/nmdc/nmdc keywords: - count slot_uri: MIXS:0000777 range: TextValue benzene: name: benzene annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of benzene in the sample title: benzene from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000153 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true biochem_oxygen_dem: name: biochem_oxygen_dem annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: Amount of dissolved oxygen needed by aerobic biological organisms in a body of water to break down organic material present in a given water sample at certain temperature over a specific time period title: biochemical oxygen demand from_schema: https://w3id.org/nmdc/nmdc keywords: - oxygen slot_uri: MIXS:0000653 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true biocide: name: biocide annotations: Expected_value: tag: Expected_value value: name;name;timestamp description: List of biocides (commercial name of product and supplier) and date of administration title: biocide administration examples: - value: ALPHA 1427;Baker Hughes;2008-01-23 from_schema: https://w3id.org/nmdc/nmdc keywords: - administration string_serialization: '{text};{text};{timestamp}' slot_uri: MIXS:0001011 recommended: true biocide_admin_method: name: biocide_admin_method annotations: Expected_value: tag: Expected_value value: measurement value;frequency;duration;duration Preferred_unit: tag: Preferred_unit value: milligram per liter description: Method of biocide administration (dose, frequency, duration, time elapsed between last biociding and sampling) (e.g. 150 mg/l; weekly; 4 hr; 3 days) title: biocide administration method from_schema: https://w3id.org/nmdc/nmdc keywords: - administration - method string_serialization: '{float} {unit};{Rn/start_time/end_time/duration};{duration}' slot_uri: MIXS:0000456 range: string recommended: true biol_stat: name: biol_stat description: The level of genome modification title: biological status examples: - value: natural from_schema: https://w3id.org/nmdc/nmdc keywords: - status slot_uri: MIXS:0000858 range: BiolStatEnum biomass: name: biomass annotations: Expected_value: tag: Expected_value value: biomass type;measurement value Preferred_unit: tag: Preferred_unit value: ton, kilogram, gram description: Amount of biomass; should include the name for the part of biomass measured, e.g. Microbial, total. Can include multiple measurements title: biomass examples: - value: total;20 gram from_schema: https://w3id.org/nmdc/nmdc keywords: - biomass string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000174 range: TextValue multivalued: true inlined_as_list: true biotic_regm: name: biotic_regm description: Information about treatment(s) involving use of biotic factors, such as bacteria, viruses or fungi title: biotic regimen examples: - value: sample inoculated with Rhizobium spp. Culture from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen slot_uri: MIXS:0001038 range: TextValue multivalued: false biotic_relationship: name: biotic_relationship description: Description of relationship(s) between the subject organism and other organism(s) it is associated with. E.g., parasite on species X; mutualist with species Y. The target organism is the subject of the relationship, and the other organism(s) is the object title: observed biotic relationship examples: - value: free living from_schema: https://w3id.org/nmdc/nmdc keywords: - observed - relationship slot_uri: MIXS:0000028 range: BioticRelationshipEnum bishomohopanol: name: bishomohopanol annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, microgram per gram storage_units: tag: storage_units value: ug/L|ug/g description: Concentration of bishomohopanol title: bishomohopanol examples: - value: 14 ug/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000175 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true blood_press_diast: name: blood_press_diast annotations: Preferred_unit: tag: Preferred_unit value: millimeter mercury storage_units: tag: storage_units value: mm[Hg] description: Resting diastolic blood pressure, measured as mm mercury title: host blood pressure diastolic from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - pressure slot_uri: MIXS:0000258 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true blood_press_syst: name: blood_press_syst annotations: Preferred_unit: tag: Preferred_unit value: millimeter mercury storage_units: tag: storage_units value: mm[Hg] description: Resting systolic blood pressure, measured as mm mercury title: host blood pressure systolic from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - pressure slot_uri: MIXS:0000259 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true bromide: name: bromide annotations: Preferred_unit: tag: Preferred_unit value: parts per million storage_units: tag: storage_units value: '[ppm]' description: Concentration of bromide title: bromide examples: - value: 0.05 [ppm] from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000176 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true build_docs: name: build_docs description: The building design, construction and operation documents title: design, construction, and operation documents examples: - value: maintenance plans from_schema: https://w3id.org/nmdc/nmdc keywords: - documents slot_uri: MIXS:0000787 range: BuildDocsEnum build_occup_type: name: build_occup_type description: The primary function for which a building or discrete part of a building is intended to be used title: building occupancy type examples: - value: market from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000761 range: BuildOccupTypeEnum multivalued: true building_setting: name: building_setting description: A location (geography) where a building is set title: building setting examples: - value: rural from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000768 range: BuildingSettingEnum built_struc_age: name: built_struc_age annotations: Preferred_unit: tag: Preferred_unit value: year storage_units: tag: storage_units value: a description: The age of the built structure since construction title: built structure age examples: - value: 15 a from_schema: https://w3id.org/nmdc/nmdc keywords: - age slot_uri: MIXS:0000145 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true built_struc_set: name: built_struc_set description: The characterization of the location of the built structure as high or low human density title: built structure setting examples: - value: rural from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000778 range: BuiltStrucSetEnum built_struc_type: name: built_struc_type description: A physical structure that is a body or assemblage of bodies in space to form a system capable of supporting loads title: built structure type from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000721 range: TextValue calcium: name: calcium annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, micromole per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L|mg/kg' description: Concentration of calcium in the sample title: calcium examples: - value: 0.2 umol/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000432 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true carb_dioxide: name: carb_dioxide annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, parts per million storage_units: tag: storage_units value: '[ppm]|umol/L' description: Carbon dioxide (gas) amount or concentration at the time of sampling title: carbon dioxide examples: - value: 410 [ppm] from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon slot_uri: MIXS:0000097 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true carb_monoxide: name: carb_monoxide annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, parts per million storage_units: tag: storage_units value: '[ppm]|umol/L' description: Carbon monoxide (gas) amount or concentration at the time of sampling title: carbon monoxide examples: - value: 0.1 [ppm] from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon slot_uri: MIXS:0000098 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true carb_nitro_ratio: name: carb_nitro_ratio annotations: Expected_value: tag: Expected_value value: measurement value storage_units: tag: storage_units value: '1' description: Ratio of amount or concentrations of carbon to nitrogen title: carbon/nitrogen ratio examples: - value: '0.417361111' from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - nitrogen - ratio string_serialization: '{float}:{float}' slot_uri: MIXS:0000310 range: QuantityValue ceil_area: name: ceil_area annotations: Preferred_unit: tag: Preferred_unit value: square meter storage_units: tag: storage_units value: m2 description: The area of the ceiling space within the room title: ceiling area examples: - value: 25 m2 from_schema: https://w3id.org/nmdc/nmdc keywords: - area - ceiling slot_uri: MIXS:0000148 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true ceil_cond: name: ceil_cond description: The physical condition of the ceiling at the time of sampling; photos or video preferred; use drawings to indicate location of damaged areas title: ceiling condition examples: - value: damaged from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling - condition slot_uri: MIXS:0000779 range: DamagedEnum ceil_finish_mat: name: ceil_finish_mat description: The type of material used to finish a ceiling title: ceiling finish material examples: - value: stucco from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling - material slot_uri: MIXS:0000780 range: CeilFinishMatEnum ceil_struc: name: ceil_struc description: The construction format of the ceiling title: ceiling structure examples: - value: concrete from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling slot_uri: MIXS:0000782 range: CeilStrucEnum ceil_texture: name: ceil_texture description: The feel, appearance, or consistency of a ceiling surface title: ceiling texture examples: - value: popcorn from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling - texture slot_uri: MIXS:0000783 range: CeilingWallTextureEnum ceil_thermal_mass: name: ceil_thermal_mass annotations: Preferred_unit: tag: Preferred_unit value: joule per degree Celsius storage_units: tag: storage_units value: J/K description: The ability of the ceiling to provide inertia against temperature fluctuations. Generally this means concrete that is exposed. A metal deck that supports a concrete slab will act thermally as long as it is exposed to room air flow title: ceiling thermal mass from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling - mass slot_uri: MIXS:0000143 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true ceil_type: name: ceil_type description: The type of ceiling according to the ceiling's appearance or construction title: ceiling type examples: - value: coffered from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling - type slot_uri: MIXS:0000784 range: CeilTypeEnum ceil_water_mold: name: ceil_water_mold description: Signs of the presence of mold or mildew on the ceiling title: ceiling signs of water/mold examples: - value: presence of mold visible from_schema: https://w3id.org/nmdc/nmdc keywords: - ceiling slot_uri: MIXS:0000781 range: MoldVisibilityEnum chem_administration: name: chem_administration annotations: Expected_value: tag: Expected_value value: CHEBI;timestamp description: List of chemical compounds administered to the host or site where sampling occurred, and when (e.g. Antibiotics, n fertilizer, air filter); can include multiple compounds. For chemical entities of biological interest ontology (chebi) (v 163), http://purl.bioontology.org/ontology/chebi title: chemical administration examples: - value: agar [CHEBI:2509];2018-05-11T20:00Z from_schema: https://w3id.org/nmdc/nmdc keywords: - administration string_serialization: '{termLabel} [{termID}];{timestamp}' slot_uri: MIXS:0000751 range: ControlledTermValue multivalued: true inlined_as_list: true chem_mutagen: name: chem_mutagen annotations: Expected_value: tag: Expected_value value: mutagen name;mutagen amount;treatment interval and duration Preferred_unit: tag: Preferred_unit value: milligram per liter description: Treatment involving use of mutagens; should include the name of mutagen, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple mutagen regimens title: chemical mutagen examples: - value: nitrous acid;0.5 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000555 range: TextValue multivalued: true inlined_as_list: true chem_oxygen_dem: name: chem_oxygen_dem annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: A measure of the capacity of water to consume oxygen during the decomposition of organic matter and the oxidation of inorganic chemicals such as ammonia and nitrite title: chemical oxygen demand from_schema: https://w3id.org/nmdc/nmdc keywords: - oxygen slot_uri: MIXS:0000656 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true chem_treat_method: name: chem_treat_method annotations: Expected_value: tag: Expected_value value: measurement value;frequency;duration;duration Preferred_unit: tag: Preferred_unit value: milligram per liter description: Method of chemical administration(dose, frequency, duration, time elapsed between administration and sampling) (e.g. 50 mg/l; twice a week; 1 hr; 0 days) title: chemical treatment method from_schema: https://w3id.org/nmdc/nmdc keywords: - method - treatment string_serialization: '{float} {unit};{Rn/start_time/end_time/duration};{duration};{duration}' slot_uri: MIXS:0000457 range: string chem_treatment: name: chem_treatment annotations: Expected_value: tag: Expected_value value: name;name;timestamp description: List of chemical compounds administered upstream the sampling location where sampling occurred (e.g. Glycols, H2S scavenger, corrosion and scale inhibitors, demulsifiers, and other production chemicals etc.). The commercial name of the product and name of the supplier should be provided. The date of administration should also be included title: chemical treatment examples: - value: ACCENT 1125;DOW;2010-11-17 from_schema: https://w3id.org/nmdc/nmdc keywords: - treatment string_serialization: '{text};{text};{timestamp}' slot_uri: MIXS:0001012 chimera_check: name: chimera_check description: Tool(s) used for chimera checking, including version number and parameters, to discover and remove chimeric sequences. A chimeric sequence is comprised of two or more phylogenetically distinct parent sequences title: chimera check software examples: - value: uchime;v4.1;default parameters from_schema: https://w3id.org/nmdc/nmdc keywords: - software slot_uri: MIXS:0000052 range: TextValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+);([^\s-]{1,2}|[^\s-]+.+[^\s-]+);([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{software};{version};{parameters}$ interpolated: true partial_match: true chloride: name: chloride annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of chloride in the sample title: chloride examples: - value: 5000 mg/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000429 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true chlorophyll: name: chlorophyll annotations: Preferred_unit: tag: Preferred_unit value: milligram per cubic meter, microgram per liter storage_units: tag: storage_units value: mg/m3|ug/L description: Concentration of chlorophyll title: chlorophyll examples: - value: 5 mg/m3 from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000177 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true climate_environment: name: climate_environment description: Treatment involving an exposure to a particular climate; treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple climates title: climate environment deprecated: true, slot is inconsistently used and provides redundant information to other slots, https://github.com/GenomicsStandardsConsortium/mixs/issues/591 and https://github.com/microbiomedata/nmdc-schema/issues/586 examples: - value: tropical climate;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - environment slot_uri: MIXS:0001040 range: TextValue multivalued: true inlined_as_list: true collection_date: name: collection_date description: 'The time of sampling, either as an instance (single point in time) or interval. In case no exact time is available, the date/time can be right truncated i.e. all of these are valid times: 2008-01-23T19:23:10+00:00; 2008-01-23T19:23:10; 2008-01-23; 2008-01; 2008; Except: 2008-01; 2008 all are ISO8601 compliant' title: collection date examples: - value: '2013-03-25T12:42:31+01:00' from_schema: https://w3id.org/nmdc/nmdc keywords: - date slot_uri: MIXS:0000011 range: TimestampValue conduc: name: conduc annotations: Preferred_unit: tag: Preferred_unit value: milliSiemens per centimeter storage_units: tag: storage_units value: mS/cm|uS/cm description: Electrical conductivity of water title: conductivity examples: - value: 10 uS/cm from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000692 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true cool_syst_id: name: cool_syst_id description: The cooling system identifier title: cooling system identifier examples: - value: '12345' from_schema: https://w3id.org/nmdc/nmdc keywords: - identifier slot_uri: MIXS:0000785 range: TextValue crop_rotation: name: crop_rotation annotations: Expected_value: tag: Expected_value value: crop rotation status;schedule description: Whether or not crop is rotated, and if yes, rotation schedule title: history/crop rotation examples: - value: yes;R2/2017-01-01/2018-12-31/P6M from_schema: https://w3id.org/nmdc/nmdc keywords: - history slot_uri: MIXS:0000318 range: TextValue cult_root_med: name: cult_root_med description: Name or reference for the hydroponic or in vitro culture rooting medium; can be the name of a commonly used medium or reference to a specific medium, e.g. Murashige and Skoog medium. If the medium has not been formally published, use the rooting medium descriptors title: culture rooting medium examples: - value: http://himedialabs.com/TD/PT158.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - culture slot_uri: MIXS:0001041 range: TextValue pattern: ^(.*|PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({text}|{PMID}|{DOI}|{URL})$ interpolated: true cur_land_use: name: cur_land_use annotations: Expected_value: tag: Expected_value value: enumeration description: Present state of sample site title: current land use examples: - value: conifers from_schema: https://w3id.org/nmdc/nmdc keywords: - land - use string_serialization: '[cities|farmstead|industrial areas|roads/railroads|rock|sand|gravel|mudflats|salt flats|badlands|permanent snow or ice|saline seeps|mines/quarries|oil waste areas|small grains|row crops|vegetable crops|horticultural plants (e.g. tulips)|marshlands (grass,sedges,rushes)|tundra (mosses,lichens)|rangeland|pastureland (grasslands used for livestock grazing)|hayland|meadows (grasses,alfalfa,fescue,bromegrass,timothy)|shrub land (e.g. mesquite,sage-brush,creosote bush,shrub oak,eucalyptus)|successional shrub land (tree saplings,hazels,sumacs,chokecherry,shrub dogwoods,blackberries)|shrub crops (blueberries,nursery ornamentals,filberts)|vine crops (grapes)|conifers (e.g. pine,spruce,fir,cypress)|hardwoods (e.g. oak,hickory,elm,aspen)|intermixed hardwood and conifers|tropical (e.g. mangrove,palms)|rainforest (evergreen forest receiving >406 cm annual rainfall)|swamp (permanent or semi-permanent water body dominated by woody plants)|crop trees (nuts,fruit,christmas trees,nursery trees)]' slot_uri: MIXS:0001080 cur_vegetation: name: cur_vegetation annotations: Expected_value: tag: Expected_value value: current vegetation type description: Vegetation classification from one or more standard classification systems, or agricultural crop title: current vegetation from_schema: https://w3id.org/nmdc/nmdc keywords: - vegetation slot_uri: MIXS:0000312 range: TextValue cur_vegetation_meth: name: cur_vegetation_meth description: Reference or method used in vegetation classification title: current vegetation method from_schema: https://w3id.org/nmdc/nmdc keywords: - method - vegetation slot_uri: MIXS:0000314 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true date_last_rain: name: date_last_rain description: The date of the last time it rained title: date last rain examples: - value: '2013-03-25T12:42:31+01:00' from_schema: https://w3id.org/nmdc/nmdc keywords: - date - rain slot_uri: MIXS:0000786 range: TimestampValue density: name: density annotations: Preferred_unit: tag: Preferred_unit value: gram per cubic meter, gram per cubic centimeter storage_units: tag: storage_units value: g/cm3|g/m3|kg/m3 description: Density of the sample, which is its mass per unit volume (aka volumetric mass density) title: density examples: - value: 1000 kg/m3 from_schema: https://w3id.org/nmdc/nmdc keywords: - density slot_uri: MIXS:0000435 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true depos_env: name: depos_env description: Main depositional environment (https://en.wikipedia.org/wiki/Depositional_environment). If "other" is specified, please propose entry in "additional info" field title: depositional environment from_schema: https://w3id.org/nmdc/nmdc keywords: - environment slot_uri: MIXS:0000992 range: DeposEnvEnum recommended: true depth: name: depth annotations: Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: The vertical distance below local surface. For sediment or soil samples depth is measured from sediment or soil surface, respectively. Depth can be reported as an interval for subsurface samples title: depth examples: - value: 10 m from_schema: https://w3id.org/nmdc/nmdc keywords: - depth slot_uri: MIXS:0000018 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true dew_point: name: dew_point annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: The temperature to which a given parcel of humid air must be cooled, at constant barometric pressure, for water vapor to condense into water title: dew point examples: - value: 22 Cel from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000129 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diether_lipids: name: diether_lipids annotations: Expected_value: tag: Expected_value value: diether lipid name;measurement value Preferred_unit: tag: Preferred_unit value: nanogram per liter description: Concentration of diether lipids; can include multiple types of diether lipids title: diether lipids examples: - value: 0.2 nanogram per liter from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000178 range: TextValue multivalued: true inlined_as_list: true diss_carb_dioxide: name: diss_carb_dioxide annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter storage_units: tag: storage_units value: mg/L|umol/L description: Concentration of dissolved carbon dioxide in the sample or liquid portion of the sample title: dissolved carbon dioxide examples: - value: 5 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - dissolved slot_uri: MIXS:0000436 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_hydrogen: name: diss_hydrogen annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter storage_units: tag: storage_units value: umol/L description: Concentration of dissolved hydrogen title: dissolved hydrogen examples: - value: 0.3 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved slot_uri: MIXS:0000179 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_inorg_carb: name: diss_inorg_carb annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|ug/L|umol/kg' description: Dissolved inorganic carbon concentration in the sample, typically measured after filtering the sample using a 0.45 micrometer filter title: dissolved inorganic carbon examples: - value: 2059 umol/kg from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - dissolved - inorganic slot_uri: MIXS:0000434 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_inorg_nitro: name: diss_inorg_nitro annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, micromole per liter storage_units: tag: storage_units value: ug/L|umol/L|mg/L description: Concentration of dissolved inorganic nitrogen title: dissolved inorganic nitrogen examples: - value: 761 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved - inorganic - nitrogen slot_uri: MIXS:0000698 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_inorg_phosp: name: diss_inorg_phosp annotations: storage_units: tag: storage_units value: '[ppm]|mg/L|ug/L|umol/L' description: Concentration of dissolved inorganic phosphorus in the sample title: dissolved inorganic phosphorus examples: - value: 56.5 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved - inorganic - phosphorus slot_uri: MIXS:0000106 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_iron: name: diss_iron annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: Concentration of dissolved iron in the sample title: dissolved iron from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved slot_uri: MIXS:0000139 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_org_carb: name: diss_org_carb annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter storage_units: tag: storage_units value: mg/L|umol/L|ug/L description: Concentration of dissolved organic carbon in the sample, liquid portion of the sample, or aqueous phase of the fluid title: dissolved organic carbon examples: - value: 197 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - dissolved - organic slot_uri: MIXS:0000433 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_org_nitro: name: diss_org_nitro annotations: storage_units: tag: storage_units value: mg/L|ug/L description: Dissolved organic nitrogen concentration measured as; total dissolved nitrogen - NH4 - NO3 - NO2 title: dissolved organic nitrogen examples: - value: 0.05 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved - nitrogen - organic slot_uri: MIXS:0000162 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_oxygen: name: diss_oxygen annotations: Preferred_unit: tag: Preferred_unit value: micromole per kilogram, milligram per liter storage_units: tag: storage_units value: mg/L|umol/kg|umol/L description: Concentration of dissolved oxygen title: dissolved oxygen examples: - value: 175 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved - oxygen slot_uri: MIXS:0000119 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true diss_oxygen_fluid: name: diss_oxygen_fluid annotations: Preferred_unit: tag: Preferred_unit value: micromole per kilogram, milligram per liter storage_units: tag: storage_units value: mg/L|umol/kg description: Concentration of dissolved oxygen in the oil field produced fluids as it contributes to oxygen-corrosion and microbial activity (e.g. Mic) title: dissolved oxygen in fluids from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved - oxygen slot_uri: MIXS:0000438 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true door_comp_type: name: door_comp_type description: The composite type of the door title: door type, composite examples: - value: revolving from_schema: https://w3id.org/nmdc/nmdc keywords: - door - type slot_uri: MIXS:0000795 range: DoorCompTypeEnum door_cond: name: door_cond description: The physical condition of the door title: door condition examples: - value: new from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - door slot_uri: MIXS:0000788 range: DamagedRupturedEnum door_direct: name: door_direct description: The direction the door opens title: door direction of opening examples: - value: inward from_schema: https://w3id.org/nmdc/nmdc keywords: - direction - door slot_uri: MIXS:0000789 range: DoorDirectEnum door_loc: name: door_loc description: The relative location of the door in the room title: door location examples: - value: north from_schema: https://w3id.org/nmdc/nmdc keywords: - door - location slot_uri: MIXS:0000790 range: CompassDirections8Enum door_mat: name: door_mat description: The material the door is composed of title: door material examples: - value: wood from_schema: https://w3id.org/nmdc/nmdc keywords: - door - material slot_uri: MIXS:0000791 range: DoorMatEnum door_move: name: door_move description: The type of movement of the door title: door movement examples: - value: swinging from_schema: https://w3id.org/nmdc/nmdc keywords: - door slot_uri: MIXS:0000792 range: DoorMoveEnum door_size: name: door_size annotations: Preferred_unit: tag: Preferred_unit value: square meter storage_units: tag: storage_units value: m2 description: The size of the door title: door area or size examples: - value: 2.5 m2 from_schema: https://w3id.org/nmdc/nmdc keywords: - area - door - size slot_uri: MIXS:0000158 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true door_type: name: door_type description: The type of door material title: door type examples: - value: wooden from_schema: https://w3id.org/nmdc/nmdc keywords: - door - type slot_uri: MIXS:0000794 range: DoorTypeEnum door_type_metal: name: door_type_metal description: The type of metal door title: door type, metal examples: - value: hollow from_schema: https://w3id.org/nmdc/nmdc keywords: - door - type slot_uri: MIXS:0000796 range: DoorTypeMetalEnum door_type_wood: name: door_type_wood annotations: Expected_value: tag: Expected_value value: enumeration description: The type of wood door title: door type, wood examples: - value: battened from_schema: https://w3id.org/nmdc/nmdc keywords: - door - type string_serialization: '[bettened and ledged|battened|ledged and braced|battened|ledged and framed|battened|ledged, braced and frame|framed and paneled|glashed or sash|flush|louvered|wire gauged]' slot_uri: MIXS:0000797 door_water_mold: name: door_water_mold description: Signs of the presence of mold or mildew on a door title: door signs of water/mold examples: - value: presence of mold visible from_schema: https://w3id.org/nmdc/nmdc keywords: - door slot_uri: MIXS:0000793 range: MoldVisibilityEnum down_par: name: down_par annotations: Preferred_unit: tag: Preferred_unit value: microEinstein per square meter per second, microEinstein per square centimeter per second storage_units: tag: storage_units value: umol/m2/s description: Visible waveband radiance and irradiance measurements in the water column title: downward PAR examples: - value: 28.71 umol/m2/s from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000703 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true drainage_class: name: drainage_class description: Drainage classification from a standard system such as the USDA system title: drainage classification examples: - value: well from_schema: https://w3id.org/nmdc/nmdc keywords: - classification slot_uri: MIXS:0001085 range: DrainageClassEnum drawings: name: drawings description: The buildings architectural drawings; if design is chosen, indicate phase-conceptual, schematic, design development, and construction documents title: drawings examples: - value: sketch from_schema: https://w3id.org/nmdc/nmdc keywords: - drawings slot_uri: MIXS:0000798 range: DrawingsEnum efficiency_percent: name: efficiency_percent annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter units_alignment_excuse: tag: units_alignment_excuse value: mixs_inconsistent description: Percentage of volatile solids removed from the anaerobic digestor title: efficiency percent from_schema: https://w3id.org/nmdc/nmdc keywords: - percent slot_uri: MIXS:0000657 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true elev: name: elev annotations: Preferred_unit: tag: Preferred_unit value: meter description: Elevation of the sampling site is its height above a fixed reference point, most commonly the mean sea level. Elevation is mainly used when referring to points on the earth's surface, while altitude is used for points above the surface, such as an aircraft in flight or a spacecraft in orbit title: elevation examples: - value: 100 meter from_schema: https://w3id.org/nmdc/nmdc keywords: - elevation slot_uri: MIXS:0000093 range: float pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true elevator: name: elevator description: The number of elevators within the built structure title: elevator count examples: - value: '2' from_schema: https://w3id.org/nmdc/nmdc keywords: - count slot_uri: MIXS:0000799 range: TextValue emulsions: name: emulsions annotations: Expected_value: tag: Expected_value value: emulsion name;measurement value Preferred_unit: tag: Preferred_unit value: gram per liter description: Amount or concentration of substances such as paints, adhesives, mayonnaise, hair colorants, emulsified oils, etc.; can include multiple emulsion types title: emulsions from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000660 range: TextValue multivalued: true inlined_as_list: true env_broad_scale: name: env_broad_scale annotations: tooltip: tag: tooltip value: The biome or major environmental system where the sample or specimen originated. Choose values from subclasses of the 'biome' class [ENVO:00000428] in the Environment Ontology (ENVO). For host-associated or plant-associated samples, use terms from the UBERON or Plant Ontology to describe the broad anatomical or morphological context description: 'Report the major environmental system the sample or specimen came from. The system(s) identified should have a coarse spatial grain, to provide the general environmental context of where the sampling was done (e.g. in the desert or a rainforest). We recommend using subclasses of EnvO s biome class: http://purl.obolibrary.org/obo/ENVO_00000428. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS' title: broad-scale environmental context examples: - value: oceanic epipelagic zone biome [ENVO:01000035] from_schema: https://w3id.org/nmdc/nmdc keywords: - context - environmental is_a: mixs_env_triad_field slot_uri: MIXS:0000012 range: ControlledIdentifiedTermValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+) \[[a-zA-Z]{2,}:[a-zA-Z0-9]\d+\]$ structured_pattern: syntax: ^{termLabel} \[{termID}\]$ interpolated: true partial_match: true env_local_scale: name: env_local_scale annotations: Expected_value: tag: Expected_value value: Environmental entities having causal influences upon the entity at time of sampling tooltip: tag: tooltip value: The specific environmental entities or features near the sample or specimen that significantly influence its characteristics or composition. These entities are typically smaller in scale than the broad environmental context. Values for this field should be countable, material nouns and must be chosen from subclasses of BFO:0000040 (material entity) that appear in the Environment Ontology (ENVO). For host-associated or plant-associated samples, use terms from the UBERON or Plant Ontology to describe specific anatomical structures or plant parts. description: 'Report the entity or entities which are in the sample or specimen s local vicinity and which you believe have significant causal influences on your sample or specimen. We recommend using EnvO terms which are of smaller spatial grain than your entry for env_broad_scale. Terms, such as anatomical sites, from other OBO Library ontologies which interoperate with EnvO (e.g. UBERON) are accepted in this field. EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS' title: local environmental context examples: - value: litter layer [ENVO:01000338] from_schema: https://w3id.org/nmdc/nmdc keywords: - context - environmental is_a: mixs_env_triad_field slot_uri: MIXS:0000013 range: ControlledIdentifiedTermValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+) \[[a-zA-Z]{2,}:[a-zA-Z0-9]\d+\]$ structured_pattern: syntax: ^{termLabel} \[{termID}\]$ interpolated: true partial_match: true env_medium: name: env_medium annotations: tooltip: tag: tooltip value: The predominant environmental material or substrate that directly surrounds or hosts the sample or specimen at the time of sampling. Choose values from subclasses of the 'environmental material' class [ENVO:00010483] in the Environment Ontology (ENVO). Values for this field should be measurable or mass material nouns, representing continuous environmental materials. For host-associated or plant-associated samples, use terms from the UBERON or Plant Ontology to indicate a tissue, organ, or plant structure description: 'Report the environmental material(s) immediately surrounding the sample or specimen at the time of sampling. We recommend using subclasses of ''environmental material'' (http://purl.obolibrary.org/obo/ENVO_00010483). EnvO documentation about how to use the field: https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS . Terms from other OBO ontologies are permissible as long as they reference mass/volume nouns (e.g. air, water, blood) and not discrete, countable entities (e.g. a tree, a leaf, a table top)' title: environmental medium examples: - value: soil [ENVO:00001998] from_schema: https://w3id.org/nmdc/nmdc keywords: - environmental is_a: mixs_env_triad_field slot_uri: MIXS:0000014 range: ControlledIdentifiedTermValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+) \[[a-zA-Z]{2,}:[a-zA-Z0-9]\d+\]$ structured_pattern: syntax: ^{termLabel} \[{termID}\]$ interpolated: true partial_match: true escalator: name: escalator description: The number of escalators within the built structure title: escalator count examples: - value: '4' from_schema: https://w3id.org/nmdc/nmdc keywords: - count slot_uri: MIXS:0000800 range: TextValue ethylbenzene: name: ethylbenzene annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of ethylbenzene in the sample title: ethylbenzene from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000155 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true exp_duct: name: exp_duct annotations: Preferred_unit: tag: Preferred_unit value: square meter storage_units: tag: storage_units value: m2 description: The amount of exposed ductwork in the room title: exposed ductwork from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000144 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true exp_pipe: name: exp_pipe annotations: storage_units: tag: storage_units value: '1' description: The number of exposed pipes in the room title: exposed pipes from_schema: https://w3id.org/nmdc/nmdc keywords: - pipes slot_uri: MIXS:0000220 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true experimental_factor: name: experimental_factor annotations: Expected_value: tag: Expected_value value: text or EFO and/or OBI description: Variable aspects of an experiment design that can be used to describe an experiment, or set of experiments, in an increasingly detailed manner. This field accepts ontology terms from Experimental Factor Ontology (EFO) and/or Ontology for Biomedical Investigations (OBI) title: experimental factor examples: - value: time series design [EFO:0001779] from_schema: https://w3id.org/nmdc/nmdc keywords: - experimental - factor string_serialization: '{termLabel} [{termID}]|{text}' slot_uri: MIXS:0000008 range: ControlledTermValue multivalued: false pattern: ^\S+.*\S+ \[[a-zA-Z]{2,}:\d+\]$ ext_door: name: ext_door description: The number of exterior doors in the built structure title: exterior door count from_schema: https://w3id.org/nmdc/nmdc keywords: - count - door - exterior slot_uri: MIXS:0000170 range: TextValue ext_wall_orient: name: ext_wall_orient description: The orientation of the exterior wall title: orientations of exterior wall examples: - value: northwest from_schema: https://w3id.org/nmdc/nmdc keywords: - exterior - wall slot_uri: MIXS:0000817 range: CompassDirections8Enum ext_window_orient: name: ext_window_orient description: The compass direction the exterior window of the room is facing title: orientations of exterior window examples: - value: southwest from_schema: https://w3id.org/nmdc/nmdc keywords: - exterior - window slot_uri: MIXS:0000818 range: CompassDirections8Enum extreme_event: name: extreme_event description: Unusual physical events that may have affected microbial populations title: history/extreme events from_schema: https://w3id.org/nmdc/nmdc keywords: - event - history slot_uri: MIXS:0000320 range: string fao_class: name: fao_class description: Soil classification from the FAO World soil distribution from International Soil Reference and Information Centre (ISRIC). The list of available soil classifications can be found at https://www.isric.org/explore/world-soil-distribution title: soil_taxonomic/FAO classification examples: - value: Luvisols from_schema: https://w3id.org/nmdc/nmdc keywords: - classification slot_uri: MIXS:0001083 range: FaoClassEnum fertilizer_regm: name: fertilizer_regm annotations: Expected_value: tag: Expected_value value: fertilizer name;fertilizer amount;treatment interval and duration Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving the use of fertilizers; should include the name of fertilizer, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple fertilizer regimens title: fertilizer regimen examples: - value: urea;0.6 milligram per liter;R2/2018-05-11:T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen string_serialization: '{text};{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000556 range: TextValue multivalued: true inlined_as_list: true field: name: field description: Name of the hydrocarbon field (e.g. Albacora) title: field name from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000291 range: TextValue recommended: true filter_type: name: filter_type description: A device which removes solid particulates or airborne molecular contaminants title: filter type examples: - value: HEPA from_schema: https://w3id.org/nmdc/nmdc keywords: - filter - type slot_uri: MIXS:0000765 range: FilterTypeEnum multivalued: true fire: name: fire description: Historical and/or physical evidence of fire title: history/fire from_schema: https://w3id.org/nmdc/nmdc keywords: - history slot_uri: MIXS:0001086 range: string fireplace_type: name: fireplace_type description: A firebox with chimney title: fireplace type examples: - value: wood burning from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000802 range: FireplaceTypeEnum flooding: name: flooding description: Historical and/or physical evidence of flooding title: history/flooding from_schema: https://w3id.org/nmdc/nmdc keywords: - history slot_uri: MIXS:0000319 range: string floor_age: name: floor_age annotations: Preferred_unit: tag: Preferred_unit value: years, weeks, days storage_units: tag: storage_units value: a|d|wk description: The time period since installment of the carpet or flooring title: floor age from_schema: https://w3id.org/nmdc/nmdc keywords: - age - floor slot_uri: MIXS:0000164 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true floor_area: name: floor_area annotations: Preferred_unit: tag: Preferred_unit value: square meter storage_units: tag: storage_units value: m2 description: The area of the floor space within the room title: floor area from_schema: https://w3id.org/nmdc/nmdc keywords: - area - floor slot_uri: MIXS:0000165 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true floor_cond: name: floor_cond description: The physical condition of the floor at the time of sampling; photos or video preferred; use drawings to indicate location of damaged areas title: floor condition examples: - value: new from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - floor slot_uri: MIXS:0000803 range: DamagedEnum floor_count: name: floor_count description: The number of floors in the building, including basements and mechanical penthouse title: floor count from_schema: https://w3id.org/nmdc/nmdc keywords: - count - floor slot_uri: MIXS:0000225 range: TextValue floor_finish_mat: name: floor_finish_mat annotations: Expected_value: tag: Expected_value value: enumeration description: The floor covering type; the finished surface that is walked on title: floor finish material examples: - value: carpet from_schema: https://w3id.org/nmdc/nmdc keywords: - floor - material string_serialization: '[tile|wood strip or parquet|carpet|rug|laminate wood|lineoleum|vinyl composition tile|sheet vinyl|stone|bamboo|cork|terrazo|concrete|none;specify unfinished|sealed|clear finish|paint]' slot_uri: MIXS:0000804 floor_struc: name: floor_struc description: Refers to the structural elements and subfloor upon which the finish flooring is installed title: floor structure examples: - value: concrete from_schema: https://w3id.org/nmdc/nmdc keywords: - floor slot_uri: MIXS:0000806 range: FloorStrucEnum floor_thermal_mass: name: floor_thermal_mass annotations: Preferred_unit: tag: Preferred_unit value: joule per degree Celsius storage_units: tag: storage_units value: J/K description: The ability of the floor to provide inertia against temperature fluctuations title: floor thermal mass from_schema: https://w3id.org/nmdc/nmdc keywords: - floor - mass slot_uri: MIXS:0000166 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true floor_water_mold: name: floor_water_mold description: Signs of the presence of mold or mildew in a room title: floor signs of water/mold examples: - value: ceiling discoloration from_schema: https://w3id.org/nmdc/nmdc keywords: - floor slot_uri: MIXS:0000805 range: FloorWaterMoldEnum fluor: name: fluor annotations: Preferred_unit: tag: Preferred_unit value: milligram chlorophyll a per cubic meter, volts storage_units: tag: storage_units value: mg/m3|V description: Raw or converted fluorescence of water title: fluorescence examples: - value: 2.5 V from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000704 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true freq_clean: name: freq_clean annotations: storage_units: tag: storage_units value: 1/d description: The number of times the sample location is cleaned per day. title: frequency of cleaning examples: - value: 2 1/d from_schema: https://w3id.org/nmdc/nmdc keywords: - frequency slot_uri: MIXS:0000226 range: QuantityValue freq_cook: name: freq_cook annotations: storage_units: tag: storage_units value: 1/d description: The number of times a meal is cooked per week title: frequency of cooking from_schema: https://w3id.org/nmdc/nmdc keywords: - frequency slot_uri: MIXS:0000227 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true fungicide_regm: name: fungicide_regm annotations: Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving use of fungicides; should include the name of fungicide, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple fungicide regimens title: fungicide regimen examples: - value: bifonazole;1 mole per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen slot_uri: MIXS:0000557 range: TextValue multivalued: true inlined_as_list: true furniture: name: furniture description: The types of furniture present in the sampled room title: furniture examples: - value: chair from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000807 range: FurnitureEnum gaseous_environment: name: gaseous_environment annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter description: Use of conditions with differing gaseous environments; should include the name of gaseous compound, amount administered, treatment duration, interval and total experimental duration; can include multiple gaseous environment regimens title: gaseous environment examples: - value: nitric oxide;0.5 micromole per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - environment slot_uri: MIXS:0000558 range: TextValue multivalued: true inlined_as_list: true gaseous_substances: name: gaseous_substances annotations: Expected_value: tag: Expected_value value: gaseous substance name;measurement value Preferred_unit: tag: Preferred_unit value: micromole per liter description: Amount or concentration of substances such as hydrogen sulfide, carbon dioxide, methane, etc.; can include multiple substances title: gaseous substances from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000661 range: TextValue multivalued: true inlined_as_list: true gender_restroom: name: gender_restroom description: The gender type of the restroom title: gender of restroom examples: - value: male from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000808 range: GenderRestroomEnum genetic_mod: name: genetic_mod description: Genetic modifications of the genome of an organism, which may occur naturally by spontaneous mutation, or be introduced by some experimental means, e.g. specification of a transgene or the gene knocked-out or details of transient transfection title: genetic modification examples: - value: PMID:19497774 from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000859 pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true geo_loc_name: name: geo_loc_name description: The geographical origin of the sample as defined by the country or sea name followed by specific region name. Country or sea names should be chosen from the INSDC country list (http://insdc.org/country.html), or the GAZ ontology (http://purl.bioontology.org/ontology/GAZ) title: geographic location (country and/or sea,region) examples: - value: 'USA: Maryland, Bethesda' from_schema: https://w3id.org/nmdc/nmdc keywords: - geographic - location slot_uri: MIXS:0000010 range: TextValue pattern: '^([^\s-]{1,2}|[^\s-]+.+[^\s-]+): ([^\s-]{1,2}|[^\s-]+.+[^\s-]+), ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$' structured_pattern: syntax: '^{country}: {region}, {specific_location}$' interpolated: true partial_match: true glucosidase_act: name: glucosidase_act annotations: Preferred_unit: tag: Preferred_unit value: mol per liter per hour storage_units: tag: storage_units value: mol/L/h description: Measurement of glucosidase activity title: glucosidase activity examples: - value: 5 mol/L/h from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000137 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true gravidity: name: gravidity description: Whether or not subject is gravid, and if yes date due or date post-conception, specifying which is used title: gravidity examples: - value: yes;due date:2018-05-11 from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{boolean};{timestamp}' slot_uri: MIXS:0000875 range: TextValue gravity: name: gravity annotations: Expected_value: tag: Expected_value value: gravity factor value;treatment interval and duration Preferred_unit: tag: Preferred_unit value: meter per square second, g description: Information about treatment involving use of gravity factor to study various types of responses in presence, absence or modified levels of gravity; treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple treatments title: gravity examples: - value: 12 g;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000559 range: TextValue multivalued: true inlined_as_list: true growth_facil: name: growth_facil annotations: Expected_value: tag: Expected_value value: free text or CO description: 'Type of facility where the sampled plant was grown; controlled vocabulary: growth chamber, open top chamber, glasshouse, experimental garden, field. Alternatively use Crop Ontology (CO) terms, see https://cropontology.org/.' title: growth facility examples: - value: Growth chamber [CO_715:0000189] from_schema: https://w3id.org/nmdc/nmdc keywords: - facility - growth string_serialization: '{text}|{termLabel} [{termID}]' slot_uri: MIXS:0001043 range: ControlledTermValue growth_habit: name: growth_habit description: Characteristic shape, appearance or growth form of a plant species title: growth habit examples: - value: spreading from_schema: https://w3id.org/nmdc/nmdc keywords: - growth slot_uri: MIXS:0001044 range: GrowthHabitEnum growth_hormone_regm: name: growth_hormone_regm annotations: Expected_value: tag: Expected_value value: growth hormone name;growth hormone amount;treatment interval and duration Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving use of growth hormones; should include the name of growth hormone, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple growth hormone regimens title: growth hormone regimen examples: - value: abscisic acid;0.5 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - growth - regimen string_serialization: '{text};{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000560 range: TextValue multivalued: true inlined_as_list: true hall_count: name: hall_count description: The total count of hallways and corridors in the built structure title: hallway/corridor count from_schema: https://w3id.org/nmdc/nmdc keywords: - corridor - count - hallway slot_uri: MIXS:0000228 range: TextValue handidness: name: handidness description: The handidness of the individual sampled title: handidness examples: - value: right handedness from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000809 range: HandidnessEnum hc_produced: name: hc_produced description: Main hydrocarbon type produced from resource (i.e. Oil, gas, condensate, etc). If "other" is specified, please propose entry in "additional info" field title: hydrocarbon type produced examples: - value: Gas from_schema: https://w3id.org/nmdc/nmdc keywords: - hydrocarbon - type slot_uri: MIXS:0000989 range: HcProducedEnum hcr: name: hcr description: Main Hydrocarbon Resource type. The term "Hydrocarbon Resource" HCR defined as a natural environmental feature containing large amounts of hydrocarbons at high concentrations potentially suitable for commercial exploitation. This term should not be confused with the Hydrocarbon Occurrence term which also includes hydrocarbon-rich environments with currently limited commercial interest such as seeps, outcrops, gas hydrates etc. If "other" is specified, please propose entry in "additional info" field title: hydrocarbon resource type examples: - value: Oil Sand from_schema: https://w3id.org/nmdc/nmdc keywords: - hydrocarbon - resource - type slot_uri: MIXS:0000988 range: HcrEnum hcr_fw_salinity: name: hcr_fw_salinity annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: Original formation water salinity (prior to secondary recovery e.g. Waterflooding) expressed as TDS title: formation water salinity from_schema: https://w3id.org/nmdc/nmdc keywords: - salinity - water slot_uri: MIXS:0000406 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true hcr_geol_age: name: hcr_geol_age description: 'Geological age of hydrocarbon resource (Additional info: https://en.wikipedia.org/wiki/Period_(geology)). If "other" is specified, please propose entry in "additional info" field' title: hydrocarbon resource geological age examples: - value: Silurian from_schema: https://w3id.org/nmdc/nmdc keywords: - age - hydrocarbon - resource slot_uri: MIXS:0000993 range: GeolAgeEnum recommended: true hcr_pressure: name: hcr_pressure annotations: Preferred_unit: tag: Preferred_unit value: atmosphere, kilopascal description: Original pressure of the hydrocarbon resource title: hydrocarbon resource original pressure from_schema: https://w3id.org/nmdc/nmdc keywords: - hydrocarbon - pressure - resource slot_uri: MIXS:0000395 range: TextValue pattern: ^[-+]?[0-9]*\.?[0-9]+ *- *[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{float} *- *{float} {unit}$ interpolated: true partial_match: true hcr_temp: name: hcr_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius description: Original temperature of the hydrocarbon resource title: hydrocarbon resource original temperature examples: - value: 150-295 degree Celsius from_schema: https://w3id.org/nmdc/nmdc keywords: - hydrocarbon - resource - temperature slot_uri: MIXS:0000393 range: TextValue pattern: ^[-+]?[0-9]*\.?[0-9]+ *- *[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{float} *- *{float} {unit}$ interpolated: true partial_match: true heat_cool_type: name: heat_cool_type description: Methods of conditioning or heating a room or building title: heating and cooling system type examples: - value: heat pump from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000766 range: HeatCoolTypeEnum multivalued: true heat_deliv_loc: name: heat_deliv_loc description: The location of heat delivery within the room title: heating delivery locations examples: - value: north from_schema: https://w3id.org/nmdc/nmdc keywords: - delivery - location - locations slot_uri: MIXS:0000810 range: CompassDirections8Enum heat_sys_deliv_meth: name: heat_sys_deliv_meth description: The method by which the heat is delivered through the system title: heating system delivery method examples: - value: radiant from_schema: https://w3id.org/nmdc/nmdc keywords: - delivery - method slot_uri: MIXS:0000812 range: string heat_system_id: name: heat_system_id description: The heating system identifier title: heating system identifier from_schema: https://w3id.org/nmdc/nmdc keywords: - identifier slot_uri: MIXS:0000833 range: TextValue heavy_metals: name: heavy_metals annotations: Expected_value: tag: Expected_value value: heavy metal name;measurement value unit Preferred_unit: tag: Preferred_unit value: microgram per gram description: Heavy metals present in the sequenced sample and their concentrations. For multiple heavy metals and concentrations, add multiple copies of this field title: extreme_unusual_properties/heavy metals examples: - value: mercury;0.09 micrograms per gram from_schema: https://w3id.org/nmdc/nmdc keywords: - extreme - properties - unusual string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000652 range: TextValue multivalued: true inlined_as_list: true heavy_metals_meth: name: heavy_metals_meth description: Reference or method used in determining heavy metals title: extreme_unusual_properties/heavy metals method from_schema: https://w3id.org/nmdc/nmdc keywords: - extreme - method - properties - unusual slot_uri: MIXS:0000343 range: string inlined_as_list: true pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true height_carper_fiber: name: height_carper_fiber annotations: Preferred_unit: tag: Preferred_unit value: centimeter storage_units: tag: storage_units value: cm description: The average carpet fiber height in the indoor environment title: height carpet fiber mat from_schema: https://w3id.org/nmdc/nmdc keywords: - height slot_uri: MIXS:0000167 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true herbicide_regm: name: herbicide_regm annotations: Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving use of herbicides; information about treatment involving use of growth hormones; should include the name of herbicide, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens title: herbicide regimen examples: - value: atrazine;10 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen slot_uri: MIXS:0000561 range: TextValue multivalued: true inlined_as_list: true horizon_meth: name: horizon_meth description: Reference or method used in determining the horizon title: horizon method from_schema: https://w3id.org/nmdc/nmdc keywords: - horizon - method slot_uri: MIXS:0000321 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true host_age: name: host_age annotations: Preferred_unit: tag: Preferred_unit value: year, day, hour storage_units: tag: storage_units value: a|d|h description: Age of host at the time of sampling; relevant scale depends on species and study, e.g. Could be seconds for amoebae or centuries for trees title: host age examples: - value: 10 d from_schema: https://w3id.org/nmdc/nmdc keywords: - age - host - host. slot_uri: MIXS:0000255 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true host_body_habitat: name: host_body_habitat description: Original body habitat where the sample was obtained from title: host body habitat from_schema: https://w3id.org/nmdc/nmdc keywords: - body - habitat - host - host. slot_uri: MIXS:0000866 range: TextValue host_body_product: name: host_body_product annotations: Expected_value: tag: Expected_value value: FMA or UBERON description: Substance produced by the body, e.g. Stool, mucus, where the sample was obtained from. Use terms from the foundational model of anatomy ontology (fma) or Uber-anatomy ontology (UBERON) title: host body product examples: - value: mucus [UBERON:0000912] from_schema: https://w3id.org/nmdc/nmdc keywords: - body - host - host. - product string_serialization: '{termLabel} [{termID}]' slot_uri: MIXS:0000888 range: ControlledTermValue host_body_site: name: host_body_site annotations: Expected_value: tag: Expected_value value: FMA or UBERON description: Name of body site where the sample was obtained from, such as a specific organ or tissue (tongue, lung etc...). Use terms from the foundational model of anatomy ontology (fma) or the Uber-anatomy ontology (UBERON) title: host body site from_schema: https://w3id.org/nmdc/nmdc keywords: - body - host - site string_serialization: '{termLabel} [{termID}]' slot_uri: MIXS:0000867 range: ControlledTermValue host_body_temp: name: host_body_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Core body temperature of the host when sample was collected title: host body temperature examples: - value: 15 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - body - host - host. - temperature slot_uri: MIXS:0000274 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true host_color: name: host_color description: The color of host title: host color from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. slot_uri: MIXS:0000260 range: TextValue host_common_name: name: host_common_name annotations: Preferred_unit: tag: Preferred_unit value: '' description: Common name of the host title: host common name from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. slot_uri: MIXS:0000248 range: TextValue host_diet: name: host_diet description: Type of diet depending on the host, for animals omnivore, herbivore etc., for humans high-fat, meditteranean etc.; can include multiple diet types title: host diet from_schema: https://w3id.org/nmdc/nmdc keywords: - diet - host - host. slot_uri: MIXS:0000869 range: TextValue multivalued: true inlined_as_list: true host_disease_stat: name: host_disease_stat annotations: Expected_value: tag: Expected_value value: disease name or Disease Ontology term description: List of diseases with which the host has been diagnosed; can include multiple diagnoses. The value of the field depends on host; for humans the terms should be chosen from the DO (Human Disease Ontology) at https://www.disease-ontology.org, non-human host diseases are free text title: host disease status from_schema: https://w3id.org/nmdc/nmdc keywords: - disease - host - host. - status string_serialization: '{termLabel} [{termID}]|{text}' slot_uri: MIXS:0000031 host_dry_mass: name: host_dry_mass annotations: Preferred_unit: tag: Preferred_unit value: kilogram, gram storage_units: tag: storage_units value: g|kg description: Measurement of dry mass title: host dry mass examples: - value: 500 g from_schema: https://w3id.org/nmdc/nmdc keywords: - dry - host - host. - mass slot_uri: MIXS:0000257 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true host_genotype: name: host_genotype description: Observed genotype title: host genotype from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. slot_uri: MIXS:0000365 range: TextValue host_growth_cond: name: host_growth_cond description: Literature reference giving growth conditions of the host title: host growth conditions examples: - value: https://academic.oup.com/icesjms/article/68/2/349/617247 from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - growth - host - host. slot_uri: MIXS:0000871 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*)|.*)$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL}|{text})$ interpolated: true partial_match: true host_height: name: host_height annotations: Preferred_unit: tag: Preferred_unit value: centimeter, millimeter, meter storage_units: tag: storage_units value: cm|m|mm description: The height of subject title: host height examples: - value: 0.1 m from_schema: https://w3id.org/nmdc/nmdc keywords: - height - host - host. slot_uri: MIXS:0000264 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true host_last_meal: name: host_last_meal annotations: Expected_value: tag: Expected_value value: content;duration description: Content of last meal and time since feeding; can include multiple values title: host last meal from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. string_serialization: '{text};{duration}' slot_uri: MIXS:0000870 multivalued: true inlined_as_list: true host_length: name: host_length annotations: Preferred_unit: tag: Preferred_unit value: centimeter, millimeter, meter storage_units: tag: storage_units value: cm|m|mm description: The length of subject title: host length examples: - value: 1 m from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - length slot_uri: MIXS:0000256 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true host_life_stage: name: host_life_stage annotations: Expected_value: tag: Expected_value value: stage description: Description of life stage of host title: host life stage from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - life slot_uri: MIXS:0000251 range: TextValue host_phenotype: name: host_phenotype annotations: Expected_value: tag: Expected_value value: PATO or HP description: Phenotype of human or other host. Use terms from the phenotypic quality ontology (pato) or the Human Phenotype Ontology (HP) title: host phenotype from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. string_serialization: '{termLabel} [{termID}]' slot_uri: MIXS:0000874 range: ControlledTermValue host_sex: name: host_sex annotations: Expected_value: tag: Expected_value value: enumeration description: Gender or physical sex of the host title: host sex comments: - example of non-binary from Excel sheets does not match any of the enumerated values from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. string_serialization: '[female|hermaphrodite|non-binary|male|transgender|transgender (female to male)|transgender (male to female) |undeclared]' slot_uri: MIXS:0000811 host_shape: name: host_shape description: Morphological shape of host title: host shape examples: - value: round from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. slot_uri: MIXS:0000261 range: TextValue host_subject_id: name: host_subject_id description: A unique identifier by which each subject can be referred to, de-identified title: host subject id from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - identifier slot_uri: MIXS:0000861 range: TextValue host_subspecf_genlin: name: host_subspecf_genlin annotations: Expected_value: tag: Expected_value value: Genetic lineage below lowest rank of NCBI taxonomy, which is subspecies, e.g. serovar, biotype, ecotype, variety, cultivar description: Information about the genetic distinctness of the host organism below the subspecies level e.g., serovar, serotype, biotype, ecotype, variety, cultivar, or any relevant genetic typing schemes like Group I plasmid. Subspecies should not be recorded in this term, but in the NCBI taxonomy. Supply both the lineage name and the lineage rank separated by a colon, e.g., biovar:abc123 title: host subspecific genetic lineage examples: - value: 'serovar:Newport, variety:glabrum, cultivar: Red Delicious' from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - lineage string_serialization: '{rank name}:{text}' slot_uri: MIXS:0001318 range: string multivalued: true host_substrate: name: host_substrate description: The growth substrate of the host title: host substrate examples: - value: rock from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. slot_uri: MIXS:0000252 range: TextValue host_symbiont: name: host_symbiont annotations: Expected_value: tag: Expected_value value: species name or common name description: The taxonomic name of the organism(s) found living in mutualistic, commensalistic, or parasitic symbiosis with the specific host. The sampled symbiont can have its own symbionts. For example, parasites may have hyperparasites (=parasites of the parasite) title: observed host symbionts from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - observed - symbiosis slot_uri: MIXS:0001298 range: string multivalued: true host_taxid: name: host_taxid annotations: Expected_value: tag: Expected_value value: NCBI taxon identifier description: NCBI taxon id of the host, e.g. 9606 title: host taxid comments: - Homo sapiens [NCBITaxon:9606] would be a reasonable has_raw_value from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: Host NCBI Taxonomy ID predicate: EXACT_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ keywords: - host - host. - taxon slot_uri: MIXS:0000250 range: ControlledIdentifiedTermValue host_tot_mass: name: host_tot_mass annotations: Preferred_unit: tag: Preferred_unit value: kilogram, gram storage_units: tag: storage_units value: g|kg description: Total mass of the host at collection, the unit depends on host title: host total mass examples: - value: 2500 g from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - mass - total slot_uri: MIXS:0000263 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true host_wet_mass: name: host_wet_mass annotations: Preferred_unit: tag: Preferred_unit value: kilogram, gram storage_units: tag: storage_units value: g|kg description: Measurement of wet mass title: host wet mass examples: - value: 1500 g from_schema: https://w3id.org/nmdc/nmdc keywords: - host - host. - mass - wet slot_uri: MIXS:0000567 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true humidity: name: humidity annotations: storage_units: tag: storage_units value: g/m3|% description: Amount of water vapour in the air, at the time of sampling title: humidity examples: - value: 25 g/m3 from_schema: https://w3id.org/nmdc/nmdc keywords: - humidity slot_uri: MIXS:0000100 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true humidity_regm: name: humidity_regm annotations: Expected_value: tag: Expected_value value: humidity value;treatment interval and duration Preferred_unit: tag: Preferred_unit value: gram per cubic meter description: Information about treatment involving an exposure to varying degree of humidity; information about treatment involving use of growth hormones; should include amount of humidity administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens title: humidity regimen examples: - value: 25 gram per cubic meter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - humidity - regimen string_serialization: '{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000568 range: TextValue multivalued: true inlined_as_list: true indoor_space: name: indoor_space description: A distinguishable space within a structure, the purpose for which discrete areas of a building is used title: indoor space examples: - value: foyer from_schema: https://w3id.org/nmdc/nmdc keywords: - indoor slot_uri: MIXS:0000763 range: IndoorSpaceEnum indoor_surf: name: indoor_surf description: Type of indoor surface title: indoor surface examples: - value: wall from_schema: https://w3id.org/nmdc/nmdc keywords: - indoor - surface slot_uri: MIXS:0000764 range: IndoorSurfEnum indust_eff_percent: name: indust_eff_percent annotations: Preferred_unit: tag: Preferred_unit value: percentage storage_units: tag: storage_units value: '%' description: Percentage of industrial effluents received by wastewater treatment plant title: industrial effluent percent from_schema: https://w3id.org/nmdc/nmdc keywords: - percent slot_uri: MIXS:0000662 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true inorg_particles: name: inorg_particles annotations: Expected_value: tag: Expected_value value: inorganic particle name;measurement value Preferred_unit: tag: Preferred_unit value: mole per liter, milligram per liter description: Concentration of particles such as sand, grit, metal particles, ceramics, etc.; can include multiple particles title: inorganic particles from_schema: https://w3id.org/nmdc/nmdc keywords: - inorganic - particle string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000664 range: TextValue multivalued: true inlined_as_list: true inside_lux: name: inside_lux annotations: Preferred_unit: tag: Preferred_unit value: kilowatt per square metre units_alignment_excuse: tag: units_alignment_excuse value: mixs_inconsistent description: The recorded value at sampling time (power density) title: inside lux light from_schema: https://w3id.org/nmdc/nmdc keywords: - inside - light slot_uri: MIXS:0000168 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true int_wall_cond: name: int_wall_cond description: The physical condition of the wall at the time of sampling; photos or video preferred; use drawings to indicate location of damaged areas title: interior wall condition examples: - value: damaged from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - interior - wall slot_uri: MIXS:0000813 range: DamagedEnum iw_bt_date_well: name: iw_bt_date_well description: Injection water breakthrough date per well following a secondary and/or tertiary recovery title: injection water breakthrough date of specific well examples: - value: '2013-03-25T12:42:31+01:00' from_schema: https://w3id.org/nmdc/nmdc keywords: - date - water slot_uri: MIXS:0001010 range: TimestampValue iwf: name: iwf annotations: Preferred_unit: tag: Preferred_unit value: percent storage_units: tag: storage_units value: '%' description: Proportion of the produced fluids derived from injected water at the time of sampling. (e.g. 87%) title: injection water fraction comments: - percent or float? examples: - value: '0.79' from_schema: https://w3id.org/nmdc/nmdc keywords: - fraction - water slot_uri: MIXS:0000455 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true last_clean: name: last_clean description: The last time the floor was cleaned (swept, mopped, vacuumed) title: last time swept/mopped/vacuumed examples: - value: '2013-03-25T12:42:31+01:00' from_schema: https://w3id.org/nmdc/nmdc keywords: - time slot_uri: MIXS:0000814 range: TimestampValue lat_lon: name: lat_lon description: The geographical origin of the sample as defined by latitude and longitude. The values should be reported in decimal degrees, limited to 8 decimal points, and in WGS84 system title: geographic location (latitude and longitude) examples: - value: 50.586825 6.408977 from_schema: https://w3id.org/nmdc/nmdc keywords: - geographic - location slot_uri: MIXS:0000009 range: GeolocationValue pattern: ^(-?((?:[0-8]?[0-9](?:\.\d{0,8})?)|90)) -?[0-9]+(?:\.[0-9]{0,8})?$|^-?(1[0-7]{1,2})$ structured_pattern: syntax: ^{lat} {lon}$ interpolated: true partial_match: true light_intensity: name: light_intensity annotations: Preferred_unit: tag: Preferred_unit value: lux storage_units: tag: storage_units value: lx description: Measurement of light intensity title: light intensity examples: - value: 0.3 lx from_schema: https://w3id.org/nmdc/nmdc keywords: - intensity - light slot_uri: MIXS:0000706 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true light_regm: name: light_regm annotations: Expected_value: tag: Expected_value value: exposure type;light intensity;light quality Preferred_unit: tag: Preferred_unit value: lux; micrometer, nanometer, angstrom description: Information about treatment(s) involving exposure to light, including both light intensity and quality title: light regimen examples: - value: incandescant light;10 lux;450 nanometer from_schema: https://w3id.org/nmdc/nmdc keywords: - light - regimen string_serialization: '{text};{float} {unit};{float} {unit}' slot_uri: MIXS:0000569 range: TextValue light_type: name: light_type description: Application of light to achieve some practical or aesthetic effect. Lighting includes the use of both artificial light sources such as lamps and light fixtures, as well as natural illumination by capturing daylight. Can also include absence of light title: light type examples: - value: desk lamp from_schema: https://w3id.org/nmdc/nmdc keywords: - light - type slot_uri: MIXS:0000769 range: LightTypeEnum multivalued: true link_addit_analys: name: link_addit_analys description: Link to additional analysis results performed on the sample title: links to additional analysis from_schema: https://w3id.org/nmdc/nmdc keywords: - link slot_uri: MIXS:0000340 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true link_class_info: name: link_class_info annotations: Expected_value: tag: Expected_value value: PMID,DOI or url description: Link to digitized soil maps or other soil classification information title: link to classification information from_schema: https://w3id.org/nmdc/nmdc keywords: - classification - information - link string_serialization: '{termLabel} [{termID}]' slot_uri: MIXS:0000329 link_climate_info: name: link_climate_info description: Link to climate resource title: link to climate information from_schema: https://w3id.org/nmdc/nmdc keywords: - information - link slot_uri: MIXS:0000328 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true lithology: name: lithology description: 'Hydrocarbon resource main lithology (Additional information: http://petrowiki.org/Lithology_and_rock_type_determination). If "other" is specified, please propose entry in "additional info" field' title: lithology examples: - value: Volcanic from_schema: https://w3id.org/nmdc/nmdc keywords: - lithology slot_uri: MIXS:0000990 range: LithologyEnum recommended: true local_class: name: local_class annotations: Expected_value: tag: Expected_value value: local classification name description: Soil classification based on local soil classification system title: soil_taxonomic/local classification from_schema: https://w3id.org/nmdc/nmdc keywords: - classification slot_uri: MIXS:0000330 range: TextValue local_class_meth: name: local_class_meth description: Reference or method used in determining the local soil classification title: soil_taxonomic/local classification method from_schema: https://w3id.org/nmdc/nmdc keywords: - classification - method slot_uri: MIXS:0000331 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true magnesium: name: magnesium annotations: Preferred_unit: tag: Preferred_unit value: mole per liter, milligram per liter, parts per million, micromole per kilogram storage_units: tag: storage_units value: '[ppm]|mg/L|mol/L|umol/kg|mg/kg' description: Concentration of magnesium in the sample title: magnesium examples: - value: 52.8 umol/kg from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000431 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true max_occup: name: max_occup annotations: storage_units: tag: storage_units value: '1' description: The maximum amount of people allowed in the indoor environment title: maximum occupancy from_schema: https://w3id.org/nmdc/nmdc keywords: - maximum slot_uri: MIXS:0000229 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true mean_frict_vel: name: mean_frict_vel annotations: Preferred_unit: tag: Preferred_unit value: meter per second storage_units: tag: storage_units value: m/s description: Measurement of mean friction velocity title: mean friction velocity examples: - value: 0.5 m/s from_schema: https://w3id.org/nmdc/nmdc keywords: - mean - velocity slot_uri: MIXS:0000498 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true mean_peak_frict_vel: name: mean_peak_frict_vel annotations: Preferred_unit: tag: Preferred_unit value: meter per second storage_units: tag: storage_units value: m/s description: Measurement of mean peak friction velocity title: mean peak friction velocity examples: - value: 1 m/s from_schema: https://w3id.org/nmdc/nmdc keywords: - mean - peak - velocity slot_uri: MIXS:0000502 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true mech_struc: name: mech_struc description: 'mechanical structure: a moving structure' title: mechanical structure examples: - value: elevator from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000815 range: MechStrucEnum mechanical_damage: name: mechanical_damage annotations: Expected_value: tag: Expected_value value: damage type;body site description: Information about any mechanical damage exerted on the plant; can include multiple damages and sites title: mechanical damage examples: - value: pruning;bark from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{text}' slot_uri: MIXS:0001052 multivalued: true inlined_as_list: true methane: name: methane annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, parts per billion, parts per million storage_units: tag: storage_units value: '[ppb]|[ppm]|umol/L' description: Methane (gas) amount or concentration at the time of sampling title: methane examples: - value: 1800 [ppb] from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000101 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true micro_biomass_meth: name: micro_biomass_meth description: Reference or method used in determining microbial biomass title: microbial biomass method comments: - slot name/scn was microbial_biomass_meth examples: - value: http://dx.doi.org/10.1016/j.soilbio.2005.01.021 from_schema: https://w3id.org/nmdc/nmdc keywords: - biomass - method - microbial slot_uri: MIXS:0000339 range: string microbial_biomass: name: microbial_biomass annotations: Preferred_unit: tag: Preferred_unit value: ton, kilogram, gram per kilogram soil units_alignment_excuse: tag: units_alignment_excuse value: complex_unit description: The part of the organic matter in the soil that constitutes living microorganisms smaller than 5-10 micrometer. If you keep this, you would need to have correction factors used for conversion to the final units title: microbial biomass from_schema: https://w3id.org/nmdc/nmdc keywords: - biomass - microbial slot_uri: MIXS:0000650 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true mineral_nutr_regm: name: mineral_nutr_regm annotations: Expected_value: tag: Expected_value value: mineral nutrient name;mineral nutrient amount;treatment interval and duration Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving the use of mineral supplements; should include the name of mineral nutrient, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple mineral nutrient regimens title: mineral nutrient regimen examples: - value: potassium;15 gram;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - mineral - nutrient - regimen string_serialization: '{text};{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000570 range: TextValue multivalued: true inlined_as_list: true misc_param: name: misc_param annotations: Expected_value: tag: Expected_value value: parameter name;measurement value description: Structured miscellaneous property assertions. Use when a value cannot cleanly fit an existing, policy-governed slot. title: miscellaneous parameter todos: - This slot should not be available in the submission portal. examples: - value: Bicarbonate ion concentration;2075 micromole per kilogram from_schema: https://w3id.org/nmdc/nmdc keywords: - parameter string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000752 range: PropertyAssertion multivalued: true inlined_as_list: true n_alkanes: name: n_alkanes annotations: Expected_value: tag: Expected_value value: n-alkane name;measurement value description: Concentration of n-alkanes; can include multiple n-alkanes title: n-alkanes examples: - value: n-hexadecane;100 milligram per liter from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000503 range: TextValue multivalued: true inlined_as_list: true nitrate: name: nitrate annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L' description: Concentration of nitrate in the sample title: nitrate examples: - value: 65 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - nitrate slot_uri: MIXS:0000425 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true nitrite: name: nitrite annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L' description: Concentration of nitrite in the sample title: nitrite examples: - value: 0.5 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - nitrite slot_uri: MIXS:0000426 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true nitro: name: nitro annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter storage_units: tag: storage_units value: umol/L|% description: Concentration of nitrogen (total) title: nitrogen examples: - value: 4.2 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - nitrogen slot_uri: MIXS:0000504 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true non_min_nutr_regm: name: non_min_nutr_regm annotations: Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving the exposure of plant to non-mineral nutrient such as oxygen, hydrogen or carbon; should include the name of non-mineral nutrient, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple non-mineral nutrient regimens title: non-mineral nutrient regimen examples: - value: https://phylogenomics.me/protocols/16s-pcr-protocol/ from_schema: https://w3id.org/nmdc/nmdc keywords: - non-mineral - nutrient - regimen slot_uri: MIXS:0000571 range: string multivalued: true nucl_acid_amp: name: nucl_acid_amp description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the enzymatic amplification (PCR, TMA, NASBA) of specific nucleic acids title: nucleic acid amplification examples: - value: https://phylogenomics.me/protocols/16s-pcr-protocol/ from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000038 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true nucl_acid_ext: name: nucl_acid_ext description: A link to a literature reference, electronic resource or a standard operating procedure (SOP), that describes the material separation to recover the nucleic acid fraction from a sample title: nucleic acid extraction examples: - value: https://mobio.com/media/wysiwyg/pdfs/protocols/12888.pdf from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000037 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true number_pets: name: number_pets annotations: storage_units: tag: storage_units value: '1' description: The number of pets residing in the sampled space title: number of pets from_schema: https://w3id.org/nmdc/nmdc keywords: - number slot_uri: MIXS:0000231 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true number_plants: name: number_plants annotations: storage_units: tag: storage_units value: '1' description: The number of plant(s) in the sampling space title: number of houseplants from_schema: https://w3id.org/nmdc/nmdc keywords: - number slot_uri: MIXS:0000230 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true number_resident: name: number_resident annotations: storage_units: tag: storage_units value: '1' description: The number of individuals currently occupying in the sampling location title: number of residents from_schema: https://w3id.org/nmdc/nmdc keywords: - number slot_uri: MIXS:0000232 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true occup_density_samp: name: occup_density_samp annotations: storage_units: tag: storage_units value: 1/[sft_i] description: Average number of occupants at time of sampling per square footage title: occupant density at sampling examples: - value: '0.1' from_schema: https://w3id.org/nmdc/nmdc keywords: - density slot_uri: MIXS:0000217 range: QuantityValue occup_document: name: occup_document description: The type of documentation of occupancy title: occupancy documentation examples: - value: estimate from_schema: https://w3id.org/nmdc/nmdc keywords: - documentation slot_uri: MIXS:0000816 range: OccupDocumentEnum occup_samp: name: occup_samp annotations: storage_units: tag: storage_units value: '1' description: Number of occupants present at time of sample within the given space title: occupancy at sampling examples: - value: '10' from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000772 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true org_carb: name: org_carb annotations: storage_units: tag: storage_units value: umol/L|%|mg/L description: Concentration of organic carbon title: organic carbon examples: - value: 0.015 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - organic slot_uri: MIXS:0000508 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true org_count_qpcr_info: name: org_count_qpcr_info annotations: Expected_value: tag: Expected_value value: gene name;FWD:forward primer sequence;REV:reverse primer sequence;initial denaturation:degrees_minutes;denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes; total cycles Preferred_unit: tag: Preferred_unit value: number of cells per gram (or ml or cm^2) description: 'If qpcr was used for the cell count, the target gene name, the primer sequence and the cycling conditions should also be provided. (Example: 16S rrna; FWD:ACGTAGCTATGACGT REV:GTGCTAGTCGAGTAC; initial denaturation:90C_5min; denaturation:90C_2min; annealing:52C_30 sec; elongation:72C_30 sec; 90 C for 1 min; final elongation:72C_5min; 30 cycles)' title: organism count qPCR information from_schema: https://w3id.org/nmdc/nmdc keywords: - count - information - organism string_serialization: '{text};FWD:{dna};REV:{dna};initial denaturation:degrees_minutes;denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes; total cycles' slot_uri: MIXS:0000099 range: string org_matter: name: org_matter annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter storage_units: tag: storage_units value: ug/L description: Concentration of organic matter title: organic matter examples: - value: 200 ug/L from_schema: https://w3id.org/nmdc/nmdc keywords: - organic slot_uri: MIXS:0000204 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true org_nitro: name: org_nitro annotations: storage_units: tag: storage_units value: ug/L description: Concentration of organic nitrogen title: organic nitrogen examples: - value: 4 ug/L from_schema: https://w3id.org/nmdc/nmdc keywords: - nitrogen - organic slot_uri: MIXS:0000205 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true org_particles: name: org_particles annotations: Expected_value: tag: Expected_value value: particle name;measurement value Preferred_unit: tag: Preferred_unit value: gram per liter description: Concentration of particles such as faeces, hairs, food, vomit, paper fibers, plant material, humus, etc title: organic particles from_schema: https://w3id.org/nmdc/nmdc keywords: - organic - particle string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000665 range: TextValue multivalued: true inlined_as_list: true organism_count: name: organism_count annotations: Expected_value: tag: Expected_value value: organism name;measurement value;enumeration storage_units: tag: storage_units value: '1' description: 'Total cell count of any organism (or group of organisms) per gram, volume or area of sample, should include name of organism followed by count. The method that was used for the enumeration (e.g. qPCR, atp, mpn, etc.) Should also be provided. (example: total prokaryotes; 3.5e7 cells per ml; qpcr)' title: organism count from_schema: https://w3id.org/nmdc/nmdc keywords: - count - organism string_serialization: '{text};{float} {unit};[ATP|MPN|qPCR|other]' slot_uri: MIXS:0000103 range: QuantityValue multivalued: true inlined_as_list: true owc_tvdss: name: owc_tvdss annotations: Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: Depth of the original oil water contact (OWC) zone (average) (m TVDSS) title: oil water contact depth from_schema: https://w3id.org/nmdc/nmdc keywords: - depth - oil - water slot_uri: MIXS:0000405 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true oxy_stat_samp: name: oxy_stat_samp description: Oxygenation status of sample title: oxygenation status of sample examples: - value: aerobic from_schema: https://w3id.org/nmdc/nmdc keywords: - oxygen - sample - status slot_uri: MIXS:0000753 range: OxyStatSampEnum oxygen: name: oxygen annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Oxygen (gas) amount or concentration at the time of sampling title: oxygen examples: - value: 600 [ppm] from_schema: https://w3id.org/nmdc/nmdc keywords: - oxygen slot_uri: MIXS:0000104 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true part_org_carb: name: part_org_carb annotations: storage_units: tag: storage_units value: ug/L|mg/L description: Concentration of particulate organic carbon title: particulate organic carbon examples: - value: 0.02 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - organic - particle - particulate slot_uri: MIXS:0000515 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true part_org_nitro: name: part_org_nitro annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, micromole per liter storage_units: tag: storage_units value: ug/L|umol/L|mg/L description: Concentration of particulate organic nitrogen title: particulate organic nitrogen examples: - value: 0.3 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - nitrogen - organic - particle - particulate slot_uri: MIXS:0000719 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true particle_class: name: particle_class annotations: Expected_value: tag: Expected_value value: particle name;measurement value Preferred_unit: tag: Preferred_unit value: micrometer description: Particles are classified, based on their size, into six general categories:clay, silt, sand, gravel, cobbles, and boulders; should include amount of particle preceded by the name of the particle type; can include multiple values title: particle classification from_schema: https://w3id.org/nmdc/nmdc keywords: - classification - particle string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000206 range: TextValue multivalued: true inlined_as_list: true pcr_cond: name: pcr_cond annotations: Expected_value: tag: Expected_value value: initial denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes;total cycles description: Description of reaction conditions and components of polymerase chain reaction performed during library preparation. title: pcr conditions examples: - value: initial denaturation:94_3;annealing:50_1;elongation:72_1.5;final elongation:72_10;35 - value: initial denaturation:94degC_1.5min from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - pcr string_serialization: initial denaturation:degrees_minutes;annealing:degrees_minutes;elongation:degrees_minutes;final elongation:degrees_minutes;total cycles slot_uri: MIXS:0000049 pcr_primers: name: pcr_primers description: PCR primers that were used to amplify the sequence of the targeted gene, locus or subfragment. This field should contain all the primers used for a single PCR reaction if multiple forward or reverse primers are present in a single PCR reaction. The primer sequence should be reported in uppercase letters title: pcr primers examples: - value: FWD:GTGCCAGCMGCCGCGGTAA;REV:GGACTACHVGGGTWTCTAAT from_schema: https://w3id.org/nmdc/nmdc keywords: - pcr slot_uri: MIXS:0000046 pattern: FWD:[ACGT];REV:[ACGT] structured_pattern: syntax: FWD:{dna_bases};REV:{dna_bases} interpolated: true permeability: name: permeability annotations: Expected_value: tag: Expected_value value: measurement value range Preferred_unit: tag: Preferred_unit value: mD description: 'Measure of the ability of a hydrocarbon resource to allow fluids to pass through it. (Additional information: https://en.wikipedia.org/wiki/Permeability_(earth_sciences))' title: permeability from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{integer} - {integer} {unit}' slot_uri: MIXS:0000404 range: TextValue perturbation: name: perturbation annotations: Expected_value: tag: Expected_value value: perturbation type name;perturbation interval and duration description: Type of perturbation, e.g. chemical administration, physical disturbance, etc., coupled with perturbation regimen including how many times the perturbation was repeated, how long each perturbation lasted, and the start and end time of the entire perturbation period; can include multiple perturbation types title: perturbation examples: - value: antibiotic addition;R2/2018-05-11T14:30Z/2018-05-11T19:30Z/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - perturbation string_serialization: '{text};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000754 range: TextValue multivalued: true inlined_as_list: true pesticide_regm: name: pesticide_regm annotations: Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter description: Information about treatment involving use of insecticides; should include the name of pesticide, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple pesticide regimens title: pesticide regimen examples: - value: pyrethrum;0.6 milligram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen slot_uri: MIXS:0000573 range: TextValue multivalued: true inlined_as_list: true petroleum_hydrocarb: name: petroleum_hydrocarb annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter storage_units: tag: storage_units value: umol/L description: Concentration of petroleum hydrocarbon title: petroleum hydrocarbon examples: - value: 0.05 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - hydrocarbon - petroleum slot_uri: MIXS:0000516 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true ph: name: ph description: pH measurement of the sample, or liquid portion of sample, or aqueous phase of the fluid title: pH examples: - value: '7.2' from_schema: https://w3id.org/nmdc/nmdc keywords: - ph slot_uri: MIXS:0001001 range: float ph_meth: name: ph_meth description: Reference or method used in determining pH title: pH method examples: - value: https://www.epa.gov/sites/production/files/2015-12/documents/9040c.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - method - ph slot_uri: MIXS:0001106 range: TextValue ph_regm: name: ph_regm description: Information about treatment involving exposure of plants to varying levels of ph of the growth media, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimen title: pH regimen examples: - value: 7.6;R2/2018-05-11:T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - ph - regimen slot_uri: MIXS:0001056 range: TextValue multivalued: true inlined_as_list: true phaeopigments: name: phaeopigments annotations: Expected_value: tag: Expected_value value: phaeopigment name;measurement value Preferred_unit: tag: Preferred_unit value: milligram per cubic meter description: Concentration of phaeopigments; can include multiple phaeopigments title: phaeopigments examples: - value: 2.5 milligram per cubic meter from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000180 range: TextValue multivalued: true inlined_as_list: true phosphate: name: phosphate annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter storage_units: tag: storage_units value: umol/L description: Concentration of phosphate title: phosphate examples: - value: 0.7 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - phosphate slot_uri: MIXS:0000505 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true phosplipid_fatt_acid: name: phosplipid_fatt_acid annotations: Expected_value: tag: Expected_value value: phospholipid fatty acid name;measurement value description: Concentration of phospholipid fatty acids; can include multiple values title: phospholipid fatty acid examples: - value: 2.98 milligram per liter from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000181 range: TextValue multivalued: true inlined_as_list: true photon_flux: name: photon_flux annotations: Preferred_unit: tag: Preferred_unit value: number of photons per second per unit area storage_units: tag: storage_units value: umol/m2/s description: Measurement of photon flux title: photon flux examples: - value: 3.926 umol/m2/s from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000725 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true plant_growth_med: name: plant_growth_med description: Specification of the media for growing the plants or tissue cultured samples, e.g. soil, aeroponic, hydroponic, in vitro solid culture medium, in vitro liquid culture medium. Recommended value is a specific value from the Plant Environment Ontology (PECO), plant growth medium exposure (http://purl.obolibrary.org/obo/PECO_0007147), or other controlled vocabulary. title: plant growth medium from_schema: https://w3id.org/nmdc/nmdc keywords: - growth - plant string_serialization: '{termLabel} [{termID}] or [husk|other artificial liquid medium|other artificial solid medium|peat moss|perlite|pumice|sand|soil|vermiculite|water]' slot_uri: MIXS:0001057 range: ControlledTermValue plant_product: name: plant_product annotations: Expected_value: tag: Expected_value value: product name description: Substance produced by the plant, where the sample was obtained from title: plant product examples: - value: xylem sap [PO:0025539] from_schema: https://w3id.org/nmdc/nmdc keywords: - plant - product slot_uri: MIXS:0001058 range: TextValue plant_sex: name: plant_sex description: Sex of the reproductive parts on the whole plant, e.g. pistillate, staminate, monoecieous, hermaphrodite title: plant sex examples: - value: Hermaphroditic from_schema: https://w3id.org/nmdc/nmdc keywords: - plant slot_uri: MIXS:0001059 range: PlantSexEnum plant_struc: name: plant_struc description: Name of plant structure the sample was obtained from; for Plant Ontology (PO) terms, see http://obofoundry.org/ontology/po.html, e.g. petiole epidermis (PO:0000051). If an individual flower is sampled, the sex of it can be recorded here. title: plant structure examples: - value: epidermis [PO:0005679] from_schema: https://w3id.org/nmdc/nmdc keywords: - plant slot_uri: MIXS:0001060 range: ControlledTermValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+) \[[a-zA-Z]{2,}:[a-zA-Z0-9]\d+\]$ structured_pattern: syntax: ^{termLabel} \[{termID}\]$ interpolated: true partial_match: true pollutants: name: pollutants annotations: Expected_value: tag: Expected_value value: pollutant name;measurement value Preferred_unit: tag: Preferred_unit value: gram, mole per liter, milligram per liter, microgram per cubic meter description: Pollutant types and, amount or concentrations measured at the time of sampling; can report multiple pollutants by entering numeric values preceded by name of pollutant title: pollutants examples: - value: lead;0.15 microgram per cubic meter from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000107 range: TextValue multivalued: true inlined_as_list: true pool_dna_extracts: name: pool_dna_extracts annotations: Expected_value: tag: Expected_value value: pooling status;number of pooled extracts Preferred_unit: tag: Preferred_unit value: gram, milliliter, microliter description: Indicate whether multiple DNA extractions were mixed. If the answer yes, the number of extracts that were pooled should be given title: pooling of DNA extracts (if done) examples: - value: yes, 5 from_schema: https://w3id.org/nmdc/nmdc keywords: - dna - pooling slot_uri: MIXS:0000325 porosity: name: porosity annotations: Expected_value: tag: Expected_value value: measurement value or range Preferred_unit: tag: Preferred_unit value: percentage description: Porosity of deposited sediment is volume of voids divided by the total volume of sample title: porosity from_schema: https://w3id.org/nmdc/nmdc keywords: - porosity string_serialization: '{float} - {float} {unit}' slot_uri: MIXS:0000211 range: TextValue potassium: name: potassium annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|mg/kg' description: Concentration of potassium in the sample title: potassium examples: - value: 463 mg/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000430 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true pour_point: name: pour_point annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: 'Temperature at which a liquid becomes semi solid and loses its flow characteristics. In crude oil a high pour point is generally associated with a high paraffin content, typically found in crude deriving from a larger proportion of plant material. (source: https://en.wikipedia.org/wiki/pour_point)' title: pour point from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000127 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true pre_treatment: name: pre_treatment annotations: Expected_value: tag: Expected_value value: pre-treatment type description: The process of pre-treatment removes materials that can be easily collected from the raw wastewater title: pre-treatment from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000348 range: TextValue pres_animal_insect: name: pres_animal_insect annotations: Expected_value: tag: Expected_value value: enumeration;count description: The type and number of animals or insects present in the sampling space title: presence of pets, animals, or insects examples: - value: cat;5 from_schema: https://w3id.org/nmdc/nmdc keywords: - animal - presence string_serialization: '[cat|dog|rodent|snake|other];{integer}' slot_uri: MIXS:0000819 range: string pressure: name: pressure annotations: Preferred_unit: tag: Preferred_unit value: atmosphere storage_units: tag: storage_units value: atm description: Pressure to which the sample is subject to, in atmospheres title: pressure examples: - value: 50 atm from_schema: https://w3id.org/nmdc/nmdc keywords: - pressure slot_uri: MIXS:0000412 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true prev_land_use_meth: name: prev_land_use_meth description: Reference or method used in determining previous land use and dates title: history/previous land use method from_schema: https://w3id.org/nmdc/nmdc keywords: - history - land - method - use slot_uri: MIXS:0000316 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true previous_land_use: name: previous_land_use annotations: Expected_value: tag: Expected_value value: land use name;date description: Previous land use and dates title: history/previous land use examples: - value: fallow;2018-05-11T14:30Z from_schema: https://w3id.org/nmdc/nmdc keywords: - history - land - use string_serialization: '{text};{timestamp}' slot_uri: MIXS:0000315 primary_prod: name: primary_prod annotations: Preferred_unit: tag: Preferred_unit value: milligram per cubic meter per day, gram per square meter per day storage_units: tag: storage_units value: g/m2/d|mg/m3/d description: Measurement of primary production, generally measured as isotope uptake title: primary production examples: - value: 100 mg/m3/d from_schema: https://w3id.org/nmdc/nmdc keywords: - primary - production slot_uri: MIXS:0000728 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true primary_treatment: name: primary_treatment annotations: Expected_value: tag: Expected_value value: primary treatment type description: The process to produce both a generally homogeneous liquid capable of being treated biologically and a sludge that can be separately treated or processed title: primary treatment from_schema: https://w3id.org/nmdc/nmdc keywords: - primary - treatment slot_uri: MIXS:0000349 range: TextValue prod_rate: name: prod_rate annotations: Preferred_unit: tag: Preferred_unit value: cubic meter per day storage_units: tag: storage_units value: m3/d description: Oil and/or gas production rates per well (e.g. 524 m3 / day) title: production rate from_schema: https://w3id.org/nmdc/nmdc keywords: - production - rate slot_uri: MIXS:0000452 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true prod_start_date: name: prod_start_date description: Date of field's first production title: production start date examples: - value: '2013-03-25T12:42:31+01:00' from_schema: https://w3id.org/nmdc/nmdc keywords: - date - production - start slot_uri: MIXS:0001008 range: TimestampValue recommended: true profile_position: name: profile_position description: Cross-sectional position in the hillslope where sample was collected.sample area position in relation to surrounding areas title: profile position examples: - value: summit from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0001084 range: ProfilePositionEnum quad_pos: name: quad_pos description: The quadrant position of the sampling room within the building title: quadrant position examples: - value: West side from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000820 range: QuadPosEnum radiation_regm: name: radiation_regm annotations: Expected_value: tag: Expected_value value: radiation type name;radiation amount;treatment interval and duration Preferred_unit: tag: Preferred_unit value: rad, gray description: Information about treatment involving exposure of plant or a plant part to a particular radiation regimen; should include the radiation type, amount or intensity administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple radiation regimens title: radiation regimen examples: - value: gamma radiation;60 gray;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen string_serialization: '{text};{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000575 range: TextValue multivalued: true inlined_as_list: true rainfall_regm: name: rainfall_regm annotations: Expected_value: tag: Expected_value value: measurement value;treatment interval and duration Preferred_unit: tag: Preferred_unit value: millimeter description: Information about treatment involving an exposure to a given amount of rainfall, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens title: rainfall regimen examples: - value: 15 millimeter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - rain - regimen string_serialization: '{float} {unit};{Rn/start_time/end_time/duration}' slot_uri: MIXS:0000576 range: TextValue multivalued: true inlined_as_list: true reactor_type: name: reactor_type annotations: Expected_value: tag: Expected_value value: reactor type name description: Anaerobic digesters can be designed and engineered to operate using a number of different process configurations, as batch or continuous, mesophilic, high solid or low solid, and single stage or multistage title: reactor type from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000350 range: TextValue redox_potential: name: redox_potential annotations: Preferred_unit: tag: Preferred_unit value: millivolt storage_units: tag: storage_units value: mV description: Redox potential, measured relative to a hydrogen cell, indicating oxidation or reduction potential title: redox potential examples: - value: 300 mV from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000182 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true rel_air_humidity: name: rel_air_humidity annotations: Preferred_unit: tag: Preferred_unit value: percentage storage_units: tag: storage_units value: '%' description: Partial vapor and air pressure, density of the vapor and air, or by the actual mass of the vapor and air title: relative air humidity comments: - percent or float? examples: - value: '0.8' from_schema: https://w3id.org/nmdc/nmdc keywords: - air - humidity - relative slot_uri: MIXS:0000121 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true rel_humidity_out: name: rel_humidity_out annotations: Preferred_unit: tag: Preferred_unit value: gram of air, kilogram of air units_alignment_excuse: tag: units_alignment_excuse value: mixs_inconsistent description: The recorded outside relative humidity value at the time of sampling title: outside relative humidity examples: - value: 12 per kilogram of air from_schema: https://w3id.org/nmdc/nmdc keywords: - humidity - relative slot_uri: MIXS:0000188 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true rel_samp_loc: name: rel_samp_loc description: The sampling location within the train car title: relative sampling location examples: - value: center of car from_schema: https://w3id.org/nmdc/nmdc keywords: - location - relative slot_uri: MIXS:0000821 range: RelSampLocEnum reservoir: name: reservoir description: Name of the reservoir (e.g. Carapebus) title: reservoir name from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000303 range: TextValue recommended: true resins_pc: name: resins_pc annotations: Preferred_unit: tag: Preferred_unit value: percent description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)' title: resins wt% from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000134 range: TextValue recommended: true pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{name};{float} {unit}$ interpolated: true partial_match: true room_air_exch_rate: name: room_air_exch_rate annotations: Preferred_unit: tag: Preferred_unit value: liter per hour storage_units: tag: storage_units value: L/h description: The rate at which outside air replaces indoor air in a given space title: room air exchange rate from_schema: https://w3id.org/nmdc/nmdc keywords: - air - rate - room slot_uri: MIXS:0000169 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true room_architec_elem: name: room_architec_elem description: The unique details and component parts that, together, form the architecture of a distinguishable space within a built structure title: room architectural elements from_schema: https://w3id.org/nmdc/nmdc keywords: - room slot_uri: MIXS:0000233 range: string room_condt: name: room_condt description: The condition of the room at the time of sampling title: room condition examples: - value: new from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - room slot_uri: MIXS:0000822 range: RoomCondtEnum room_connected: name: room_connected description: List of rooms connected to the sampling room by a doorway title: rooms connected by a doorway examples: - value: office from_schema: https://w3id.org/nmdc/nmdc keywords: - doorway - room slot_uri: MIXS:0000826 range: RoomConnectedEnum room_count: name: room_count description: The total count of rooms in the built structure including all room types title: room count from_schema: https://w3id.org/nmdc/nmdc keywords: - count - room slot_uri: MIXS:0000234 range: TextValue room_dim: name: room_dim annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: meter description: The length, width and height of sampling room title: room dimensions examples: - value: 4 meter x 4 meter x 4 meter from_schema: https://w3id.org/nmdc/nmdc keywords: - dimensions - room string_serialization: '{integer} {unit} x {integer} {unit} x {integer} {unit}' slot_uri: MIXS:0000192 range: TextValue room_door_dist: name: room_door_dist annotations: Preferred_unit: tag: Preferred_unit value: meter description: Distance between doors (meters) in the hallway between the sampling room and adjacent rooms title: room door distance from_schema: https://w3id.org/nmdc/nmdc keywords: - distance - door - room slot_uri: MIXS:0000193 range: TextValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true room_door_share: name: room_door_share description: List of room(s) (room number, room name) sharing a door with the sampling room title: rooms that share a door with sampling room from_schema: https://w3id.org/nmdc/nmdc keywords: - door - room slot_uri: MIXS:0000242 range: TextValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+);[1-9][0-9]*$ structured_pattern: syntax: ^{room_name};{room_number}$ interpolated: true partial_match: true room_hallway: name: room_hallway description: List of room(s) (room number, room name) located in the same hallway as sampling room title: rooms that are on the same hallway from_schema: https://w3id.org/nmdc/nmdc keywords: - hallway - room slot_uri: MIXS:0000238 range: TextValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+);[1-9][0-9]*$ structured_pattern: syntax: ^{room_name};{room_number}$ interpolated: true partial_match: true room_loc: name: room_loc description: The position of the room within the building title: room location in building examples: - value: interior room from_schema: https://w3id.org/nmdc/nmdc keywords: - location - room slot_uri: MIXS:0000823 range: RoomLocEnum room_moist_dam_hist: name: room_moist_dam_hist description: The history of moisture damage or mold in the past 12 months. Number of events of moisture damage or mold observed title: room moisture damage or mold history from_schema: https://w3id.org/nmdc/nmdc keywords: - history - moisture - room slot_uri: MIXS:0000235 range: integer room_net_area: name: room_net_area annotations: Preferred_unit: tag: Preferred_unit value: square feet, square meter description: The net floor area of sampling room. Net area excludes wall thicknesses title: room net area from_schema: https://w3id.org/nmdc/nmdc keywords: - area - room slot_uri: MIXS:0000194 range: TextValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true room_occup: name: room_occup annotations: storage_units: tag: storage_units value: '1' description: Count of room occupancy at time of sampling title: room occupancy from_schema: https://w3id.org/nmdc/nmdc keywords: - room slot_uri: MIXS:0000236 range: QuantityValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true room_samp_pos: name: room_samp_pos description: The horizontal sampling position in the room relative to architectural elements title: room sampling position examples: - value: south corner from_schema: https://w3id.org/nmdc/nmdc keywords: - room slot_uri: MIXS:0000824 range: RoomSampPosEnum room_type: name: room_type annotations: Expected_value: tag: Expected_value value: enumeration description: The main purpose or activity of the sampling room. A room is any distinguishable space within a structure title: room type examples: - value: bathroom from_schema: https://w3id.org/nmdc/nmdc keywords: - room - type string_serialization: '[attic|bathroom|closet|conference room|elevator|examining room|hallway|kitchen|mail room|private office|open office|stairwell|,restroom|lobby|vestibule|mechanical or electrical room|data center|laboratory_wet|laboratory_dry|gymnasium|natatorium|auditorium|lockers|cafe|warehouse]' slot_uri: MIXS:0000825 room_vol: name: room_vol annotations: Preferred_unit: tag: Preferred_unit value: cubic feet, cubic meter description: Volume of sampling room title: room volume from_schema: https://w3id.org/nmdc/nmdc keywords: - room - volume slot_uri: MIXS:0000195 range: TextValue pattern: ^[1-9][0-9]* .*$ structured_pattern: syntax: ^{integer} {text}$ interpolated: true partial_match: true room_wall_share: name: room_wall_share description: List of room(s) (room number, room name) sharing a wall with the sampling room title: rooms that share a wall with sampling room from_schema: https://w3id.org/nmdc/nmdc keywords: - room - wall slot_uri: MIXS:0000243 range: TextValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+);[1-9][0-9]*$ structured_pattern: syntax: ^{room_name};{room_number}$ interpolated: true partial_match: true room_window_count: name: room_window_count description: Number of windows in the room title: room window count from_schema: https://w3id.org/nmdc/nmdc keywords: - count - room - window slot_uri: MIXS:0000237 range: integer root_cond: name: root_cond description: Relevant rooting conditions such as field plot size, sowing density, container dimensions, number of plants per container title: rooting conditions examples: - value: http://himedialabs.com/TD/PT158.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - condition slot_uri: MIXS:0001061 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*)|.*)$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL}|{text})$ interpolated: true partial_match: true root_med_carbon: name: root_med_carbon annotations: Expected_value: tag: Expected_value value: carbon source name;measurement value Preferred_unit: tag: Preferred_unit value: milligram per liter description: Source of organic carbon in the culture rooting medium; e.g. sucrose title: rooting medium carbon examples: - value: sucrose from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000577 range: TextValue root_med_macronutr: name: root_med_macronutr annotations: Expected_value: tag: Expected_value value: macronutrient name;measurement value Preferred_unit: tag: Preferred_unit value: milligram per liter description: Measurement of the culture rooting medium macronutrients (N,P, K, Ca, Mg, S); e.g. KH2PO4 (170 mg/L) title: rooting medium macronutrients examples: - value: KH2PO4;170 milligram per liter from_schema: https://w3id.org/nmdc/nmdc keywords: - macronutrients string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000578 range: TextValue root_med_micronutr: name: root_med_micronutr annotations: Expected_value: tag: Expected_value value: micronutrient name;measurement value Preferred_unit: tag: Preferred_unit value: milligram per liter description: Measurement of the culture rooting medium micronutrients (Fe, Mn, Zn, B, Cu, Mo); e.g. H3BO3 (6.2 mg/L) title: rooting medium micronutrients examples: - value: H3BO3;6.2 milligram per liter from_schema: https://w3id.org/nmdc/nmdc keywords: - micronutrients string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000579 range: TextValue root_med_ph: name: root_med_ph annotations: storage_units: tag: storage_units value: '[pH]' description: pH measurement of the culture rooting medium; e.g. 5.5 title: rooting medium pH examples: - value: '7.5' from_schema: https://w3id.org/nmdc/nmdc keywords: - ph slot_uri: MIXS:0001062 range: QuantityValue root_med_regl: name: root_med_regl annotations: Expected_value: tag: Expected_value value: regulator name;measurement value Preferred_unit: tag: Preferred_unit value: milligram per liter description: Growth regulators in the culture rooting medium such as cytokinins, auxins, gybberellins, abscisic acid; e.g. 0.5 mg/L NAA title: rooting medium regulators examples: - value: abscisic acid;0.75 milligram per liter from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000581 range: TextValue root_med_solid: name: root_med_solid description: Specification of the solidifying agent in the culture rooting medium; e.g. agar title: rooting medium solidifier examples: - value: agar from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0001063 range: TextValue root_med_suppl: name: root_med_suppl annotations: Expected_value: tag: Expected_value value: supplement name;measurement value Preferred_unit: tag: Preferred_unit value: milligram per liter description: Organic supplements of the culture rooting medium, such as vitamins, amino acids, organic acids, antibiotics activated charcoal; e.g. nicotinic acid (0.5 mg/L) title: rooting medium organic supplements examples: - value: nicotinic acid;0.5 milligram per liter from_schema: https://w3id.org/nmdc/nmdc keywords: - organic string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000580 range: TextValue salinity: name: salinity annotations: Preferred_unit: tag: Preferred_unit value: practical salinity unit, percentage storage_units: tag: storage_units value: '%|mg/L' description: The total concentration of all dissolved salts in a liquid or solid sample. While salinity can be measured by a complete chemical analysis, this method is difficult and time consuming. More often, it is instead derived from the conductivity measurement. This is known as practical salinity. These derivations compare the specific conductance of the sample to a salinity standard such as seawater title: salinity examples: - value: 70 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - salinity slot_uri: MIXS:0000183 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true salt_regm: name: salt_regm annotations: Preferred_unit: tag: Preferred_unit value: gram, microgram, mole per liter, gram per liter description: Information about treatment involving use of salts as supplement to liquid and soil growth media; should include the name of salt, amount administered, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple salt regimens title: salt regimen examples: - value: NaCl;5 gram per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen - salt slot_uri: MIXS:0000582 range: TextValue multivalued: true inlined_as_list: true samp_capt_status: name: samp_capt_status description: Reason for the sample title: sample capture status examples: - value: farm sample from_schema: https://w3id.org/nmdc/nmdc keywords: - sample - status slot_uri: MIXS:0000860 range: SampCaptStatusEnum samp_collect_point: name: samp_collect_point description: Sampling point on the asset were sample was collected (e.g. Wellhead, storage tank, separator, etc). If "other" is specified, please propose entry in "additional info" field title: sample collection point examples: - value: well from_schema: https://w3id.org/nmdc/nmdc keywords: - sample slot_uri: MIXS:0001015 range: SampCollectPointEnum samp_dis_stage: name: samp_dis_stage description: Stage of the disease at the time of sample collection, e.g. inoculation, penetration, infection, growth and reproduction, dissemination of pathogen title: sample disease stage examples: - value: infection from_schema: https://w3id.org/nmdc/nmdc keywords: - disease - sample slot_uri: MIXS:0000249 range: SampDisStageEnum samp_floor: name: samp_floor annotations: Expected_value: tag: Expected_value value: enumeration description: The floor of the building, where the sampling room is located title: sampling floor examples: - value: 4th floor from_schema: https://w3id.org/nmdc/nmdc keywords: - floor slot_uri: MIXS:0000828 pattern: ^(?:(?:\d*1[1-3]th|\d*1st|\d*2nd|\d*3rd|\d*[04-9]th) floor|basement|lobby)$ samp_loc_corr_rate: name: samp_loc_corr_rate annotations: Preferred_unit: tag: Preferred_unit value: millimeter per year description: Metal corrosion rate is the speed of metal deterioration due to environmental conditions. As environmental conditions change corrosion rates change accordingly. Therefore, long term corrosion rates are generally more informative than short term rates and for that reason they are preferred during reporting. In the case of suspected MIC, corrosion rate measurements at the time of sampling might provide insights into the involvement of certain microbial community members in MIC as well as potential microbial interplays title: corrosion rate at sample location from_schema: https://w3id.org/nmdc/nmdc keywords: - location - rate - sample slot_uri: MIXS:0000136 range: TextValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+ *- *[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{float} *- *{float} {unit}$ interpolated: true partial_match: true samp_mat_process: name: samp_mat_process description: A brief description of any processing applied to the sample during or after retrieving the sample from environment, or a link to the relevant protocol(s) performed title: sample material processing examples: - value: filtering of seawater, storing samples in ethanol from_schema: https://w3id.org/nmdc/nmdc keywords: - material - process - sample slot_uri: MIXS:0000016 range: ControlledTermValue samp_md: name: samp_md annotations: Expected_value: tag: Expected_value value: measurement value;enumeration Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: In non deviated well, measured depth is equal to the true vertical depth, TVD (TVD=TVDSS plus the reference or datum it refers to). In deviated wells, the MD is the length of trajectory of the borehole measured from the same reference or datum. Common datums used are ground level (GL), drilling rig floor (DF), rotary table (RT), kelly bushing (KB) and mean sea level (MSL). If "other" is specified, please propose entry in "additional info" field title: sample measured depth examples: - value: 1534 m from_schema: https://w3id.org/nmdc/nmdc keywords: - depth - measurement - sample string_serialization: '{float} {unit};[GL|DF|RT|KB|MSL|other]' slot_uri: MIXS:0000413 range: QuantityValue samp_name: name: samp_name annotations: Preferred_unit: tag: Preferred_unit value: '' description: A local identifier or name that for the material sample used for extracting nucleic acids, and subsequent sequencing. It can refer either to the original material collected or to any derived sub-samples. It can have any format, but we suggest that you make it concise, unique and consistent within your lab, and as informative as possible. INSDC requires every sample name from a single Submitter to be unique. Use of a globally unique identifier for the field source_mat_id is recommended in addition to sample_name title: sample name examples: - value: ISDsoil1 from_schema: https://w3id.org/nmdc/nmdc keywords: - sample slot_uri: MIXS:0001107 range: string samp_preserv: name: samp_preserv annotations: Preferred_unit: tag: Preferred_unit value: milliliter description: Preservative added to the sample (e.g. Rnalater, alcohol, formaldehyde, etc.). Where appropriate include volume added (e.g. Rnalater; 2 ml) title: preservative added to sample from_schema: https://w3id.org/nmdc/nmdc keywords: - sample slot_uri: MIXS:0000463 range: TextValue pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{name};{float} {unit}$ interpolated: true partial_match: true samp_room_id: name: samp_room_id description: Sampling room number. This ID should be consistent with the designations on the building floor plans title: sampling room ID or name from_schema: https://w3id.org/nmdc/nmdc keywords: - identifier - room slot_uri: MIXS:0000244 range: TextValue samp_size: name: samp_size annotations: storage_units: tag: storage_units value: L|g|mL|mg description: The total amount or size (volume (ml), mass (g) or area (m2) ) of sample collected title: amount or size of sample collected examples: - value: 5 L from_schema: https://w3id.org/nmdc/nmdc keywords: - sample - size slot_uri: MIXS:0000001 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true samp_sort_meth: name: samp_sort_meth description: Method by which samples are sorted; open face filter collecting total suspended particles, prefilter to remove particles larger than X micrometers in diameter, where common values of X would be 10 and 2.5 full size sorting in a cascade impactor title: sample size sorting method from_schema: https://w3id.org/nmdc/nmdc keywords: - method - sample - size slot_uri: MIXS:0000216 range: string multivalued: true inlined_as_list: true samp_store_dur: name: samp_store_dur description: Duration for which the sample was stored. Indicate the duration for which the sample was stored written in ISO 8601 format title: sample storage duration examples: - value: P1Y6M from_schema: https://w3id.org/nmdc/nmdc keywords: - duration - period - sample - storage slot_uri: MIXS:0000116 range: TextValue pattern: ^P(?:(?:\d+D|\d+M(?:\d+D)?|\d+Y(?:\d+M(?:\d+D)?)?)(?:T(?:\d+H(?:\d+M(?:\d+S)?)?|\d+M(?:\d+S)?|\d+S))?|T(?:\d+H(?:\d+M(?:\d+S)?)?|\d+M(?:\d+S)?|\d+S)|\d+W)$ structured_pattern: syntax: ^{duration}$ interpolated: true partial_match: true samp_store_loc: name: samp_store_loc annotations: Expected_value: tag: Expected_value value: location name description: Location at which sample was stored, usually name of a specific freezer/room title: sample storage location examples: - value: Freezer no:5 from_schema: https://w3id.org/nmdc/nmdc keywords: - location - sample - storage slot_uri: MIXS:0000755 range: TextValue samp_store_temp: name: samp_store_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Temperature at which sample was stored, e.g. -80 degree Celsius title: sample storage temperature examples: - value: -80 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - sample - storage - temperature slot_uri: MIXS:0000110 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true samp_subtype: name: samp_subtype description: Name of sample sub-type. For example if "sample type" is "Produced Water" then subtype could be "Oil Phase" or "Water Phase". If "other" is specified, please propose entry in "additional info" field title: sample subtype examples: - value: biofilm from_schema: https://w3id.org/nmdc/nmdc keywords: - sample slot_uri: MIXS:0000999 range: SampSubtypeEnum recommended: true samp_taxon_id: name: samp_taxon_id description: NCBI taxon id of the sample. Maybe be a single taxon or mixed taxa sample. Use 'synthetic metagenome for mock community/positive controls, or 'blank sample' for negative controls title: taxonomy ID of DNA sample comments: - coal metagenome [NCBITaxon:1260732] would be a reasonable has_raw_value from_schema: https://w3id.org/nmdc/nmdc keywords: - dna - identifier - sample - taxon slot_uri: MIXS:0001320 range: ControlledIdentifiedTermValue pattern: ^.* \[NCBITaxon:\d+\]$ structured_pattern: syntax: ^{text} \[{NCBItaxon_id}\]$ interpolated: true partial_match: true samp_time_out: name: samp_time_out annotations: Expected_value: tag: Expected_value value: time Preferred_unit: tag: Preferred_unit value: hour description: The recent and long term history of outside sampling title: sampling time outside from_schema: https://w3id.org/nmdc/nmdc keywords: - time string_serialization: '{float}' slot_uri: MIXS:0000196 range: TextValue samp_transport_cond: name: samp_transport_cond annotations: Expected_value: tag: Expected_value value: measurement value;measurement value Preferred_unit: tag: Preferred_unit value: days;degree Celsius description: Sample transport duration (in days or hrs) and temperature the sample was exposed to (e.g. 5.5 days; 20 C) title: sample transport conditions examples: - value: 5 days;-20 degree Celsius from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - sample - transport string_serialization: '{float} {unit};{float} {unit}' slot_uri: MIXS:0000410 range: TextValue samp_tvdss: name: samp_tvdss annotations: Expected_value: tag: Expected_value value: measurement value or measurement value range Preferred_unit: tag: Preferred_unit value: meter description: Depth of the sample i.e. The vertical distance between the sea level and the sampled position in the subsurface. Depth can be reported as an interval for subsurface samples e.g. 1325.75-1362.25 m title: sample true vertical depth subsea from_schema: https://w3id.org/nmdc/nmdc keywords: - depth - sample string_serialization: '{float}-{float} {unit}' slot_uri: MIXS:0000409 range: TextValue recommended: true samp_type: name: samp_type description: The type of material from which the sample was obtained. For the Hydrocarbon package, samples include types like core, rock trimmings, drill cuttings, piping section, coupon, pigging debris, solid deposit, produced fluid, produced water, injected water, swabs, etc. For the Food Package, samples are usually categorized as food, body products or tissues, or environmental material. This field accepts terms listed under environmental specimen (http://purl.obolibrary.org/obo/GENEPIO_0001246) title: sample type examples: - value: built environment sample [GENEPIO:0001248] from_schema: https://w3id.org/nmdc/nmdc keywords: - sample - type slot_uri: MIXS:0000998 range: TextValue pattern: ^([^\s-]{1,2}|[^\s-]+.+[^\s-]+) \[[a-zA-Z]{2,}:[a-zA-Z0-9]\d+\]$ structured_pattern: syntax: ^{termLabel} \[{termID}\]$ interpolated: true partial_match: true samp_vol_we_dna_ext: name: samp_vol_we_dna_ext annotations: Preferred_unit: tag: Preferred_unit value: milliliter, gram, milligram, square centimeter storage_units: tag: storage_units value: cm2|g|mL|mg description: 'Volume (ml) or mass (g) of total collected sample processed for DNA extraction. Note: total sample collected should be entered under the term Sample Size (MIXS:0000001)' title: sample volume or weight for DNA extraction examples: - value: 1500 mL from_schema: https://w3id.org/nmdc/nmdc keywords: - dna - sample - volume - weight slot_uri: MIXS:0000111 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true samp_weather: name: samp_weather description: The weather on the sampling day title: sampling day weather examples: - value: foggy from_schema: https://w3id.org/nmdc/nmdc keywords: - day - weather slot_uri: MIXS:0000827 range: SampWeatherEnum samp_well_name: name: samp_well_name description: Name of the well (e.g. BXA1123) where sample was taken title: sample well name from_schema: https://w3id.org/nmdc/nmdc keywords: - sample slot_uri: MIXS:0000296 range: TextValue recommended: true saturates_pc: name: saturates_pc annotations: Preferred_unit: tag: Preferred_unit value: percent description: 'Saturate, Aromatic, Resin and Asphaltene (SARA) is an analysis method that divides crude oil components according to their polarizability and polarity. There are three main methods to obtain SARA results. The most popular one is known as the Iatroscan TLC-FID and is referred to as IP-143 (source: https://en.wikipedia.org/wiki/Saturate,_aromatic,_resin_and_asphaltene)' title: saturates wt% from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000131 range: TextValue recommended: true pattern: ^.*;[-+]?[0-9]*\.?[0-9]+ ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)$ structured_pattern: syntax: ^{name};{float} {unit}$ interpolated: true partial_match: true season: name: season description: The season when sampling occurred. Any of the four periods into which the year is divided by the equinoxes and solstices. This field accepts terms listed under season (http://purl.obolibrary.org/obo/NCIT_C94729) title: season examples: - value: autumn [NCIT:C94733] from_schema: https://w3id.org/nmdc/nmdc keywords: - season slot_uri: MIXS:0000829 range: SeasonEnum season_environment: name: season_environment description: Treatment involving an exposure to a particular season (e.g. Winter, summer, rabi, rainy etc.), treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment title: seasonal environment examples: - value: rainy;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - environment - season slot_uri: MIXS:0001068 range: TextValue multivalued: true inlined_as_list: true season_precpt: name: season_precpt annotations: Preferred_unit: tag: Preferred_unit value: millimeter storage_units: tag: storage_units value: mm description: The average of all seasonal precipitation values known, or an estimated equivalent value derived by such methods as regional indexes or Isohyetal maps title: mean seasonal precipitation examples: - value: 10 mm from_schema: https://w3id.org/nmdc/nmdc keywords: - mean - season slot_uri: MIXS:0000645 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true season_temp: name: season_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Mean seasonal temperature title: mean seasonal temperature examples: - value: 18 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - mean - season - temperature slot_uri: MIXS:0000643 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true season_use: name: season_use description: The seasons the space is occupied title: seasonal use examples: - value: Winter from_schema: https://w3id.org/nmdc/nmdc keywords: - season - use slot_uri: MIXS:0000830 range: SeasonUseEnum secondary_treatment: name: secondary_treatment annotations: Expected_value: tag: Expected_value value: secondary treatment type description: The process for substantially degrading the biological content of the sewage title: secondary treatment from_schema: https://w3id.org/nmdc/nmdc keywords: - secondary - treatment slot_uri: MIXS:0000351 range: TextValue sediment_type: name: sediment_type description: Information about the sediment type based on major constituents title: sediment type examples: - value: biogenous from_schema: https://w3id.org/nmdc/nmdc keywords: - sediment - type slot_uri: MIXS:0001078 range: SedimentTypeEnum seq_meth: name: seq_meth description: Sequencing machine used. Where possible the term should be taken from the OBI list of DNA sequencers (http://purl.obolibrary.org/obo/OBI_0400103) title: sequencing method examples: - value: 454 Genome Sequencer FLX [OBI:0000702] from_schema: https://w3id.org/nmdc/nmdc keywords: - method slot_uri: MIXS:0000050 range: string pattern: ^.*|(([^\s-]{1,2}|[^\s-]+.+[^\s-]+) \[[a-zA-Z]{2,}:[a-zA-Z0-9]\d+\])$ structured_pattern: syntax: ^{text}|({termLabel} \[{termID}\])$ interpolated: true partial_match: true seq_quality_check: name: seq_quality_check annotations: Expected_value: tag: Expected_value value: none or manually edited description: Indicate if the sequence has been called by automatic systems (none) or undergone a manual editing procedure (e.g. by inspecting the raw data or chromatograms). Applied only for sequences that are not submitted to SRA,ENA or DRA title: sequence quality check examples: - value: none from_schema: https://w3id.org/nmdc/nmdc keywords: - quality slot_uri: MIXS:0000051 range: SeqQualityCheckEnum sewage_type: name: sewage_type annotations: Expected_value: tag: Expected_value value: sewage type name description: Type of wastewater treatment plant as municipial or industrial title: sewage type from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000215 range: TextValue shad_dev_water_mold: name: shad_dev_water_mold description: Signs of the presence of mold or mildew on the shading device title: shading device signs of water/mold examples: - value: no presence of mold visible from_schema: https://w3id.org/nmdc/nmdc keywords: - device slot_uri: MIXS:0000834 range: string shading_device_cond: name: shading_device_cond description: The physical condition of the shading device at the time of sampling title: shading device condition examples: - value: new from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - device slot_uri: MIXS:0000831 range: DamagedRupturedEnum shading_device_loc: name: shading_device_loc description: The location of the shading device in relation to the built structure title: shading device location examples: - value: exterior from_schema: https://w3id.org/nmdc/nmdc keywords: - device - location slot_uri: MIXS:0000832 range: ShadingDeviceLocEnum shading_device_mat: name: shading_device_mat annotations: Expected_value: tag: Expected_value value: material name description: The material the shading device is composed of title: shading device material from_schema: https://w3id.org/nmdc/nmdc keywords: - device - material slot_uri: MIXS:0000245 range: TextValue shading_device_type: name: shading_device_type description: The type of shading device title: shading device type examples: - value: slatted aluminum description: was slatted aluminum awning from_schema: https://w3id.org/nmdc/nmdc keywords: - device - type slot_uri: MIXS:0000835 range: ShadingDeviceTypeEnum sieving: name: sieving annotations: Expected_value: tag: Expected_value value: design name and/or size;amount description: Collection design of pooled samples and/or sieve size and amount of sample sieved title: sieving from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000322 range: TextValue silicate: name: silicate annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter storage_units: tag: storage_units value: umol/L description: Concentration of silicate title: silicate examples: - value: 0.05 umol/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000184 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true size_frac: name: size_frac annotations: Expected_value: tag: Expected_value value: filter size value range description: Filtering pore size used in sample preparation title: size fraction selected examples: - value: 0-0.22 micrometer from_schema: https://w3id.org/nmdc/nmdc keywords: - fraction - size string_serialization: '{float}-{float} {unit}' slot_uri: MIXS:0000017 range: TextValue size_frac_low: name: size_frac_low annotations: Preferred_unit: tag: Preferred_unit value: micrometer storage_units: tag: storage_units value: um description: Refers to the mesh/pore size used to pre-filter/pre-sort the sample. Materials smaller than the size threshold are excluded from the sample title: size-fraction lower threshold examples: - value: 0.2 um from_schema: https://w3id.org/nmdc/nmdc keywords: - lower slot_uri: MIXS:0000735 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true size_frac_up: name: size_frac_up annotations: Preferred_unit: tag: Preferred_unit value: micrometer storage_units: tag: storage_units value: um description: Mesh or pore size of the device used to retain the sample. Materials larger than the size threshold are excluded from the sample. title: size-fraction upper threshold examples: - value: 20 um from_schema: https://w3id.org/nmdc/nmdc keywords: - upper slot_uri: MIXS:0000736 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true slope_aspect: name: slope_aspect annotations: Preferred_unit: tag: Preferred_unit value: degree storage_units: tag: storage_units value: deg description: The direction a slope faces. While looking down a slope use a compass to record the direction you are facing (direction or degrees); e.g., nw or 315 degrees. This measure provides an indication of sun and wind exposure that will influence soil temperature and evapotranspiration title: slope aspect examples: - value: 35 deg from_schema: https://w3id.org/nmdc/nmdc keywords: - slope slot_uri: MIXS:0000647 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true slope_gradient: name: slope_gradient annotations: Preferred_unit: tag: Preferred_unit value: percentage storage_units: tag: storage_units value: '%' description: Commonly called 'slope'. The angle between ground surface and a horizontal line (in percent). This is the direction that overland water would flow. This measure is usually taken with a hand level meter or clinometer title: slope gradient from_schema: https://w3id.org/nmdc/nmdc keywords: - slope slot_uri: MIXS:0000646 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true sludge_retent_time: name: sludge_retent_time annotations: Preferred_unit: tag: Preferred_unit value: hours storage_units: tag: storage_units value: h description: The time activated sludge remains in reactor title: sludge retention time from_schema: https://w3id.org/nmdc/nmdc keywords: - time slot_uri: MIXS:0000669 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true sodium: name: sodium annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Sodium concentration in the sample title: sodium examples: - value: 10.5 mg/L from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000428 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true soil_horizon: name: soil_horizon description: Specific layer in the land area which measures parallel to the soil surface and possesses physical characteristics which differ from the layers above and beneath title: soil horizon examples: - value: A horizon from_schema: https://w3id.org/nmdc/nmdc keywords: - horizon - soil slot_uri: MIXS:0001082 range: SoilHorizonEnum soil_texture_meth: name: soil_texture_meth description: Reference or method used in determining soil texture title: soil texture method examples: - value: https://uwlab.soils.wisc.edu/wp-content/uploads/sites/17/2015/09/particle_size.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - method - soil - texture slot_uri: MIXS:0000336 range: string soil_type: name: soil_type annotations: Expected_value: tag: Expected_value value: ENVO:00001998 description: Description of the soil type or classification. This field accepts terms under soil (http://purl.obolibrary.org/obo/ENVO_00001998). Multiple terms can be separated by pipes title: soil type examples: - value: plinthosol [ENVO:00002250] from_schema: https://w3id.org/nmdc/nmdc keywords: - soil - type slot_uri: MIXS:0000332 range: TextValue soil_type_meth: name: soil_type_meth description: Reference or method used in determining soil series name or other lower-level classification title: soil type method examples: - value: https://www.lrh.usace.army.mil/Portals/38/docs/PR/BluestoneSFEIS/Appendix%20K-Soil%20Descriptions.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - method - soil - type slot_uri: MIXS:0000334 range: TextValue solar_irradiance: name: solar_irradiance annotations: Preferred_unit: tag: Preferred_unit value: kilowatts per square meter per day, ergs per square centimeter per second storage_units: tag: storage_units value: kW/m2/d|erg/cm2/s description: The amount of solar energy that arrives at a specific area of a surface during a specific time interval title: solar irradiance examples: - value: 1.36 kW/m2/d from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000112 range: QuantityValue multivalued: false pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true soluble_inorg_mat: name: soluble_inorg_mat annotations: Expected_value: tag: Expected_value value: soluble inorganic material name;measurement value Preferred_unit: tag: Preferred_unit value: gram, microgram, mole per liter, gram per liter, parts per million description: Concentration of substances such as ammonia, road-salt, sea-salt, cyanide, hydrogen sulfide, thiocyanates, thiosulfates, etc title: soluble inorganic material from_schema: https://w3id.org/nmdc/nmdc keywords: - inorganic - material - soluble string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000672 range: TextValue multivalued: true inlined_as_list: true soluble_org_mat: name: soluble_org_mat annotations: Expected_value: tag: Expected_value value: soluble organic material name;measurement value Preferred_unit: tag: Preferred_unit value: gram, microgram, mole per liter, gram per liter, parts per million description: Concentration of substances such as urea, fruit sugars, soluble proteins, drugs, pharmaceuticals, etc title: soluble organic material from_schema: https://w3id.org/nmdc/nmdc keywords: - material - organic - soluble string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000673 range: TextValue multivalued: true inlined_as_list: true soluble_react_phosp: name: soluble_react_phosp annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L|ug/L' description: Concentration of soluble reactive phosphorus title: soluble reactive phosphorus examples: - value: 0.1 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - phosphorus - soluble slot_uri: MIXS:0000738 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true source_mat_id: name: source_mat_id annotations: Expected_value: tag: Expected_value value: 'for cultures of microorganisms: identifiers for two culture collections; for other material a unique arbitrary identifer' description: A unique identifier assigned to a material sample (as defined by http://rs.tdwg.org/dwc/terms/materialSampleID, and as opposed to a particular digital record of a material sample) used for extracting nucleic acids, and subsequent sequencing. The identifier can refer either to the original material collected or to any derived sub-samples. The INSDC qualifiers /specimen_voucher, /bio_material, or /culture_collection may or may not share the same value as the source_mat_id field. For instance, the /specimen_voucher qualifier and source_mat_id may both contain 'UAM:Herps:14' , referring to both the specimen voucher and sampled tissue with the same identifier. However, the /culture_collection qualifier may refer to a value from an initial culture (e.g. ATCC:11775) while source_mat_id would refer to an identifier from some derived culture from which the nucleic acids were extracted (e.g. xatc123 or ark:/2154/R2) title: source material identifiers examples: - value: MPI012345 from_schema: https://w3id.org/nmdc/nmdc keywords: - identifier - material - source slot_uri: MIXS:0000026 range: TextValue multivalued: false space_typ_state: name: space_typ_state description: Customary or normal state of the space title: space typical state examples: - value: typically occupied from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000770 range: SpaceTypStateEnum specific: name: specific description: 'The building specifications. If design is chosen, indicate phase: conceptual, schematic, design development, construction documents' title: specifications examples: - value: construction from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000836 range: SpecificEnum specific_humidity: name: specific_humidity annotations: Preferred_unit: tag: Preferred_unit value: gram of air, kilogram of air storage_units: tag: storage_units value: g/kg description: The mass of water vapour in a unit mass of moist air, usually expressed as grams of vapour per kilogram of air, or, in air conditioning, as grains per pound title: specific humidity examples: - value: 15 per kilogram of air from_schema: https://w3id.org/nmdc/nmdc keywords: - humidity slot_uri: MIXS:0000214 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true sr_dep_env: name: sr_dep_env description: Source rock depositional environment (https://en.wikipedia.org/wiki/Source_rock). If "other" is specified, please propose entry in "additional info" field title: source rock depositional environment examples: - value: Marine from_schema: https://w3id.org/nmdc/nmdc keywords: - environment - source slot_uri: MIXS:0000996 range: SrDepEnvEnum sr_geol_age: name: sr_geol_age description: 'Geological age of source rock (Additional info: https://en.wikipedia.org/wiki/Period_(geology)). If "other" is specified, please propose entry in "additional info" field' title: source rock geological age examples: - value: Silurian from_schema: https://w3id.org/nmdc/nmdc keywords: - age - source slot_uri: MIXS:0000997 range: GeolAgeEnum sr_kerog_type: name: sr_kerog_type description: 'Origin of kerogen. Type I: Algal (aquatic), Type II: planktonic and soft plant material (aquatic or terrestrial), Type III: terrestrial woody/ fibrous plant material (terrestrial), Type IV: oxidized recycled woody debris (terrestrial) (additional information: https://en.wikipedia.org/wiki/Kerogen). If "other" is specified, please propose entry in "additional info" field' title: source rock kerogen type examples: - value: Type IV from_schema: https://w3id.org/nmdc/nmdc keywords: - source - type slot_uri: MIXS:0000994 range: SrKerogTypeEnum sr_lithology: name: sr_lithology description: Lithology of source rock (https://en.wikipedia.org/wiki/Source_rock). If "other" is specified, please propose entry in "additional info" field title: source rock lithology examples: - value: Coal from_schema: https://w3id.org/nmdc/nmdc keywords: - lithology - source slot_uri: MIXS:0000995 range: SrLithologyEnum standing_water_regm: name: standing_water_regm description: Treatment involving an exposure to standing water during a plant's life span, types can be flood water or standing water, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens title: standing water regimen examples: - value: standing water;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen - water slot_uri: MIXS:0001069 range: TextValue multivalued: true inlined_as_list: true store_cond: name: store_cond description: Explain how and for how long the soil sample was stored before DNA extraction (fresh/frozen/other) title: storage conditions examples: - value: -20 degree Celsius freezer;P2Y10D from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - storage slot_uri: MIXS:0000327 range: TextValue substructure_type: name: substructure_type description: The substructure or under building is that largely hidden section of the building which is built off the foundations to the ground floor level title: substructure type examples: - value: basement from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000767 range: SubstructureTypeEnum multivalued: true sulfate: name: sulfate annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L' description: Concentration of sulfate in the sample title: sulfate examples: - value: 5 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - sulfate slot_uri: MIXS:0000423 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true sulfate_fw: name: sulfate_fw annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: Original sulfate concentration in the hydrocarbon resource title: sulfate in formation water from_schema: https://w3id.org/nmdc/nmdc keywords: - sulfate - water slot_uri: MIXS:0000407 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true sulfide: name: sulfide annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L' description: Concentration of sulfide in the sample title: sulfide examples: - value: 2 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - sulfide slot_uri: MIXS:0000424 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true surf_air_cont: name: surf_air_cont description: Contaminant identified on surface title: surface-air contaminant examples: - value: radon from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000759 range: SurfAirContEnum recommended: true multivalued: true surf_humidity: name: surf_humidity annotations: Preferred_unit: tag: Preferred_unit value: percentage storage_units: tag: storage_units value: '%' description: 'Surfaces: water activity as a function of air and material moisture' title: surface humidity comments: - percent or float? examples: - value: '0.1' from_schema: https://w3id.org/nmdc/nmdc keywords: - humidity - surface slot_uri: MIXS:0000123 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true surf_material: name: surf_material description: Surface materials at the point of sampling title: surface material examples: - value: wood from_schema: https://w3id.org/nmdc/nmdc keywords: - material - surface slot_uri: MIXS:0000758 range: SurfMaterialEnum surf_moisture: name: surf_moisture annotations: Preferred_unit: tag: Preferred_unit value: parts per million, gram per cubic meter, gram per square meter storage_units: tag: storage_units value: '[ppm]|g/m2|g/m3' description: Water held on a surface title: surface moisture examples: - value: 0.01 g/m2 from_schema: https://w3id.org/nmdc/nmdc keywords: - moisture - surface slot_uri: MIXS:0000128 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true surf_moisture_ph: name: surf_moisture_ph description: ph measurement of surface title: surface moisture pH examples: - value: '7' from_schema: https://w3id.org/nmdc/nmdc keywords: - moisture - ph - surface slot_uri: MIXS:0000760 range: float recommended: true surf_temp: name: surf_temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Temperature of the surface at the time of sampling title: surface temperature examples: - value: 15 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - surface - temperature slot_uri: MIXS:0000125 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true suspend_part_matter: name: suspend_part_matter annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: Concentration of suspended particulate matter title: suspended particulate matter examples: - value: 0.5 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - particle - particulate - suspended slot_uri: MIXS:0000741 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true suspend_solids: name: suspend_solids annotations: Expected_value: tag: Expected_value value: suspended solid name;measurement value Preferred_unit: tag: Preferred_unit value: gram, microgram, milligram per liter, mole per liter, gram per liter, part per million description: Concentration of substances including a wide variety of material, such as silt, decaying plant and animal matter; can include multiple substances title: suspended solids from_schema: https://w3id.org/nmdc/nmdc keywords: - solids - suspended string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000150 range: TextValue multivalued: true inlined_as_list: true tan: name: tan annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: 'Total Acid Number (TAN) is a measurement of acidity that is determined by the amount of potassium hydroxide in milligrams that is needed to neutralize the acids in one gram of oil. It is an important quality measurement of crude oil. (source: https://en.wikipedia.org/wiki/Total_acid_number)' title: total acid number from_schema: https://w3id.org/nmdc/nmdc keywords: - number - total slot_uri: MIXS:0000120 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true target_gene: name: target_gene description: Targeted gene or locus name for marker gene studies title: target gene examples: - value: 16S rRNA, 18S rRNA, nif, amoA, rpo from_schema: https://w3id.org/nmdc/nmdc keywords: - target slot_uri: MIXS:0000044 range: TargetGeneEnum target_subfragment: name: target_subfragment description: Name of subfragment of a gene or locus. Important to e.g. identify special regions on marker genes like V6 on 16S rRNA title: target subfragment examples: - value: V6, V9, ITS from_schema: https://w3id.org/nmdc/nmdc keywords: - target slot_uri: MIXS:0000045 range: TextValue temp: name: temp annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: Temperature of the sample at the time of sampling title: temperature examples: - value: 25 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - temperature slot_uri: MIXS:0000113 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true temp_out: name: temp_out annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius storage_units: tag: storage_units value: Cel description: The recorded temperature value at sampling time outside title: temperature outside house examples: - value: 5 Cel from_schema: https://w3id.org/nmdc/nmdc keywords: - house - temperature slot_uri: MIXS:0000197 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tertiary_treatment: name: tertiary_treatment annotations: Expected_value: tag: Expected_value value: tertiary treatment type description: The process providing a final treatment stage to raise the effluent quality before it is discharged to the receiving environment title: tertiary treatment from_schema: https://w3id.org/nmdc/nmdc keywords: - treatment slot_uri: MIXS:0000352 range: TextValue tidal_stage: name: tidal_stage description: Stage of tide title: tidal stage examples: - value: high tide from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000750 range: TidalStageEnum tillage: name: tillage description: Note method(s) used for tilling title: history/tillage examples: - value: chisel from_schema: https://w3id.org/nmdc/nmdc keywords: - history slot_uri: MIXS:0001081 range: TillageEnum multivalued: true tiss_cult_growth_med: name: tiss_cult_growth_med description: Description of plant tissue culture growth media used title: tissue culture growth media examples: - value: https://link.springer.com/content/pdf/10.1007/BF02796489.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - culture - growth slot_uri: MIXS:0001070 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*)|.*)$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL}|{text})$ interpolated: true partial_match: true toluene: name: toluene annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of toluene in the sample title: toluene from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000154 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_carb: name: tot_carb annotations: storage_units: tag: storage_units value: ug/L|% description: Total carbon content title: total carbon from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - total slot_uri: MIXS:0000525 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_depth_water_col: name: tot_depth_water_col annotations: Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: Measurement of total depth of water column title: total depth of water column examples: - value: 500 m from_schema: https://w3id.org/nmdc/nmdc keywords: - depth - total - water slot_uri: MIXS:0000634 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_diss_nitro: name: tot_diss_nitro annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter storage_units: tag: storage_units value: ug/L|umol/L description: 'Total dissolved nitrogen concentration, reported as nitrogen, measured by: total dissolved nitrogen = NH4 + NO3NO2 + dissolved organic nitrogen' title: total dissolved nitrogen examples: - value: 40 ug/L from_schema: https://w3id.org/nmdc/nmdc keywords: - dissolved - nitrogen - total slot_uri: MIXS:0000744 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_inorg_nitro: name: tot_inorg_nitro annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter storage_units: tag: storage_units value: ug/L description: Total inorganic nitrogen content title: total inorganic nitrogen examples: - value: 40 ug/L from_schema: https://w3id.org/nmdc/nmdc keywords: - inorganic - nitrogen - total slot_uri: MIXS:0000745 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_iron: name: tot_iron annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, milligram per kilogram storage_units: tag: storage_units value: mg/L|mg/kg description: Concentration of total iron in the sample title: total iron from_schema: https://w3id.org/nmdc/nmdc keywords: - total slot_uri: MIXS:0000105 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_nitro: name: tot_nitro annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, micromole per liter, milligram per liter storage_units: tag: storage_units value: mg/L|ug/L|umol/L|% description: 'Total nitrogen concentration of water samples, calculated by: total nitrogen = total dissolved nitrogen + particulate nitrogen. Can also be measured without filtering, reported as nitrogen' title: total nitrogen concentration examples: - value: 50 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - concentration - nitrogen - total slot_uri: MIXS:0000102 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_nitro_cont_meth: name: tot_nitro_cont_meth description: Reference or method used in determining the total nitrogen title: total nitrogen content method examples: - value: https://currentprotocols.onlinelibrary.wiley.com/doi/abs/10.1002/0471142913.fab0102s00 from_schema: https://w3id.org/nmdc/nmdc keywords: - content - method - nitrogen - total slot_uri: MIXS:0000338 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true tot_nitro_content: name: tot_nitro_content annotations: storage_units: tag: storage_units value: mg/L|ug/L|umol/L|% description: Total nitrogen content of the sample title: total nitrogen content examples: - value: 5 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - content - nitrogen - total slot_uri: MIXS:0000530 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_org_c_meth: name: tot_org_c_meth description: Reference or method used in determining total organic carbon title: total organic carbon method examples: - value: https://www.epa.gov/sites/production/files/2015-12/documents/9060a.pdf from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - method - organic - total slot_uri: MIXS:0000337 range: string pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true tot_org_carb: name: tot_org_carb annotations: Preferred_unit: tag: Preferred_unit value: gram Carbon per kilogram sample material storage_units: tag: storage_units value: mg/L description: Total organic carbon content title: total organic carbon examples: - value: 5 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - organic - total slot_uri: MIXS:0000533 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_part_carb: name: tot_part_carb annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, micromole per liter storage_units: tag: storage_units value: ug/L|umol/L description: Total particulate carbon content title: total particulate carbon examples: - value: 35 umol/L from_schema: https://w3id.org/nmdc/nmdc keywords: - carbon - particle - particulate - total slot_uri: MIXS:0000747 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_phosp: name: tot_phosp annotations: Preferred_unit: tag: Preferred_unit value: micromole per liter, milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L|umol/L' description: 'Total phosphorus concentration in the sample, calculated by: total phosphorus = total dissolved phosphorus + particulate phosphorus' title: total phosphorus examples: - value: 0.03 mg/L from_schema: https://w3id.org/nmdc/nmdc keywords: - phosphorus - total slot_uri: MIXS:0000117 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_phosphate: name: tot_phosphate annotations: Preferred_unit: tag: Preferred_unit value: microgram per liter, micromole per liter storage_units: tag: storage_units value: ug/L|umol/L description: Total amount or concentration of phosphate title: total phosphate from_schema: https://w3id.org/nmdc/nmdc keywords: - phosphate - total slot_uri: MIXS:0000689 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tot_sulfur: name: tot_sulfur annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of total sulfur in the sample title: total sulfur from_schema: https://w3id.org/nmdc/nmdc keywords: - sulfur - total slot_uri: MIXS:0000419 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true train_line: name: train_line description: The subway line name title: train line examples: - value: red from_schema: https://w3id.org/nmdc/nmdc keywords: - train slot_uri: MIXS:0000837 range: TrainLineEnum train_stat_loc: name: train_stat_loc description: The train station collection location title: train station collection location examples: - value: forest hills from_schema: https://w3id.org/nmdc/nmdc keywords: - location - train slot_uri: MIXS:0000838 range: TrainStatLocEnum train_stop_loc: name: train_stop_loc description: The train stop collection location title: train stop collection location examples: - value: end from_schema: https://w3id.org/nmdc/nmdc keywords: - location - stop - train slot_uri: MIXS:0000839 range: TrainStopLocEnum turbidity: name: turbidity annotations: storage_units: tag: storage_units value: '[NTU]|[FNU]' description: Measure of the amount of cloudiness or haziness in water caused by individual particles title: turbidity examples: - value: 0.3 [NTU] from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000191 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tvdss_of_hcr_press: name: tvdss_of_hcr_press annotations: Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: True vertical depth subsea (TVDSS) of the hydrocarbon resource where the original pressure was measured (e.g. 1578 m) title: depth (TVDSS) of hydrocarbon resource pressure from_schema: https://w3id.org/nmdc/nmdc keywords: - depth - hydrocarbon - pressure - resource slot_uri: MIXS:0000397 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true tvdss_of_hcr_temp: name: tvdss_of_hcr_temp annotations: Preferred_unit: tag: Preferred_unit value: meter storage_units: tag: storage_units value: m description: True vertical depth subsea (TVDSS) of the hydrocarbon resource where the original temperature was measured (e.g. 1345 m) title: depth (TVDSS) of hydrocarbon resource temperature from_schema: https://w3id.org/nmdc/nmdc keywords: - depth - hydrocarbon - resource - temperature slot_uri: MIXS:0000394 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true typ_occup_density: name: typ_occup_density description: Customary or normal density of occupants title: typical occupant density examples: - value: '25' from_schema: https://w3id.org/nmdc/nmdc keywords: - density slot_uri: MIXS:0000771 range: float ventilation_rate: name: ventilation_rate annotations: Preferred_unit: tag: Preferred_unit value: cubic meter per minute, liters per second storage_units: tag: storage_units value: L/s|m3/min description: Ventilation rate of the system in the sampled premises title: ventilation rate examples: - value: 750 m3/min from_schema: https://w3id.org/nmdc/nmdc keywords: - rate slot_uri: MIXS:0000114 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true ventilation_type: name: ventilation_type annotations: Expected_value: tag: Expected_value value: ventilation type name description: Ventilation system used in the sampled premises title: ventilation type examples: - value: Operable windows from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000756 range: TextValue multivalued: false vfa: name: vfa annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of Volatile Fatty Acids in the sample title: volatile fatty acids from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000152 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true vfa_fw: name: vfa_fw annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter storage_units: tag: storage_units value: mg/L description: Original volatile fatty acid concentration in the hydrocarbon resource title: vfa in formation water from_schema: https://w3id.org/nmdc/nmdc keywords: - water slot_uri: MIXS:0000408 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true vis_media: name: vis_media annotations: Expected_value: tag: Expected_value value: enumeration description: The building visual media title: visual media examples: - value: 3D scans from_schema: https://w3id.org/nmdc/nmdc string_serialization: '[photos|videos|commonly of the building|site context (adjacent buildings, vegetation, terrain, streets)|interiors|equipment|3D scans]' slot_uri: MIXS:0000840 viscosity: name: viscosity annotations: Expected_value: tag: Expected_value value: measurement value;measurement value Preferred_unit: tag: Preferred_unit value: cP at degree Celsius description: A measure of oil's resistance to gradual deformation by shear stress or tensile stress (e.g. 3.5 cp; 100 °C) title: viscosity from_schema: https://w3id.org/nmdc/nmdc string_serialization: '{float} {unit};{float} {unit}' slot_uri: MIXS:0000126 range: TextValue volatile_org_comp: name: volatile_org_comp annotations: Expected_value: tag: Expected_value value: volatile organic compound name;measurement value Preferred_unit: tag: Preferred_unit value: microgram per cubic meter, parts per million, nanogram per liter description: Concentration of carbon-based chemicals that easily evaporate at room temperature; can report multiple volatile organic compounds by entering numeric values preceded by name of compound title: volatile organic compounds examples: - value: formaldehyde;500 nanogram per liter from_schema: https://w3id.org/nmdc/nmdc keywords: - organic string_serialization: '{text};{float} {unit}' slot_uri: MIXS:0000115 range: TextValue multivalued: true inlined_as_list: true wall_area: name: wall_area annotations: Preferred_unit: tag: Preferred_unit value: square meter storage_units: tag: storage_units value: m2 description: The total area of the sampled room's walls title: wall area from_schema: https://w3id.org/nmdc/nmdc keywords: - area - wall slot_uri: MIXS:0000198 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true wall_const_type: name: wall_const_type description: The building class of the wall defined by the composition of the building elements and fire-resistance rating title: wall construction type examples: - value: fire resistive from_schema: https://w3id.org/nmdc/nmdc keywords: - type - wall slot_uri: MIXS:0000841 range: WallConstTypeEnum wall_finish_mat: name: wall_finish_mat description: The material utilized to finish the outer most layer of the wall title: wall finish material examples: - value: wood from_schema: https://w3id.org/nmdc/nmdc keywords: - material - wall slot_uri: MIXS:0000842 range: WallFinishMatEnum wall_height: name: wall_height annotations: Preferred_unit: tag: Preferred_unit value: centimeter storage_units: tag: storage_units value: cm description: The average height of the walls in the sampled room title: wall height from_schema: https://w3id.org/nmdc/nmdc keywords: - height - wall slot_uri: MIXS:0000221 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true wall_loc: name: wall_loc description: The relative location of the wall within the room title: wall location examples: - value: north from_schema: https://w3id.org/nmdc/nmdc keywords: - location - wall slot_uri: MIXS:0000843 range: CompassDirections8Enum wall_surf_treatment: name: wall_surf_treatment description: The surface treatment of interior wall title: wall surface treatment examples: - value: paneling from_schema: https://w3id.org/nmdc/nmdc keywords: - surface - treatment - wall slot_uri: MIXS:0000845 range: WallSurfTreatmentEnum wall_texture: name: wall_texture description: The feel, appearance, or consistency of a wall surface title: wall texture examples: - value: popcorn from_schema: https://w3id.org/nmdc/nmdc keywords: - texture - wall slot_uri: MIXS:0000846 range: CeilingWallTextureEnum wall_thermal_mass: name: wall_thermal_mass annotations: Preferred_unit: tag: Preferred_unit value: joule per degree Celsius storage_units: tag: storage_units value: J/K description: The ability of the wall to provide inertia against temperature fluctuations. Generally this means concrete or concrete block that is either exposed or covered only with paint title: wall thermal mass from_schema: https://w3id.org/nmdc/nmdc keywords: - mass - wall slot_uri: MIXS:0000222 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true wall_water_mold: name: wall_water_mold description: Signs of the presence of mold or mildew on a wall title: wall signs of water/mold examples: - value: no presence of mold visible from_schema: https://w3id.org/nmdc/nmdc keywords: - wall slot_uri: MIXS:0000844 range: MoldVisibilityEnum wastewater_type: name: wastewater_type annotations: Expected_value: tag: Expected_value value: wastewater type name description: The origin of wastewater such as human waste, rainfall, storm drains, etc title: wastewater type from_schema: https://w3id.org/nmdc/nmdc keywords: - type slot_uri: MIXS:0000353 range: TextValue water_cont_soil_meth: name: water_cont_soil_meth description: Reference or method used in determining the water content of soil title: water content method from_schema: https://w3id.org/nmdc/nmdc keywords: - content - method - water slot_uri: MIXS:0000323 range: string water_content: name: water_content annotations: Preferred_unit: tag: Preferred_unit value: gram per gram or cubic centimeter per cubic centimeter description: Water content measurement title: water content from_schema: https://w3id.org/nmdc/nmdc keywords: - content - water slot_uri: MIXS:0000185 range: string pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true water_current: name: water_current annotations: Preferred_unit: tag: Preferred_unit value: cubic meter per second, knots storage_units: tag: storage_units value: '[kn_i]|m3/s' description: Measurement of magnitude and direction of flow within a fluid title: water current examples: - value: 10 m3/s from_schema: https://w3id.org/nmdc/nmdc keywords: - water slot_uri: MIXS:0000203 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true water_cut: name: water_cut annotations: Preferred_unit: tag: Preferred_unit value: percent storage_units: tag: storage_units value: '%' description: Current amount of water (%) in a produced fluid stream; or the average of the combined streams title: water cut comments: - percent or float? examples: - value: 45% from_schema: https://w3id.org/nmdc/nmdc keywords: - water slot_uri: MIXS:0000454 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true water_feat_size: name: water_feat_size annotations: Preferred_unit: tag: Preferred_unit value: square meter storage_units: tag: storage_units value: m2 description: The size of the water feature title: water feature size from_schema: https://w3id.org/nmdc/nmdc keywords: - feature - size - water slot_uri: MIXS:0000223 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true water_feat_type: name: water_feat_type description: The type of water feature present within the building being sampled title: water feature type examples: - value: stream from_schema: https://w3id.org/nmdc/nmdc keywords: - feature - type - water slot_uri: MIXS:0000847 range: WaterFeatTypeEnum water_prod_rate: name: water_prod_rate annotations: Preferred_unit: tag: Preferred_unit value: cubic meter per day storage_units: tag: storage_units value: m3/d description: Water production rates per well (e.g. 987 m3 / day) title: water production rate from_schema: https://w3id.org/nmdc/nmdc keywords: - production - rate - water slot_uri: MIXS:0000453 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true water_temp_regm: name: water_temp_regm annotations: Preferred_unit: tag: Preferred_unit value: degree Celsius description: Information about treatment involving an exposure to water with varying degree of temperature, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens title: water temperature regimen examples: - value: 15 degree Celsius;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen - temperature - water slot_uri: MIXS:0000590 range: TextValue multivalued: true inlined_as_list: true watering_regm: name: watering_regm annotations: Preferred_unit: tag: Preferred_unit value: milliliter, liter description: Information about treatment involving an exposure to watering frequencies, treatment regimen including how many times the treatment was repeated, how long each treatment lasted, and the start and end time of the entire treatment; can include multiple regimens title: watering regimen examples: - value: 1 liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M from_schema: https://w3id.org/nmdc/nmdc keywords: - regimen - water slot_uri: MIXS:0000591 range: TextValue multivalued: true inlined_as_list: true weekday: name: weekday description: The day of the week when sampling occurred title: weekday examples: - value: Sunday from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000848 range: WeekdayEnum win: name: win description: 'A unique identifier of a well or wellbore. This is part of the Global Framework for Well Identification initiative which is compiled by the Professional Petroleum Data Management Association (PPDM) in an effort to improve well identification systems. (Supporting information: https://ppdm.org/ and http://dl.ppdm.org/dl/690)' title: well identification number from_schema: https://w3id.org/nmdc/nmdc keywords: - identifier - number slot_uri: MIXS:0000297 range: TextValue recommended: true wind_direction: name: wind_direction annotations: Preferred_unit: tag: Preferred_unit value: degrees or cardinal direction description: Wind direction is the direction from which a wind originates title: wind direction from_schema: https://w3id.org/nmdc/nmdc keywords: - direction - wind slot_uri: MIXS:0000757 range: TextValue wind_speed: name: wind_speed annotations: storage_units: tag: storage_units value: km/h|m/s description: speed of wind measured at the time of sampling title: wind speed examples: - value: 21 km/h from_schema: https://w3id.org/nmdc/nmdc keywords: - speed - wind slot_uri: MIXS:0000118 range: QuantityValue pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true window_cond: name: window_cond description: The physical condition of the window at the time of sampling title: window condition examples: - value: rupture from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - window slot_uri: MIXS:0000849 range: DamagedRupturedEnum window_cover: name: window_cover description: The type of window covering title: window covering examples: - value: curtains from_schema: https://w3id.org/nmdc/nmdc keywords: - window slot_uri: MIXS:0000850 range: WindowCoverEnum window_horiz_pos: name: window_horiz_pos description: The horizontal position of the window on the wall title: window horizontal position examples: - value: middle from_schema: https://w3id.org/nmdc/nmdc keywords: - window slot_uri: MIXS:0000851 range: WindowHorizPosEnum window_loc: name: window_loc description: The relative location of the window within the room title: window location examples: - value: west from_schema: https://w3id.org/nmdc/nmdc keywords: - location - window slot_uri: MIXS:0000852 range: CompassDirections8Enum window_mat: name: window_mat description: The type of material used to finish a window title: window material examples: - value: wood from_schema: https://w3id.org/nmdc/nmdc keywords: - material - window slot_uri: MIXS:0000853 range: WindowMatEnum window_open_freq: name: window_open_freq description: The number of times windows are opened per week title: window open frequency from_schema: https://w3id.org/nmdc/nmdc keywords: - frequency - window slot_uri: MIXS:0000246 range: TextValue window_size: name: window_size annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: inch, meter description: The window's length and width title: window area/size from_schema: https://w3id.org/nmdc/nmdc keywords: - window string_serialization: '{float} {unit} x {float} {unit}' slot_uri: MIXS:0000224 range: TextValue window_status: name: window_status description: Defines whether the windows were open or closed during environmental testing title: window status examples: - value: open from_schema: https://w3id.org/nmdc/nmdc keywords: - status - window slot_uri: MIXS:0000855 range: WindowStatusEnum window_type: name: window_type description: The type of windows title: window type examples: - value: fixed window from_schema: https://w3id.org/nmdc/nmdc keywords: - type - window slot_uri: MIXS:0000856 range: WindowTypeEnum window_vert_pos: name: window_vert_pos description: The vertical position of the window on the wall title: window vertical position examples: - value: middle from_schema: https://w3id.org/nmdc/nmdc keywords: - window slot_uri: MIXS:0000857 range: WindowVertPosEnum window_water_mold: name: window_water_mold description: Signs of the presence of mold or mildew on the window title: window signs of water/mold examples: - value: no presence of mold visible from_schema: https://w3id.org/nmdc/nmdc keywords: - window slot_uri: MIXS:0000854 range: MoldVisibilityEnum xylene: name: xylene annotations: Preferred_unit: tag: Preferred_unit value: milligram per liter, parts per million storage_units: tag: storage_units value: '[ppm]|mg/L' description: Concentration of xylene in the sample title: xylene from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000156 range: QuantityValue recommended: true pattern: ^[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?( *- *[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?)? *.*$ structured_pattern: syntax: ^{scientific_float}( *- *{scientific_float})? *{text}$ interpolated: true partial_match: true estimated_size: name: estimated_size description: The estimated size of the genome prior to sequencing. Of particular importance in the sequencing of (eukaryotic) genome which could remain in draft form for a long or unspecified period title: estimated size notes: - The maximum_value here (1e11 bp = 100,000 Mb) is the eukaryote ceiling from JGI esplims. The tighter microbe ceiling (5,000 Mb) and the category-conditional required rule are enforced in submission-schema via class rules on IsolateInterface, keyed on biosafety_mat_cat. comments: - JGI reports values in megabases (Mb); NMDC stores them in base pairs (bp). examples: - object: 300000 from_schema: https://w3id.org/nmdc/nmdc keywords: - size slot_uri: MIXS:0000024 range: integer minimum_value: 1 maximum_value: 100000000000 ploidy: name: ploidy description: The ploidy level of the genome (e.g. allopolyploid, haploid, diploid, triploid, tetraploid). It has implications for the downstream study of duplicated gene and regions of the genomes (and perhaps for difficulties in assembly). For terms, please select terms listed under class ploidy (PATO:001374) of Phenotypic Quality Ontology (PATO), and for a browser of PATO (v 2018-03-27) please refer to http://purl.bioontology.org/ontology/PATO title: ploidy from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000021 range: PloidyEnum ref_biomaterial: name: ref_biomaterial description: Primary publication if isolated before genome publication; otherwise, primary genome report title: reference for biomaterial examples: - value: doi:10.1016/j.syapm.2018.01.009 from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000025 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true isol_growth_condt: name: isol_growth_condt description: Publication reference in the form of pubmed ID (pmid), digital object identifier (doi) or url for isolation and growth condition specifications of the organism/material title: isolation and growth condition examples: - value: doi:10.1016/j.syapm.2018.01.009 from_schema: https://w3id.org/nmdc/nmdc keywords: - condition - growth - isolation slot_uri: MIXS:0000003 range: TextValue pattern: ^(PMID:\d+|doi:10\.\d{2,9}/.*|https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*))$ structured_pattern: syntax: ^({PMID}|{DOI}|{URL})$ interpolated: true partial_match: true lib_layout: name: lib_layout description: Specify whether to expect single, paired, or other configuration of reads title: library layout examples: - value: paired from_schema: https://w3id.org/nmdc/nmdc keywords: - library slot_uri: MIXS:0000041 range: LibLayoutEnum adapters: name: adapters description: Adapters provide priming sequences for both amplification and sequencing of the sample-library fragments. Both adapters should be reported; in uppercase letters title: adapters examples: - value: AATGATACGGCGACCACCGAGATCTACACGCT;CAAGCAGAAGACGGCATACGAGAT from_schema: https://w3id.org/nmdc/nmdc slot_uri: MIXS:0000048 pattern: ^[ACGT];[ACGT]$ structured_pattern: syntax: ^{dna_bases};{dna_bases}$ interpolated: true partial_match: true samp_collec_device: name: samp_collec_device description: 'The device used to collect an environmental sample. Recommended values are subclasses of specimen collection device (http://purl.obolibrary.org/obo/OBI_0002814). OBI itself contains only swab/wipe subclasses; environmental sampling devices (corers, grab samplers, passive samplers, etc.) are defined in GENEPIO under the same OBI:0002814 parent. Free-text values are accepted for backward compatibility; new submissions should prefer the form: label [PREFIX:LOCALID].' title: sample collection device comments: - GENEPIO's subtree of OBI:0002814 includes grouping classes such as GENEPIO:0100941 (grab sampling device), GENEPIO:0100942 (composite sampling device), GENEPIO:0100943 (core sampling device), and GENEPIO:0100948 (passive sampling device). - ENVO has no device classes; do not use ENVO terms here. - 'Existing NMDC biosamples populate this slot with free text (e.g., "corer", "Van Dorn"). New submissions are encouraged to use the form: label [PREFIX:LOCALID].' examples: - value: specimen collection swab stick [OBI:0002820] - value: PONAR grab sampler [GENEPIO:0100929] - value: trowel from_schema: https://w3id.org/nmdc/nmdc keywords: - device - sample slot_uri: MIXS:0000002 range: string pattern: ^([^\[\]]+|.+ \[[A-Za-z][A-Za-z0-9_]*:[A-Za-z0-9_]+\])$ samp_collec_method: name: samp_collec_method description: The method employed for collecting the sample title: sample collection method from_schema: https://w3id.org/nmdc/nmdc structured_aliases: - literal_form: samp_collect_method contexts: - https://github.com/GenomicsStandardsConsortium/mixs/releases/tag/v6.3.0 keywords: - method - sample slot_uri: MIXS:0001225 range: string mixs_env_triad_field: name: mixs_env_triad_field annotations: tooltip: tag: tooltip value: The MIxS environmental triad provides context about where a sample was collected and what it consists of. description: The MIxS environmental triad provides context about where a sample was collected and what it consists of. Its component slots capture the biome that the sample was found in, nearby geographical features that might influence the organisms in the sample, and the substance that was displaced in the process of collecting the sample. Careful population of these slots makes it easier for data users to find samples that are similar, not just in terms of textual values, but through ontological relationships. Furthermore, NMDC requires that its three component slots are populated because the INSDC Biosample databases require that they are populated because the MIxS standard from the GSC requires that they are populated. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/EnvironmentOntology/envo/wiki/Using-ENVO-with-MIxS created_by: orcid:0000-0002-5004-3362 contributors: - orcid:0000-0001-9076-6066 abstract: true range: ControlledIdentifiedTermValue chemical_conversion_category: name: chemical_conversion_category description: The type of chemical conversion process. from_schema: https://w3id.org/nmdc/nmdc range: ChemicalConversionCategoryEnum substances_volume: name: substances_volume annotations: storage_units: tag: storage_units value: mL description: The volume of the combined substances that was included in a ChemicalConversionProcess. from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue biosample_categories: name: biosample_categories title: Categories the biosample belongs to from_schema: https://w3id.org/nmdc/nmdc range: BiosampleCategoryEnum multivalued: true collected_from: name: collected_from description: The Site from which a Biosample was collected todos: - add an OBO slot_uri ? comments: - this illustrates implementing a Biosample relation with a (binary) slot from_schema: https://w3id.org/nmdc/nmdc range: FieldResearchSite bulk_elect_conductivity: name: bulk_elect_conductivity annotations: storage_units: tag: storage_units value: mS/cm description: Electrical conductivity is a measure of the ability to carry electric current, which is mostly dictated by the chemistry of and amount of water. title: bulk electrical conductivity comments: - Provide the value output of the field instrument. examples: - description: The conductivity measurement was 0.017 millisiemens per centimeter. object: has_raw_value: 0.017 mS/cm has_numeric_value: 0.017 has_unit: mS/cm from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue subsurface_depth: name: subsurface_depth annotations: storage_units: tag: storage_units value: m from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue env_package: name: env_package description: MIxS extension for reporting of measurements and observations obtained from one or more of the environments where the sample was obtained. All environmental packages listed here are further defined in separate subtables. By giving the name of the environmental package, a selection of fields can be made from the subtables and can be reported notes: - no longer in MIxS as of 6.0? from_schema: https://w3id.org/nmdc/nmdc aliases: - environmental package range: TextValue zinc: name: zinc annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: mg/kg (ppm) occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]|mg/kg|mg/L' description: Concentration of zinc in the sample title: zinc examples: - value: 2.5 mg/kg from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 range: QuantityValue manganese: name: manganese annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: mg/kg (ppm) occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]|mg/kg|mg/L' description: Concentration of manganese in the sample title: manganese examples: - value: 24.7 mg/kg from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 range: QuantityValue ammonium_nitrogen: name: ammonium_nitrogen annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: mg/kg occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]|mg/kg|mg/L' description: Concentration of ammonium nitrogen in the sample title: ammonium nitrogen examples: - value: 2.3 mg/kg from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 aliases: - NH4-N range: QuantityValue nitrate_nitrogen: name: nitrate_nitrogen annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: mg/kg occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]|mg/kg|mg/L' description: Concentration of nitrate nitrogen in the sample title: nitrate nitrogen comments: - often below some specified limit of detection examples: - value: 0.29 mg/kg from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 aliases: - NO3-N range: QuantityValue nitrite_nitrogen: name: nitrite_nitrogen annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: mg/kg occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]|mg/kg|mg/L' description: Concentration of nitrite nitrogen in the sample title: nitrite nitrogen examples: - value: 1.2 mg/kg from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 aliases: - NO2-N range: QuantityValue lbc_thirty: name: lbc_thirty annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: ppm CaCO3/pH occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]' description: lime buffer capacity, determined after 30 minute incubation title: lime buffer capacity (at 30 minutes) comments: - This is the mass of lime, in mg, needed to raise the pH of one kg of soil by one pH unit examples: - value: 543 [ppm] from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 - https://secure.caes.uga.edu/extension/publications/files/pdf/C%20874_5.PDF aliases: - lbc30 - lime buffer capacity (at 30 minutes) range: QuantityValue lbceq: name: lbceq annotations: Expected_value: tag: Expected_value value: measurement value Preferred_unit: tag: Preferred_unit value: ppm CaCO3/pH occurrence: tag: occurrence value: '1' storage_units: tag: storage_units value: '[ppm]' description: lime buffer capacity, determined at equilibrium after 5 day incubation title: lime buffer capacity (after 5 day incubation) comments: - This is the mass of lime, in mg, needed to raise the pH of one kg of soil by one pH unit examples: - value: 1575 [ppm] from_schema: https://w3id.org/nmdc/nmdc see_also: - https://www.ornl.gov/content/bio-scales-0 aliases: - lime buffer capacity (at 5-day equilibrium) range: QuantityValue dna_absorb1: name: dna_absorb1 description: 260/280 measurement of DNA sample purity title: DNA absorbance 260/280 comments: - Recommended value is between 1 and 3. examples: - value: '2.02' from_schema: https://w3id.org/nmdc/nmdc rank: 7 is_a: biomaterial_purity slot_group: JGI-Metagenomics range: float recommended: true dna_absorb2: name: dna_absorb2 description: 260/230 measurement of DNA sample purity title: DNA absorbance 260/230 comments: - Recommended value is between 1 and 3. examples: - value: '2.02' from_schema: https://w3id.org/nmdc/nmdc rank: 8 is_a: biomaterial_purity slot_group: JGI-Metagenomics range: float recommended: true mass: name: mass annotations: storage_units: tag: storage_units value: g description: A physical quality that inheres in a bearer by virtue of the proportion of the bearer's amount of matter. title: mass from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - PATO:0000125 range: QuantityValue substances_used: name: substances_used description: The substances that are combined to enable a ChemicalConversionProcess. from_schema: https://w3id.org/nmdc/nmdc range: PortionOfSubstance multivalued: true inlined_as_list: true substance_role: name: substance_role description: The role of a substance in a process from_schema: https://w3id.org/nmdc/nmdc range: SubstanceRoleEnum concentration: name: concentration description: The concentration of a substance used in a process comments: - Union of child units from source_concentration and final_concentration is %|mmol/L|umol/L|mg/L|g/L from_schema: https://w3id.org/nmdc/nmdc abstract: true range: QuantityValue source_concentration: name: source_concentration annotations: storage_units: tag: storage_units value: '%|mmol/L' description: When solutions A (containing substance X) and B are combined together, this slot captures the concentration of X in solution A from_schema: https://w3id.org/nmdc/nmdc is_a: concentration final_concentration: name: final_concentration annotations: storage_units: tag: storage_units value: '%|mmol/L|umol/L|mg/L|g/L' description: When solutions A (containing substance X) and B are combined together, this slot captures the concentration of X in the combination from_schema: https://w3id.org/nmdc/nmdc is_a: concentration duration: name: duration annotations: storage_units: tag: storage_units value: h|min description: The elapsed time of an activity. examples: - object: has_numeric_value: 2 has_unit: h from_schema: https://w3id.org/nmdc/nmdc range: QuantityValue temperature: name: temperature annotations: storage_units: tag: storage_units value: Cel description: The value of a temperature measurement or temperature used in a process. notes: - Not to be confused with the MIXS:0000113 from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 range: QuantityValue total_bases: name: total_bases description: Total number of basepairs. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 members_id: name: members_id description: Names of the contigs that make up a metagenome-assembled genome. from_schema: https://w3id.org/nmdc/nmdc close_mappings: - GENEPIO:0100596 range: string multivalued: true bin_name: name: bin_name description: Name of the metagenome-assembled genome. from_schema: https://w3id.org/nmdc/nmdc range: string required: true number_of_contig: name: number_of_contig description: Number of contigs from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - GENEPIO:0000093 range: integer minimum_value: 0 completeness: name: completeness description: Estimate of the completeness of the metagenome-assembled genome, estimated by a tool like CheckM. from_schema: https://w3id.org/nmdc/nmdc range: float minimum_value: 0 contamination: name: contamination description: Estimate of the completeness of the metagenome-assembled genome, estimated by a tool like CheckM. from_schema: https://w3id.org/nmdc/nmdc range: float minimum_value: 0 gene_count: name: gene_count description: Number of genes. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 bin_quality: name: bin_quality description: The quality of the metagenome-assembled genome based on MIMAG standards (https://doi.org/10.1038/nbt.3893). from_schema: https://w3id.org/nmdc/nmdc range: BinQualityEnum num_16s: name: num_16s description: Number of 16s sequences detected, a subunit of prokaryotic ribosomes. from_schema: https://w3id.org/nmdc/nmdc broad_mappings: - OMIT:0013243 range: integer minimum_value: 0 num_5s: name: num_5s description: Number of 5s seqeuences detected, a subunit of ribosomes. from_schema: https://w3id.org/nmdc/nmdc broad_mappings: - OMIT:0013248 range: integer minimum_value: 0 num_23s: name: num_23s description: Number of 23 seqeuences detected, a subunit of ribosomes. from_schema: https://w3id.org/nmdc/nmdc broad_mappings: - OMIT:0013245 range: integer minimum_value: 0 num_t_rna: name: num_t_rna description: Number of transfer transfer RNAs. from_schema: https://w3id.org/nmdc/nmdc broad_mappings: - OMIT:0013250 range: integer minimum_value: 0 gtdbtk_domain: name: gtdbtk_domain description: Taxonomic domain assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000022 range: string gtdbtk_phylum: name: gtdbtk_phylum description: Taxonomic phylum assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000001 range: string gtdbtk_class: name: gtdbtk_class description: Taxonomic class assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000002 range: string gtdbtk_order: name: gtdbtk_order description: Taxonomic order assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000003 range: string gtdbtk_family: name: gtdbtk_family description: Taxonomic family assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000004 range: string gtdbtk_genus: name: gtdbtk_genus description: Taxonomic genus assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000005 range: string gtdbtk_species: name: gtdbtk_species description: Taxonomic genus assigned by GTDB-Tk. from_schema: https://w3id.org/nmdc/nmdc see_also: - doi:10.1093/bioinformatics/btz848 exact_mappings: - TAXRANK:0000006 range: string highest_similarity_score: name: highest_similarity_score todos: - Yuri to fill in description from_schema: https://w3id.org/nmdc/nmdc range: float metabolite_identified: name: metabolite_identified description: the specific metabolite identifier from_schema: https://w3id.org/nmdc/nmdc range: string chemical_formula: name: chemical_formula description: A generic grouping for molecular formulae and empirical formulae from_schema: https://w3id.org/nmdc/nmdc range: string volume: name: volume annotations: storage_units: tag: storage_units value: mL|uL description: The volume of a substance. from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 range: QuantityValue known_as: name: known_as description: The substance from which a portion was taken. from_schema: https://w3id.org/nmdc/nmdc range: ChemicalEntityEnum unique_peptide_seq_count: name: unique_peptide_seq_count description: The number of distinct peptide sequences identified in the LC-MS/MS file. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer razor_protein_count: name: razor_protein_count description: The minimal protein set that describes the unique peptide sequences identified after applying Razor Protein parsimony. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer peptide_to_spectrum_match_count: name: peptide_to_spectrum_match_count description: Total number of MS2 spectra with a false discovery rate passing peptide match. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer peptide_to_spectrum_match_rate: name: peptide_to_spectrum_match_rate annotations: storage_units: tag: storage_units value: '%' description: The percentage of peptide-to-spectrum matches relative to the total number of spectra analyzed. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: QuantityValue mean_peptide_count: name: mean_peptide_count description: The average number of peptides per protein identified in the metaproteomics analysis. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: float total_protein_count: name: total_protein_count description: The total number of distinct proteins identified in the metaproteomics analysis. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer metaproteomics_analysis_category: name: metaproteomics_analysis_category description: The category of metaproteomics analysis being performed. from_schema: https://w3id.org/nmdc/nmdc range: MetaproteomicsAnalysisCategoryEnum required: true metabolomics_analysis_category: name: metabolomics_analysis_category description: The category of metabolomics analysis being performed. from_schema: https://w3id.org/nmdc/nmdc range: MetabolomicsAnalysisCategoryEnum required: true metagenome_assembly_parameter: name: metagenome_assembly_parameter from_schema: https://w3id.org/nmdc/nmdc abstract: true asm_score: name: asm_score description: A score for comparing metagenomic assembly quality from same sample. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaffolds: name: scaffolds description: Total sequence count of all scaffolds. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_logsum: name: scaf_logsum description: The sum of the (length*log(length)) of all scaffolds, times some constant. Increase the contiguity, the score will increase from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_powsum: name: scaf_powsum description: Powersum of all scaffolds is the same as logsum except that it uses the sum of (length*(length^P)) for some power P (default P=0.25). from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_max: name: scaf_max description: Maximum scaffold length. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_bp: name: scaf_bp description: Total size in bp of all scaffolds. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_n50: name: scaf_n50 description: Given a set of scaffolds, each with its own length, the N50 count is defined as the smallest number of scaffolds whose length sum makes up half of genome size. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_n90: name: scaf_n90 description: Given a set of scaffolds, each with its own length, the N90 count is defined as the smallest number of scaffolds whose length sum makes up 90% of genome size. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_l50: name: scaf_l50 description: Given a set of scaffolds, the L50 is defined as the sequence length of the shortest scaffold at 50% of the total genome length. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_l90: name: scaf_l90 description: The L90 statistic is less than or equal to the L50 statistic; it is the length for which the collection of all scaffolds of that length or longer contains at least 90% of the sum of the lengths of all scaffolds. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_n_gt50k: name: scaf_n_gt50k description: Total sequence count of scaffolds greater than 50 KB. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_l_gt50k: name: scaf_l_gt50k description: Total size in bp of all scaffolds greater than 50 KB. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float scaf_pct_gt50k: name: scaf_pct_gt50k description: Total sequence size percentage of scaffolds greater than 50 KB. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float contigs: name: contigs description: The sum of the (length*log(length)) of all contigs, times some constant. Increase the contiguity, the score will increase from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float contig_bp: name: contig_bp description: Total size in bp of all contigs. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_n50: name: ctg_n50 description: Given a set of contigs, each with its own length, the N50 count is defined as the smallest number_of_contigs whose length sum makes up half of genome size. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_l50: name: ctg_l50 description: Given a set of contigs, the L50 is defined as the sequence length of the shortest contig at 50% of the total genome length. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_n90: name: ctg_n90 description: Given a set of contigs, each with its own length, the N90 count is defined as the smallest number of contigs whose length sum makes up 90% of genome size. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_l90: name: ctg_l90 description: The L90 statistic is less than or equal to the L50 statistic; it is the length for which the collection of all contigs of that length or longer contains at least 90% of the sum of the lengths of all contigs. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_logsum: name: ctg_logsum description: Maximum contig length. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_powsum: name: ctg_powsum description: Powersum of all contigs is the same as logsum except that it uses the sum of (length*(length^P)) for some power P (default P=0.25). from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float ctg_max: name: ctg_max description: Maximum contig length. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float gap_pct: name: gap_pct description: The gap size percentage of all scaffolds. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float gc_std: name: gc_std description: Standard deviation of GC content of all contigs. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float gc_avg: name: gc_avg description: Average of GC content of all contigs. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float num_input_reads: name: num_input_reads description: The sequence count number of input reads for assembly. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float num_aligned_reads: name: num_aligned_reads description: The sequence count number of input reads aligned to assembled contigs. from_schema: https://w3id.org/nmdc/nmdc is_a: metagenome_assembly_parameter range: float read_qc_analysis_statistic: name: read_qc_analysis_statistic from_schema: https://w3id.org/nmdc/nmdc abstract: true mags_list: name: mags_list description: Contains detailed information about each metagenome-assembled genome. from_schema: https://w3id.org/nmdc/nmdc range: MagBin multivalued: true inlined_as_list: true too_short_contig_num: name: too_short_contig_num description: Number of contigs which were excluded from binning for length. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 binned_contig_num: name: binned_contig_num description: Number of contigs that ended up in a medium or high quality bin. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 input_contig_num: name: input_contig_num description: Total number of input contigs. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 unbinned_contig_num: name: unbinned_contig_num description: Number of contigs which did not end up in a medium or high quality bin. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 low_depth_contig_num: name: low_depth_contig_num description: Number of contigs which were excluded from binning for depth of coverage. from_schema: https://w3id.org/nmdc/nmdc range: integer minimum_value: 0 input_read_count: name: input_read_count description: The sequence count number of input reads for QC analysis. from_schema: https://w3id.org/nmdc/nmdc is_a: read_qc_analysis_statistic range: float input_base_count: name: input_base_count description: The nucleotide base count number of input reads for QC analysis. from_schema: https://w3id.org/nmdc/nmdc is_a: read_qc_analysis_statistic range: float output_read_count: name: output_read_count description: After QC analysis sequence count number. from_schema: https://w3id.org/nmdc/nmdc is_a: read_qc_analysis_statistic range: float output_base_count: name: output_base_count description: After QC analysis nucleotide base count number. from_schema: https://w3id.org/nmdc/nmdc is_a: read_qc_analysis_statistic range: float output_read_bases: name: output_read_bases description: TODO from_schema: https://w3id.org/nmdc/nmdc range: float input_read_bases: name: input_read_bases description: 'TODO ' from_schema: https://w3id.org/nmdc/nmdc range: float has_metabolite_identifications: name: has_metabolite_identifications from_schema: https://w3id.org/nmdc/nmdc range: MetaboliteIdentification multivalued: true inlined_as_list: true ms_analysis_qc_metric: name: ms_analysis_qc_metric description: A quality control metric for mass spectrometry-based analyses. from_schema: https://w3id.org/nmdc/nmdc abstract: true peak_count: name: peak_count description: The total number of peaks detected in the analysis. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer peak_assignment_count: name: peak_assignment_count description: The number of m/z peaks with assignments in an analysis. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer c13_isotopologue_count: name: c13_isotopologue_count description: The number of two-dimensional mass-to-charge (m/z) versus retention time features that have been isotopically characterized as either 13C-containing isotopologues or monoisotopic (12C-only) features. from_schema: https://w3id.org/nmdc/nmdc is_a: ms_analysis_qc_metric range: integer rna_isolate_meth: name: rna_isolate_meth description: Describe the method/protocol/kit used to extract DNA/RNA. title: RNA isolation method examples: - value: phenol/chloroform extraction from_schema: https://w3id.org/nmdc/nmdc aliases: - Sample Isolation Method rank: 16 recommended: true dna_lr_isolate_meth: name: dna_lr_isolate_meth description: Describe the method/protocol/kit used to extract DNA/RNA for long read sequencing. title: DNA isolation method for long read sequencing examples: - value: phenol/chloroform extraction from_schema: https://w3id.org/nmdc/nmdc aliases: - Sample Isolation Method rank: 16 recommended: true dna_isolate_meth: name: dna_isolate_meth description: Describe the method/protocol/kit used to extract DNA/RNA. title: DNA isolation method examples: - value: phenol/chloroform extraction from_schema: https://w3id.org/nmdc/nmdc aliases: - Sample Isolation Method rank: 16 recommended: true emsl_store_temp: name: emsl_store_temp description: The temperature at which the sample should be stored upon delivery to EMSL title: EMSL sample storage temperature, deg. C todos: - add 'see_also's with link to NEXUS info comments: - Enter a temperature in celsius. Numeric portion only. examples: - value: '-80' from_schema: https://w3id.org/nmdc/nmdc rank: 4 range: float recommended: true project_id: name: project_id description: Proposal IDs or names associated with dataset title: project ID from_schema: https://w3id.org/nmdc/nmdc rank: 1 recommended: true sample_shipped: name: sample_shipped description: The total amount or size (volume, mass, or area) of sample sent to EMSL. title: sample shipped amount comments: - This field is only required when completing metadata for samples being submitted to EMSL for analyses. examples: - value: 15 g - value: 100 uL - value: 5 mL from_schema: https://w3id.org/nmdc/nmdc rank: 3 recommended: true sample_type: name: sample_type description: Type of sample being submitted title: sample type comments: - This can vary from 'environmental package' if the sample is an extraction. examples: - value: water extracted soil from_schema: https://w3id.org/nmdc/nmdc rank: 2 range: SampleTypeEnum recommended: true replicate_number: name: replicate_number description: If sending biological replicates, indicate the rep number here. title: replicate number comments: - This will guide staff in ensuring your samples are blocked & randomized correctly from_schema: https://w3id.org/nmdc/nmdc rank: 6 range: integer recommended: true technical_reps: name: technical_reps description: If sending technical replicates of the same sample, indicate the replicate count. title: number technical replicate comments: - This field is only required when completing metadata for samples being submitted to EMSL for analyses. examples: - value: '2' from_schema: https://w3id.org/nmdc/nmdc rank: 5 range: integer recommended: true collection_date_inc: name: collection_date_inc description: Date the incubation was harvested/collected/ended. Only relevant for incubation samples. title: incubation collection date notes: - MIxS collection_date accepts (truncated) ISO8601. DH taking arbitrary precision date only comments: - Date should be formatted as YYYY(-MM(-DD)). Ie, 2021-04-15, 2021-04 and 2021 are all acceptable. examples: - value: '2021-04-15' - value: 2021-04 - value: '2021' from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000011 rank: 2 string_serialization: '{date, arbitrary precision}' slot_group: MIxS Inspired recommended: true collection_time: name: collection_time description: The time of sampling, either as an instance (single point) or interval. title: collection time, GMT notes: - MIxS collection_date accepts (truncated) ISO8601. DH taking seconds optional time only comments: - 'Time should be entered as HH:MM(:SS) in GMT. See here for a converter: https://www.worldtimebuddy.com/pst-to-gmt-converter' examples: - value: '13:33' - value: '13:33:55' from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000011 rank: 1 string_serialization: '{time, seconds optional}' slot_group: MIxS Inspired recommended: true collection_time_inc: name: collection_time_inc description: Time the incubation was harvested/collected/ended. Only relevant for incubation samples. title: incubation collection time, GMT notes: - MIxS collection_date accepts (truncated) ISO8601. DH taking seconds optional time only comments: - 'Time should be entered as HH:MM(:SS) in GMT. See here for a converter: https://www.worldtimebuddy.com/pst-to-gmt-converter' examples: - value: '13:33' - value: '13:33:55' from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000011 rank: 3 string_serialization: '{time, seconds optional}' slot_group: MIxS Inspired recommended: true experimental_factor_other: name: experimental_factor_other description: Other details about your sample that you feel can't be accurately represented in the available columns. title: experimental factor- other comments: - This slot accepts open-ended text about your sample. - We recommend using key:value pairs. - Provided pairs will be considered for inclusion as future slots/terms in this data collection template. examples: - value: 'experimental treatment: value' from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000008 - MIXS:0000300 rank: 7 string_serialization: '{text}' slot_group: MIxS Inspired recommended: true filter_method: name: filter_method description: Type of filter used or how the sample was filtered title: filter method comments: - describe the filter or provide a catalog number and manufacturer examples: - value: C18 - value: Basix PES, 13-100-106 FisherSci from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000765 rank: 6 string_serialization: '{text}' slot_group: MIxS Inspired recommended: true isotope_exposure: name: isotope_exposure description: List isotope exposure or addition applied to your sample. title: isotope exposure/addition todos: - Can we make the H218O correctly super and subscripted? comments: - This is required when your experimental design includes the use of isotopically labeled compounds examples: - value: 13C glucose - value: 18O water from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000751 rank: 16 slot_group: MIxS Inspired recommended: true micro_biomass_c_meth: name: micro_biomass_c_meth description: Reference or method used in determining microbial biomass carbon title: microbial biomass carbon method todos: - How should we separate values? | or ;? lets be consistent comments: - required if "microbial_biomass_c" is provided examples: - value: https://doi.org/10.1016/0038-0717(87)90052-6 - value: doi:10.1016/0038-0717(87)90052-6 from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000339 rank: 11 string_serialization: '{PMID}|{DOI}|{URL}' slot_group: MIxS Inspired recommended: true micro_biomass_n_meth: name: micro_biomass_n_meth description: Reference or method used in determining microbial biomass nitrogen title: microbial biomass nitrogen method comments: - required if "microbial_biomass_n" is provided examples: - value: https://doi.org/10.1016/0038-0717(87)90052-6 - value: doi:10.1016/0038-0717(87)90052-6 from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000339 rank: 13 string_serialization: '{PMID}|{DOI}|{URL}' slot_group: MIxS Inspired microbial_biomass_c: name: microbial_biomass_c description: The part of the organic matter in the soil that constitutes living microorganisms smaller than 5-10 micrometer. title: microbial biomass carbon comments: - If you provide this, correction factors used for conversion to the final units and method are required examples: - value: 0.05 ug C/g dry soil from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000650 rank: 10 string_serialization: '{float} {unit}' slot_group: MIxS Inspired microbial_biomass_n: name: microbial_biomass_n description: The part of the organic matter in the soil that constitutes living microorganisms smaller than 5-10 micrometer. title: microbial biomass nitrogen comments: - If you provide this, correction factors used for conversion to the final units and method are required examples: - value: 0.05 ug N/g dry soil from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000650 rank: 12 string_serialization: '{float} {unit}' slot_group: MIxS Inspired non_microb_biomass: name: non_microb_biomass description: Amount of biomass; should include the name for the part of biomass measured, e.g.insect, plant, total. Can include multiple measurements separated by ; title: non-microbial biomass examples: - value: insect 0.23 ug; plant 1g from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000174 - MIXS:0000650 rank: 8 string_serialization: '{text};{float} {unit}' slot_group: MIxS Inspired non_microb_biomass_method: name: non_microb_biomass_method description: Reference or method used in determining biomass title: non-microbial biomass method comments: - required if "non-microbial biomass" is provided examples: - value: https://doi.org/10.1038/s41467-021-26181-3 - value: doi:10.1038/s41467-021-26181-3 from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000650 rank: 9 string_serialization: '{PMID}|{DOI}|{URL}' slot_group: MIxS Inspired org_nitro_method: name: org_nitro_method description: Method used for obtaining organic nitrogen title: organic nitrogen method comments: - required if "org_nitro" is provided examples: - value: https://doi.org/10.1016/0038-0717(85)90144-0 - value: doi:10.1016/0038-0717(85)90144-0 from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000338 - MIXS:0000205 rank: 14 string_serialization: '{PMID}|{DOI}|{URL}' slot_group: MIxS Inspired other_treatment: name: other_treatment description: Other treatments applied to your samples that are not applicable to the provided fields title: other treatments notes: - Values entered here will be used to determine potential new slots. comments: - This is an open text field to provide any treatments that cannot be captured in the provided slots. from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000300 rank: 15 string_serialization: '{text}' slot_group: MIxS Inspired recommended: true start_date_inc: name: start_date_inc description: Date the incubation was started. Only relevant for incubation samples. title: incubation start date notes: - MIxS collection_date accepts (truncated) ISO8601. DH taking arbitrary precision date only comments: - Date should be formatted as YYYY(-MM(-DD)). Ie, 2021-04-15, 2021-04 and 2021 are all acceptable. examples: - value: '2021-04-15' - value: 2021-04 - value: '2021' from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000011 rank: 4 string_serialization: '{date, arbitrary precision}' slot_group: MIxS Inspired recommended: true start_time_inc: name: start_time_inc description: Time the incubation was started. Only relevant for incubation samples. title: incubation start time, GMT notes: - MIxS collection_date accepts (truncated) ISO8601. DH taking seconds optional time only comments: - 'Time should be entered as HH:MM(:SS) in GMT. See here for a converter: https://www.worldtimebuddy.com/pst-to-gmt-converter' examples: - value: '13:33' - value: '13:33:55' from_schema: https://w3id.org/nmdc/nmdc see_also: - MIXS:0000011 rank: 5 string_serialization: '{time, seconds optional}' slot_group: MIxS Inspired recommended: true analysis_type: name: analysis_type description: Select all the data types associated or available for this biosample title: analysis/data type comments: - MIxS:investigation_type was included as a `see_also` but that term doesn't resolve any more examples: - value: metagenomics; metabolomics; metaproteomics from_schema: https://w3id.org/nmdc/nmdc rank: 3 slot_group: Sample ID range: AnalysisTypeEnum recommended: true multivalued: true sample_link: name: sample_link description: A unique identifier to assign parent-child, subsample, or sibling samples. This is relevant when a sample or other material was used to generate the new sample. title: sample linkage comments: - 'This field allows multiple entries separated by ; (Examples: Soil collected from the field will link with the soil used in an incubation. The soil a plant was grown in links to the plant sample. An original culture sample was transferred to a new vial and generated a new sample)' examples: - value: igsn:DSJ0284 from_schema: https://w3id.org/nmdc/nmdc rank: 5 string_serialization: '{text}:{text}' slot_group: Sample ID recommended: true multivalued: true classes: EukEval: name: EukEval description: This class contains information pertaining to evaluating if a Metagenome-Assembled Genome (MAG) is eukaryotic. comments: - A tool like eukCC (https://doi.org/10.1186/s13059-020-02155-4) would generate information for this class. from_schema: https://w3id.org/nmdc/nmdc slots: - type - completeness - contamination - ncbi_lineage_tax_ids - ncbi_lineage class_uri: nmdc:EukEval NucleotideSequencing: name: NucleotideSequencing description: A DataGeneration in which the sequence of DNA or RNA molecules is generated. comments: - For example data generated from an Illumina or Pacific Biosciences instrument. from_schema: https://w3id.org/nmdc/nmdc is_a: DataGeneration slots: - gold_sequencing_project_identifiers - insdc_bioproject_identifiers - insdc_experiment_identifiers - ncbi_project_name slot_usage: id: name: id pattern: ^(nmdc):(dgns|omprc)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dgns|omprc)-{id_shoulder}-{id_blade}$' interpolated: true analyte_category: name: analyte_category range: NucleotideSequencingEnum class_uri: nmdc:NucleotideSequencing MassSpectrometry: name: MassSpectrometry description: Spectrometry where the sample is converted into gaseous ions which are characterised by their mass-to-charge ratio and relative abundance. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - CHMO:0000470 is_a: DataGeneration slots: - eluent_introduction_category - generates_calibration - has_chromatography_configuration - has_mass_spectrometry_configuration slot_usage: id: name: id pattern: ^(nmdc):(dgms|omprc)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dgms|omprc)-{id_shoulder}-{id_blade}$' interpolated: true has_chromatography_configuration: name: has_chromatography_configuration pattern: ^(nmdc):chrcon-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:chrcon-{id_shoulder}-{id_blade}$' interpolated: true has_mass_spectrometry_configuration: name: has_mass_spectrometry_configuration required: true pattern: ^(nmdc):mscon-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:mscon-{id_shoulder}-{id_blade}$' interpolated: true analyte_category: name: analyte_category range: MassSpectrometryEnum eluent_introduction_category: name: eluent_introduction_category required: true class_uri: nmdc:MassSpectrometry rules: - preconditions: slot_conditions: eluent_introduction_category: name: eluent_introduction_category equals_string: gas_chromatography postconditions: slot_conditions: generates_calibration: name: generates_calibration required: true description: If eluent_introduction_category is gas_chromatography, then generates_calibration is required. title: generates_calibration_required_if_gc - preconditions: slot_conditions: eluent_introduction_category: name: eluent_introduction_category equals_string: liquid_chromatography postconditions: slot_conditions: has_chromatography_configuration: name: has_chromatography_configuration required: true description: If eluent_introduction_category is liquid_chromatography, then has_chromatography_configuration is required. title: has_chromatography_configuration_required_if_lc - preconditions: slot_conditions: eluent_introduction_category: name: eluent_introduction_category equals_string: gas_chromatography postconditions: slot_conditions: has_chromatography_configuration: name: has_chromatography_configuration required: true description: If eluent_introduction_category is gas_chromatography, then has_chromatography_configuration is required. title: has_chromatography_configuration_required_if_gc Configuration: name: Configuration description: A set of parameters that define the actions of a process and is shared among multiple instances of the process. notes: - This class is intended to represent the parameters within a method file (or similar) that control a process. from_schema: https://w3id.org/nmdc/nmdc is_a: InformationObject abstract: true slots: - protocol_link class_uri: nmdc:Configuration MassSpectrometryConfiguration: name: MassSpectrometryConfiguration description: A set of parameters that define and control the actions of a mass spectrometry process. notes: - This class is intended to represent a mass spectrometry method file that controls a mass spectrometry process. from_schema: https://w3id.org/nmdc/nmdc is_a: Configuration slots: - mass_spectrometry_acquisition_strategy - resolution_categories - mass_analyzers - ionization_source - mass_spectrum_collection_modes - polarity_mode slot_usage: name: name: name required: true description: name: description required: true id: name: id pattern: ^(nmdc):mscon-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:mscon-{id_shoulder}-{id_blade}$' interpolated: true mass_spectrometry_acquisition_strategy: name: mass_spectrometry_acquisition_strategy required: true resolution_categories: name: resolution_categories required: true mass_analyzers: name: mass_analyzers required: true ionization_source: name: ionization_source required: true mass_spectrum_collection_modes: name: mass_spectrum_collection_modes required: true polarity_mode: name: polarity_mode required: true class_uri: nmdc:MassSpectrometryConfiguration ChromatographyConfiguration: name: ChromatographyConfiguration description: A set of parameters that define and control the actions of a chromatography process. notes: - This class is intended to represent a chromatography method file associated with a mass spectrometry process. from_schema: https://w3id.org/nmdc/nmdc is_a: Configuration slots: - chromatographic_category - ordered_mobile_phases - stationary_phase - temperature slot_usage: name: name: name required: true description: name: description required: true id: name: id pattern: ^(nmdc):chrcon-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:chrcon-{id_shoulder}-{id_blade}$' interpolated: true chromatographic_category: name: chromatographic_category required: true stationary_phase: name: stationary_phase required: true class_uri: nmdc:ChromatographyConfiguration Manifest: name: Manifest description: A qualified collection of DataObjects that can be analyzed together in the same experimental context. comments: - Manifest are currently uncoupled from other modelling. For example, there is no schema requirement that DataObjects in a fractions Manifest were all obtained by analyzing the same ProcessedSample. from_schema: https://w3id.org/nmdc/nmdc is_a: InformationObject slots: - manifest_category slot_usage: id: name: id pattern: ^(nmdc):manif-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:manif-{id_shoulder}-{id_blade}$' class_uri: nmdc:Manifest CalibrationInformation: name: CalibrationInformation description: A calibration object that is associated with a process. from_schema: https://w3id.org/nmdc/nmdc is_a: InformationObject slots: - calibration_object - internal_calibration - calibration_target - calibration_standard slot_usage: internal_calibration: name: internal_calibration required: true calibration_target: name: calibration_target required: true id: name: id pattern: ^(nmdc):calib-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:calib-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:CalibrationInformation rules: - preconditions: slot_conditions: calibration_target: name: calibration_target equals_string: retention_index postconditions: slot_conditions: calibration_standard: name: calibration_standard required: true description: If the calibration_target is retention_index, a calibration_standard is required. title: calibration_standard_if_rt - preconditions: slot_conditions: internal_calibration: name: internal_calibration equals_expression: 'False' postconditions: slot_conditions: calibration_object: name: calibration_object required: true description: If internal_calibration is false, a calibration_object is required. title: calibration_object_if_not_internal_calibration FunctionalAnnotationAggMember: name: FunctionalAnnotationAggMember description: This class is used to store aggregated results from workflows which produce functional annotations such as metaproteomics and metagenomics. from_schema: https://w3id.org/nmdc/nmdc slots: - was_generated_by - gene_function_id - count - type slot_usage: was_generated_by: name: was_generated_by range: AnnotatingWorkflow required: true pattern: ^(nmdc):(wfmgan|wfmp|wfmtan)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(wfmgan|wfmp|wfmtan)-{id_shoulder}-{id_blade}{id_version}$' interpolated: true count: name: count description: The number of sequences (for a metagenome or metatranscriptome) or spectra (for metaproteomics) associated with the specified function. gene_function_id: name: gene_function_id pattern: (COG:COG\d+|PFAM:PF\d{5}|KEGG.ORTHOLOGY:K\d+) class_uri: nmdc:FunctionalAnnotationAggMember Database: name: Database description: An abstract holder for any set of metadata and data. It does not need to correspond to an actual managed database top level holder class. When translated to JSON-Schema this is the 'root' object. It should contain pointers to other objects of interest. For MongoDB, the lists of objects that Database slots point to correspond to **collections**. from_schema: https://w3id.org/nmdc/nmdc aliases: - NMDC metadata object slots: - biosample_set - calibration_set - collecting_biosamples_from_site_set - configuration_set - data_generation_set - data_object_set - field_research_site_set - functional_annotation_agg - functional_annotation_set - genome_feature_set - instrument_set - manifest_set - material_processing_set - organism_sample_set - organism_set - processed_sample_set - storage_process_set - study_set - workflow_execution_set class_uri: nmdc:Database tree_root: true Pooling: name: Pooling description: physical combination of several instances of like material. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - OBI:0600016 is_a: MaterialProcessing slot_usage: has_input: name: has_input required: true pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true minimum_cardinality: 2 has_output: name: has_output required: true pattern: ^(nmdc):procsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:procsm-{id_shoulder}-{id_blade}$' interpolated: true minimum_cardinality: 1 maximum_cardinality: 1 id: name: id required: true pattern: ^(nmdc):poolp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:poolp-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:Pooling Isolation: name: Isolation description: A material processing that separates an organism from a mixed sample by selection techniques such as serial dilution, plating on selective media, and colony picking. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2978 close_mappings: - OBI:0000512 is_a: MaterialProcessing slot_usage: id: name: id required: true pattern: ^(nmdc):isnp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:isnp-{id_shoulder}-{id_blade}$' interpolated: true has_input: name: has_input required: true pattern: ^(nmdc):(bsm|osm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|osm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: OrganismSample required: true pattern: ^(nmdc):(osm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(osm)-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:Isolation Culturing: name: Culturing description: A material processing that grows an organism under controlled conditions. The input and output are both organism samples; the output is an expanded or maintained culture of the input organism. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2978 close_mappings: - OBI:0001147 is_a: MaterialProcessing slot_usage: id: name: id required: true pattern: ^(nmdc):cultp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:cultp-{id_shoulder}-{id_blade}$' interpolated: true has_input: name: has_input range: OrganismSample required: true pattern: ^(nmdc):(osm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(osm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: OrganismSample required: true pattern: ^(nmdc):(osm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(osm)-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:Culturing Extraction: name: Extraction description: A material separation in which a desired component of an input material is separated from the remainder. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - OBI:0302884 is_a: MaterialProcessing slots: - substances_used - extraction_targets - input_mass - volume - temperature slot_usage: has_input: name: has_input range: Sample required: true pattern: ^(nmdc):(bsm|osm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|osm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output required: true pattern: ^(nmdc):(procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(procsm)-{id_shoulder}-{id_blade}$' interpolated: true id: name: id required: true pattern: ^(nmdc):extrp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:extrp-{id_shoulder}-{id_blade}$' interpolated: true volume: name: volume description: The volume of the solvent/solute being used, not the input. class_uri: nmdc:Extraction LibraryPreparation: name: LibraryPreparation comments: - OBI:0000711 specifies a DNA input (but not ONLY a DNA input) from_schema: https://w3id.org/nmdc/nmdc aliases: - LibraryConstruction close_mappings: - OBI:0000711 is_a: MaterialProcessing slots: - is_stranded - library_preparation_kit - library_type - nucl_acid_amp - pcr_cond - pcr_cycles - pcr_primers - stranded_orientation - target_gene - target_subfragment - library_selection - library_strategy - library_source - lib_layout - adapters slot_usage: has_input: name: has_input required: true pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output required: true pattern: ^(nmdc):(procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(procsm)-{id_shoulder}-{id_blade}$' interpolated: true id: name: id required: true pattern: ^(nmdc):libprp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:libprp-{id_shoulder}-{id_blade}$' interpolated: true pcr_cond: name: pcr_cond description: Description of reaction conditions and components of polymerase chain reaction performed during library preparation class_uri: nmdc:LibraryPreparation CollectingBiosamplesFromSite: name: CollectingBiosamplesFromSite title: Collecting Biosamples From Site comments: - this illustrates implementing a Biosample relation with a process class from_schema: https://w3id.org/nmdc/nmdc close_mappings: - OBI:0000744 is_a: PlannedProcess slot_usage: has_input: name: has_input range: Site required: true pattern: ^(nmdc):(frsite|site)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(frsite|site)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: Biosample required: true pattern: ^(nmdc):bsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:bsm-{id_shoulder}-{id_blade}$' interpolated: true id: name: id required: true pattern: ^(nmdc):clsite-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:clsite-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:CollectingBiosamplesFromSite SubSamplingProcess: name: SubSamplingProcess description: 'Separating a sample aliquot from the starting material for downstream activity. ' notes: - A subsample may be (a) a portion of the sample obtained by selection or division; (b) an individual unit of the lot taken as part of the sample; (c) the final unit of multistage sampling. The term 'subsample' is used either in the sense of a 'sample of a sample' or as a synonym for 'unit'. In practice, the meaning is usually apparent from the context or is defined. - TODO - Montana to visit slot descriptions from_schema: https://w3id.org/nmdc/nmdc related_mappings: - OBI:0000744 contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 - ORCID:0000-0001-9076-6066 - ORCID:0009-0008-4013-7737 is_a: MaterialProcessing slots: - container_size - contained_in - temperature - volume - mass - sampled_portion slot_usage: id: name: id required: true pattern: ^(nmdc):subspr-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:subspr-{id_shoulder}-{id_blade}$' interpolated: true volume: name: volume description: The output volume of the SubSampling Process. mass: name: mass description: The output mass of the SubSampling Process. has_input: name: has_input range: Sample pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output description: The subsample. range: ProcessedSample pattern: ^(nmdc):(procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(procsm)-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:SubSamplingProcess MixingProcess: name: MixingProcess description: 'The combining of components, particles or layers into a more homogeneous state. ' comments: - The mixing may be achieved manually or mechanically by shifting the material with stirrers or pumps or by revolving or shaking the container. - The process must not permit segregation of particles of different size or properties. - Homogeneity may be considered to have been achieved in a practical sense when the sampling error of the processed portion is negligible compared to the total error of the measurement system. from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 is_a: MaterialProcessing slots: - duration slot_usage: id: name: id required: true pattern: ^(nmdc):mixpro-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:mixpro-{id_shoulder}-{id_blade}$' has_input: name: has_input range: Sample pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output description: The mixed sample. range: ProcessedSample pattern: ^(nmdc):procsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:procsm-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:MixingProcess FiltrationProcess: name: FiltrationProcess description: The process of segregation of phases; e.g. the separation of suspended solids from a liquid or gas, usually by forcing a carrier gas or liquid through a porous medium. from_schema: https://w3id.org/nmdc/nmdc related_mappings: - CHMO:0001640 contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-8683-0050 - ORCID:0000-0001-9076-6066 - ORCID:0009-0008-4013-7737 is_a: MaterialProcessing slots: - conditionings - container_size - filter_material - filter_pore_size - filtration_category - is_pressurized - separation_method - volume slot_usage: id: name: id required: true pattern: ^(nmdc):filtpr-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:filtpr-{id_shoulder}-{id_blade}$' interpolated: true volume: name: volume description: The volume of sample filtered. has_input: name: has_input range: Sample pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: ProcessedSample pattern: ^(nmdc):procsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:procsm-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:FiltrationProcess StorageProcess: name: StorageProcess description: A planned process with the objective to preserve and protect material entities by placing them in an identified location which may have a controlled environment. from_schema: https://w3id.org/nmdc/nmdc related_mappings: - OBI:0302893 is_a: PlannedProcess slots: - substances_used - contained_in - temperature slot_usage: substances_used: name: substances_used description: The substance(s) that a processed sample is stored in. id: name: id required: true pattern: ^(nmdc):storpr-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:storpr-{id_shoulder}-{id_blade}$' interpolated: true has_input: name: has_input range: Sample pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: ProcessedSample pattern: ^(nmdc):procsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:procsm-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:StorageProcess ChromatographicSeparationProcess: name: ChromatographicSeparationProcess description: The process of using a selective partitioning of the analyte or interferent between two immiscible phases. from_schema: https://w3id.org/nmdc/nmdc contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-1368-8217 is_a: MaterialProcessing slots: - chromatographic_category - ordered_mobile_phases - stationary_phase - temperature slot_usage: id: name: id required: true pattern: ^(nmdc):cspro-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:cspro-{id_shoulder}-{id_blade}$' has_input: name: has_input range: Sample pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: ProcessedSample pattern: ^(nmdc):procsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:procsm-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:ChromatographicSeparationProcess DissolvingProcess: name: DissolvingProcess description: 'A mixing step where a soluble component is mixed with a liquid component. ' from_schema: https://w3id.org/nmdc/nmdc aliases: - Solubilization exact_mappings: - CHMO:0002773 contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-1368-8217 is_a: MaterialProcessing slots: - duration - temperature - substances_used slot_usage: id: name: id required: true pattern: ^(nmdc):dispro-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:dispro-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:DissolvingProcess GenomeFeature: name: GenomeFeature description: A feature localized to an interval along a genome comments: - corresponds to an entry in GFF3 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/The-Sequence-Ontology/Specifications/blob/master/gff3.md slots: - encodes - end - feature_type - phase - seqid - start - strand - type - feature_category slot_usage: seqid: name: seqid required: true start: name: start required: true end: name: end required: true class_uri: nmdc:GenomeFeature FunctionalAnnotationTerm: name: FunctionalAnnotationTerm description: Abstract grouping class for any term/descriptor that can be applied to a functional unit of a genome (protein, ncRNA, complex). from_schema: https://w3id.org/nmdc/nmdc aliases: - function - FunctionalAnnotation is_a: OntologyClass abstract: true class_uri: nmdc:FunctionalAnnotationTerm OrthologyGroup: name: OrthologyGroup id_prefixes: - CATH - EGGNOG - KEGG.ORTHOLOGY - PANTHER.FAMILY - PFAM - SUPFAM - TIGRFAM description: A set of genes or gene products in which all members are orthologous todos: - is OrthologyGroup instantiated in an MongoDB collection? Aren't Pathways searchable in the Data Portal? notes: - KEGG.ORTHOLOGY prefix is used for KO numbers from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - biolink:GeneFamily is_a: FunctionalAnnotationTerm class_uri: nmdc:OrthologyGroup FunctionalAnnotation: name: FunctionalAnnotation description: An assignment of a function term (e.g. reaction or pathway) that is executed by a gene product, or which the gene product plays an active role in. Functional annotations can be assigned manually by curators, or automatically in workflows. In the context of NMDC, all function annotation is performed automatically, typically using HMM or Blast type methods from_schema: https://w3id.org/nmdc/nmdc see_also: - https://img.jgi.doe.gov/docs/functional-annotation.pdf - https://github.com/microbiomedata/mg_annotation/blob/master/functional-annotation.wdl narrow_mappings: - biolink:GeneToGoTermAssociation slots: - has_function - subject - was_generated_by - type - feature_category slot_usage: has_function: name: has_function notes: - Still missing patterns for COG and RetroRules - These patterns are not yet tied to the listed prefixes. - Are these lists are intended to be open examples or closed? was_generated_by: name: was_generated_by description: provenance for the annotation. notes: - To be consistent with the rest of the NMDC schema we use the PROV annotation model, rather than GPAD range: MetagenomeAnnotation pattern: ^(nmdc):(wfmgan)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(wfmgan)-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:FunctionalAnnotation AttributeValue: name: AttributeValue description: The value for any value of a attribute for a sample. This object can hold both the un-normalized atomic value and the structured value from_schema: https://w3id.org/nmdc/nmdc abstract: true slots: - has_raw_value - type class_uri: nmdc:AttributeValue QuantityValue: name: QuantityValue description: A simple quantity, e.g. 2cm from_schema: https://w3id.org/nmdc/nmdc mappings: - schema:QuantityValue is_a: AttributeValue slots: - has_maximum_numeric_value - has_minimum_numeric_value - has_numeric_value - has_unit slot_usage: has_raw_value: name: has_raw_value description: Unnormalized atomic string representation, should in syntax {number} {unit} has_unit: name: has_unit description: The unit of the quantity range: UnitEnum required: true has_numeric_value: name: has_numeric_value description: The number part of the quantity class_uri: nmdc:QuantityValue ImageValue: name: ImageValue description: An attribute value representing an image. from_schema: https://w3id.org/nmdc/nmdc is_a: AttributeValue slots: - url - description - display_order class_uri: nmdc:ImageValue PersonValue: name: PersonValue description: An attribute value representing a person todos: - add additional fields e.g for institution - deprecate "has_raw_value" in favor of "name" from_schema: https://w3id.org/nmdc/nmdc is_a: AttributeValue slots: - email - name - orcid - profile_image_url - websites slot_usage: orcid: name: orcid annotations: tooltip: tag: tooltip value: Open Researcher and Contributor ID for this person. See https://orcid.org email: name: email annotations: tooltip: tag: tooltip value: Email address for this person. has_raw_value: name: has_raw_value description: The full name of the Investigator in format FIRST LAST. notes: - May eventually be deprecated in favor of "name". name: name: name annotations: tooltip: tag: tooltip value: First name, middle initial, and last name of this person. description: The full name of the Investigator. It should follow the format FIRST [MIDDLE NAME| MIDDLE INITIAL] LAST, where MIDDLE NAME| MIDDLE INITIAL is optional. class_uri: nmdc:PersonValue TextValue: name: TextValue description: A basic string value from_schema: https://w3id.org/nmdc/nmdc is_a: AttributeValue slots: - language class_uri: nmdc:TextValue TimestampValue: name: TimestampValue description: A value that is a timestamp. The range should be ISO-8601 from_schema: https://w3id.org/nmdc/nmdc is_a: AttributeValue class_uri: nmdc:TimestampValue ControlledTermValue: name: ControlledTermValue description: A controlled term or class from an ontology todos: - add fields for ontology, branch from_schema: https://w3id.org/nmdc/nmdc is_a: AttributeValue slots: - term class_uri: nmdc:ControlledTermValue ControlledIdentifiedTermValue: name: ControlledIdentifiedTermValue description: A controlled term or class from an ontology, requiring the presence of term with an id from_schema: https://w3id.org/nmdc/nmdc is_a: ControlledTermValue slot_usage: term: name: term required: true class_uri: nmdc:ControlledIdentifiedTermValue GeolocationValue: name: GeolocationValue description: A normalized value for a location on the earth's surface from_schema: https://w3id.org/nmdc/nmdc mappings: - schema:GeoCoordinates is_a: AttributeValue slots: - latitude - longitude slot_usage: has_raw_value: name: has_raw_value description: The raw value for a geolocation should follow {latitude} {longitude} latitude: name: latitude required: true longitude: name: longitude required: true class_uri: nmdc:GeolocationValue PropertyAssertion: name: PropertyAssertion description: A structured record of data that doesn't fit nicely within the constraints of other NMDC AttributeValues. Uses primitive ranges only. comments: - This class enables flexible metadata capture for properties that don't align with existing, policy-governed slots in NMDC schema. - 'Interoperability note: This approach is aligned with the BERtron schema''s ''properties'' slot pattern (see https://github.com/ber-data/bertron-schema), which uses any_of to support both TextValue and QuantityValue ranges. NMDC''s PropertyAssertion provides a more granular approach by using primitive types with optional semantic annotations, enabling better validation while maintaining flexibility for diverse metadata types.' - PropertyAssertion supports both categorical values (via has_value_term_id) and numeric values (via has_numeric_value with optional min/max ranges), along with temporal (has_datetime_value) and boolean (has_boolean_value) data types. examples: - description: Data provided from submission that doesn't conform to required abs_air_humidity units object: type: nmdc:PropertyAssertion has_raw_value: 50 kPa has_attribute_id: MIXS:0000122 has_attribute_label: absolute air humidity has_numeric_value: 50 has_unit: kPa - description: Data provided from submission that doesn't conform to required UCUM unit object: type: nmdc:PropertyAssertion has_raw_value: 5.5 mL/L has_attribute_id: MIXS:0000119 has_attribute_label: dissolved oxygen has_numeric_value: 5.5 has_unit: mL/L - description: Unit provided is invalid for UCUM and standard object: type: nmdc:PropertyAssertion has_raw_value: 250 W/m2 has_attribute_id: MIXS:0000112 has_attribute_label: solar irradiance has_numeric_value: 250 has_unit: W/m2 from_schema: https://w3id.org/nmdc/nmdc is_a: AttributeValue slots: - has_attribute_label - has_attribute_id - has_quantity_kind_id - has_value_term_id - has_boolean_value - has_datetime_value - has_numeric_value - has_minimum_numeric_value - has_maximum_numeric_value - has_unit slot_usage: has_raw_value: name: has_raw_value description: Original contributor string representation (unparsed) required: true has_unit: name: has_unit description: UCUM unit code (required only when numeric value is present) required: false class_uri: nmdc:PropertyAssertion NamedThing: name: NamedThing description: a databased entity or concept/class from_schema: https://w3id.org/nmdc/nmdc abstract: true slots: - id - name - description - alternative_identifiers - type class_uri: nmdc:NamedThing OntologyClass: name: OntologyClass description: A representation of class defined in an external ontology. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - biolink:OntologyClass - owl:Class - schema:Class is_a: NamedThing slots: - alternative_names - relations - definition - is_obsolete - is_root slot_usage: id: name: id notes: - The identifiers for terms from external ontologies can't have their ids constrained to the nmdc namespace pattern: ^[a-zA-Z0-9][a-zA-Z0-9_\.]+:[a-zA-Z0-9_][a-zA-Z0-9_\-\/\.,]*$ class_uri: nmdc:OntologyClass NcbiTaxon: name: NcbiTaxon id_prefixes: - NCBITaxon description: A taxonomy term from NCBI Taxonomy. NcbiTaxon instances are identified by NCBITaxon CURIEs (e.g. NCBITaxon:511145) and stored in ontology_class_set alongside other OntologyClass instances. No NMDC-minted identifiers are assigned. Support for additional taxonomic authorities (GTDB, LPSN, SeqCode) would be represented by separate classes or by widening this class's id_prefixes in a follow-on PR. comments: - 'Follows the OrthologyGroup pattern: a concrete, directly-instantiated semantic subclass of OntologyClass with no additional slots, no typecode, and no dedicated Database collection. Instances go into ontology_class_set and are referenced from sample slots such as classified_as.' - Sub-species information (strains, cultivars, lab-specific isolates) is below the resolution of NCBI Taxonomy. Strain identity is captured via dedicated slots on Organism (e.g. strain_name, isolate_name), not by minting NcbiTaxon instances. - Existing taxonomy slots (samp_taxon_id, host_taxid) already use ControlledIdentifiedTermValue with range OntologyClass. The intent is that these slots point to NcbiTaxon instances specifically, but LinkML does not currently support constraining the term slot of a ControlledIdentifiedTermValue to a particular OntologyClass subclass. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2959 - https://github.com/microbiomedata/nmdc-schema/issues/2971 close_mappings: - biolink:OrganismTaxon is_a: OntologyClass slot_usage: id: name: id comments: - Validation is intentionally limited to NCBITaxon CURIEs. If GTDB, LPSN, or SeqCode support is added, widen this pattern in lockstep with id_prefixes and example data. pattern: ^NCBITaxon:\d+$ class_uri: nmdc:NcbiTaxon OntologyRelation: name: OntologyRelation description: A relationship between two ontology classes as specified either directly in the ontology in the form of axioms (statements or assertions that defines rules or constraints in an ontology) or inferred via reasoning. The association object is defined by two terms (the subject and the object) and the relationship between them (the predicate). Because ontologies often have a plethora of relationships/axiom types and can have additional metadata on the relationship itself, these kinds of relationships are structured as a class instead of a simple set of slots on OntologyClass itself. comments: - 'For example, the relationship between ''soil'' and ''enriched soil'' in the Environmental Ontology (ENVO) is defined by the following axioms: ''enriched soil'' subclass_of ''soil'', and ''enriched soil'' has_increased_levels_of (some) ''material entity.'' Converting these statements to OntologyAssociations so they can be used in the NMDC data stores, the subject of the first axiom or statement, would be ''soil'', the predicate would be ''subclass_of'', and the object would be ''enriched soil''. For the second axiom, the subject would be ''enriched soil'', the predicate would be ''has_increased_levels_of'', and the object would be ''material entity.'' (Note that text labels are used in this example for ease of understanding and the literal values of subject, predicate, and object in this class will be the id (curie) of the `OntologyClass` as defined below). Not all ontology axioms (associations) between terms need to be ingested into the NMDC data stores. In general, subclass_of and part_of relationships/axioms are often good default relations/associations to support ontology browsing in user interfaces.' from_schema: https://w3id.org/nmdc/nmdc aliases: - OntologyAssociation slots: - type attributes: subject: name: subject from_schema: https://w3id.org/nmdc/basic_classes range: OntologyClass required: true predicate: name: predicate from_schema: https://w3id.org/nmdc/basic_classes range: OntologyClass required: true object: name: object from_schema: https://w3id.org/nmdc/basic_classes range: OntologyClass required: true class_uri: nmdc:OntologyRelation FailureCategorization: name: FailureCategorization from_schema: https://w3id.org/nmdc/nmdc slots: - qc_failure_what - qc_failure_where - type class_uri: nmdc:FailureCategorization MaterialEntity: name: MaterialEntity description: A named thing that occupies space and has mass. title: Material Entity from_schema: https://w3id.org/nmdc/nmdc aliases: - Material - Physical entity exact_mappings: - BFO:0000040 is_a: NamedThing abstract: true class_uri: nmdc:MaterialEntity Instrument: name: Instrument description: A material entity that is designed to perform a function in a scientific investigation, but is not a reagent. This class models the make and model of the instrument, not the specific instance of the instrument. from_schema: https://w3id.org/nmdc/nmdc aliases: - device exact_mappings: - OBI:0000968 is_a: MaterialEntity slots: - vendor - model slot_usage: id: name: id pattern: ^(nmdc):inst-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:inst-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:Instrument unique_keys: main: unique_key_name: main unique_key_slots: - vendor - model description: A unique instrument is defined by its vendor and model. Organism: name: Organism description: A material entity that is a living or once-living individual. Organism instances represent the biological identity of what is in a sample, not the sample itself. Sub-species identity (strain, cultivar, lab isolate) is captured by slots on this class rather than via a separate Strain subclass. comments: - An Organism is not a sample; it is the biological entity that an OrganismSample is expected to contain, linked via expected_organism. Sub-species identity (strain_name, isolate_name) is captured directly on Organism. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2959 - https://github.com/microbiomedata/nmdc-schema/issues/2803 - https://github.com/microbiomedata/nmdc-schema/issues/2971 exact_mappings: - COB:0000022 is_a: MaterialEntity slots: - classified_as - organism_genus - organism_species - strain_name - isolate_name - estimated_size - gc_content - ref_biomaterial slot_usage: id: name: id required: true pattern: ^(nmdc):orgn-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:orgn-{id_shoulder}-{id_blade}$' interpolated: true classified_as: name: classified_as description: Taxonomic classification of this organism. notes: - Narrowing `classified_as` to `NcbiTaxon` on organism-oriented classes via slot_usage is tracked in https://github.com/microbiomedata/nmdc-schema/issues/3016. range: NcbiTaxon estimated_size: name: estimated_size examples: - value: '5000000' in_subset: - jgi_isolate structured_aliases: - literal_form: Estimated Genome Size (Mb) predicate: BROAD_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. - 'Per @aclum: Mb is a coarser unit than bp, so a single Mb value covers many possible bp values; the alias is broader in granularity.' source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ ref_biomaterial: name: ref_biomaterial description: Reference for the organism, preferentially a DOI when a primary publication or genome report exists; PMID and URL are also accepted per the MIxS ref_biomaterial pattern (`{PMID}|{DOI}|{URL}`). Reuses MIxS ref_biomaterial (MIXS:0000025). comments: - The MIxS pattern accepts DOI, PMID, or URL. DOI is preferred when available; it gives a stable reference to the publication or genome report. See the `associated_dois` pattern elsewhere in the NMDC schema for DOI-structured alternatives. - The MIxS name ref_biomaterial may be renamed in a future MIxS release. See ongoing MIxS renaming work. examples: - description: DOI form (preferred when a primary publication exists) object: type: nmdc:TextValue has_raw_value: doi:10.1016/j.syapm.2018.01.009 - description: PubMed ID form object: type: nmdc:TextValue has_raw_value: PMID:24296464 - description: URL form (e.g. NCBI Genome record) object: type: nmdc:TextValue has_raw_value: https://www.ncbi.nlm.nih.gov/datasets/genome/GCA_000016065.1/ class_uri: nmdc:Organism PlannedProcess: name: PlannedProcess description: A named thing that is executed according to a plan. title: Planned Process from_schema: https://w3id.org/nmdc/nmdc is_a: NamedThing abstract: true slots: - has_input - has_output - processing_institution - protocol_link - start_date - end_date - qc_status - qc_comment - has_failure_categorization class_uri: OBI:0000011 Protocol: name: Protocol from_schema: https://w3id.org/nmdc/nmdc slots: - url - name - type - description - protocol_for - analysis_type class_uri: nmdc:Protocol CreditAssociation: name: CreditAssociation description: This class supports binding associated researchers to studies. There will be at least a slot for a CRediT Contributor Role and for a person value. Specifically see the associated researchers tab on the NMDC_SampleMetadata-V4_CommentsForUpdates at https://docs.google.com/spreadsheets/d/1INlBo5eoqn2efn4H2P2i8rwRBtnbDVTqXrochJEAPko/edit#gid=0 from_schema: https://w3id.org/nmdc/nmdc see_also: - https://casrai.org/credit/ aliases: - study role - credit table - associated researchers slots: - applies_to_person - applied_roles - type class_uri: prov:Association Doi: name: Doi description: A centrally registered identifier symbol used to uniquely identify objects given by the International DOI Foundation. The DOI system is particularly used for electronic documents. from_schema: https://w3id.org/nmdc/nmdc aliases: - DOIs - digital object identifiers exact_mappings: - OBI:0002110 slots: - doi_value - doi_provider - doi_category - type class_uri: nmdc:Doi rules: - preconditions: slot_conditions: doi_category: name: doi_category equals_string: dataset_doi postconditions: slot_conditions: doi_provider: name: doi_provider required: true description: If doi_category is a publication_doi, then doi_provider is not required. Otherwise, doi_provider is required. title: dataset_dois_require_provider - preconditions: slot_conditions: doi_category: name: doi_category equals_string: award_doi postconditions: slot_conditions: doi_provider: name: doi_provider required: true description: If doi_category is a publication_doi, then doi_provider is not required. Otherwise, doi_provider is required. title: award_dois_require_provider Study: name: Study description: A study summarizes the overall goal of a research initiative and outlines the key objective of its underlying projects. alt_descriptions: embl.ena: source: embl.ena description: A study (project) groups together data submitted to the archive and controls its release date. A study accession is typically used when citing data submitted to ENA todos: - determine how to get data values for submitted_to_insdc, investigation_type, experimental_factor notes: - sample GOLD link https://bioregistry.io/gold:Gs0110115 - sample insdc.srs link https://www.ebi.ac.uk/ena/browser/view/PRJEB45055 ? - sample mgnify link https://www.ebi.ac.uk/metagenomics/studies/MGYS00005757 - GOLD, insdc.srs and mgnify are reasonable prefixes for alternative study identifiers, but no longer for the Study.id comments: - The Study includes both consortia and research studies. from_schema: https://w3id.org/nmdc/nmdc aliases: - proposal - research proposal - research study - investigation - project - umbrella project - research initiative exact_mappings: - OBI:0000066 - SIO:000747 - NCIT:C41198 - ISA:Investigation broad_mappings: - prov:Activity is_a: NamedThing slots: - emsl_project_identifiers - gnps_task_identifiers - gold_study_identifiers - insdc_bioproject_identifiers - jgi_portal_study_identifiers - mgnify_project_identifiers - neon_study_identifiers - related_identifiers - alternative_descriptions - alternative_names - provenance_metadata - alternative_titles - ecosystem - ecosystem_category - ecosystem_subtype - ecosystem_type - specific_ecosystem - associated_dois - funding_sources - has_credit_associations - homepage_website - notes - objective - part_of - principal_investigator - protocol_link - study_category - study_image - title - websites slot_usage: id: name: id required: true pattern: ^(nmdc):sty-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:sty-{id_shoulder}-{id_blade}$' interpolated: true name: name: name annotations: tooltip: tag: tooltip value: Provide a name for the study your samples will belong with. websites: name: websites annotations: tooltip: tag: tooltip value: Link to the Principal Investigator's research lab webpage or the study webpage associated with this collection of samples. Multiple links can be provided. homepage_website: name: homepage_website annotations: tooltip: tag: tooltip value: Link to the consortium's homepage if the study_category is a consortium. description: name: description annotations: tooltip: tag: tooltip value: Provide a brief description of your study. description: A brief, link-free summary of a Study comments: - Include links in other Study slots, such as websites or dois. notes: name: notes annotations: tooltip: tag: tooltip value: Add any additional notes or comments about this study. alternative_identifiers: name: alternative_identifiers description: Unique identifier for a study submitted to additional resources. Matches that which has been submitted to NMDC alternative_names: name: alternative_names annotations: tooltip: tag: tooltip value: Project, study, or sample set names the are also associated with this submission or other names / identifiers for this study. related_identifiers: name: related_identifiers description: Unique identifier for a study submitted to additional resources. Similar, but not necessarily identical to that which has been submitted to NMDC insdc_bioproject_identifiers: name: insdc_bioproject_identifiers annotations: tooltip: tag: tooltip value: Provide the NCBI BioProject Accession Number associated with the listed NCBI BioProject Title. description: Unique identifier for a bioproject submitted to INSDC that relates to the NMDC submitted study. part_of: name: part_of description: Links a study or consortium to a parent (or umbrella) study or consortium. comments: - Value is the id of the umbrella study or consortium. range: Study pattern: ^(nmdc):sty-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:sty-{id_shoulder}-{id_blade}$' interpolated: true protocol_link: name: protocol_link multivalued: true inlined_as_list: true provenance_metadata: name: provenance_metadata description: Provenance metadata for this Study, including when the record was added to and last modified in the NMDC database. class_uri: nmdc:Study InformationObject: name: InformationObject description: Any data or knowledge that reduces uncertainty or enhances understanding about a system, process, or entity. comments: - The direct subclasses of NamedThing should aggregate the relevant classes and make them uniform. PlannedProcess and MaterialEntity are clearly disjoint. Let's do the same thing for our modelling of things that don't consist of matter and aren't processes. - InformationObjects may include embedded data or links to external resources via the url slot - May appear as output from a process, inputs into a process, or both - All slots relating one class to a InformationObject should be is_a sub-properties of has_input or has_output, if they are multivalued or otherwise organized - Historically information about many classes has been inlined into the class. This is an alternative pattern. from_schema: https://w3id.org/nmdc/nmdc see_also: - nmdc:AttributeValue exact_mappings: - IAO:0000030 is_a: NamedThing abstract: true class_uri: nmdc:InformationObject DataObject: name: DataObject description: An object that primarily consists of symbols that represent information. Files, records, and omics data are examples of data objects. from_schema: https://w3id.org/nmdc/nmdc is_a: InformationObject slots: - compression_type - data_category - data_object_type - file_size_bytes - insdc_experiment_identifiers - insdc_run_identifiers - md5_checksum - url - was_generated_by - in_manifest - superseded_by slot_usage: name: name: name required: true description: name: description required: true id: name: id required: true pattern: ^(nmdc):dobj-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:dobj-{id_shoulder}-{id_blade}$' interpolated: true was_generated_by: name: was_generated_by range: DataEmitterProcess pattern: ^(nmdc):(wfmag|wfmb|wfmgan|wfmgas|wfmsa|wfmp|wfmt|wfmtan|wfmtas|wfmtex|wfnom|wfrbt|wfrqc)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$|^(nmdc):(omprc|dgms|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(wfmag|wfmb|wfmgan|wfmgas|wfmsa|wfmp|wfmt|wfmtan|wfmtas|wfmtex|wfnom|wfrbt|wfrqc)-{id_shoulder}-{id_blade}{id_version}$|{id_nmdc_prefix}:(omprc|dgms|dgns)-{id_shoulder}-{id_blade}$' interpolated: true data_object_type: name: data_object_type required: true data_category: name: data_category required: true class_uri: nmdc:DataObject rules: - preconditions: slot_conditions: data_object_type: name: data_object_type equals_string: SRA toolkit-accessible sequence data postconditions: slot_conditions: insdc_run_identifiers: name: insdc_run_identifiers required: true description: If data_object_type is "SRA toolkit-accessible sequence data", then insdc_run_identifiers is required, because such objects are retrieved by INSDC run accession through the SRA Toolkit rather than by a stable URL. title: sra_toolkit_object_requires_run_identifier DataEmitterProcess: name: DataEmitterProcess description: A process that generates data objects as output. from_schema: https://w3id.org/nmdc/nmdc is_a: PlannedProcess abstract: true class_uri: nmdc:DataEmitterProcess DataGeneration: name: DataGeneration description: The methods and processes used to generate omics data from a biosample or organism. alt_descriptions: embl.ena: source: embl.ena description: An experiment contains information about a sequencing experiment including library and instrument details. from_schema: https://w3id.org/nmdc/nmdc aliases: - OmicsProcessing - assay - omics assay - sequencing project - experiment broad_mappings: - OBI:0000070 - ISA:Assay is_a: DataEmitterProcess abstract: true slots: - analyte_category - associated_studies - instrument_used - principal_investigator - instrument_instance_specifier - provenance_metadata slot_usage: has_input: name: has_input range: Sample required: true pattern: ^(nmdc):(bsm|osm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|osm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true associated_studies: name: associated_studies range: Study pattern: ^(nmdc):(sty)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(sty)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: DataObject pattern: ^(nmdc):(dobj)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dobj)-{id_shoulder}-{id_blade}$' interpolated: true provenance_metadata: name: provenance_metadata description: Provenance metadata for this DataGeneration, including when the record was added to and last modified in the NMDC database. class_uri: nmdc:DataGeneration WorkflowExecution: name: WorkflowExecution description: Represents an instance of an execution of a particular workflow alt_descriptions: embl.ena: source: embl.ena description: An analysis contains secondary analysis results derived from sequence reads (e.g. a genome assembly) comments: - Each instance of this (and all other) subclasses of WorkflowExecution is a distinct run with start and stop times, potentially with different inputs and outputs from_schema: https://w3id.org/nmdc/nmdc aliases: - analysis is_a: DataEmitterProcess abstract: true slots: - ended_at_time - execution_resource - git_url - started_at_time - version - was_informed_by - processing_institution_workflow_metadata - superseded_by slot_usage: started_at_time: name: started_at_time required: true git_url: name: git_url description: The url that points to the exact software repository location used to run a workflow required: true has_input: name: has_input range: DataObject required: true pattern: ^(nmdc):(dobj)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dobj)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: DataObject pattern: ^(nmdc):(dobj)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dobj)-{id_shoulder}-{id_blade}$' interpolated: true processing_institution: name: processing_institution required: true was_informed_by: name: was_informed_by required: true version: name: version description: The NMDC release tag for a given workflow release used for data processing. If workflows are processed externally, as denoted by processing_institution, this value represents the best mapping between a processing institution's (e.g., JGI) workflow metadata and a NMDC tagged release. class_uri: nmdc:WorkflowExecution rules: - preconditions: slot_conditions: qc_status: name: qc_status equals_string: pass postconditions: slot_conditions: has_output: name: has_output required: true description: If qc_status has a value of pass, then the has_output slot is required. title: qc_status_pass_has_output_required - preconditions: slot_conditions: qc_status: name: qc_status value_presence: ABSENT postconditions: slot_conditions: has_output: name: has_output required: true description: If qc_status is not specified, then the has_output slot is required. title: qc_status_pass_null_has_output_required ProvenanceMetadata: name: ProvenanceMetadata description: Metadata pertaining to how a record was created. from_schema: https://w3id.org/nmdc/nmdc slots: - add_date - git_url - mod_date - version - source_system_of_record - submission_portal_identifier - type slot_usage: add_date: name: add_date description: The date and time at which a record was added to the NMDC database. comments: - Biosample and NucleotideSequencing records brought in from GOLD before 2026-03-23 may carry GOLD-sourced dates rather than NMDC-asserted timestamps. range: datetime mod_date: name: mod_date description: The date and time at which a record was last modified in the NMDC database. comments: - Biosample and NucleotideSequencing records brought in from GOLD before 2026-03-23 may carry GOLD-sourced dates rather than NMDC-asserted timestamps. range: datetime version: name: version description: The version tag of the software used to generate the NMDC metadata record git_url: name: git_url description: The url of the software repository used to generate the NMDC metadata record class_uri: nmdc:ProvenanceMetadata ChemicalConversionProcess: name: ChemicalConversionProcess description: 'A process that results in the interconversion of chemical species by a reaction to transform the reagents into products. ' comments: - The values of both has_reagents slot and has_input slot are considered the reagents of a chemical process. from_schema: https://w3id.org/nmdc/nmdc aliases: - chemical reaction exact_mappings: - MISO:0000001 contributors: - ORCID:0009-0001-1555-1601 - ORCID:0000-0002-1368-8217 is_a: MaterialProcessing slots: - chemical_conversion_category - duration - temperature - substances_used - substances_volume slot_usage: id: name: id required: true pattern: ^(nmdc):chcpr-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:chcpr-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:ChemicalConversionProcess AnnotatingWorkflow: name: AnnotatingWorkflow description: A WorkflowExecution whose output indicates the potential functions of genes or gene products from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution abstract: true class_uri: nmdc:AnnotatingWorkflow MetagenomeAnnotation: name: MetagenomeAnnotation description: A workflow execution activity that provides functional and structural annotation of assembled metagenome contigs from_schema: https://w3id.org/nmdc/nmdc is_a: AnnotatingWorkflow slots: - img_identifiers - gold_analysis_project_identifiers slot_usage: id: name: id required: true pattern: ^(nmdc):wfmgan-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmgan-{id_shoulder}-{id_blade}{id_version}$' interpolated: true img_identifiers: name: img_identifiers maximum_cardinality: 1 was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true gold_analysis_project_identifiers: name: gold_analysis_project_identifiers pattern: ^gold:Ga[0-9]+$ structured_pattern: syntax: ^gold:Ga[0-9]+$ interpolated: true class_uri: nmdc:MetagenomeAnnotation FieldResearchSite: name: FieldResearchSite description: A site, outside of a laboratory, from which biosamples may be collected. title: Field Research Site comments: - Provides grouping of biosamples at level that's more specific than belonging to the same study - be very clear that this could be part of a larger site - In Bioscales, one might say that rhizosphere soil and bulk soil from around the same plant were obtained at the same site. In this case, the site would correspond to one tree. - might correspond to GOLD's identifier on a page like https://gold.jgi.doe.gov/biosample?id=Gb0305833 from_schema: https://w3id.org/nmdc/nmdc aliases: - research plot is_a: Site slots: - cur_vegetation - elev - geo_loc_name - habitat - lat_lon - local_class - part_of - soil_type slot_usage: id: name: id required: true pattern: ^(nmdc):frsite-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:frsite-{id_shoulder}-{id_blade}$' interpolated: true part_of: name: part_of range: FieldResearchSite pattern: ^(nmdc):frsite-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:frsite-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:FieldResearchSite Sample: name: Sample description: A sample is a material entity that can be characterized by an experiment. from_schema: https://w3id.org/nmdc/nmdc is_a: MaterialEntity abstract: true class_uri: nmdc:Sample Biosample: name: Biosample description: Biological source material which can be characterized by an experiment. alt_descriptions: embl.ena: source: embl.ena description: A sample contains information about the sequenced source material. Samples are associated with checklists, which define the fields used to annotate the samples. Samples are always associated with a taxon. from_schema: https://w3id.org/nmdc/nmdc aliases: - sample - material sample - specimen - biospecimen exact_mappings: - OBI:0000747 - NCIT:C43412 - http://purl.obolibrary.org/obo/FBcv_0003024 is_a: Sample slots: - associated_studies - biosample_categories - collected_from - embargoed - host_disease_stat - img_identifiers - neon_biosample_identifiers - alternative_names - provenance_metadata - gold_biosample_identifiers - insdc_biosample_identifiers - emsl_biosample_identifiers - igsn_biosample_identifiers - abs_air_humidity - add_recov_method - additional_info - address - adj_room - aero_struc - agrochem_addition - air_PM_concen - air_temp - air_temp_regm - al_sat - al_sat_meth - alkalinity - alkalinity_method - alkyl_diethers - alt - aminopept_act - ammonium - amount_light - ances_data - annual_precpt - annual_temp - antibiotic_regm - api - arch_struc - aromatics_pc - asphaltenes_pc - atmospheric_data - avg_dew_point - avg_occup - avg_temp - bac_prod - bac_resp - bacteria_carb_prod - barometric_press - basin - bathroom_count - bedroom_count - benzene - biochem_oxygen_dem - biocide - biocide_admin_method - biol_stat - biomass - biotic_regm - biotic_relationship - bishomohopanol - blood_press_diast - blood_press_syst - bromide - build_docs - build_occup_type - building_setting - built_struc_age - built_struc_set - built_struc_type - calcium - carb_dioxide - carb_monoxide - carb_nitro_ratio - ceil_area - ceil_cond - ceil_finish_mat - ceil_struc - ceil_texture - ceil_thermal_mass - ceil_type - ceil_water_mold - chem_administration - chem_mutagen - chem_oxygen_dem - chem_treat_method - chem_treatment - chloride - chlorophyll - climate_environment - collection_date - conduc - cool_syst_id - crop_rotation - cult_root_med - cur_land_use - cur_vegetation - cur_vegetation_meth - date_last_rain - density - depos_env - depth - dew_point - diether_lipids - diss_carb_dioxide - diss_hydrogen - diss_inorg_carb - diss_inorg_nitro - diss_inorg_phosp - diss_iron - diss_org_carb - diss_org_nitro - diss_oxygen - diss_oxygen_fluid - door_comp_type - door_cond - door_direct - door_loc - door_mat - door_move - door_size - door_type - door_type_metal - door_type_wood - door_water_mold - down_par - drainage_class - drawings - efficiency_percent - elev - elevator - emulsions - env_broad_scale - env_local_scale - env_medium - env_package - escalator - ethylbenzene - exp_duct - exp_pipe - experimental_factor - ext_door - ext_wall_orient - ext_window_orient - extreme_event - fao_class - fertilizer_regm - field - filter_type - fire - fireplace_type - flooding - floor_age - floor_area - floor_cond - floor_count - floor_finish_mat - floor_struc - floor_thermal_mass - floor_water_mold - fluor - freq_clean - freq_cook - fungicide_regm - furniture - gaseous_environment - gaseous_substances - gender_restroom - genetic_mod - geo_loc_name - glucosidase_act - gravidity - gravity - growth_facil - growth_habit - growth_hormone_regm - hall_count - handidness - hc_produced - hcr - hcr_fw_salinity - hcr_geol_age - hcr_pressure - hcr_temp - heat_cool_type - heat_deliv_loc - heat_sys_deliv_meth - heat_system_id - heavy_metals - heavy_metals_meth - height_carper_fiber - herbicide_regm - horizon_meth - host_age - host_body_habitat - host_body_product - host_body_site - host_body_temp - host_color - host_common_name - host_diet - host_dry_mass - host_family_relation - host_genotype - host_genus - host_growth_cond - host_height - host_last_meal - host_length - host_life_stage - host_phenotype - host_sex - host_shape - host_species - host_strain - host_subject_id - host_subspecf_genlin - host_substrate - host_symbiont - host_taxid - host_tot_mass - host_wet_mass - humidity - humidity_regm - indoor_space - indoor_surf - indust_eff_percent - inorg_particles - inside_lux - int_wall_cond - iw_bt_date_well - iwf - last_clean - lat_lon - light_intensity - light_regm - light_type - link_addit_analys - link_class_info - link_climate_info - lithology - local_class - local_class_meth - magnesium - max_occup - mean_frict_vel - mean_peak_frict_vel - mech_struc - mechanical_damage - methane - micro_biomass_meth - microbial_biomass - mineral_nutr_regm - misc_param - n_alkanes - nitrate - nitrite - nitro - non_min_nutr_regm - number_pets - number_plants - number_resident - occup_density_samp - occup_document - occup_samp - org_carb - org_count_qpcr_info - org_matter - org_nitro - org_particles - organism_count - owc_tvdss - oxy_stat_samp - oxygen - part_org_carb - part_org_nitro - particle_class - permeability - perturbation - pesticide_regm - petroleum_hydrocarb - ph - ph_meth - ph_regm - phaeopigments - phosphate - phosplipid_fatt_acid - photon_flux - plant_growth_med - plant_product - plant_sex - plant_struc - pollutants - porosity - potassium - pour_point - pre_treatment - pres_animal_insect - pressure - prev_land_use_meth - previous_land_use - primary_prod - primary_treatment - prod_rate - prod_start_date - profile_position - quad_pos - radiation_regm - rainfall_regm - reactor_type - redox_potential - rel_air_humidity - rel_humidity_out - rel_samp_loc - reservoir - resins_pc - room_air_exch_rate - room_architec_elem - room_condt - room_connected - room_count - room_dim - room_door_dist - room_door_share - room_hallway - room_loc - room_moist_dam_hist - room_net_area - room_occup - room_samp_pos - room_type - room_vol - room_wall_share - room_window_count - root_cond - root_med_carbon - root_med_macronutr - root_med_micronutr - root_med_ph - root_med_regl - root_med_solid - root_med_suppl - salinity - salinity_meth - salt_regm - samp_capt_status - samp_collec_device - samp_collec_method - samp_collect_point - samp_dis_stage - samp_floor - samp_loc_corr_rate - samp_mat_process - samp_md - samp_name - samp_preserv - samp_room_id - samp_size - samp_sort_meth - samp_store_dur - samp_store_loc - samp_store_temp - samp_subtype - samp_taxon_id - samp_time_out - samp_transport_cond - samp_tvdss - samp_type - samp_weather - samp_well_name - saturates_pc - season - season_environment - season_precpt - season_temp - season_use - secondary_treatment - sediment_type - sewage_type - shad_dev_water_mold - shading_device_cond - shading_device_loc - shading_device_mat - shading_device_type - sieving - silicate - size_frac - size_frac_low - size_frac_up - slope_aspect - slope_gradient - sludge_retent_time - sodium - soil_horizon - soil_text_measure - soil_texture_meth - soil_type - soil_type_meth - solar_irradiance - soluble_inorg_mat - soluble_org_mat - soluble_react_phosp - source_mat_id - space_typ_state - specific - specific_humidity - sr_dep_env - sr_geol_age - sr_kerog_type - sr_lithology - standing_water_regm - store_cond - substructure_type - sulfate - sulfate_fw - sulfide - surf_air_cont - surf_humidity - surf_material - surf_moisture - surf_moisture_ph - surf_temp - suspend_part_matter - suspend_solids - tan - temp - temp_out - tertiary_treatment - tidal_stage - tillage - tiss_cult_growth_med - toluene - tot_carb - tot_depth_water_col - tot_diss_nitro - tot_inorg_nitro - tot_iron - tot_nitro - tot_nitro_cont_meth - tot_nitro_content - tot_org_c_meth - tot_org_carb - tot_part_carb - tot_phosp - tot_phosphate - tot_sulfur - train_line - train_stat_loc - train_stop_loc - turbidity - tvdss_of_hcr_press - tvdss_of_hcr_temp - typ_occup_density - ventilation_rate - ventilation_type - vfa - vfa_fw - vis_media - viscosity - volatile_org_comp - wall_area - wall_const_type - wall_finish_mat - wall_height - wall_loc - wall_surf_treatment - wall_texture - wall_thermal_mass - wall_water_mold - wastewater_type - water_cont_soil_meth - water_content - water_current - water_cut - water_feat_size - water_feat_type - water_prod_rate - water_temp_regm - watering_regm - weekday - win - wind_direction - wind_speed - window_cond - window_cover - window_horiz_pos - window_loc - window_mat - window_open_freq - window_size - window_status - window_type - window_vert_pos - window_water_mold - xylene - ecosystem - ecosystem_category - ecosystem_type - ecosystem_subtype - specific_ecosystem - ecosystem_path_id - community - habitat - host_name - location - ncbi_taxonomy_name - proport_woa_temperature - salinity_category - sample_collection_site - soluble_iron_micromol - subsurface_depth - dna_isolate_meth - rna_isolate_meth - collection_date_inc - collection_time - collection_time_inc - experimental_factor_other - filter_method - isotope_exposure - micro_biomass_c_meth - micro_biomass_n_meth - microbial_biomass_c - microbial_biomass_n - non_microb_biomass - non_microb_biomass_method - org_nitro_method - other_treatment - start_date_inc - start_time_inc - project_id - replicate_number - sample_shipped - sample_type - technical_reps - analysis_type - sample_link - bulk_elect_conductivity - infiltrations - zinc - manganese - ammonium_nitrogen - nitrate_nitrogen - nitrite_nitrogen - lbc_thirty - lbceq slot_usage: name: name: name description: A local identifier or name for the material sample collected. We recommend it be informative, concise, and consistent within your lab. It must be unique within a study. International Nucleotide Sequence Database Collaboration (INSDC) requires every sample name from a single submitter to be unique. We recommend that, in addition to populating this field, you populate the `source_mat_id` field with a globally-unique identifier. examples: - value: BW-H-17-M required: true provenance_metadata: name: provenance_metadata description: Provenance metadata for this Biosample, including when the record was added to and last modified in the NMDC database. collected_from: name: collected_from pattern: ^(nmdc):frsite-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:frsite-{id_shoulder}-{id_blade}$' interpolated: true elev: name: elev title: elevation, meters comments: - All elevations must be reported in meters. Provide the numerical portion only. - Please use https://www.advancedconverter.com/map-tools/find-altitude-by-coordinates, if needed, to help estimate the elevation based on latitude and longitude coordinates. examples: - value: '100' range: float id: name: id description: An NMDC assigned unique identifier for a biosample submitted to NMDC. required: true pattern: ^(nmdc):bsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:bsm-{id_shoulder}-{id_blade}$' interpolated: true gold_biosample_identifiers: name: gold_biosample_identifiers annotations: tooltip: tag: tooltip value: Provide the GOLD biosample IDs associated with this biosample. description: Unique identifier for a biosample submitted to GOLD that matches the NMDC submitted biosample comments: - This is the ID provided by GOLD that starts with 'Gb' alternative_identifiers: name: alternative_identifiers description: Unique identifier for a biosample submitted to additional resources. Matches the entity that has been submitted to NMDC lat_lon: name: lat_lon notes: - This is currently a required field but it's not clear if this should be required for human hosts env_broad_scale: name: env_broad_scale required: true env_local_scale: name: env_local_scale required: true env_medium: name: env_medium required: true associated_studies: name: associated_studies range: Study required: true pattern: ^(nmdc):sty-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:sty-{id_shoulder}-{id_blade}$' interpolated: true fire: name: fire annotations: Expected_value: tag: Expected_value value: date string todos: - is "to" acceptable? Is there a better way to request that be written? comments: - Provide the date the fire occurred. If extended burning occurred provide the date range. examples: - value: '1871-10-10' - value: 1871-10-01 to 1871-10-31 range: string pattern: ^[12]\d{3}(?:(?:-(?:0[1-9]|1[0-2]))(?:-(?:0[1-9]|[12]\d|3[01]))?)?(\s+to\s+[12]\d{3}(?:(?:-(?:0[1-9]|1[0-2]))(?:-(?:0[1-9]|[12]\d|3[01]))?)?)?$ flooding: name: flooding annotations: Expected_value: tag: Expected_value value: date string todos: - is "to" acceptable? Is there a better way to request that be written? - What about if the "day" isn't known? Is this ok? comments: - Provide the date the flood occurred. If extended flooding occurred provide the date range. examples: - value: '1927-04-15' - value: 1927-04 to 1927-05 range: string extreme_event: name: extreme_event annotations: Expected_value: tag: Expected_value value: date, string examples: - value: 1980-05-18, volcanic eruption range: string slope_aspect: name: slope_aspect description: The direction a slope faces. While looking down a slope use a compass to record the direction you are facing (direction or degrees). This measure provides an indication of sun and wind exposure that will influence soil temperature and evapotranspiration. comments: - Aspect is the orientation of slope, measured clockwise in degrees from 0 to 360, where 0 is north-facing, 90 is east-facing, 180 is south-facing, and 270 is west-facing. slope_gradient: name: slope_gradient todos: - Slope is a percent. How does the validation work? Check to correct examples examples: - value: 10% - value: 10 % - value: '0.10' al_sat: name: al_sat description: The relative abundance of aluminum in the sample title: aluminum saturation/ extreme unusual properties todos: - Example & validation. Can we configure things so that 27% & 27 % & 0.27 will validate? - I think it's weird the way GSC writes the title. I recommend this change. Thoughts? I would argue this isn't an extreme unusual property. It's just a biogeochemical measurement. notes: - Aluminum saturation is the percentage of the CEC occupies by aluminum. Like all cations, aluminum held by the cation exchange complex is in equilibrium with aluminum in the soil solution. examples: - value: 27% al_sat_meth: name: al_sat_meth description: Reference or method used in determining Aluminum saturation title: aluminum saturation method/ extreme unusual properties todos: - I think it's weird the way GSC writes the title. I recommend this change. Thoughts? comments: - Required when aluminum saturation is provided. examples: - value: https://doi.org/10.1371/journal.pone.0176357 - value: doi:10.1371/journal.pone.0176357 - value: PMID:28448589 cur_vegetation: name: cur_vegetation description: Vegetation classification from one or more standard classification systems, or agricultural crop todos: - Recommend changing this from text value to some king of ontology? comments: - Values provided here can be specific species of vegetation or vegetation regions - See for vegetation regions- https://education.nationalgeographic.org/resource/vegetation-region examples: - value: deciduous forest - value: forest - value: Bauhinia variegata cur_vegetation_meth: name: cur_vegetation_meth todos: - I'm not sure this is a DOI, PMID, or URI. Should pool the community and find out how they accomplish this if provided. comments: - Required when current vegetation is provided. examples: - value: https://doi.org/10.1111/j.1654-109X.2011.01154.x - value: doi:10.1111/j.1654-109X.2011.01154.x heavy_metals: name: heavy_metals description: Heavy metals present in the sample and their concentrations. title: heavy metals/ extreme unusual properties todos: - Example & validation. Can we configure things so that 27% & 27 % & 0.27 will validate? - I think it's weird the way GSC writes the title. I recommend this change. Thoughts? I would argue this isn't an extreme unusual property. It's just a biogeochemical measurement. comments: - For multiple heavy metals and concentrations, separate by ; examples: - value: mercury 0.09 micrograms per gram - value: mercury 0.09 ug/g; chromium 0.03 ug/g heavy_metals_meth: name: heavy_metals_meth title: heavy metals method/ extreme unusual properties comments: - Required when heavy metals are provided examples: - value: https://doi.org/10.3390/ijms9040434 - value: doi:10.1007/BF01056090 - value: https://doi.org/10.1007/s00216-006-0322-8 multivalued: true horizon_meth: name: horizon_meth examples: - value: https://doi.org/10.1016/j.geoderma.2019.113898 - value: doi:10.1016/j.geoderma.2019.113898 link_addit_analys: name: link_addit_analys examples: - value: https://doi.org/10.1111/j.1574-6941.2011.01140.x - value: doi:10.1111/j.1574-6941.2011.01140.x link_climate_info: name: link_climate_info examples: - value: https://www.int-res.com/abstracts/cr/v14/n3/p161-173/ - value: doi:10.3354/cr014161 local_class_meth: name: local_class_meth examples: - value: https://www.nrcs.usda.gov/resources/education-and-teaching-materials/the-twelve-orders-of-soil-taxonomy micro_biomass_meth: name: micro_biomass_meth examples: - value: https://doi.org/10.1016/j.soilbio.2005.01.021 - value: doi:10.1016/j.soilbio.2005.01.021 prev_land_use_meth: name: prev_land_use_meth examples: - value: https://doi.org/10.2737/SRS-GTR-155 - value: doi:10.2737/SRS-GTR-155 season_precpt: name: season_precpt title: average seasonal precipitation todos: - check validation & examples. always mm? so value only? Or value + unit notes: - mean and average are the same thing, but it seems like bad practice to not be consistent. Changed mean to average comments: - Seasons are defined as spring (March, April, May), summer (June, July, August), autumn (September, October, November) and winter (December, January, February). water_cont_soil_meth: name: water_cont_soil_meth todos: - Why is it soil water content method in the name but not the title? Is this slot used in other samples? - Soil water content can be measure MANY ways and often, multiple ways are used in one experiment (gravimetric water content and water holding capacity and water filled pore space, to name a few). - Should this be multi valued? How to we manage and validate this? comments: - Required if providing water content examples: - value: https://dec.alaska.gov/applications/spar/webcalc/definitions.htm - value: doi:10.1016/j.geoderma.2019.113898 water_content: name: water_content annotations: Expected_value: tag: Expected_value value: string Preferred_unit: tag: Preferred_unit value: gram per gram or cubic centimeter per cubic centimeter todos: - value in preferred unit is too limiting. need to change this - check and correct validation so examples are accepted - how to manage multiple water content methods? examples: - value: 0.75 g water/g dry soil - value: 75% water holding capacity - value: 1.1 g fresh weight/ dry weight - value: 10% water filled pore space range: string multivalued: true ph_meth: name: ph_meth comments: - This can include a link to the instrument used or a citation for the method. examples: - value: https://doi.org/10.2136/sssabookser5.3.c16 - value: doi:10.2136/sssabookser5.3.c16 - value: https://www.southernlabware.com/pc9500-benchtop-ph-conductivity-meter-kit-ph-accuracy-2000mv-ph-range-2-000-to-20-000.html tot_carb: name: tot_carb todos: - is this inorganic and organic? both? could use some clarification. - ug/L doesn't seem like the right units. Should check this slots usage in databases and re-evaluate. I couldn't find any references that provided this data in this format examples: - value: 1 ug/L tot_nitro_cont_meth: name: tot_nitro_cont_meth examples: - value: https://doi.org/10.2134/agronmonogr9.2.c32 - value: doi:10.2136/sssaj2009.0389 tot_org_c_meth: name: tot_org_c_meth examples: - value: https://doi.org/10.1080/07352680902776556 - value: doi:10.1080/07352680902776556 tot_org_carb: name: tot_org_carb todos: - check description. How are they different? sieving: name: sieving todos: - check validation and examples comments: - Describe how samples were composited or sieved. - Use 'sample link' to indicate which samples were combined. examples: - value: combined 2 cores | 4mm sieved - value: 4 mm sieved and homogenized - value: 50 g | 5 cores | 2 mm sieved climate_environment: name: climate_environment todos: - description says "can include multiple climates" but multivalued is set to false - add examples, i need to see some examples to add correctly formatted example. gaseous_environment: name: gaseous_environment todos: - would like to see usage examples for this slot. Requiring micromole/L seems too limiting and doesn't match expected_value value - did I do this right? keep the example that's provided and add another? so as to not override examples: - value: CO2; 500ppm above ambient; constant - value: nitric oxide;0.5 micromole per liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M watering_regm: name: watering_regm examples: - value: 1 liter;R2/2018-05-11T14:30/2018-05-11T19:30/P1H30M - value: 75% water holding capacity; constant source_mat_id: name: source_mat_id description: A globally unique identifier assigned to the biological sample. title: source material identifier todos: - Currently, the comments say to use UUIDs. However, if we implement assigning NMDC identifiers with the minter we dont need to require a GUID. It can be an optional field to fill out only if they already have a resolvable ID. comments: - Identifiers must be prefixed. Possible FAIR prefixes are IGSNs (http://www.geosamples.org/getigsn), NCBI biosample accession numbers, ARK identifiers (https://arks.org/). These IDs enable linking to derived analytes and subsamples. If you have not assigned FAIR identifiers to your samples, you can generate UUIDs (https://www.uuidgenerator.net/). examples: - value: igsn:AU1243 - value: UUID:24f1467a-40f4-11ed-b878-0242ac120002 class_uri: nmdc:Biosample MobilePhaseSegment: name: MobilePhaseSegment description: A fluid mixture of substances that flow though a chromatographic stationary phase. comments: - Can be assembled into a list to account for a gradient. - Works best for separations that can be accounted for by a series of essentially linear changes in the mobile phase composition. - For gradients, each segment should declare it's duration. - For step-wise separations that might be implemented with a syringe and a cartridge, it will probably be more important to assert volumes. from_schema: https://w3id.org/nmdc/nmdc slots: - duration - substances_used - type - volume class_uri: nmdc:MobilePhaseSegment MaterialProcessing: name: MaterialProcessing description: A process that takes one or more samples as inputs and generates one or more samples as outputs. notes: - This class is a replacement for BiosampleProcessing. from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - OBI:0000094 is_a: PlannedProcess abstract: true slots: - instrument_used slot_usage: has_input: name: has_input range: Sample pattern: ^(nmdc):(bsm|procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(bsm|procsm)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output range: ProcessedSample pattern: ^(nmdc):(procsm)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(procsm)-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:MaterialProcessing PortionOfSubstance: name: PortionOfSubstance description: A portion of any matter of defined composition that has discrete existence, whose origin may be biological, mineral or chemical. title: Portion of a Substance from_schema: https://w3id.org/nmdc/nmdc mappings: - schema:Substance slots: - final_concentration - mass - source_concentration - known_as - substance_role - type - volume class_uri: nmdc:PortionOfSubstance ProcessedSample: name: ProcessedSample title: Processed Sample from_schema: https://w3id.org/nmdc/nmdc is_a: Sample slots: - biomaterial_purity - dna_absorb1 - dna_concentration - external_database_identifiers - sampled_portion slot_usage: id: name: id required: true pattern: ^(nmdc):procsm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:procsm-{id_shoulder}-{id_blade}$' interpolated: true class_uri: nmdc:ProcessedSample OrganismSample: name: OrganismSample description: A material sample in which all cells are expected to share the same genome. This includes microbial colony picks, pellets from presumably pure liquid cultures, plant tissue clips, fungal fruiting body sections, and similar materials where the submitter intends to study a single organism. The purity expectation may be contradicted by sequencing results. title: Organism Sample comments: - An OrganismSample is not necessarily pure. The submitter expects it to contain a single organism, but sequencing may reveal contamination. Purity and strain-verification fields (single-colony isolation, ribosomal sequences, fungal screening) are JGI submission logistics and live in submission-schema JgiIsolateInterface, not here. - The expected_organism slot links to an Organism instance representing what the submitter believes is in the sample. - The defining criterion is genomic homogeneity of intent, not material type. A bacterial colony pick, a plant leaf clip, and a fungal fruiting body section are all OrganismSamples because the submitter expects one genome. An algal mat, a cat fecal sample for microbiome study, or a soil sample are Biosamples because they contain communities of organisms. from_schema: https://w3id.org/nmdc/nmdc see_also: - https://github.com/microbiomedata/nmdc-schema/issues/2803 - https://github.com/microbiomedata/nmdc-schema/issues/2961 close_mappings: - OBI:0100051 is_a: Sample slots: - associated_studies - expected_organism - embargoed - provenance_metadata - external_database_identifiers - gold_organism_identifiers - collection_date - samp_name - host_taxid - ploidy - source_mat_id - analysis_type slot_usage: id: name: id required: true pattern: ^(nmdc):osm-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:osm-{id_shoulder}-{id_blade}$' interpolated: true expected_organism: name: expected_organism pattern: ^(nmdc):orgn-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:orgn-{id_shoulder}-{id_blade}$' interpolated: true source_mat_id: name: source_mat_id description: Culture collection identifier for the source of this organism sample. comments: - On OrganismSample the slot identifies the catalog entry the strain was ordered from. CURIE form using a declared prefix is preferred (e.g. dsmz:DSM-15171, atcc:700808). Per-collection normalization rules and prefix-coverage gaps are documented in src/docs/jgi-isolate-field-routing.md. examples: - description: Ruegeria pomeroyi DSS-3 at DSMZ (bioregistry prefix dsmz; same strain as atcc:700808 and lmg:23168). Verified in GOLD organism_v2. https://www.dsmz.de/collection/catalogue/details/culture/DSM-15171 object: type: nmdc:TextValue has_raw_value: dsmz:DSM-15171 - description: Ruegeria pomeroyi DSS-3 at ATCC (bioregistry prefix atcc; same strain as dsmz:DSM-15171 and lmg:23168). Verified in GOLD organism_v2. https://www.atcc.org/products/700808 object: type: nmdc:TextValue has_raw_value: atcc:700808 - description: Ruegeria pomeroyi DSS-3 at BCCM/LMG (not yet in bioregistry; same strain as dsmz:DSM-15171 and atcc:700808). Verified in BCCM/LMG catalogue 2026-04-30. https://bccm.belspo.be/catalogues/lmg-strain-details?NUM=23168 object: type: nmdc:TextValue has_raw_value: lmg:23168 - description: Pseudomonas putida KT2440 at JCM/RIKEN (bioregistry prefix jcm). http://www.jcm.riken.go.jp/cgi-bin/jcm/jcm_number?JCM=20004 object: type: nmdc:TextValue has_raw_value: jcm:20004 - description: Bacillus subtilis 168 at NBRC/NITE (bioregistry prefix nbrc). http://www.nbrc.nite.go.jp/NBRC2/NBRCCatalogueDetailServlet?ID=NBRC&CAT=13719 object: type: nmdc:TextValue has_raw_value: nbrc:13719 - description: Escherichia coli at BCRC/FIRDI (bioregistry prefix bcrc). https://catalog.bcrc.firdi.org.tw/BcrcContent?bid=10694 object: type: nmdc:TextValue has_raw_value: bcrc:10694 in_subset: - jgi_isolate see_also: - https://github.com/microbiomedata/nmdc-schema/issues/3036 structured_aliases: - literal_form: Culture Collection and ID predicate: NARROW_SYNONYM notes: - Exact JGI form template is access-restricted; source is the public submission overview. - JGI label is narrower (culture-collection-only) than MIxS source_mat_id (any material-sample identifier). source: https://jgi.doe.gov/user-programs/pmo-overview/project-materials-submission-overview/ class_uri: nmdc:OrganismSample Site: name: Site title: Site comments: - BCO sample collection site ? from_schema: https://w3id.org/nmdc/nmdc is_a: MaterialEntity abstract: true class_uri: nmdc:Site MagBin: name: MagBin from_schema: https://w3id.org/nmdc/nmdc slots: - bin_name - bin_quality - completeness - contamination - gene_count - gtdbtk_class - gtdbtk_domain - gtdbtk_family - gtdbtk_genus - gtdbtk_order - gtdbtk_phylum - gtdbtk_species - members_id - num_16s - num_23s - num_5s - num_t_rna - number_of_contig - total_bases - type - eukaryotic_evaluation class_uri: nmdc:MagBin MetaboliteIdentification: name: MetaboliteIdentification description: This is used to link a metabolomics analysis workflow to a specific metabolite from_schema: https://w3id.org/nmdc/nmdc slots: - alternative_identifiers - highest_similarity_score - metabolite_identified - type class_uri: nmdc:MetaboliteIdentification GeneProduct: name: GeneProduct id_prefixes: - PR - UniProtKB - gtpo description: A molecule encoded by a gene that has an evolved function notes: - we may include a more general gene product class in future to allow for ncRNA annotation from_schema: https://w3id.org/nmdc/nmdc exact_mappings: - biolink:GeneProduct is_a: NamedThing class_uri: nmdc:GeneProduct MetagenomeAssembly: name: MetagenomeAssembly description: A workflow execution activity that converts sequencing reads into an assembled metagenome. comments: - instances of this class may use a de novo assembly strategy in most or all cases relevant to NMDC from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - asm_score - scaffolds - scaf_logsum - scaf_powsum - scaf_max - scaf_bp - scaf_n50 - scaf_n90 - scaf_l50 - scaf_l90 - scaf_n_gt50k - scaf_l_gt50k - scaf_pct_gt50k - contigs - contig_bp - ctg_n50 - ctg_l50 - ctg_n90 - ctg_l90 - ctg_logsum - ctg_powsum - ctg_max - gap_pct - gc_std - gc_avg - num_input_reads - num_aligned_reads - insdc_assembly_identifiers slot_usage: id: name: id required: true pattern: ^(nmdc):wfmgas-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmgas-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: MetagenomeAssembly pattern: ^(nmdc):wfmgas-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmgas-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:MetagenomeAssembly MetatranscriptomeAssembly: name: MetatranscriptomeAssembly from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - asm_score - scaffolds - scaf_logsum - scaf_powsum - scaf_max - scaf_bp - scaf_n50 - scaf_n90 - scaf_l50 - scaf_l90 - scaf_n_gt50k - scaf_l_gt50k - scaf_pct_gt50k - contigs - contig_bp - ctg_n50 - ctg_l50 - ctg_n90 - ctg_l90 - ctg_logsum - ctg_powsum - ctg_max - gap_pct - gc_std - gc_avg - num_input_reads - num_aligned_reads - insdc_assembly_identifiers slot_usage: id: name: id required: true pattern: ^(nmdc):wfmtas-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmtas-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: MetatranscriptomeAssembly pattern: ^(nmdc):wfmtas-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmtas-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:MetatranscriptomeAssembly MetatranscriptomeAnnotation: name: MetatranscriptomeAnnotation from_schema: https://w3id.org/nmdc/nmdc is_a: AnnotatingWorkflow slots: - img_identifiers - gold_analysis_project_identifiers slot_usage: id: name: id required: true pattern: ^(nmdc):wfmtan-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmtan-{id_shoulder}-{id_blade}{id_version}$' interpolated: true img_identifiers: name: img_identifiers maximum_cardinality: 1 has_input: name: has_input pattern: ^(nmdc):(dobj)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dobj)-{id_shoulder}-{id_blade}$' interpolated: true has_output: name: has_output pattern: ^(nmdc):(dobj)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(dobj)-{id_shoulder}-{id_blade}$' interpolated: true was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true gold_analysis_project_identifiers: name: gold_analysis_project_identifiers pattern: ^gold:Ga[0-9]+$ structured_pattern: syntax: ^gold:Ga[0-9]+$ interpolated: true superseded_by: name: superseded_by range: MetatranscriptomeAnnotation pattern: ^(nmdc):wfmtan-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmtan-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:MetatranscriptomeAnnotation MetatranscriptomeExpressionAnalysis: name: MetatranscriptomeExpressionAnalysis description: A workflow process that provides expression values and read counts for gene features predicted on the contigs. from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - img_identifiers slot_usage: id: name: id required: true pattern: ^(nmdc):wfmtex-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmtex-{id_shoulder}-{id_blade}{id_version}$' interpolated: true img_identifiers: name: img_identifiers maximum_cardinality: 1 was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: MetatranscriptomeExpressionAnalysis pattern: ^(nmdc):wfmtex-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmtex-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:MetatranscriptomeExpressionAnalysis MagsAnalysis: name: MagsAnalysis description: A workflow execution activity that uses computational binning tools to group assembled contigs into genomes title: Metagenome-Assembled Genome analysis activity from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - binned_contig_num - input_contig_num - low_depth_contig_num - mags_list - too_short_contig_num - unbinned_contig_num - img_identifiers slot_usage: id: name: id required: true pattern: ^(nmdc):wfmag-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmag-{id_shoulder}-{id_blade}{id_version}$' interpolated: true img_identifiers: name: img_identifiers maximum_cardinality: 1 was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: MagsAnalysis pattern: ^(nmdc):wfmag-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmag-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:MagsAnalysis ReadQcAnalysis: name: ReadQcAnalysis description: A workflow execution activity that performs quality control on raw Illumina reads including quality trimming, artifact removal, linker trimming, adapter trimming, spike-in removal, and human/cat/dog/mouse/microbe contaminant removal title: Read quality control analysis activity from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - input_base_count - input_read_bases - input_read_count - output_base_count - output_read_bases - output_read_count slot_usage: id: name: id required: true pattern: ^(nmdc):wfrqc-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfrqc-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: ReadQcAnalysis pattern: ^(nmdc):wfrqc-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfrqc-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:ReadQcAnalysis ReadBasedTaxonomyAnalysis: name: ReadBasedTaxonomyAnalysis description: A workflow execution activity that performs taxonomy classification using sequencing reads title: Read based analysis activity from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slot_usage: id: name: id required: true pattern: ^(nmdc):wfrbt-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfrbt-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: NucleotideSequencing pattern: ^(nmdc):(omprc|dgns)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgns)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: ReadBasedTaxonomyAnalysis pattern: ^(nmdc):wfrbt-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfrbt-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:ReadBasedTaxonomyAnalysis MetabolomicsAnalysis: name: MetabolomicsAnalysis from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - has_metabolite_identifications - uses_calibration - metabolomics_analysis_category - peak_count - peak_assignment_count - c13_isotopologue_count slot_usage: id: name: id required: true pattern: ^(nmdc):wfmb-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmb-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: MassSpectrometry pattern: ^(nmdc):(omprc|dgms)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgms)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: MetabolomicsAnalysis pattern: ^(nmdc):wfmb-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmb-{id_shoulder}-{id_blade}{id_version}$' interpolated: true peak_count: name: peak_count description: 'The total number of two dimensional mass to charge (m/z) : retention time features detected in the metabolomics analysis.' peak_assignment_count: name: peak_assignment_count description: 'The total number of two dimensional mass to charge (m/z) : retention time features with associated metabolite identification in the metabolomics or lipidomics analysis.' class_uri: nmdc:MetabolomicsAnalysis MetaproteomicsAnalysis: name: MetaproteomicsAnalysis from_schema: https://w3id.org/nmdc/nmdc is_a: AnnotatingWorkflow slots: - metaproteomics_analysis_category - peptide_to_spectrum_match_count - peptide_to_spectrum_match_rate - unique_peptide_seq_count - razor_protein_count - mean_peptide_count - total_protein_count slot_usage: id: name: id required: true pattern: ^(nmdc):wfmp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmp-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: MassSpectrometry pattern: ^(nmdc):(omprc|dgms)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgms)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: MetaproteomicsAnalysis pattern: ^(nmdc):wfmp-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfmp-{id_shoulder}-{id_blade}{id_version}$' interpolated: true class_uri: nmdc:MetaproteomicsAnalysis NomAnalysis: name: NomAnalysis from_schema: https://w3id.org/nmdc/nmdc is_a: WorkflowExecution slots: - uses_calibration - peak_count - peak_assignment_count slot_usage: id: name: id required: true pattern: ^(nmdc):wfnom-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfnom-{id_shoulder}-{id_blade}{id_version}$' interpolated: true was_informed_by: name: was_informed_by range: MassSpectrometry pattern: ^(nmdc):(omprc|dgms)-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})$ structured_pattern: syntax: '{id_nmdc_prefix}:(omprc|dgms)-{id_shoulder}-{id_blade}$' interpolated: true superseded_by: name: superseded_by range: NomAnalysis pattern: ^(nmdc):wfnom-([0-9][a-z]{0,6}[0-9])-([A-Za-z0-9]{1,})(\.[1-9]{1}[0-9]{0,})$ structured_pattern: syntax: '{id_nmdc_prefix}:wfnom-{id_shoulder}-{id_blade}{id_version}$' interpolated: true peak_assignment_count: name: peak_assignment_count description: The number of m/z peaks with assigned molecular formulas in the analysis. class_uri: nmdc:NomAnalysis metamodel_version: 1.11.0 source_file: src/schema/nmdc.yaml settings: id_nmdc_prefix: setting_key: id_nmdc_prefix setting_value: ^(nmdc) id_shoulder: setting_key: id_shoulder setting_value: ([0-9][a-z]{0,6}[0-9]) id_blade: setting_key: id_blade setting_value: ([A-Za-z0-9]{1,}) id_version: setting_key: id_version setting_value: (\.[1-9]{1}[0-9]{0,}) id_locus: setting_key: id_locus setting_value: (_[A-Za-z0-9_\.-]+)?$ add_recov_methods: setting_key: add_recov_methods setting_value: Water Injection|Dump Flood|Gas Injection|Wag Immiscible Injection|Polymer Addition|Surfactant Addition|Not Applicable|other agrochemical_name: setting_key: agrochemical_name setting_value: .* amount: setting_key: amount setting_value: '[-+]?[0-9]*\.?[0-9]+' boolean: setting_key: boolean setting_value: (?:yes|no) country: setting_key: country setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) date_time_stamp: setting_key: date_time_stamp setting_value: (\d{4})(-(0[1-9]|1[0-2])(-(0[1-9]|[12]\d|3[01])(T([01]\d|2[0-3]):([0-5]\d)(:([0-5]\d))?(\.\d+)?(Z|([+-][01]\d:[0-5]\d))?)?)?)? dna_bases: setting_key: dna_bases setting_value: '[ACGT]' DOI: setting_key: DOI setting_value: doi:10\.\d{2,9}/.* duration: setting_key: duration setting_value: P(?:(?:\d+D|\d+M(?:\d+D)?|\d+Y(?:\d+M(?:\d+D)?)?)(?:T(?:\d+H(?:\d+M(?:\d+S)?)?|\d+M(?:\d+S)?|\d+S))?|T(?:\d+H(?:\d+M(?:\d+S)?)?|\d+M(?:\d+S)?|\d+S)|\d+W) float: setting_key: float setting_value: '[-+]?[0-9]*\.?[0-9]+' integer: setting_key: integer setting_value: '[1-9][0-9]*' lat: setting_key: lat setting_value: (-?((?:[0-8]?[0-9](?:\.\d{0,8})?)|90)) lon: setting_key: lon setting_value: -?[0-9]+(?:\.[0-9]{0,8})?$|^-?(1[0-7]{1,2}) name: setting_key: name setting_value: .* NCBItaxon_id: setting_key: NCBItaxon_id setting_value: NCBITaxon:\d+ parameters: setting_key: parameters setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) particulate_matter_name: setting_key: particulate_matter_name setting_value: .* PMID: setting_key: PMID setting_value: PMID:\d+ primer_adapter_codes: setting_key: primer_adapter_codes setting_value: '[ACGTRYSWKMBDHVNI]' region: setting_key: region setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) room_name: setting_key: room_name setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) room_number: setting_key: room_number setting_value: '[1-9][0-9]*' scientific_float: setting_key: scientific_float setting_value: '[-+]?[0-9]*\.?[0-9]+(?:[eE][-+]?[0-9]+)?' software: setting_key: software setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) specific_location: setting_key: specific_location setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) storage_condition_type: setting_key: storage_condition_type setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) termID: setting_key: termID setting_value: '[a-zA-Z]{2,}:[a-zA-Z0-9]\d+' termLabel: setting_key: termLabel setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) text: setting_key: text setting_value: .* timestamp: setting_key: timestamp setting_value: (\d{4})(-(0[1-9]|1[0-2])(-(0[1-9]|[12]\d|3[01])(T([01]\d|2[0-3]):([0-5]\d)(:([0-5]\d))?(\.\d+)?(Z|([+-][01]\d:[0-5]\d))?)?)?)? unit: setting_key: unit setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+) URL: setting_key: URL setting_value: https?:\/\/(?:www\.)?[-a-zA-Z0-9@:%._\+~#=]{1,256}\.[a-zA-Z0-9()]{1,6}\b(?:[-a-zA-Z0-9()@:%_\+.~#?&\/=]*) version: setting_key: version setting_value: ([^\s-]{1,2}|[^\s-]+.+[^\s-]+)