{ "graphs" : [ { "id" : "http://purl.obolibrary.org/obo/geno.json", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.org/dc/elements/1.1/description", "val" : "GENO is an OWL model of genotypes, their more fundamental sequence components, and links to related biological and experimental entities. At present many parts of the model are exploratory and set to undergo refactoring. In addition, many classes and properties have GENO URIs but are place holders for classes that will be imported from an external ontology (e.g. SO, ChEBI, OBI, etc). Furthermore, ongoing work will implement a model of genotype-to-phenotype associations. This will support description of asserted and inferred relationships between a genotypes, phenotypes, and environments, and the evidence/provenance behind these associations. \n\nDocumentation is under development as well, and for now a slidedeck is available at http://www.slideshare.net/mhb120/brush-icbo-2013" }, { "pred" : "http://purl.org/dc/elements/1.1/title", "val" : "GENO ontology" }, { "pred" : "http://purl.org/dc/terms/license", "val" : "https://creativecommons.org/licenses/by/4.0/" }, { "pred" : "http://www.w3.org/2002/07/owl#versionInfo", "val" : "2026-02-02" } ], "version" : "http://purl.obolibrary.org/obo/geno/releases/2026-02-02/geno.json" }, "nodes" : [ { "id" : "http://biohackathon.org/resource/faldo#BothStrandsPosition", "lbl" : "Both strands", "type" : "CLASS" }, { "id" : "http://biohackathon.org/resource/faldo#ExactPosition", "lbl" : "Exact position", "type" : "CLASS", "meta" : { "definition" : { "val" : "A position that is exactly known." } } }, { "id" : "http://biohackathon.org/resource/faldo#ForwardStrandPosition", "lbl" : "Positive strand", "type" : "CLASS" }, { "id" : "http://biohackathon.org/resource/faldo#Position", "lbl" : "Position", "type" : "CLASS", "meta" : { "definition" : { "val" : "Superclass for the general concept of a position on a sequence. The sequence is designated with the reference predicate." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We place the FALDO:Position class under GENO:genomic location, as it represents a type of genomic location with an extent of 1 (i.e.has the same start and end coordinates - representing a single position as opposed to a location spanning a longer region)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "FALDO" } ] } }, { "id" : "http://biohackathon.org/resource/faldo#Region", "lbl" : "Region", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region describes a length of sequence with a start position and end position that represents a feature on a sequence, e.g. a gene." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "From what I can tell, feature instances in data whose position is to be defined using FALDO are always mapped to a Region, and then the position of this Region is defined according to its location within some larger reference sequence. The exception may be feature instances that are explicitly part of the reference sequence on which its location is being defined (such that no 'mapping' to a reference is required). This suggests that, conceptually, we can think of a FALDO:Region as a subregion of a reference sequence that is mapped to from a feature of interest, in order to define its position with respect to that reference sequence." } ] } }, { "id" : "http://biohackathon.org/resource/faldo#ReverseStrandPosition", "lbl" : "Negative strand", "type" : "CLASS" }, { "id" : "http://biohackathon.org/resource/faldo#StrandedPosition", "lbl" : "Stranded position", "type" : "CLASS", "meta" : { "comments" : [ "Part of the coordinate system denoting on which strand the feature can be found. If you do not yet know which stand the feature is on, you should tag the position with just this class. If you know more you should use one of the subclasses. This means a region described with a '.' in GFF3. A GFF3 unstranded position does not have this type in FALDO -- those are just a 'position'." ] } }, { "id" : "http://purl.obolibrary.org/obo/APOLLO_SV_00000008", "lbl" : "software development", "type" : "CLASS", "meta" : { "definition" : { "val" : "A planned process that has specified output a software product and that involves the creation of source code." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Mathias Brochhausen" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "William R. Hogan" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://en.wikipedia.org/wiki/Software_development" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "A planned process resulting in a software product involving the creation of source code." } ] } }, { "id" : "http://purl.obolibrary.org/obo/APOLLO_SV_00000796", "lbl" : "dataset creating", "type" : "CLASS", "meta" : { "definition" : { "val" : "A planned process that has a data set as its specified output." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "creating a data set" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "William R. Hogan" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data set creation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "dataset creation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000001", "lbl" : "entity", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "entity" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Entity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Julius Caesar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Verdi’s Requiem" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the Second World War" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "your body mass index" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: In all areas of empirical inquiry we encounter general terms of two sorts. First are general terms which refer to universals or types:animaltuberculosissurgical procedurediseaseSecond, are general terms used to refer to groups of entities which instantiate a given universal but do not correspond to the extension of any subuniversal of that universal because there is nothing intrinsic to the entities in question by virtue of which they – and only they – are counted as belonging to the given group. Examples are: animal purchased by the Emperortuberculosis diagnosed on a Wednesdaysurgical procedure performed on a patient from Stockholmperson identified as candidate for clinical trial #2056-555person who is signatory of Form 656-PPVpainting by Leonardo da VinciSuch terms, which represent what are called ‘specializations’ in [81" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001])" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000002", "lbl" : "continuant", "type" : "CLASS", "meta" : { "definition" : { "val" : "An entity that exists in full at any time in which it exists at all, persists through time while maintaining its identity and has no temporal parts." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "continuant" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Continuant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "continuant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: Continuant entities are entities which can be sliced to yield parts only along the spatial dimension, yielding for example the parts of your table which we call its legs, its top, its nails. ‘My desk stretches from the window to the door. It has spatial parts, and can be sliced (in space) in two. With respect to time, however, a thing is a continuant.’ [60, p. 240" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000003", "lbl" : "occurrent", "type" : "CLASS", "meta" : { "definition" : { "val" : "An entity that has temporal parts and that happens, unfolds or develops through time." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "occurrent" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Occurrent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: every occurrent that is not a temporal or spatiotemporal region is s-dependent on some independent continuant that is not a spatial region" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: s-dependence obtains between every process and its participants in the sense that, as a matter of necessity, this process could not have existed unless these or those participants existed also. A process may have a succession of participants at different phases of its unfolding. Thus there may be different players on the field at different times during the course of a football game; but the process which is the entire game s-depends_on all of these players nonetheless. Some temporal parts of this process will s-depend_on on only some of the players." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000004", "lbl" : "independent continuant", "type" : "CLASS", "meta" : { "definition" : { "val" : "b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002])" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "ic" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "IndependentContinuant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a chair" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a heart" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a leg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a molecule" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a spatial region" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an atom" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an orchestra." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an organism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the bottom right portion of a human torso" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the interior of your mouth" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000015", "lbl" : "process", "type" : "CLASS", "meta" : { "definition" : { "val" : "p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003])" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "process" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Process" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a process of cell-division, \\ a beating of the heart" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a process of meiosis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a process of sleeping" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the course of a disease" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the flight of a bird" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the life of an organism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "your process of aging." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: The realm of occurrents is less pervasively marked by the presence of natural units than is the case in the realm of independent continuants. Thus there is here no counterpart of ‘object’. In BFO 1.0 ‘process’ served as such a counterpart. In BFO 2.0 ‘process’ is, rather, the occurrent counterpart of ‘material entity’. Those natural – as contrasted with engineered, which here means: deliberately executed – units which do exist in the realm of occurrents are typically either parasitic on the existence of natural units on the continuant side, or they are fiat in nature. Thus we can count lives; we can count football games; we can count chemical reactions performed in experiments or in chemical manufacturing. We cannot count the processes taking place, for instance, in an episode of insect mating behavior.Even where natural units are identifiable, for example cycles in a cyclical process such as the beating of a heart or an organism’s sleep/wake cycle, the processes in question form a sequence with no discontinuities (temporal gaps) of the sort that we find for instance where billiard balls or zebrafish or planets are separated by clear spatial gaps. Lives of organisms are process units, but they too unfold in a continuous series from other, prior processes such as fertilization, and they unfold in turn in continuous series of post-life processes such as post-mortem decay. Clear examples of boundaries of processes are almost always of the fiat sort (midnight, a time of death as declared in an operating theater or on a death certificate, the initiation of a state of war)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000016", "lbl" : "disposition", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "disposition" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Disposition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an atom of element X has the disposition to decay to an atom of element Y" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "certain people have a predisposition to colon cancer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "children are innately disposed to categorize objects in certain ways." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the cell wall is disposed to filter chemicals in endocitosis and exocitosis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the cell wall is disposed to filter chemicals in endocytosis and exocytosis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type [89" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000017", "lbl" : "realizable entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "A specifically dependent continuant that inheres in continuant entities and are not exhibited in full at every time in which it inheres in an entity or group of entities. The exhibition or actualization of a realizable entity is a particular manifestation, functioning or process that occurs under certain circumstances." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "realizable" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "RealizableEntity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the disposition of this piece of metal to conduct electricity." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the disposition of your blood to coagulate" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the function of your reproductive organs" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of being a doctor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of this boundary to delineate where Utah and Colorado meet" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000019", "lbl" : "quality", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "quality" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Quality" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "quality" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the ambient temperature of this portion of air" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the color of a tomato" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the length of the circumference of your waist" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the mass of this piece of gold." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the shape of your nose" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the shape of your nostril" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000020", "lbl" : "specifically dependent continuant", "type" : "CLASS", "meta" : { "definition" : { "val" : "b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003])" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "sdc" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "SpecificallyDependentContinuant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "specifically dependent continuant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Reciprocal specifically dependent continuants: the function of this key to open this lock and the mutually dependent disposition of this lock: to be opened by this key" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "of one-sided specifically dependent continuants: the mass of this tomato" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "of relational dependent continuants (multiple bearers): John’s love for Mary, the ownership relation between John and this statue, the relation of authority between John and his subordinates." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the disposition of this fish to decay" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the function of this heart: to pump blood" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the mutual dependence of proton donors and acceptors in chemical reactions [79" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the mutual dependence of the role predator and the role prey as played by two organisms in a given interaction" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the pink color of a medium rare piece of grilled filet mignon at its center" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of being a doctor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the shape of this hole." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the smell of this portion of mozzarella" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000023", "lbl" : "role", "type" : "CLASS", "meta" : { "definition" : { "val" : "A realizable entity the manifestation of which brings about some result or end that is not essential to a continuant in virtue of the kind of thing that it is but that can be served or participated in by that kind of continuant in some kinds of natural, social or institutional contexts." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "role" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "Role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the priest role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of a boundary to demarcate two neighboring administrative territories" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of a building in serving as a military target" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of a stone in marking a property boundary" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the role of subject in a clinical trial" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the student role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: One major family of examples of non-rigid universals involves roles, and ontologies developed for corresponding administrative purposes may consist entirely of representatives of entities of this sort. Thus ‘professor’, defined as follows,b instance_of professor at t =Def. there is some c, c instance_of professor role & c inheres_in b at t.denotes a non-rigid universal and so also do ‘nurse’, ‘student’, ‘colonel’, ‘taxpayer’, and so forth. (These terms are all, in the jargon of philosophy, phase sortals.) By using role terms in definitions, we can create a BFO conformant treatment of such entities drawing on the fact that, while an instance of professor may be simultaneously an instance of trade union member, no instance of the type professor role is also (at any time) an instance of the type trade union member role (any more than any instance of the type color is at any time an instance of the type length).If an ontology of employment positions should be defined in terms of roles following the above pattern, this enables the ontology to do justice to the fact that individuals instantiate the corresponding universals – professor, sergeant, nurse – only during certain phases in their lives." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "b is a role means: b is a realizable entity and b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be and b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000031", "lbl" : "generically dependent continuant", "type" : "CLASS", "meta" : { "definition" : { "val" : "b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001])" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "gdc" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "GenericallyDependentContinuant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The entries in your database are patterns instantiated as quality instances in your hard drive. The database itself is an aggregate of such patterns. When you create the database you create a particular instance of the generically dependent continuant type database. Each entry in the database is an instance of the generically dependent continuant type IAO: information content entity." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the pdf file on your laptop, the pdf file that is a copy thereof on my laptop" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the sequence of this protein molecule; the sequence that is a copy thereof in that protein molecule." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000034", "lbl" : "function", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000040", "lbl" : "material entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/BFO_0000179", "val" : "material" }, { "pred" : "http://purl.obolibrary.org/obo/BFO_0000180", "val" : "MaterialEntity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material entity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material entity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a flame" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a forest fire" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a human being" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a hurricane" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a photon" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a puff of smoke" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a sea wave" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a tornado" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an aggregate of human beings." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an energy wave" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an epidemic" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the undetached arm of a human being" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: Material entities (continuants) can preserve their identity even while gaining and losing material parts. Continuants are contrasted with occurrents, which unfold themselves in successive temporal parts or phases [60" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: Object, Fiat Object Part and Object Aggregate are not intended to be exhaustive of Material Entity. Users are invited to propose new subcategories of Material Entity." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BFO 2 Reference: ‘Matter’ is intended to encompass both mass and energy (we will address the ontological treatment of portions of energy in a later version of BFO). A portion of matter is anything that includes elementary particles among its proper or improper parts: quarks and leptons, including electrons, as the smallest particles thus far discovered; baryons (including protons and neutrons) at a higher level of granularity; atoms and molecules at still higher levels, forming the cells, organs, organisms and other material entities studied by biologists, the portions of rock studied by geologists, the fossils studied by paleontologists, and so on.Material entities are three-dimensional entities (entities extended in three spatial dimensions), as contrasted with the processes in which they participate, which are four-dimensional entities (entities extended also along the dimension of time).According to the FMA, material entities may have immaterial entities as parts – including the entities identified below as sites; for example the interior (or ‘lumen’) of your small intestine is a part of your body. BFO 2.0 embodies a decision to follow the FMA here." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Elucidation: An independent continuant that is spatially extended whose identity is independent of that of other entities and can be maintained through time." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ido.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uberon.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000601", "val" : "every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002])" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000602", "val" : "(forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] " }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CHEBI_23367", "lbl" : "molecular entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "molecular entity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for imports of molecular entities from ChEBI ontology." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We are assuming that every molecular entity has to be completely connected by chemical bonds. This excludes protein complexes, which are comprised of minimally two separate molecular entities. We will follow up with Chebi to ensure this is their understanding as well" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/chebi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CHEBI_33696", "lbl" : "nucleic acid", "type" : "CLASS", "meta" : { "definition" : { "val" : "A macromolecule made up of nucleotide units and hydrolysable into certain pyrimidine or purine bases (usually adenine, cytosine, guanine, thymine, uracil), D-ribose or 2-deoxy-D-ribose and phosphoric acid." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "nucleic acid" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/chebi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CHEBI_33839", "lbl" : "macromolecule", "type" : "CLASS", "meta" : { "definition" : { "val" : "A macromolecule is a molecule of high relative molecular mass, the structure of which essentially comprises the multiple repetition of units derived, actually or conceptually, from molecules of low relative molecular mass." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "macromolecule" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "polymer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/chebi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CLO_0000001", "lbl" : "细胞系细胞", "type" : "CLASS", "meta" : { "definition" : { "val" : "一个培养细胞,它是一个细胞株(一个稳定的,同质的细胞群,具有共同的生物学起源和增殖史)的一部分\n" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cell line cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cell line cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "细胞系细胞" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/clo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CLO_0000031", "lbl" : "细胞系", "type" : "CLASS", "meta" : { "definition" : { "val" : "培养的细胞群体代表具有共同繁殖历史(即已经在培养中一起连续传代)的遗传稳定且同质的培养细胞群体。 \n" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cell line" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "细胞系" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/clo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000000", "lbl" : "cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity of anatomical origin (part of or deriving from an organism) that has as its parts a maximally connected cell compartment surrounded by a plasma membrane.", "xrefs" : [ "CARO:mah" ] }, "comments" : [ "Stub class to serve as root of hierarchy for imports of cell types from CL or other cell terminologies." ], "xrefs" : [ { "val" : "CALOHA:TS-2035" }, { "val" : "FMA:68646" }, { "val" : "GO:0005623" }, { "val" : "KUPO:0000002" }, { "val" : "MESH:D002477" }, { "val" : "VHOG:0001533" }, { "val" : "WBbt:0004017" }, { "val" : "XAO:0003012" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "PMID:18089833.Cancer Res. 2007 Dec 15;67(24):12018-25. \"...Epithelial cells were harvested from histologically confirmed adenocarcinomas ..\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "CL and GO definitions of cell differ based on inclusive or exclusive of cell wall, etc." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We struggled with this definition. We are worried about circularity. We also considered requiring the capability of metabolism." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000001", "lbl" : "primary cultured cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cultured cell that is freshly isolated from a organismal source, or derives in culture from such a cell prior to the culture being passaged." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "primary cultured cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000010", "lbl" : "cultured cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cell in vitro that is or has been maintained or propagated as part of a cell culture." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cultured cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000236", "lbl" : "B cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A lymphocyte of B lineage that is capable of B cell mediated immunity." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "B cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000542", "lbl" : "lymphocyte", "type" : "CLASS", "meta" : { "definition" : { "val" : "A lymphocyte is a leukocyte commonly found in the blood and lymph that has the characteristics of a large nucleus, a neutral staining cytoplasm, and prominent heterochromatin." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "lymphocyte" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000578", "lbl" : "experimentally modified cell in vitro", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cell in vitro that has undergone physical changes as a consequence of a deliberate and specific experimental procedure." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "experimentally modified cell in vitro" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/CL_0000842", "lbl" : "mononuclear cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A leukocyte with a single non-segmented nucleus in the mature form." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "mononuclear cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/cl.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01000254", "lbl" : "environmental system", "type" : "CLASS", "meta" : { "definition" : { "val" : "A system which has the disposition to environ one or more material entities.", "xrefs" : [ "DOI:10.1186/2041-1480-4-43" ] }, "comments" : [ "In ENVO's alignment with the Basic Formal Ontology, this class is being considered as a subclass of a proposed BFO class \"system\". The relation \"environed_by\" is also under development. Roughly, a system which includes a material entity (at least partially) within its site and causally influences that entity may be considered to environ it. Following the completion of this alignment, this class' definition and the definitions of its subclasses will be revised." ], "xrefs" : [ { "val" : "EcoLexicon:environment" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "1. Stub class to serve as root of hierarchy for imports from an ontology of environment and experimental conditions.\n\n2. Need to consdier how to model environments in a way that covers ENVO and XCO content in a consistent and coherent way. A couple classes under Exploratory Class are relvant here. Consider how we might approach environments/condisitons using an EQ aproach analogous to how phenotypes are defined (i.e. consider environments/coonditions as qualities inhereing in some entity)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000000", "lbl" : "genomic genotype (sex-agnostic)", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic genotype that does not specify the sex determining chromosomal features of its bearer (i.e. does not indicate the background sex chromosome complement)" }, "comments" : [ "In practice, most genotype instances classified as sex-agnostic genotypes because they are not sex-specific. When a genotype is indicated to be that of a male or female, it implies a known sex chromosome complement in the genomic background. This requires us to distinguish separate 'sex-qualified' genotype instances for males and females that share a common 'sex-agnostic' genotype. For example, male and female mice that of the same strain/background and containing the same set of genetic variations will have the same sex-agnostic intrinsic genotype, but different sex-qualified intrinsic genotypes (which take into account background sex chromosome sequence as identifying criteria for genotype instances)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Example zebrafish intrinsic genotype:\n\nGenotype = fgf8a; shha (AB)\nreference component (genomic background) = AB \nvariant component ('genomic variation complement') = fgf8a; shha\n\n. . . and within this variant component, there are two 'variant single locus complements' represented:\n\nallele complement 1 = fgf8a\nallele complement 2 = shha\n\nand within each of these 'variant single locus complements' there is one or more variant gene locus member:\n\nin complement 1: fgf8a\nin complement 2: shha" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This modeling approach allows use to create separate genotype instances for data sources that report sex-specific phenotypes to ensure that sex-specific G2P differences are accurately described. These sex-qualified genotypes can be linked to the more general sex-agnostic intrinsic genotype that is shared by make and female mice of the same strain, to aggregate associated phenotypes at this level, and allow aggregation with G2P association data about the same strains from sources that distinguish sex-specific phenotypes (e.g. IMPC) and those that do not (e.g. MGI).\n\nConceptually, a sex-qualified phenotype represents a superset of sequence features relative to a sex-agnostic intirnsic genotype, in that if specifies the background sex-chromosome complement of the genome. Thus, in the genotype partonomy, a sex-qualified genotype has as part a sex-agnostic genotype. This allows for the propagation of phenotypes associated with a sex-qualified genotype to the intrinsic genotype." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genotype" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "organismal genotype" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sex-agnostic intrinsic genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000002", "lbl" : "variant allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele that varies in it sequence from what is considered the reference or canonical sequence at that location." }, "comments" : [ "Note that what is considered the 'reference' vs. 'variant' sequence at a given locus may be context-dependent - so being 'variant' is more a role played in a particular situation. A 'variant allele' contains a 'sequence alteration', or is itself a 'sequence alteration', that makes it vary_with some other allele to which it is being compared. But in any comparison of alternative sequences at a particular genomic location, the choice of a 'reference' vs the 'variant' is context-dependent - as comparisons in other contexts might consider a different feature to be the reference. So being 'variant' is more a role played in a particular situation - as an allele that is variant in one context/analysis may be considered reference in another.\n\nA variant allele can be variant along its entire extent, in which case it is considered a 'sequence alteration', or it can span a broader extent of sequence contains sequence alteration(s) as part. And example of the former is a SNP, and an example of the latter is a variant gene allele that contains one or more point mutations in its sequence." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The use of the descriptor 'variant' here is consistent with naming recommendations from the ACMG Guidelines paper here: PMID:25741868. Generally, the descriptive labels chosen for subtypes of variant allele conform these recommendations as well, where 'variant' is used to cover mutant and polymorphic alleles." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "alternate allele" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sequence-variant feature" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "variant feature" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000009", "lbl" : "genomic variation complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic feature set representing all 'variant single locus complements' in a single genome, which together constitute the 'variant' component of a genomic genotype." }, "comments" : [ "A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a complement may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features. Here, a 'genomic variation complement' is the set of all 'single locus complements' in a particular genome that harbor some known variation.\n\nIn model organisms, the majority of genotypes describe variation at a single location in the genome (ie only one 'single-locus variant complement') that are variant realtive to some reference background. For example, the genotype instance 'fgf8a(AB)') exhibits a mutation at only one locus. But some genotypes describe variation at more than one location (e.g. a double mutant that has alterations in the fgf8a gene and the shh gene))." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note that even a reference feature (e.g. a wild-type gene) that is a member of a single locus complement that contains a variant allele is included in this 'genomic variation complement'. Thus, the members of this 'genomic variation complement' (which is a sequence collection) are 'single locus variant complements'. Our axiom below uses has_part rather than has_member, however, to account for the fact that many 'genomic variation complements' have only one 'single locus variant complement' as members. So because has_member is not reflexive, it is not appropriate for these cases." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000010", "lbl" : "background genome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A reference genome that represents the sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations)." }, "xrefs" : [ { "val" : "OBI:genetic population background information" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The ZFIN background 'AB' that serves as a reference as part of the genotype fgf8a^ti282a/+ (AB)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Here, a 'genomic background' would differ form a 'reference genome' in that 'background' implies a derivation of the variant from the background (which is the case for most MOD strains), whereas a reference is simply meant as a target for comparison. But in a sense all background genomes are by default reference, in that the derived variant genome is compared against it." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genomic background" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000014", "lbl" : "gene allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic feature that represents one of a set of versions of a gene (i.e. a haplotype whose extent is that of a gene)" }, "comments" : [ "In SO, the concept of a 'gene' is functionally defined, in that a gene necessarily produces a functional product. By contrast, the concept of a 'gene allele' here is positionally defined - representing the sequence present at the location a gene resides in a reference genome (based on sequence alignment). An Shh gene allele, for example, may be a fully functional wild-type version of the gene, a non-functional version carrying a deleterious point mutation, a truncated version of the gene, or even a complete deletion. In all these cases, an 'Shh gene allele' exists at the position where the canonical gene resides in the reference genome - even if the extent of this allele different than the wild-type, or even zero in the case of the complete deletion.\n\nA genomic feature being an allele_of a gene is based on its location in a host genome - not on its sequence. This means, for example, that the insertion of the human SMN2 gene into the genome of a mouse (see http://www.informatics.jax.org/allele/MGI:3056903) DOES NOT represent an allele_of the human SMN2 gene according to the GENO model - because it is located in a mouse genome, not a human one. Rather, this is a transgenic insertion that derives_sequence_from the human SMN2 gene. If this human SMN2 gene is inserted within the mouse SMN2 gene locus (e.g. used to replace mouse SMN2 gene), the feature it creates is an allele_of the mouse SMN2 gene (one that happens to match the sequence of the human ortholog of the gene). But again, it is not an allele_of the human SMN2 gene." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/SO_0001023 ! allele" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The reference/wild-type cd99l2 danio rerio gene allele spans bases 27,004,426-27,021,059 on Chromosome 7. The \"mn004Gt\" represents an experimentally-created allele of this gene, in which sequence from a gene trap construct containing an RFP marker has been inserted at the cd99l2 gene locus. The resulting gene allele includes sequence from this construct that make it longer than the reference gene sequence, and also alter its seqauence in a way that prevents it from producing a functional product. The sequence extent of this cd99l2 gene allele is determined based on how its sequence aligns with that of the canonical gene and surrounding sequence in a reference genome.\n\nhttp://useast.ensembl.org/Danio_rerio/Gene/Summary?g=ENSDARG00000056722\n\nhttps://zfin.org/ZDB-ALT-111117-8" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Regarding the distinction between a 'gene' and a 'gene allele': Every zebrafish genome contains a 'gene allele' for every zebrafish gene. Many will be 'wild-type' or at least functional gene alleles. But some may be alleles that are mutated or truncated so as to lack functionality. According to current SO criteria defining genes, a 'gene' no longer exists in the case of a non-functional or deleted variant. But the 'gene allele' does exist - and its extent is that of the remaining/altered sequence based on alignment with a reference gene. Even for completely deleted genes, an allele of the gene exists (and here is equivalent to the junction corresponding to the where gene would live based on a reference alignment).\n\nThis design allows us to classify genes and any variants of those genes (be they functional or not) as the same type of thing (ie a 'gene allele'), since classification is based on genomic position rather than functional capacity. This is practical for representation of variant genotypes which often carry non-functional versions of a gene at a particular locus. What is important here is specifying what is present at a locus associated with a particular gene, whether or not it is a functional gene or not." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000017", "lbl" : "reference sequence", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence that serves as a standard against which other sequences at the same location are compared." }, "comments" : [ "A reference sequence is one that serves as a standard against which 'variant' versions of the feature are compared, or against which located sequence features within the reference region are aligned in order to assign position information. Being 'reference' does not imply anything about the frequency or function of features bearing the sequence. Only that some agent has used it to serve a reference role in defining a variant or locating a sequence." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The notion of a 'reference' in GENO is implemented at the level of 'biological sequence' rather than at the level of a sequence feature - i.e. we define a class for 'reference sequence' rather than reference sequence feature'. This is because it is at the *sequence* level that features of interest are determined to be variant or not. It is taken for granted that the *location* of the feature of interest is the same as that of the reference sequence to which it is compared, becasue an alignment process establishing common location always precedes the sequence comparison that determines if the feature is variant." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "reference sequence" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000019", "lbl" : "obsolete sequence feature collection", "type" : "CLASS", "meta" : { "definition" : { "val" : "a collection more than one sequence features (ie a collection of discontinuous sequence features)" }, "comments" : [ "1. Note that members of this class can be features with extents of zero (e.g. junctions). This is likely different than the SO:sequence feature class which has members that are regions." ], "xrefs" : [ { "val" : "perhaps not same as SO:sequence collection, as here we explicitly include features that can have an extent of zero (and SO:sequence collection is a collection of regions that have an extent of at least one)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000022", "lbl" : "obsolete genomic feature collection", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature collection comprised of discontiguous sequences from a single genome" }, "comments" : [ "Conceptually, members of this collection are meant to be about the sum total genetic material in a single cell or organism. But these members need not be associated with an actual material in a real cell or organism individual. For example, things like a 'reference genome' may not actually represent the material genome of any individual cell or organism in reality. Here, there may be no genomic material referents of the sequences in such a collection because the genome is tied to an idealized, hypothetical cell or organism instance. The key is that conceptually, they are still tied to the idea of being contained in a single genome. In the case of a genotype, the individual seqeunce members are not all about the genetic material of a singel cell or organism. Rather, it is the resolved sequence contained in the genotype that is meant to be about the total genomic sequence content of a genome - which we deem acceptable for classifying as a genetic locus collection." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Previously called 'genetic locus collection'. Difference between 'genetic' and 'genomic', as used here, is that 'genomic' implies a feature is a heritable part of some genome, while 'genetic' implies that it is part of some feature that is capable of contributing to gene expression in a cell or other biological system." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genomic feature collection" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000029", "lbl" : "obsolete reference single locus complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A single locus complement that serves as a standard against which 'variant' sequences are compared" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "reference allelic complement" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "reference single locus feature complement" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity.\n\nEq Class axiom:\n'single locus complement'\n and (has_sequence_attribute some reference)\n\nSC axioms:\n'has member' exactly 0 'variant allele'\n'has member' only 'reference genomic feature'\n'has member' some 'reference genomic feature'" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000030", "lbl" : "variant single locus complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A single locus complement in which at least one member allele is considered variant, and/or the total number of features in the complement deviates from the normal poloidy of the reference genome (e.g. trisomy 13)." }, "comments" : [ "Instances of this class are sets comprised of all allels at a specified genomic location where at least one allele is variant (non-reference). In diploid genomes this complement typically has two members.\n\nNote that this class also covers cases where deviant numbers of genes or chromosomes are present in a genome (e.g. trisomy of chromosome 21), even if their sequence is not variant." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "variant allelic complement" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000033", "lbl" : "variant genome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genome that varies at one or more loci from the sequence of some reference genome." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/SO_0001506 ! variant_genome (definition of SO term here is too vague to know if has same meaning as GENO class here)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000036", "lbl" : "reference allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele whose sequence matches what is consdiered to be the reference sequence at that location in the genome." }, "comments" : [ "Being a 'reference allele' is a role or status assigned in the context of a specific dataset or analysis. In human variation datasets, 'reference' status is typically assigned based on factors such as being the most common in a population, being an ancestral allele, or being indentified first as a prototypical example of some feature or gene. For example, 'reference alleles' in characterizing SNPs often represent the allele first characterized in a reference genome, or the most common allele in a population.\n\nIn model organism datasets, 'reference' alleles are typically (but not always) the 'wild-type' variant at a given locus, representing a functional and unaltered version of the feature that is part of a defined genomic background, and against which natural or experimentally-induced alterations are compared." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000037", "lbl" : "obsolete unspecified feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic feature known to exist, but remaining uncharacterized with respect to its identity (e.g. which allele exists at a given gene locus)." }, "comments" : [ "An unspecified feature is known to exist as the partner of a characterized allele when the zygosity at that locus is not known. Its specific sequence/identity, however, is unknown (ie whether it is a reference or variant allele)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Uses as a term of convenience for describing data reporting unspecified alleles in a genotype (i.e. in cases where zygosoty for a given locus is not known). Typlically recorded in genotype syntaxes as a ' /? '." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity.\n\nEq Class def: 'genomic feature'\n and (has_sequence_attribute some unspecified)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000042", "lbl" : "obsolete reference junction", "type" : "CLASS", "meta" : { "definition" : { "val" : "A junction found at a chromosomal position where an insertion has occurred on the homologous chromosome, such that the junction represents the reference feature paired with the hemizygously inserted feature." }, "comments" : [ "In the case of a transgenic insertion that creates a hemizygous locus, the refernce locus that this insertion is variant_with is the junction on the homologous chromosome at the same position where the insertion occurred. This is the 'hemizygous reference' junction.\n\nThe junction-insertion pair represents the allelic complement at that locus, which is considered to be hemizygous. Most genotype syntaxes represent this hemizygous state with a ' /0' notation." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "hemizygous reference junction" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Eliminating unecessary defined/organizational classes. Former logical def:\n\njunction\n and (has_sequence_attribute some reference)\n\nSubclass axiom:\nis_variant_with some insertion" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000047", "lbl" : "danio rerio gene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A gene that originates from the genome of a danio rerio." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000054", "lbl" : "homo sapiens gene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A gene that originates from the genome of a homo sapiens." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000057", "lbl" : "mus musculus gene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A gene that originates from the genome of a mus musculus." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000060", "lbl" : "obsolete reference gene allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "A version/allele of a gene that serves as a standard against which variant genes are compared." }, "comments" : [ "Being a 'reference gene' is a role or status assigned in the context of a specific dataset or analysis. In human variation datasets, 'reference' status is typically assigned based on factors such as being the most common version/allele in a population, being an ancestral allele, or being indentified first as a prototypical example of a gene.\n\nIn model organism datasets, 'reference' genes are typically the 'wild-type' allele for a given gene, representing a functional and unaltered version of the gene that is part of a defined genomic background, and against which natural or experimentally-induced versions are compared." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A reference human sonic hedgehog (shh) gene spans bases 155,592,680-155,604,967 on Chromosome 7, according to genome build GRCh37, and produces a primary funcitonal transcript that is 4454 bp in length and produces a 462 amino acid protein involved in cell signaling events behind various aspects of cell differentiation and development.\nhttp://useast.ensembl.org/Homo_sapiens/Gene/Summary?g=ENSG00000164690\n\nNote that this may be slightly different than the extend described in other gene databases, such as Entrez Gene:http://www.ncbi.nlm.nih.gov/gene/6469" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "reference gene" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Not required at present for any specific use case, so marking as exploratory and obsoleting for simplicity.\n\nEq Class axiom:\n'gene allele'\n and (has_sequence_attribute some reference)\n\nSC axioms:\nis_variant_with some 'gene allele'\nis_reference_allele_of some gene" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000091", "lbl" : "obsolete experimental insertion", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000092", "lbl" : "gene trap insertion", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000093", "lbl" : "integrated transgene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene that has been integrated into a chrromosome in the host genome." }, "comments" : [ "An integrated transgene differs from a transgenic insertion in that a transgenic insertion may contain single transgene, a partial transgene that needs endognous sequences from the host genome to become functional (e.g. an enhancer trap), or multiple transgenes (i.e. be polycistronic). Fiurthermore, the transgenic insertion may contain sequences in addition to its transgene(s - e.g. sequences flanking the transgene reqired for integration or replicaiton/maintenance in the host genome. The term 'integrated transgene' covers individual transgenes that were delivered in whole or in part by a transgenic insertion.\n\nAn 'integrated transgene' differs from its parent 'transgene' in that transgenes can include genes introduced into a cell/organism on an extra-chromosomal plasmid that is never integrated into the host genome." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000106", "lbl" : "genomic material", "type" : "CLASS", "meta" : { "definition" : { "val" : "A nucleic acid macromolecule that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or is capable of being replicated and inherited through successive generations of progeny." }, "comments" : [ "1. Genomic material here is considered as a DNA or RNA molecule that is found in a cell or virus, and capable of being replicated and inherited by progeny cells or virus. As such, this nucleic acid is either chromosomal DNA, or some replicative epi-chromosomal plasmid or transposon. Genetic material is necessarily part of some 'material genome', and both are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genetic material - rather, we could say that this genomic library is a 'genomic material sample' that bears the concretization of some genome.\n\n2. Genomic material need not be inherited from an immediate ancestor cell or organism (e.g. a replicative plasmid or transposon acquired through some experimental modification), but such cases must be capable of being inherited by progeny cells or organisms." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "1. Note that at present, a material genome and genetic material are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genomic material - rather, we could say that this genomic library is a 'genomic material sample' that bears the concretization of some genome.\n\n2. A challenging edge case is experimentally delivered DNA into a terminally differentiated cell that will never divide. Such material does technically meet our definition - since we are careful to say that the material must be *capable of* being stably inherited through subsequent generations. Thus, we would say that *if* the cell were resume replication, the material would be heritable in this way." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000108", "lbl" : "material genome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity that represents all genetic material in a cell or virion. The material genome is typically molecular aggregate of all the chromosomal DNA and epi-chromosomal DNA that represents all sequences that are heritable by progeny of a cell or virion." }, "comments" : [ "A genome is the collection of all nucleic acids in a cell or virus, representing all of an organism's hereditary information. It is typically DNA, but many viruses have RNA genomes. The genome includes both nuclear chromosomes (ie nuclear and micronucleus chromosomes) and cytoplasmic chromosomes stored in various organelles (e.g. mitochondrial or chloroplast chromosomes), and can in addition contain non-chromosomal elements such as replicative viruses, plasmids, and transposable elements.\n\nNote that at present, a material genome and genetic material are necessarily part of some cell or virion. So a genomic library is not considered a material genome/genetic material - rather, we could say that this genomic library is a 'genomic material sample' that bears the concretization of some SO:genome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "physical genome" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000111", "lbl" : "human population", "type" : "CLASS", "meta" : { "definition" : { "val" : "a population of homo sapiens grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Consider http://semanticscience.org/resource/SIO_001062 ! human population (\"A human population refers to a collection of human beings\")." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "homo sapiens population" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000112", "lbl" : "strain or breed", "type" : "CLASS", "meta" : { "definition" : { "val" : "A maximal collection of organisms of a single species that have been bred or experimentally manipulated with the goal of being genetically identical." }, "comments" : [ "Two mice colonies with the same genotype information, but maintained in different labs, are different strains (many examples of this in MGI/IMSR)" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "organism strain or breed" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000113", "lbl" : "taxonomic group", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A group comprised of organisms from a single taxonomic group (e.g. family, order, genus, species, or a strain or breed within a given taxon)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000118", "lbl" : "mus musculus strain", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000119", "lbl" : "danio rerio strain", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000125", "lbl" : "obsolete sequence feature collection attribute", "type" : "CLASS", "meta" : { "definition" : { "val" : "sequence attribute that can inhere only in a collection of more than one sequence features" }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000131", "lbl" : "in cis", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in a collection of discontinuous sequence features in a single genome that reside on the same macromolecule (eg the same chromosomes)." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000132", "lbl" : "in trans", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in a collection of discontinuous sequence features in a single genome that reside on different macromolecules (e.g. different chromosomes)." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000133", "lbl" : "zygosity", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allelic state that describes the degree of similarity between features in a 'single locus complement', within the genome of a cell or organism (i.e., whether the alleles or haplotypes that reside at the same location on paired chromosomes are the same or different)." }, "xrefs" : [ { "val" : "http://semanticscience.org/resource/SIO_001263" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "allelic state" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "derived from https://en.wikipedia.org/wiki/Zygosity" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000134", "lbl" : "hemizygous", "type" : "CLASS", "meta" : { "definition" : { "val" : "A zygosity quality inhering in a 'single locus complement' with half the number of alleles than normal (e.g. a single allele in a diploid genome, for example, a locus on the Y chromosome in a eukaryotic male genome, or a transgene that is present only in one of the two parental chromosome sets)" }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000135", "lbl" : "heterozygous", "type" : "CLASS", "meta" : { "definition" : { "val" : "A zygosity quality inhering in a 'single locus complement' where the copies of the feature at this location have at least one difference in sequence (in a eukaryotic diploid genome, this means having two distinct alleles on each of the two homologous chromosomes, one inherited from each parent)." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000136", "lbl" : "homozygous", "type" : "CLASS", "meta" : { "definition" : { "val" : "A zygosity quality inhering in a 'single locus complement' where all copies of the feature at this location have the same sequence (in a eukaryotic diploid genome, this means having identical alleles on each of the two homologous chromosomes, one inherited from each parent)." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000137", "lbl" : "unspecified zygosity", "type" : "CLASS", "meta" : { "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "indeterminite zygosity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "no-call zygosity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "unknown zygosity" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000138", "lbl" : "heritabililty", "type" : "CLASS", "meta" : { "definition" : { "val" : "The disposition of an entity to be transmitted to subsequent generations following a genetic replication or organismal reproduction event." }, "comments" : [ "We can use these terms to describe the heritability of genetic matieral or sequence features - e.g. chromosomal DNA or genes are heritable in that they are passed on to child cells/organisms). Such genetic material has a heritable disposition in a cell or virion, in virtue of its being replicated in its cellular host and inherited by progeny cells (such that the sequence content it encodes is stably propagated in the genetic material of subsequence generations of cells).\n\nWe can also use these terms to describe the heritability of phenotypes/conditions - e.g. the passage of a particular trait or disease across generations of reproducing cells/organisms." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000139", "lbl" : "heritable", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000140", "lbl" : "non-heritable", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000141", "lbl" : "inheritance pattern", "type" : "CLASS", "meta" : { "definition" : { "val" : "The pattern in which a genetic trait or condition is passed from one generation to the next, as determined by genetic interactions between alleles of the causal gene, and interactions between these alleles and the environment." }, "comments" : [ "An inheritance pattern results from the disposition of a genetic variant to cause a particular trait or phenotype when it is present in a particular genetic and environmental context. Here, \"genetic context\" refers to the allelic state of the variant, which depends on what other alleles exist at the same location/locus in the genome. Zygosities such as heterozygous and homozygous are simple, common examples of 'states' of an allele. \n\nThese genetic and environmental \"interactions\" of alleles play out at the level of the gene products produced by the causal alleles, and are observable in the pattern with which the trait caused by an allele is inherited across generations of individuals. Thus, an inheritance pattern such as dominance is not inherent to a single allele or its phenotype, but rather a result of the relationship between two alleles of a gene and the phenotype that results in a given environment. This also means that the 'dominance' of an allele is context dependent - Allele 1 can be dominant over Allele 2 in the context of Phenotype X, but recessive to Allele 3 in the context of Phenotype Y." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0000005" }, { "val" : "http://purl.obolibrary.org/obo/NCIT_C45827" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The subtypes of inheritance pattern in this hierarchy are largely distinguished based on the underlying genetic mechanism, which will manifest in a characteristic pattern of traits in affected and unaffected family members. For example, 'autosomal dominant inheritance' defines an inheritance pattern that is caused by the interaction of alleles on non-sex chromosomes wherein the trait manifests even in heterozygotes - resulting in a characteristic pattern of 'dominant' inheritance across generations of individuals in a family." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mode of inheritance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "phenotypic inheritance pattern" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000142", "lbl" : "obsolete dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "disposition inhering in a genetic locus variant that is realized in its inheritance by some offspring such that at least a partial variant-associated phenotype is apparent in heterozygotes" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Triage until decide if want to define this as grouping class that would result in multiple-inheritance." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000143", "lbl" : "co-dominant autosomal inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An autosomal dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000144", "lbl" : "complete autosomal dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An autosomal dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pure dominant inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000145", "lbl" : "incomplete autosomal dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An autosomal dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "intermediate dominant autosomal inheritance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "semi-dominant autosomal inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000146", "lbl" : "X-linked dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An X-linked inheritance pattern wherein the trait manifests in heterozygotes." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001423" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000147", "lbl" : "autosomal dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in heterozygotes." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0000006" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "vertical inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000148", "lbl" : "autosomal recessive inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein a trait caused by alleles of an autosomal gene manifests in homozygous but not heterozygote individuals." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000149", "lbl" : "X-linked recessive inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An X-linked inheritance pattern wherein a trait caused by alleles of a gene on the X-chromosome manifests in homozygous but not heterozygote individuals." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001419" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000150", "lbl" : "obsolete autosomal recessive inheritance", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "duplicate term, use GENO:0000148" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000152", "lbl" : "reference", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute inhering in a feature that is designated to serve as a standard against which 'variant' versions of the same location are compared." }, "comments" : [ "Being 'reference' is a role or status assigned in the context of a data set or analysis framework. A given allele can be reference on one context and variant in another." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000160", "lbl" : "unspecified life cycle stage", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000164", "lbl" : "obsolete genetic insertion technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000165", "lbl" : "obsolete mutagen treatment technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000166", "lbl" : "obsolete targeted gene mutation technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000169", "lbl" : "obsolete random genetic insertion technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000170", "lbl" : "obsolete targeted genetic insertion technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000171", "lbl" : "obsolete enhancer trapping technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000172", "lbl" : "obsolete gene trapping technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000173", "lbl" : "obsolete promoter trapping technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000174", "lbl" : "obsolete targeted knock-in technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000175", "lbl" : "obsolete random transgene insertion technique", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000324", "lbl" : "obsolete chromosome complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A single locus complement that represents the collection of all chromosome sequences for a given chromosome in a single genome" }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000338", "lbl" : "gained aneusomic chromosome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A complete chromosome that has been abnormally duplicated in a genome, typically as the result of a meiotic non-disjunction event or unbalanced translocation" }, "comments" : [ "This 'gained' chromosome is conceptually an 'insertion' in a genome that received two copies of a chromosome in a cell division following a non-disjunction event. As such, it qualifies as a type of sequence_alteration, and as a 'extra' chromosome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "duplicate chromosome" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000339", "lbl" : "lost aneusomic chromosome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A 'deletion' resulting from the loss of a complete chromosome, typically as the result of a meiotic non-disjunction event or unbalanced translocation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This 'lost' chromosome is conceptually a 'deletion' in a genome that received zero copies of a chromosome in a cell division following a non-disjunction event. As such, it qualifies as a type of sequence_alteration. But it doesn't classify under SO:deletion because this class is defined as \"the point at which one or more contiguous nucleotides were excised\"." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "absent aneusomic chromosome" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000343", "lbl" : "aneusomic chromosomal part", "type" : "CLASS", "meta" : { "definition" : { "val" : "A large deletion or terminal addition of part of some non-homologous chromsosome, as the result of an unbalanced translocation." }, "comments" : [ "Aneusomic chromosomal parts are examples of \"partial aneuploidy\" as described in http://en.wikipedia.org/wiki/Aneuploidy: \"The terms \"partial monosomy\" and \"partial trisomy\" are used to describe an imbalance of genetic material caused by loss or gain of part of a chromosome. In particular, these terms would be used in the situation of an unbalanced translocation, where an individual carries a derivative chromosome formed through the breakage and fusion of two different chromosomes. In this situation, the individual would have three copies of part of one chromosome (two normal copies and the portion that exists on the derivative chromosome) and only one copy of part of the other chromosome involved in the derivative chromosome.\"" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Novel sequence features gained in a genome are considered to be sequence alterations, including aneusomic chromosome segments gained through unbalanced translocation events, entire aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that becoome part of the heritable genome of a cell or organism." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "aneuploid chromosomal segment" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "aneusomic chromosomal subregion/segment" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "partial aneusomic chromosomal element" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000344", "lbl" : "gained aneusomic chromosomal segment", "type" : "CLASS", "meta" : { "definition" : { "val" : "A part of some non-homologous chromosome that has been gained as the result of an unbalanced translocation event." }, "comments" : [ "Such additions of translocated chromosomal parts confer a trisomic condition to the duplicated region of the chromsome, and are thus considered to be 'variant single locus complements' in virtue of an abnormal number of features at a particular genomic location, rather than abnormal sequence within the location." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "duplicate partial aneuploid chromosomal element" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "translocated duplicate chromosomal element" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "translocated duplicate chromosomal segment" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000345", "lbl" : "lost aneusomic chromosomal segment", "type" : "CLASS", "meta" : { "definition" : { "val" : "A deletion of a terminal portion of a chromosome resulting from an unbalanced translocation to another chromosome." }, "comments" : [ "This is not a deletion in the sense defined by the Sequence Ontology in that it is not the result of an 'excision' of nucleotides, but an unbalanced translocation event. The allelic complement that results is comprised of the terminus or junction represented by this lost chromosomal segment, and the remaining normal segment in the homologous chromosome. The lost aneusommic chromosomal segment is typically accommpanied by a gained aneusomic chromosomal segment from another chromosome.\n\nLoss of translocated chromosomal parts can confer a monosomic condition to a region of the chromsome. This results in a 'variant single locus complement' - in virtue of an abnormal number of features at a particular locus, rather than abnormal sequence within the locus." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "In our model, we consider this chromosomal region to be monosomic, and thus a variant single locus complement" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "dropped partial anneuploid chromosomal element" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "translocated absent chromosomal segment" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "truncated chromosome terminus" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000346", "lbl" : "aneusomic chromosome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A complete chromosome that has been abnormally duplicated, or the absense of a chromosome that has been lost, typically as the result of a non-disjunction event or unbalanced translocation" }, "comments" : [ "Large sequence features gained in a genome are considered to be sequence alterations (akin to insertions), including aneusomic chromosome segments gained through unbalanced translocation events, entrie aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that become part of the heritable gneme of a cell or organism.\n\nSimilarly, large sequence features lost from genome are akin to deletions and therefore also considered sequence alterations. This includes the loss of chromosomal segments through unbalanced translocation events, and the loss of entire chromosomes through a non-disjunction event during replication." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "complete aneusomic chromosome" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000351", "lbl" : "biological process", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for imports of biological processes from GO-BP." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000391", "lbl" : "disomic zygosity", "type" : "CLASS", "meta" : { "definition" : { "val" : "A zygosity quality inhering in a 'single locus complement' in a genome with a normal ploidy of two (i.e. two copies of autosomal chromosomes). Disomic zygosity terms describe the degree of similarity of the two sequence features that reside at a particular location across homozygous chromosomes (or the state of being the only feature at a given locus in the case of hemizygosity)." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000392", "lbl" : "aneusomic zygosity", "type" : "CLASS", "meta" : { "definition" : { "val" : "A zygosity quality inhering in a 'single locus complement' in a genome with an abnormal ploidy at the location (i.e. an autosomal locus with one or three copies in a diploid genome)." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000393", "lbl" : "trisomic homozygous", "type" : "CLASS", "meta" : { "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000394", "lbl" : "trisomic heterozygous", "type" : "CLASS", "meta" : { "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000402", "lbl" : "compound heterozygous", "type" : "CLASS", "meta" : { "definition" : { "val" : "A heterozygous quality inhering in a single locus complement comprised of two different varaint alleles and no wild type locus. (e.g.fgf8a/fgf8a)" }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "trans-heterozygous" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000415", "lbl" : "obsolete reagent sequence feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature that references some biological macromolecule applied as a reagent in an experiment or technique (e.g. a morpholino expression plasmid, or oligonucleotide probe)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "replaced with SO:engineered_region" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "extra-genomic sequence" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000458", "lbl" : "simple heterozygous", "type" : "CLASS", "meta" : { "comments" : [ "a heterozygous quality inhering in a single locus complement comprised of one variant allele and one wild-type/reference allele (e.g.fgf8a)" ], "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000460", "lbl" : "transgene part", "type" : "CLASS", "meta" : { "definition" : { "val" : "A structurally or functionally defined component of a transgene (e.g. a promoter, a region coding for a fluorescent protein tag, etc)" } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000476", "lbl" : "variant", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute inhering in a sequence feature that varies from some designated reference in virtue of alterations in its sequence or expression level" } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000477", "lbl" : "polymorphic", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute inhereing in a sequence feature for which there is more than one version fixed in a population at some significant percentage (typically 1% or greater), where the locus is not considered to be either reference or a variant." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000480", "lbl" : "mutant", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute inhering in a feature bearing a sequence alteration that is present at very low levels in a given population (typically less than 1%), or that has been experimentally generated to alter the feature with respect to some reference sequence." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000481", "lbl" : "genomic feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature (continuous extent of biological sequence) that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)" }, "comments" : [ "1. A feature being 'of genomic origin' here means only that its sequence has been located to the genome of some organism by alignment with some reference genome. This is because the sequence was originally identified in, or artificially created to replicate, sequence from an organism's genome. \n\n2. The location of a genomic feature is defined by start and end coordinates based on alignment with a reference genome. Genomic features can span any size from a complete chromosome, to a chromosomal band or region, to a gene, to a single base pair or even junction between base pairs (this would be a sequence feature with an extent of zero). \n\n3. As sequence features, instances of genomic features are identified by both their inherent *sequence* and their *position* in a genome - as determined by an alignment with some reference sequence. Accordingly, the 'ATG' start codon in the coding DNA sequence of the human AKT gene and the 'ATG' start codon in the human SHH gene represent two distinct genomic features despite having he same sequence, in virtue of their different positions in the genome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This class was created largely as a modeling convenience to support organizing data for schema definitions. We may consider obsoleting it if it ends up causing confusion or complicating classification of terms in the ontology." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000482", "lbl" : "genetic material", "type" : "CLASS", "meta" : { "definition" : { "val" : "A nucleic acid molecule that contains one or more sequences serving as a template for gene expression in a biological system (ie a cell or virion)." }, "comments" : [ "This class is different from genomic material in that genomic material is necessarily heritable, while genetic material includes genomic material, as well as any additional nucleic acids that participate in gene expression resulting in a cellular or organismal phenotype. So things like transiently transfected expression constructs would qualify as 'genetic material but not 'genomic material'. Things like siRNAs and morpholinos affect gene expression indirectly, (ie are not templates for gene expression), and therefore do not qualify as genetic material." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000491", "lbl" : "obsolete mutant allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele that is variant with respect to some wild-type allele, in virtue of its being very rare in a population (typically <1%), or being an experimentally-induced alteration that derives from a wild-type feature in a given strain." }, "comments" : [ "'Mutant' is typically contrasted with 'wild-type', where 'mutant' indicates a natural but very rare allele in a population (typically <1%), or an experimentally-induced variation that derives from a wild-type background locus for a given strain, which can be selected for in establishing a mutant line." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Based on use of 'mutant' as described in PMID: 25741868 ACMG Guidelines" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Not required for any specific use case at this point so removed for simplicity. \nFormely asserted as allele and inferred as varaint allele. \nEq class definition:\nallele\n and (mutation or ('has subsequence' some mutation))" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000492", "lbl" : "mutation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence alteration that is very rare allele in a population (typically <1%), or an experimentally-induced variation that derives from a wild-type feature in a given strain." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000494", "lbl" : "extrachromosomal replicon", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genetic feature that is not part of the chromosomal genome of a cell or virion, but rather a stable and heritable element that is replilcated and passed on to progeny (e.g. a replicative plasmid or transposon)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Consider replacing with SO_0001038 ! extrachromosomal_mobile_genetic_element" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "episomal replicon" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Extrachromosomal replicons are replicated and passed on to descendents, and thus part of the heritable genome of a cell or organism. In cases where the presence of such a replicon is novel or aberrant (i.e. not included in the reference for that genome), the replicon is considered a 'sequence alteration'." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000495", "lbl" : "expression construct", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "expression construct feature" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000497", "lbl" : "polymorphic allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele that is fixed in a population at some stable level, typically > 1%. Polymorphic alleles reside at loci where more than one version exists at some signifcant frequency in a population." }, "comments" : [ "Polymorphic alleles are contrasted with mutant alleles (extremely rare variants that exist in <1% of a population), and 'wild-type alleles' (extremenly common variants present in >99% of a population). Polymorphic alleles exist in equilibrium in a given population somewhere between these two extremes (i.e. >1% and <99%)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PMID: 25741868 ACMG Guidelines" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000498", "lbl" : "major polymorphic allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "A polymorphic allele that is present at the highest frequency relative to other polymorphic variants at the same genomic location." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "major allele" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000499", "lbl" : "minor polymorphic allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "A polymorphic allele that is not present at the highest frequency among all fixed variants at the locus (i.e. not the major polymorphic allele at a given location)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "minor allele" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000500", "lbl" : "ancestral polymorphic allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "A polymorphic allele that is determined from the sequence of a recent ancestor in a phylogentic tree." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ancestral allele" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000501", "lbl" : "wild-type allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele representing a highly common varaint (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are often compared." }, "comments" : [ "'Wild-type' is typically contrasted with 'mutant', where 'wild-type' indicates a highly prevalent allele in a population (typically >99%), and/or some prototypical allele in a background genome that serves as a basis for some experimental alteration to generate a mutant allele, which can be selected for in establishing a mutant strain.\n\nThe notion of wild-type alleles is more common in model organism databases, where specific mutations are generated against a wild-type reference feature. Wild-type alleles are typically but not always used as reference alleles in sequence comparison/analysis applications. More than one wild-type sequence can exist for a given feature, but typically only one allele is deemed wild-type iin the context of a single dataset or analysis." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "wild-type allele" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000502", "lbl" : "wild-type gene", "type" : "CLASS", "meta" : { "comments" : [ "A gene allele representing the most common varaint in a population (typically >99% frequency), that exhibits canonical function, and against which rare and/or non-functional mutant gene alleles are compared in characterizing the phenotypic consequences of genetic variation." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "wild-type gene allele" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000504", "lbl" : "reagent targeted gene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A gene altered in its expression level in the context of some experiment as a result of being targeted by gene-knockdown reagent(s) such as a morpholino or RNAi." }, "comments" : [ "The identity of a given instance of a reagent-targeted gene is dependent on the experimental context of its knock-down - specifically what reagent was used and at what level. For example, the wild-type shha zebrafish gene targeted in epxeriment 1 by morpholino1 annd in experiment 2 by morpholino 2 represent two distinct instances of a 'reagent-targeted gene', despite sharing the same sequence and position." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000506", "lbl" : "transiently-expressed transgene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene that is delivered as part of a DNA expression construct into a cell or organism in order to transiently express a specified product (i.e. it has not integrated into the host genome)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "experimentally-expressed transgene" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "extrinsic transgene" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000511", "lbl" : "wild-type", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele attribute describing a highly common variant (typically >99% in a population), that typically exhibits canonical function, and against which rare and/or non-functional mutant alleles are compared." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000512", "lbl" : "allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "One of a set of sequence features known to exist at a particular genomic location." }, "comments" : [ "An allele is a seqeunce feature at a genomic location where variation occurs (i.e. where >1 different sequence is known to exist). An allele can span only the extent of sequence known to vary (e.g. a single base SNP, or short insertion), or it can span a larger extent that includes one or more variable features as proper parts (e.g. a 'gene allele' that spans the extent of an entire gene which contains several sequence alterations).\n\nAlleles can carry 'reference' or 'variant' sequence - depending on whether the its 'state' matches that considered to be the reference at that location. Alleles whose state differs from the reference are called 'variant alleles', and those that match the reference are called 'reference alleles'. What is considered the 'reference' state at a particular location may vary, depending on the context/goal of a particular analysis. A 'sequence alteration' is a 'variant allele' that varies along its entire extent (i.e every position varies from that of some defined reference sequence)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A landsacpe review found mostly gene-centric definitions of 'allele' that represented a particular version of a gene, or variation within a gene sequence [1][2][3][4][5][6][6a]. But we also found 'allele' used to refer to other types and extents of variation - including single nucleotide polymorphisms, repeat regions, and copy number variations [7][8][9][10][11], where such variations don't neccessarily impact a gene.\n\nTo be maximally accommodating of how this term is used across research communities, GENO defines 'allele' broadly and allow alleles can span any locus or extent of sequence. While 'alleles' encountered in public datases typically overlap a gene, many do not. But GENO does define the 'gene allele' class as a subtype of 'allele' to refers more specifically to a specifc version of an entire gene.\n\t\n[1] https://isogg.org/wiki/Allele (retrieved 2018-03-17)\n[2] http://semanticscience.org/resource/allele (retrieved 2018-03-17)\n[3] https://en.wikipedia.org/wiki/Allele (retrieved 2018-03-17)\n[4] https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/allele (retrieved 2018-03-17)\n[5] http://purl.obolibrary.org/obo/SO_0001023 (retrieved 2018-03-17)\n[6] http://purl.obolibrary.org/obo/NCIT_C16277 (retrieved 2018-03-17)\n[6a] https://www.ncbi.nlm.nih.gov/mesh/68000483\n[7] https://www.snpedia.com/index.php/Allele (retrieved 2018-03-17)\n[8] https://en.wikipedia.org/wiki/Single-nucleotide_polymorphism (retrieved 2018-03-17)\n[9] http://purl.obolibrary.org/obo/OGI_0000008 (retrieved 2018-03-17)\n[10] http://purl.obolibrary.org/obo/OBI_0001352 (retrieved 2018-03-17)\n[11] http://purl.phyloviz.net/ontology/typon#Allele (retrieved 2018-03-17)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "variable feature" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000513", "lbl" : "aneusomic", "type" : "CLASS", "meta" : { "definition" : { "val" : "a sequence attribute of a chromosome or chromosomal region that has been abnormally duplicated or lost, as the result of a non-disjunction event or unbalanced translocation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000515", "lbl" : "variant gene allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allele of a gene that contains some sequence alteration." }, "comments" : [ "A gene allele is 'variant' in virtue of its containing a sequence alteration that varies from some reference gene standard. But note that a gene allele that is variant in one context/dataset can be considered a reference in another context/dataset." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000516", "lbl" : "single locus complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set representing the complement of all sequence features occupying a particular genomic location across all homologous chromosomes in the genome of a single organism." }, "comments" : [ "A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a complement may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features. Here, a 'single locus complement' is the set of all alleles at a specified location in a particular genome. This complement is typically a pair of two features in a diploid genome (with two copies of each chromosome). E.g. a gene pair, a QTL pair, a nucleotide pair for a SNP, or a pair of entire chromosomes.\n\nThe fact that we are counting how many copies of the same *sequence* exist in a genome, as opposed to how many of the same *feature*, is what sets feature-level concepts like 'single locus complement'. apart from sequence-level concepts like 'copy number complement'. To illustrate the difference, consider a duplication event that creates a new copy of the human APOE gene on a different chromosome. This creates an entirely new sequence feature at a distinct locus from that of the original APOE gene. The 'copy number complement' for sequence defined by the APOE gene locus would have a count of three, as this sequence is present three times in the genome. But the 'single locus complement' at the APOE gene locus would still have a count of two - because the duplicated copy is at a different location in the genome, and therefore does not represent a copy of the APOE locus." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The set of both shha gene alleles in a diiploid zebrafish genome, e.g. fgf8a.\n\nThe collection of the individual base-pairs present at the position 24126737 in both copies of chromosome 5 in a diploid human genome." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "TO DO: show a VCF representation of this example. Consider making 'allelic complement' the primary label." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "allelic complement" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "homologous allele complement" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "single locus feature complement" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000524", "lbl" : "extrinsic genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A specification of the known state of gene expression across a genome, and how it varies from some baseline/reference state." }, "comments" : [ "An extrinsic genotype describes variation in the 'expression level' of genes in a cell or organism, as mediated by transient, gene-specific experimental interventions such as RNAi, morpholinos, TALENS CRISPR, or construct overexpression. This concept is relevant primarily for model organisms and systems that are subjected to such interventions to determine how altered expression of specific genes may impact organismal or cellular phenotypes in the context of a particular experiment.\n\nThe 'extrinsic genotype' concept is contrasted with the more familiar notion of an 'intrinsic genotype', describing variation in the inherent genomic sequence (i.e. 'allelic state'). In G2P research, interventions affecting both genomic sequence and gene expression are commonly applied in order to assess the impact specific genomic features can have on phenotype and disease. It is in this context that we chose to model 'extrinsic' alterations in expression as genotypes - to support parallel conceptualization and representation of these different types of genetic variation that inform the discovery of G2P associations." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "In an experiment where shha is targeted by MO1 and shhb is overexpressed from a transgenic expression construct, the extrinsic genotype captures the altered expression status of these two genes. A notation for representing such a genotype might describe this scenario as:\n\n shha; shhb\n\nThis notation parallels those used for more traditional 'intrinsic' genotypes, where the affected gene is presented with its alteration in angled brackets < >. In the extrinsic genotype shown here, the variation in shha is affected by a specific concentration of an shha-targeting morpholino (instead of a mutation in the shha gene). And the variation in shhb is affected by its overexpression from a pFLAG Shhb expression construct." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We acknowledge that this is not a 'genotype' in the traditional sense, but this terminological choice highlights similarities that play out in parallel modeling of intrinsic and extrinsic genotype partonomies, and parallel syntactic formats for labeling instances of these genotypes. \n\nOur rationale here is that what we care about from perspective of G2P associations is identifying genomic features that impact phenotype - where experimental approaches include permanent introduction of intrinsic modifications to genomic sequence, and transient introduction of extrinsic factors that modify expression of specific genes. As the former is described by the traditional notion of a genotype, it seems a rational leap to consider the latter akin to an 'extrinsic genotype' wherein the alterations are externally applied rather than inherent to the genome. \n\nFinally, there is some precedent to thinking about such extrinsic modifications in terms of a genotype, in the EFO:0000513 ! genotype: \"The total sum of the genetic information of an organism that is known and relevant to the experiment being performed, including chromosomal, plasmid, viral or other genetic material which has been introduced into the organism either prior to or during the experiment.\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "experimental genotype" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "expression genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000525", "lbl" : "effective genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genotype that describes the total intrinsic and extrinsic variation across a genome at the time of a phenotypic assessment (where 'intrinsic' refers to variation in genomic sequence, as mediated by sequence alterations, and 'extrinsic' refers to variation in gene expression, as mediated through transient gene-specific interventions such as gene knockdown reagents or overexpression constructs)." }, "comments" : [ "An effective genotype is meant to summarize all factors related to genes and their expression that influence an observed phenotype - including 'intrinsic' alterations in genomic sequence, and gene-specific 'extrinsic' alterations in expression transiently introduced at the time of the phenotypic assessment." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Closest concept/definition we could find for this concept was for EFO:0000513 ! genotype: \"The total sum of the genetic information of an organism that is known and relevant to the experiment being performed, including chromosomal, plasmid, viral or other genetic material which has been introduced into the organism either prior to or during the experiment.\"" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000527", "lbl" : "reagent-targeted gene complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set comprised of *all* reagent-targeted genes in a single genome in the context of a given experiment (e.g. the zebrafish shha and shhb genes in a zebrafish exposed to morpholinos targeting both of these genes)." }, "comments" : [ "A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a complement may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features. For example, a 'reagent-targeted gene complement' is the set of all genes in a particular genome that are targeted by reagents in the context of a particular experiment." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000528", "lbl" : "transiently-expressed transgene complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "The set of all transgenes trransiently expressed in a biological system in the context of a given experiment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "experimental transgene complement" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000529", "lbl" : "expression-variant gene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A gene altered in its expression level relative to some baseline of normal expression in the system under investigation (e.g. a cell line or model organism)." }, "comments" : [ "Expression-variant genes are altered in their expression level through some modification or intervention external to its sequence and position. These may include endogenous mechanisms (e.g. direct epigentic modification that impact expression level, or altered regulatory networks controlling gene expression), or experimental interventions (e.g. targeting by a gene-knockdown reagent, or being transiently expressed as part of a transgenic construct in a host cell or organism).\n\nThe identity of a given instance of a experssion-variant gene is dependent on how its level of expression is manipulated in a biological system (i.e. via targeting by gene-knockdown reagents, or being transiently overexpressed). So expression-variant genes have the additional identity criteria of a genetic context of its material bearer (external to its sequence and position) that impacts its level of expression in a biological system." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Consider wild-type zebrafish shha gene in the context of being targeted by morpholino1 vs morpholino 2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'expression-variant genes' because of their different external context. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants of the same gene can have potentially different associated phenotypes)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "See SO classes under 'silenced gene' (e.g. 'gene silenced by RNA interference'). These seem to represent the concept of a qualified feature as I define it here, in that they are defined by alterations extrinsic to the sequence and position of the gene itself." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "expression allele" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000533", "lbl" : "gene knockdown reagent", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "gene targeting reagent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sequence targeting reagent" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000534", "lbl" : "reagent-targeted gene subregion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region within a gene that is specifically targeted by a gene knockdown reagent, typically in virtue of bearing sequence complementary to the reagent." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "targeted gene segment" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000536", "lbl" : "genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A specification of the genetic state of an organism, whether complete (defined over the whole genome) or incomplete (defined over a subset of the genome). Genotypes typically describe this genetic state as a diff between some variant component and a canonical reference." }, "comments" : [ "1. Scope of 'Genetic State': \n'Genetic state' is considered quite broadly in GENO to describe two general kinds of 'states'. First, is traditional notion of 'allelic state' - defined as the complement of alleles present at a particular location or locations in a genome (i.e. across all homologous chromosomes containing this location). Here, a genotype can describe allelic state at a specific locus in a genome (an 'allelic genotype'), or describe the allelic state across the entire genome ('genomic genotype'). Second, this concept can also describe states of genomic features 'extrinsic' to their intrinsic sequence, such as the expression status of a gene as a result of being specifically targeted by experimental interventions such as RNAi, morpholinos, or CRISPRs.\n\n2. Genotype Subtypes:\nIn GENO, we use the term 'intrinsic' for genotypes describing variation in genomic sequence, and 'extrinsic' for genotypes describing variation in gene expression (e.g. resulting from the targeted experimental knock-down or over-expression of endogenous genes). We use the term 'effective genotype' to describe the total intrinsic and extrinsic variation in a cell or organism at the time a phenotypic assessment is performed. \n\nTwo more precise conccepts are subsumed by the notion of an 'intrinsic genotype': (1) 'allelic genotypes', which specify allelic state at a single genomic location; and (2) 'genomic genotypes', which specify allelic state across an entire genome. In both cases, allelic state is typically specified in terms of a differential between a reference and a set of 1 or more known variant features.\n\n3. The Genotype Partonomy: \n'Genomic genotypes' describing sequence variation across an entire genome are 'decomposed' in GENO into a partonomy of more granular levels of variation. These levels are defined to be meaningful to biologists in their attempts to relate genetic variation to phenotypic features. They include 'genomic variation complement' (GVC), 'variant single locus complement' (VSLC), 'allele', 'haplotype', 'sequence alteration', and 'genomic background' classes. For example, the components of the zebrafish genotype \"fgf8a; fgf3[AB]\", described at https://zfin.org/ZDB-FISH-150901-9362, include the following elements:\n\n - GVC: fgf8a; fgf3 (total intrinsic variation in the genome)\n - Genomic Background: AB (the reference against which the GVC is variant)\n - VSLC1: fgf8a (homozygous complement of gene alleles at one known variant locus)\n - VSLC2: fgf3 (heterozygous complement of gene alleles at another known variant locus)\n - Allele 1: fgf8a (variant version of the fgf8a gene, present in two copies)\n - Allele 2: fgf3 (variant version of the fgf3 gene, present in one copy)\n - Allele 3: fgf3<+> (wild-type version of the fgf3 gene, present in one copy)\n - Sequence Alteration1: (the specific mutation within the fgf8a gene that makes it variant)\n - Sequence Alteration2: (the specific mutation within the fgf3 gene that makes it variant)\n\nA graphical representation of this decomposition that maps each element to a visual depiction of the portion of a genome it denotes can be found here: https://github.com/monarch-initiative/GENO-ontology/blob/develop/README.md\n\nOne reason that explicit representation of these levels is important is because it is at these levels that phenotypic features are annotated to genetic variations in different clinical and model organism databases For example, ZFIN typically annotates phenotypes to effective genotypes, MGI to intrinsic genotypes, Wormbase to variant alleles, and ClinVar to haplotypes and sequence alterations. The ability to decompose a genotype into representations at these levels allows us to \"propagate phenotypes\" up or down the partonomy (e.g. infer associations of phenotypes annotated to a genotype to its more granular levels of variation and the gene(s) affected). This helps to supporting integrated analysis of G2P data." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "As information artifacts, genotypes specify the state of a genome be defining a diff between some canonical reference and a variant or alternate sequence that replaces the corresponding portion of the reference. We can consider a genotype then as a collection of these reference and variant features, along with some rule for operating on them and resolve a final single sequence. This is valid ontologically because we commit only to sequence features being GDCs - which allows for their concretization in either biological or informational patterns. Accordingly, a particular gene allele, such as shh, can be part of a genome in a biological sense and part of a genotype in an informational sense. This idea underpins the 'genotype partonomy' at the core of the GENO model that decomposes a complete genotype into its more fundamental parts, including alleles and allele complements, as described in the comment above." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Core definition above adapted from the GA4GH VMC data model definition here: https://docs.google.com/document/d/12E8WbQlvfZWk5NrxwLytmympPby6vsv60RxCeD5wc1E/edit#heading=h.4e32jj4jtmsl (retrieved 2018-04-09). \nNote however that the VMC genotype concept likely is not intended to cover 'effective' and 'extrinsic' genotype concepts defined in GENO." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000575", "lbl" : "zebrafish phenotype", "type" : "CLASS", "meta" : { "comments" : [ "ZFIN do not annotate with a pre-composed phenotype ontology - all annotations compose phenotypes on-the-fly using a combination of PATO, ZFA, GO and other ontologies. So while there is no manually curated zebrafish phenotype ontology, the Upheno pipeline generates one automatically here: http://purl.obolibrary.org/obo/upheno/zp.owl\nThis ontology does not have a root 'phenotype' class, however, and so we generate our own in GENO as a stub placeholder for import of needed zebrafish phenotype classes." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000602", "lbl" : "homoplasmic", "type" : "CLASS", "meta" : { "definition" : { "val" : "an allelic state where a single allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000603", "lbl" : "heteroplasmic", "type" : "CLASS", "meta" : { "definition" : { "val" : "an allelic state where more than one type of allele exists at a particular location in the organellar genome (mitochondrial or plastid) of a cell/organism." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000604", "lbl" : "hemizygous X-linked", "type" : "CLASS", "meta" : { "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000605", "lbl" : "hemizygous Y-linked", "type" : "CLASS", "meta" : { "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000606", "lbl" : "hemizygous insertion-linked", "type" : "CLASS", "meta" : { "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000611", "lbl" : "genomic background", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic genotype that specifies the baseline sequence of a genome from which a variant genome is derived (through the introduction of sequence alterations)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Being a 'genomic background' implies that a variant genotype was derived from this background (which is the case for most model organism database genotypes/strains). This is a subtly different notion than being a 'reference genotype' , which can be any genotype that serves as a basis for comparison. But in a sense all background genotypes are by default reference genotypes, in that the derived variant genotype is compared against it." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "background genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000614", "lbl" : "chromosomal region", "type" : "CLASS", "meta" : { "definition" : { "val" : "An extended part of a chromosome representing a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome > arm > region > band > sub-band." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "New term request for SO." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here:\nchromosome > arm > region > band > sub-band\n\nNote that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html):\nchromosome > arm > band > sub-band > sub-sub-band" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000616", "lbl" : "chromosome sub-band", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here:\nchromosome > arm > region > band > sub-band\n\nNote that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html):\nchromosome > arm > band > sub-band > sub-sub-band" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000618", "lbl" : "chromosomal band intensity", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "chromosomal band brightness" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000619", "lbl" : "gpos", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000620", "lbl" : "gneg", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000621", "lbl" : "gvar", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000622", "lbl" : "gpos100", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000623", "lbl" : "gpos75", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000624", "lbl" : "gpos50", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000625", "lbl" : "gpos25", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000628", "lbl" : "short chromosome arm", "type" : "CLASS", "meta" : { "definition" : { "val" : "A chromosome arm that is the shorter of the two arms of a given chromosome." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "p-arm" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "stalk" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000629", "lbl" : "long chromosome arm", "type" : "CLASS", "meta" : { "definition" : { "val" : "A chromosome arm that is the longer of the two arms of a given chromosome." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "q-arm" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000632", "lbl" : "gpos66", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000633", "lbl" : "gpos33", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000637", "lbl" : "regulatory transgene region", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene part whose sequence regulates the synthesis of a functional product, but which is not itself transcribed." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000638", "lbl" : "expressed transgene region", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene part whose sequence is expressed in a gene product through transcription and/or translation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "coding transgene feature" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000640", "lbl" : "reporter region", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000642", "lbl" : "selectable marker transgene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene whose product is used as a selectable marker." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000644", "lbl" : "karyotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genotype that describes what is known about variation in a genome at a gross structural level, in terms of the number and appearance of chromosomes in the nucleus of a eukaryotic cell." }, "comments" : [ "Karyotypes describe structural variation across a genome at the level of chromosomal morphology and banding patterns detectable in stained chromosomal spreads. This coarser level does not capture more granular levels of variation commonly represented in other forms of genotypes (e.g. specific alleles and sequence alterations). \n\nA base karyotype representing a genome with no known structural variation can be as simple as '46XY', but karyotypes typically contains some gross variant component (such as a chromosome duplication or translocation)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Derived from http://en.wikipedia.org/wiki/Karyotype (accessed 2017-03-28)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000645", "lbl" : "genomic genotype (sex-qualified)", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic genotype where the genomic background specifies a male or female sex chromosome complement." }, "comments" : [ "We distinguish the notion of a sex-agnostic intrinsic genotype, which does not specify whether the portion of the genome defining organismal sex is male or female, from the notion of a sex-qualified intrinsic genotype, which does. Male and female mice that contain the same background and genetic variation complement will have the same 'sex-agnostic intrinsic genotype', despite their genomes varying in their sex-chromosome complement. By contrast, these two mice would have different 'sex-qualified intrinsic genotypes', as this class takes background sex chromosome sequences into account in the identity criteria for its instances.\n\nConceptually, a sex-qualified phenotype represents a superset of sequence features relative to a sex-agnostic intirnsic genotype, in that if specifies the background sex-chromosome complement of the genome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This modeling approach enables creation separate genotype instances for data sources that report sex-specific phenotypes to ensure that sex-specific G2P differences are accurately described. These sex specific genotypes can be linked to the broader intrinsic genotype that is shared by male and female mice of the same strain, to aggregate associated phenotypes at this level, and allow aggregation with G2P association data about the same strains from sources that distinguish sex-specific phenotypes (e.g. IMPC) and those that do not (e.g. MGI).\n\nIn the genotype partonomy, a sex qualified genotype has as part a sex-agnostic genotype. This allows for the propagation of phenotypes associated with a sex-qualified genotype to the intrinsic genotype. Ontologically, this parthood is based on the fact that the background component of a sex-qualified genotype specifies the sex chromosomes while that of the sex-agnostic genotype does not. Thus, the sequence content of the sex-qualified genotype is a superset of that of the intrinsic genotype, with the latter being a proper part of the former." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "intrinsic genotype (sex-specific)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sex-qualified genotype" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sex-qualified intrinsic genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000646", "lbl" : "male intrinsic genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic genotype here the genomic background specifies a male sex chromosome complement." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000647", "lbl" : "female intrinsic genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic genotype here the genomic background specifies a female sex chromosome complement." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000649", "lbl" : "unspecified genomic background", "type" : "CLASS", "meta" : { "definition" : { "val" : "A background genotype whose sequence or identity is not known or specified." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "unspecified background genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000659", "lbl" : "sequence feature set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of sequence features." }, "comments" : [ "'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. Sets may also include duplicates (i.e. contain more than one member representing the same feature).\n\nThe notion of a 'complement' is a special case of a set, where the members necessarily comprise an exhaustive collection of all objects that make up some well-defined set. It is useful for defining many biologically-relevant sets of sequence features. For example, a 'haplotype' is the set of all genetically-linked alleles on a single chromosomal strand at a defined location - e.g. the SNP alleles {rs7412-C, rs429358-C} comprise the haplotype defining the APOEɛ4 gene allele [1]. And a 'single locus complement' is the set of all alleles at a specified location in a particular genome - e.g. the APOEɛ4 and APOEɛ4 gene alleles ([1], [2]) that make up the 'Gs270' APOE genotype [3].\n\n[1] https://www.snpedia.com/index.php/APOE-%CE%B54\n[2] https://www.snpedia.com/index.php/APOE-%CE%B52\n[3] https://www.snpedia.com/index.php/Gs270" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "1. The set of all alleles at a particular location in a genome (a 'single locus complement') - e.g. {APOE-epsilon2 / APOE-epsilon4} at the APOE locus\n\n2. The set of all alleles that comprise a haplotype - e.g. the SNPs {rs7412-T, rs429358-T} in the APOEɛ2 allele.\n\n3. The set of all chromosomes in a genome - e.g. {human Chr1, 2, 3, . . . 22, X, Y}" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000660", "lbl" : "genomic feature set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of genomic features (i.e. sequence features that are of genomic origin)." }, "comments" : [ "A genomic feature is any located sequence feature in the genome, from a single nucleotide to a gene into an entire chromosome. 'Sets' are used to represent entities that are typically collections of more than one member - e.g. the set of chromosomes that make up the human genome. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. For example, a 'single locus complement' at an X-linked locus in a XY male will consist of only one allele, as there is only one X-chromosome in the genome. Note also that sets may contain duplicates (i.e. more than one member representing the same feature). For example, a homozygous 'single locus complement' is a set comprised of two of the same feature.\n\nThe notion of a 'genomic feature set' differs from that of a 'genomic sequence set' in that we are counting how many copies of the same *sequence feature* exist in a genome, as opposed to how many of the same *sequence*. 'Genomic feature sets are useful for representing things like 'single locus complements', where members are sequence features whose identity is dependent on their location. By contrast, 'genomic sequence sets' are useful for describing things like 'copy number complements', which are concerned only with how many copies of a sequence exist in a genome, regardless of the location where these reside." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "In some cases there may be zero or only one member of such a complement, which is why this class is not defened to necessarily have some 'genomic feature' as a member." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genomic locus complement" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000666", "lbl" : "gene part", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic feature that is part of a gene, and delineated by some functional or structural function or role it serves (e.g.a promoter element, coding region, etc)." }, "xrefs" : [ { "val" : "SO:0000831 (gene member region)" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "defined gene part" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000667", "lbl" : "reporter transgene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene that codes for a product used as a reporter of gene expression or activity." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000680", "lbl" : "obsolete null feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic feature that has an extent of zero." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A junction between bases, a deletion variant, a terminus at the end of a chromosome." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Former logical def: \n'genomic feature'\n and (has_extent value 0)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000681", "lbl" : "novel extrachromosomal replicon", "type" : "CLASS", "meta" : { "definition" : { "val" : "An extrachromosomal replicon that is variant in a genome in virtue of its being a novel addition to the genome - i.e. it is not present in the reference for the genome in which it is found." }, "comments" : [ "Extrachromosomal replicons are replicated and passed on to descendents, and thus part of the heritable genome of a cell or organism. In cases where the presence of such a replicon is exogenous or aberrant (i.e. not included in the reference for that genome), the replicon is considered a 'sequence alteration'." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "aberrant extrachromosomal replicon" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "exogenous extrachromosomal replicon" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "transgenic extrachromosomal replicon" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000684", "lbl" : "novel replicon", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genomic feature that represents an entirely new replicon in the genome, e.g. an extrachromosomal replicon or an extra copy of a chromosome." }, "comments" : [ "Novel replicons are considered as an 'insertion' in a genome, and as such, qualify as types of sequence_alterations and variant alleles. There is no pre-existing locus that it modifies, however, and thus it is not really an 'allele of' a named locus. But conceptually, we still consider these to represent genetic variants and classify them as variant alleles." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This class is defined so as to support classification of things like novel extrachromosomal replicons and aneusomic chromosomes as being variant alleles in a genome. These represent entirely new features in the genome - not variants of an existing feature." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000685", "lbl" : "novel", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute of a genomic feature that represents a feature not previously found in a given genome, e.g. an extrachromosomal replicon or aneusomic third copy of a chromosome." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000688", "lbl" : "terminus", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature representing the end of a sequence that is bounded only on one side (e.g. at the end of an chromosome or oligonucleotide)." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000701", "lbl" : "sequence feature or set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature or a set of such features." }, "comments" : [ "GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria.\n1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence.\n2. 'Sequence feature' identity is dependent on its sequence and the genomic position if the sequence (aligns with definition of 'sequence feature' in the Sequence Ontology).\n3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material bearing the feature, extrinsic to its sequence and its genomic position. For example, its being targeted by gene knockdown reagents, its being transgenically expressed in a foreign cell from a recombinant expression construct, its having been epigenetically modified in a way that alters its expression level or pattern, or its being located in a specific cellular or anatomical location." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sequence feature or collection" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000702", "lbl" : "biological sequence", "type" : "CLASS", "meta" : { "definition" : { "val" : "A linear ordering of units representing monomers of a biological macromolecule (e.g. nucleotides in DNA and RNA, amino acids in polypeptides)." }, "comments" : [ "'Sequences' differ from 'sequence features' in that instances are distinguished only by their inherent ordering of units, and not by any positional aspect related to alignment with some reference sequence. Accordingly, the 'ATG' translational start codon of the human AKT gene is the same *sequence* as the 'ATG' start codon of the human SHH gene, but these represent two distinct *sequence features* in virtue of their different positions in the genome." ], "xrefs" : [ { "val" : "VMC:State" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria.\n1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence.\n2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology).\n3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "biomacromolecular sequence" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "state" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000713", "lbl" : "qualified sequence feature or collection", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature (or collection of features) whose identity is dependent on the context or state of its material bearer (in addition to its sequence an position). This context/state describes factors external to its inherent sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000714", "lbl" : "qualified genomic feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A qualified sequence feature that carries sequence derived from the genome of a cell or organism." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Consider wild-type zebrafish shha gene in the context of being targeted by morpholino MO-1 vs morpholino MO-2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'qualified sequence feature' because of their different external contexts. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants (alleles) of the same gene can have potentially different associated phenotypes)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000715", "lbl" : "qualified genomic feature set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of qualified sequence features that carry genomic sequence." }, "comments" : [ "A 'complement' refers to an exhaustive collection of all objects that make up some well-defined set. This notion is useful for defining biologically-relevant sets of sequence features. For example, a haplotype is defined as the set of all genetically-linked alleles on a single chromosomal strand at a defined location - e.g. the SNP alleles {rs7412-C, rs429358-C} comprise the haplotype defining the APOEɛ4 gene allele.\n\nA complements may contain 0, 1, or more than one members. For example, the complement of alleles at a defined locus across homologous chromosomes in an individual's genome will consist of two members for autosomal locations, and one member for non-homologous locations on the X and Y chromosome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Because there are cases there may be zero or only one member of such a set, this class is not asserted to necessarily have some 'qualified genomic feature' as a member." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000719", "lbl" : "intrinsic genotype", "type" : "CLASS", "meta" : { "comments" : [ "1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome ('genomic background'), and all specific variants from this reference (the 'genomic variation complement'). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'genomic background' sequence.\n\n2. 'Heritable' genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Genotype vs Genome in GENO: An (intrinsic) genotype is an information artifact representing an indirect syntax for specifying a genome sequence. This syntax has reference and variant components - a 'background genotype' and 'genomic variation complement' - that must be operated on to resolve a specifie genome sequence. Specifically, the genome sequence is resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the 'reference genome'. So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence. It is this end-point that we consider when holding that a genotype 'specifies' a genome." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000720", "lbl" : "DNA sequence", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000721", "lbl" : "RNA sequence", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000722", "lbl" : "amino acid sequence", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000724", "lbl" : "obsolete biological sequence or collection", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000725", "lbl" : "obsolete biological sequence collection", "type" : "CLASS", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000736", "lbl" : "location-qualified sequence feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature whose identity is additionally dependent on the cellular or anatomical location of the genetic material bearing the feature." }, "comments" : [ "As a qualified sequence feature, the BRCA1c.5096G>A variant as materialized in a somatic breast epithelial cell could be distinguished as a separate entity from a BRCA1c.5096G>A variant in a different cell type or location (e.g. germline BRCA1 varaint in a sperm cell)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000737", "lbl" : "expression-qualified sequence feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature whose identity is additionally dependent on factors specifically influencing its level of expression in the context of a biological system (e.g. being targeted by gene-knockdown reagents, or driven from exogneous expression system like recombinant construct)" } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000768", "lbl" : "obsolete genomic position", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature position based on a genomic coordinate system, where the position specifies start and end coordinates based on its alignment with some reference genomic sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This 'genomic position' concept differs from the faldo:Position concecpt in that the former describes the start AND end points/coordinates of a feature, while the latter describes a single point/coordinate at the beginning OR end of a feature." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genomic coordinates" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "remodeling notion of sequence feature position around the idea of a 'genomic locus'" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000770", "lbl" : "phenotypic inheritance process", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000772", "lbl" : "obsolete unspecified", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence attribute inhering in a feature whose identity is not specified." }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000773", "lbl" : "variation attribute", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute describing a type of variation inhering in a sequence feature or collection." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "allele attribute" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000777", "lbl" : "variant genomic genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "An intrinsic genotype that specifies variation from a defined reference genome." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000778", "lbl" : "obsolete sequence information entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "An information entity that is intented to represent some biological sequence, sequence feature, qualified sequence feature, or a collection of one or more of these entities." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "eliminating classes that are not necessary or add uneeded complexity." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000779", "lbl" : "biological sequence unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "biological sequence residue" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "monomeric residue" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000780", "lbl" : "DNA residue", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "deoxyribonucleic acid residue" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000781", "lbl" : "RNA residue", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ribonucleic acid residue" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000782", "lbl" : "amino acid residue", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000788", "lbl" : "sequence feature attribute", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute, quality, or state of a sequence feature or collection." }, "comments" : [ "Sequence feature attributes can be 'intrinsic' - reflecting feature-level characteristics that depend only on the sequence, location, or genomic context of a feature or collection, or 'extrinsic' - reflecting characteristics of the physical molecule in which the feature is concretized (e.g. its cellular context, source of origin, physical appearance, etc.). Intrinsic attributes include things like allelic state, allelic phase. Extrinsic attributes include things like its cellular distribution and chromosomal band intensity." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/SO_0000400" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000815", "lbl" : "sequence feature location", "type" : "CLASS", "meta" : { "definition" : { "val" : "The location of a sequence feature as defined by its start and end position on some reference coordinate system." }, "comments" : [ "1. A sequence feature location is defined by its begin and end coordinates on a reference sequence, but it is not identified by a particular sequence that may reside there. The same location, as defined on a particular reference, may be occupied by different sequences in the genome of organism 1 vs that of organism 2 (e.g. if a SNV exists within this location in only one of the organisms).\n\n2. The notion of a sequence feature location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be 'occupied by' physical objects, while a genomic location is 'occupied by' sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic location is distinct from a sequence feature that occupies it. As a more concrete example, consider the distinction between a street address and the building that occupies it as analogous to the relationship between a genomic locus and the sequence feature that resides there." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000818", "lbl" : "modification-qualified sequence feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature whose identity is additionally dependent on a chemical modification made to the genetic material bearing the feature (e.g. binding of transcriptional regulators, or epigenetic modifications including direct DNA methylation, or modification of histones associated with a feature)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000823", "lbl" : "allelic genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genotype that specifies the 'allelic state' at a particular location in the genome - i.e. the set of alleles present at this locus across all homologous chromosomes." }, "comments" : [ "An 'allelic genotype' describes the set of alleles present at a particular location in the genome. This use of the term 'genotype' reflects its use in clinical genetics where variation has historically been assessed at a specific locus, and a genotype describes the allelic state at that particular location.\n\nThis contrasts to the use of the term 'genotype in model orgnaism communities where it commonly describes the allelic state at all loci in a genome known to vary from an established reference or background." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "1. The zebrafish \"fgf8a/fgf8a<+>\" allelic genotype describes the combination of gene alleles present at a specific gene locus (the fgf8a locus - which here has a heterozygous state).\n\n2. The human allelic genotypes in the VCF records describes below describe the set of SNPs present at specific positions on Chromosome 20 in the human genome. The first record describes a heterozygouse C/T allelic genotype at Chr20:2300608, and the second describes a homozygous G/G allelic genotype at Chr20:2301308.\n\n ##fileformat=VCFv4.2\n ##FORMAT=\n #CHROM POS REF ALT FILTER FORMAT SAMP001\n 20 2300608 C T PASS GT\t 0/1\t\n 20 2301308 T G PASS GT\t 1/1\n (derived from https://faculty.washington.edu/browning/beagle/intro-to-vcf.html)\n\n3. Some allelic genotype formats encode the genotype as a single string - e.g. \"GRCh38 Chr12:258635(A;T)\" describes a heterozygous A/T allelic genotype of SNPs present at a specific position 258635 on human chromosome 12." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "single locus genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000833", "lbl" : "genotype-phenotype association", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Exploratory class looking at creating more specific subtypes of associatiosn, and defining identity criteria for each." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000839", "lbl" : "knockdown reagent targeted gene complement", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000848", "lbl" : "obsolete coding sequence alteration", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence alteration within the coding sequence of a gene." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Not required at this poitn, so marked exploratory and obsoleted. \nAsserted under sequence_alteration." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000850", "lbl" : "P-element construct", "type" : "CLASS", "meta" : { "definition" : { "val" : "A construct that contains a mobile P-element, holding sequences to be delivered to a target cell or genome." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000856", "lbl" : "engineered genetic construct", "type" : "CLASS", "meta" : { "definition" : { "val" : "An engineered region that is used to transfer foreign genetic material into a host cell." }, "comments" : [ "Constructs can be engineered to carry inserts of DNA from external sources, for purposes of cloning and propagation or gene expression in host cells. \n\nConstructs are typically packaged as part of delivery systems such as plasmids or viral vectors." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "engineered_genetic_vector" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000861", "lbl" : "extra-chromosomal transgene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transgene that is not chromosomally integrated in the host genome, but instead exists as part of an extra-chromosomal construct." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "non-integrated transgene" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000870", "lbl" : "obsolete sequence feature collection", "type" : "CLASS", "meta" : { "definition" : { "val" : "A collection of more than one sequence feature." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/SO_0001260 ! sequence_collection" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000871", "lbl" : "haplotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of discrete, genetically-linked sequence alterations that reside on the same chromosomal strand and are typically co-inherited within a haplotype block." }, "comments" : [ "A haplotype is a set of non-overlapping alleles that reside in close proximity on the same DNA strand. We model them as 'complements' because they include all known/relevant alleles within a defined region in the genome (e.g. a 'gene', or a 'haplotype block') - where this set may consist of 0, 1, or more alterations from some reference. Because they are genetically linked, the alleles comprising a haplotype are likely to be co-inherited and survive descent across many generations of reproduction. \n\nAs highlighted in https://en.wikipedia.org/wiki/Haplotype, the term 'haplotype' is most commonly used to describe the following scenarios of genetic linkage between 'alleles':\n\n1. The 'alleles' comprising the haplotype are 'single nucleotide polymorphisms' (SNPs) or other small alterations, which collectively tend to occur together on a chromosomal strand). This use of 'haplotype' is commonly seen in phasing of patient WGS or WES data, to describe a state where two or more alterations that are believed to occur 'in cis' on the same chromosomal strand. \n\n2. The 'alleles' comprising the haplotype are SNPs or other short alterations, which collectively define a specific version of a gene. In this case, the locaiton bounding the haplotype corresponds to a gene locus, and the haplotype defines a specific allele of that gene (i.e 'gene allele'). \"Star alleles\" of PGx genes are examples of this category of haplotype (e.g. https://www.ebi.ac.uk/cgi-bin/ipd/imgt/hla/get_allele_hgvs.cgi?A*33:01:01, https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4724253/).\n\n3. Each of the 'alleles' comprising the haplotype is itself a 'gene allele' (i.e. a specific version of an entire gene), such that the haolotype contains multiple complete 'gene alleles' that are co-inherited because they reside in tightly linked clusters on a single chromosome. \n\nEach of these more specific definition serves a purpose for a particular type of genetic analysis or use case. The GENO definition of 'haplotype' is broadly inclusive of these and any other scenarios where distinct 'alleles' of any kind on the same chromosomal strand are genetically linked, and thus tend to be co-inherited across successive generations." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Consider if we dont want to define this as a 'complement', as it implies a complet set of memebrs of a defined type. But many haplotypes will be incomplete, due to lack of knowledge of other variation bound by the haplotype block.\n\nInstead, we can create an 'allele set' class as the haplotype parent?" }, { "pred" : "http://purl.org/dc/terms/source", "val" : "Informed by https://isogg.org/wiki/Haplotype and https://en.wikipedia.org/wiki/Haplotype." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000872", "lbl" : "genomic sequence set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of genomic sequences (a biological sequence that is of genomic origin)." }, "comments" : [ "A 'genomic *sequence* set' differs from a 'genomic *feature* set' in that we are counting how many copies of the same *sequence* exist in a genome, as opposed to how many of the same *sequence feature*. 'Genomic sequence sets' are useful for describing things like 'copy number complements', which are concerned only with how many copies of a sequence exist in a genome, regardless of the location where these reside. By contrast, 'genomic feature sets are useful for representing things like 'single locus complements', where members are sequence features whose identity is dependent on their location." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "copy number complement" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000873", "lbl" : "microsatellite alteration", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000874", "lbl" : "repeat region alteration", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000875", "lbl" : "allelic state", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in an 'allelic complement' (aka a 'single locus complement') that describes the allelic variability found at a particular locus in the genome of a single cell/organism" } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000876", "lbl" : "obsolete genetic dosage", "type" : "CLASS", "meta" : { "comments" : [ "Genetic dosage reflects how many 'functional' copies of a sequence are present in a genome. In diploid organisms, the normal dosage is 2 for autosomal genes/regions. Dosage increases if there is a duplication of the gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This sets it apart from the notion of 'copy number', which reflects how many actual copies of a sequence exist in a genome. Addition of a non-functional allele of a gene will increase its copy number, but not increase its dosage.\n\nDuplications of a sequence can occur at new locations in the genome, such that the resulting sequence represents a distinct sequence feature from the copy at its native locus. For example, duplication of a region containing the human APOE gene on a different chromosome creates a sequence feature that shares sequence from the original gene, but not location, and therefore represents a different sequence feature. The notions of dosage and copy number are therefore concerned with sequence-level entities (how many copies of a 'sequence' exist), as opposed to sequence feature-level entities. The notion of a single-locus complement would be used to describe how many of a particular features are present in a genome - and describe which alleles of this feature are found." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "allelic dosage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "an attribute inhering in a feature based on the total number or relative stoichiometry of functional copies present in a particular genome." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "gene dosage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Remodeled this concept as a 'genetic dosage complement' - a sequence-level class, as opposed to a sequence feature attribute." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000877", "lbl" : "allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in an allele that describes its genetic origin (how it came to be part of a cell's genome), i.e. whether it occurred de novo through some spontaneous mutation event, or was inherited from a parent." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genetic origin" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "variant origin" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000878", "lbl" : "maternal allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that is inherited from a female parent in virtue of the allele being present in the mother's egg." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "maternally inherited" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000879", "lbl" : "paternal allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that is inherited from a male parent in virtue of the allele being present in the father's sperm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "paternally inherited" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000880", "lbl" : "de novo allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that originated through a mutation event in a germ cell of one of the parents, or in the fertilized egg itself during early embryogenesis. De novo alleles are* heritable* but *not inherited*." }, "comments" : [ "We distinguish germline, somatic, and de novo allele origin based on a combination two key criteria - whether the allele *inherited* from a parent, and whether it is *heritble' by offspring. De novo variants are *heritable* but not *inherited* - as they are not observed constitutively in either parent, but can be passed to offspring in virtue of their being present in the individual's germ cells. By contrast, germline variants are both inherited (passed down from a parent) and heritable (passable down to offspring), and somatic variants are neither inherited or heritable - having originated via a spontaneous mutation in a non-germ cell. \n\t\t\nDe novo variants appear for the first time in one family member. They often explain genetic disorders in which an affected child has a mutation in every cell in the body but the parents do not, and there is no family history of the disorder." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Derived from https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/de-novo-mutation and https://ghr.nlm.nih.gov/primer/mutationsanddisorders/genemutation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000881", "lbl" : "unknown allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele whose origin is not known." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000882", "lbl" : "somatic allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that result from some spontaneous mutation event in a somatic cell after fertilization, and thus are not present in every cell in the body." }, "comments" : [ "We distinguish germline, somatic, and de novo allele origin based on a combination two key criteria - whether the allele *inherited* from a parent, and whether it is *heritble' by offspring. Somatic variants are neither inherited or heritable - having originated via a spontaneous mutation in a non-germ cell. By contrast, germline variants are both inherited (passed down from a parent) and heritable (passable down to offspring). De novo mutations are not inherited but are typically heritable, as they originated through a spontaneous mutation that made them present in germ cells.\n\t\t\nThese acquired mutations are called 'somatic' because they typically affect somatic (non-germ) cells. But when spontaneous do mutations occur in the germ cells of an organism, these can be passed on to offspring in whom they will be considered de novo mutations." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "acquired" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Derived from https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/somatic-variant and https://ghr.nlm.nih.gov/primer/mutationsanddisorders/genemutation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000883", "lbl" : "obsolete gametic", "type" : "CLASS", "meta" : { "definition" : { "val" : "a quality inhering in a feature in virtue of its presence only in the genome of gametes (germ cells)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "germ-line" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "replaced by GENO:0000900 ! 'germline'" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000885", "lbl" : "diplotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allelic genotype specifying the set of two alleles present at a particular location in a diploid genome (i.e., a diploid 'single locus complement')\n\nAlt: A sequence feature complement comprised of two haplotypes at a particular location on paired homologous chromosomes in a diploid genome." }, "comments" : [ "\"Humans are diploid organisms; they have paired homologous chromosomes in their somatic cells, which contain two copies of each gene. An allele is one member of a pair of genes occupying a specific spot on a chromosome (called locus). Two alleles at the same locus on homologous chromosomes make up the individual’s genotype. A haplotype (a contraction of the term ‘haploid genotype’) is a combination of alleles at multiple loci that are transmitted together on the same chromosome. Haplotype may refer to as few as two loci or to an entire chromosome depending on the number of recombination events that have occurred between a given set of loci. Genewise haplotypes are established with markers within a gene; familywise haplotypes are established with markers within members of a gene family; and regionwise haplotypes are established within different genes in a region at the same chromosome. Finally, a diplotype is a matched pair of haplotypes on homologous chromosomes.\"\nFrom https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4118015/\nhttps://www.ncbi.nlm.nih.gov/pmc/articles/PMC4118015/figure/sap-26-03-165-g002/" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000886", "lbl" : "allelic phase", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in a collection of discontinuous sequence features in a single genome in virtue of their relative position on the same or separate chromosomes." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000887", "lbl" : "oryzias latipes strain", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000888", "lbl" : "germline allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that is inherited from a parent in virtue of the allele being present in the germline of one of the parents." }, "comments" : [ "We distinguish germline, somatic, and de novo allele origin based on a combination two key criteria - whether the allele *inherited* from a parent, and whether it is *heritble' by offspring. Germline variants are both *inherited* (present constitutively in a parent and passed down to offspring) and *heritable* (passable down to future offspring). By contrast, somatic variants are neither inherited or heritable - having originated via a spontaneous mutation in a non-germ cell. Traits caused by de novo mutations in germ cells are not inherited but are typically heritable, as they originated through a spontaneous mutation that made them present a germ cells." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "hereditary" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "parental origin" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "parentally inherited" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Derived from https://www.cancer.gov/publications/dictionaries/genetics-dictionary/def/germline-variant and https://ghr.nlm.nih.gov/primer/mutationsanddisorders/genemutation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000889", "lbl" : "undetermined inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern that is not determined or not known." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "unknown inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000890", "lbl" : "obsolete canonical allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "One of a set of sequence features or haplotypes that exist at a particular genetic locus. " }, "comments" : [ "As a 'sequence feature or collection' (sensu SO), a 'canonical allele' is considered here as an extent of biological sequence encoded in nucleic acid molecules of a cell or organism (as opposed to an information artifact that is about such a sequence). Canonical alleles can include haplotypes that contain more than one discontinuous sequence alteration that exist in cis on the same chromosomal strand.\n\nIn the ClinGen allele model, 'canonical alleles are contrasted with 'contextual alleles'. Contextual alleles are informational representation that describe a canonical allele using a particular reference sequence. A single canonical allele can be described by many contextual alleles that each use a different reference sequence in their representation (e.g. different chromosomal or transcript references)" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The canonical allele that represents a single nucleotide variation in the BRCA2 gene, which can be described by various contextual alleles such as “NC_000013.11:g.32319070T>A” and “NG_012772.3:g.8591T>A”." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The notion of a 'canonical allele' is taken from the ClinGen Allele model (http://dataexchange.clinicalgenome.org/allele/). It is implemented in GENO to provide an ontological representation of this concept that will support data integration efforts, but may be replaced by should an IRI become available from the ClinGen model." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://dataexchange.clinicalgenome.org/allele/resource/canonical_allele/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "No longer needed by ClinGen for their interpretation models, and will likely be replaced in ClinGen and elsewhere by VMC/GA4GH modeling constructs." }, { "pred" : "http://purl.org/dc/terms/source", "val" : "ClinGen Allele Model (http://dataexchange.clinicalgenome.org/allele/)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000891", "lbl" : "obsolete contextual allele", "type" : "CLASS", "meta" : { "definition" : { "val" : "An informational artifact that describes a canonical allele by defining its sequence and position relative to a particular reference sequence." }, "comments" : [ "The notion of a 'contextual allele' derives from the ClinGen Allele model. Here, each genetic allele in a patient corresponds to a single 'canonical allele', which in turn may aggregate any number of 'contextual allele' representations that are may be defined against different reference sequences. Accordingly, many contextual alleles can describe a single canonical allele. For example, the contextual alleles “NC_000013.11:g.32319070T>A” and “NG_012772.3:g.8591T>A” both describe the same underlying canonical allele, a single nucleotide variation, in the BRCA2 gene." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The notion of a 'contextual allele' is taken from the ClinGen Allele model (http://dataexchange.clinicalgenome.org/allele/). It is implemented in GENO to provide an ontological representation of this concept that will support data integration efforts, but may be replaced by should an IRI become available from the ClinGen model." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://dataexchange.clinicalgenome.org/allele/resource/contextual_allele/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "No longer needed by ClinGen for their interpretation models, and will likely be replaced in ClinGen and elsewhere by VMC/GA4GH modeling constructs.\n\nFormer axiom: denotes some 'obsolete_canonical allele'" }, { "pred" : "http://purl.org/dc/terms/source", "val" : "ClinGen Allele Model (http://dataexchange.clinicalgenome.org/allele/)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000892", "lbl" : "heteroplasmic mitochondrial inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A mitochondrial inheritance pattern whereby manifestation of a trait is observed when some inherited mitochondria contian the causative allele and some do not." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000893", "lbl" : "homoplasmic mitochondrial inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A mitochondrial inheritance pattern whereby manifestation of a trait occurs when only mitochondria containing the causative allele are inherited." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000897", "lbl" : "genomic entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "An generically dependent continuant that carries biological sequence that is part of or derived from a genome." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/GENO_0000905", "val" : "true" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "An abstract/organizational class to support data modeling, that includes genomic features, genomic feature complements, qualified genomic features and their complements, as well as genotypes that denote such entities." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000898", "lbl" : "haplotype block", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequence alterations it contains are typically co-inherited across generations." }, "comments" : [ "A particular haplotype block is defined by the set of sequence alterations it is known to contain, which collectively represent a 'haplotype'. The boundaries of haplotype blocks are defined in efforts to identify haplotypes that exist in organisms or populations. A haplotype block may span any number of sequence alterations, and may cover small or large chromosomal regions - depending on the number of recombination events that have occurred between the alterations defining the haplotype." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Consider whether we might better model a 'haplotype block' at the level of a sequence location, rather than a sequence region - e.g. as \n\"A genomic location over which there is little evidence for historical recombination, such that sequence alterations it contains are typically co-inherited across generations.\" Look at how teh concept is used in research, and if people think of each version of sequence in a haplotype block to be an instance. I think we would just call these versions 'alleles', and then could define haplotype block as a location.\n\nCurrent definition is based on http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block (def = A region of the genome which is co-inherited as the result of the lack of historic recombination within it). If we stick with a region-level treatment, consdier if as a defined region of genomic sequence where variation is known to occur, a haplotype block should be classified as a subtype of allele." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Informed by http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block, and DOI: 10.1126/science.1069424." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000899", "lbl" : "genomic genotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genotype that describes the total variation in heritable genomic sequence of a cell or organism, typically in terms of alterations from some reference or background genotype." }, "comments" : [ "1. A genomic genotype is a short-hand specification of a genome that uses a representational syntax comprised of information about a reference genome ('genomic background'), and all specific variants from this reference (the 'genomic variation complement'). Conceptually, this variant genome sequence can be resolved by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'genomic background' sequence.\n\n2. 'Heritable' genomic sequence is that which is passed on to subsequent generations of cells/organisms, and includes all chromosomal sequences, the mitochondrial genome, and any transmissable extrachromosomal replicons." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "'Genomic Genotype' vs 'Genome' in GENO: \nA genomic genotype is an information artifact with a representational syntax that can specify what is known about the complete sequence of a genome. This syntax describes 'reference' and 'variant' components - namely a 'background genotype' and 'genomic variation complement' - that must be operated on to resolve the genome sequence. Specifically, the genome sequence is determined by substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the reference 'background genotype'. So, while the total sequence content described in a genotype may exceed that of a single a genome (in that it includes a reference genome and variatoin complement), the intended resolution of these sequences is to arrive at a single genome sequence. It is this end-point that we consider when asserting that a genotype 'specifies' a genome." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "complete genotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000901", "lbl" : "obsolete allele cellular context", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in a particular allele in virtue of its presence only in a particular type of cell in an organism (e.g. somatic vs germ cells)" }, "comments" : [ "Cellular context of an allele is typically defined in the context of evaluating an individual organism, as alleles that are somatic in one organism can be germline in others." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "decided this attribute is not needed, and moved its child 'germline' and 'somatic' concepts under allele origin" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000902", "lbl" : "genomic feature location", "type" : "CLASS", "meta" : { "definition" : { "val" : "The location of a sequence feature in a genome, defined by its start and end position on some reference genomic coordinate system" }, "comments" : [ "1. A genomic location (aka locus) is defined by its begin and end coordinates on a reference genome, independent of a particular sequence that may reside there. In GENO, we say that a genomic location is occupied_by a 'sequence feature' - where the identity of this feature depends on both it sequence, and its location in the genome (i.e. the locus it occupies). For example, the 'ATG' sequence beginning the ORF of the human SHH gene shares the *same sequence* as the 'ATG' beginning the ORF of the human AKT gene. But these are *distinct sequence features* because they occupy different genomic locations. \n\t\n2. A given genomic location (e.g. the human SHH gene locus) may be occupied by different alleles (e.g. different alleles of the SHH gene). Within the genome of a single diploid organism, there is potential for two alleles to exist at such a locus (i.e. two different versions of the SHH gene). And across genomes of all members of a species, many more alleles of the SHH gene may exist and occupy this same locus.\n\n3. The notion of a genomic location in the realm of biological sequences is analogous to a BFO:spatiotemporal region in the realm of physical entities. A spatiotemporal region can be occupied_by physical objects, while a genomic location is occupied_by sequence features. Just as a spatiotemporal region is distinct from an object that occupies it, so too a genomic locus is distinct from a sequence feature that occupies it. As a more concrete example, consider the distinction between a street address and the building that occupies it as analogous to the relationship between a genomic location and the feature that resides there." ], "xrefs" : [ { "val" : "VMC:Location" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "In GENO, the notion of a Genomic Location (aka Genomic Locus) plays the same role as that of a FALDO:Region in the design pattern for describing the location of a feature of interest. We define this specific GENO class because the ontological nature of FALDO:Region class is not clear in the context of the BFO and SO-based GENO model. We will work to resolve these questions and ideally converge these concepts in the future.\n\nWe don't link a Genomic Location to a specific reference sequence because in the FALDO model (which GENO adopts with the exception of swapping GENO:Genomic Locus for FALDO:Region), allows the start and end positions of a region to be defined on separate reference sequences. So while a given Location is conceptually associated with a single reference, in practice it can be pragmatic to define start and stop on different references sequences." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "In practice, GENO advocates describing biology at the level of genomic features - i.e. define specific terms for genes as genomic features, and not duplicate representation of the loci where each gene resides. So we might define a class representing the human Shh gene as a 'genomic feature', but not parallel this with a 'human Shh gene locus' class. The utility of the 'genomic locus' class in the ontology is primarily to be clear about the distinction, but we would only use it in modeling data if absolutely needed.\n\nFor example, we would define an 'HLA gene block' as a subclass of 'genomic feature', and assert that HLA-A, HLA-B, and HLA-C genes are part/subsequences of this HLA gene block (as opposed to modeling this as an 'HLA locus' and asserting that the HLA-A, HLA-B, and HLA-C genes occupy this locus)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genomic location" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genomic locus" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000904", "lbl" : "organismal entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity that is an organism, derived from an organism, or composed of organisms (e.g. a cell line, biosample, tissue culture, population, etc)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/GENO_0000905", "val" : "true" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "useful organizational term to collect entities that have genomes/genotypes." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000907", "lbl" : "gene product", "type" : "CLASS", "meta" : { "definition" : { "val" : "The molecular product resulting from transcription of a single gene (either a protein or RNA molecule)" } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000910", "lbl" : "reporter", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000911", "lbl" : "selectable marker", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000912", "lbl" : "selectable marker region", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000914", "lbl" : "reference genome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genome whose sequence is identical to that of a genome sequence considered to be the reference." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000915", "lbl" : "obsolete haplotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "A haplotype is an allele that represents one of many possible versions of a 'haplotype block', which defines a region of genomic sequence that is typically 'co-inherited' across generations due to a lack of historically observed recombination within it." }, "comments" : [ "1. The relationship between 'haplotype' and 'haplotype block' is analogous to the relationship between 'gene allele' and 'gene': a 'gene allele' is one of many possible instances of a 'gene', while a 'haplotype' is one of many possible instances of a 'haplotype block'. In this sense, a gene allele can be considered to be a haplotype whose extent is that of a gene (as it is generally true that there is a low probability of recombination within any given gene).\n\n2. Haplotypes typically contain more than one 'genetically-linked' loci where sequence alterations are known to exist, such that a set of alterations will be co-inherited together across many generations of reproduction. A common use of 'haplotype' is in phasing of patient WGS or WES data, where this term refers to sequence containing two or more alterations that are beleived to occur 'in cis' on the same chromosomal strand. \n\nGENO's definition is consistent with but more inclusive than this view, allowing for haplotypes with one or zero established alterations as long as there is a low probability of recombination within the region it spans (such that alterations found in cis are likely to remain in cis across successive generations). As a result, GENO considers any allele that spans an extent greater than that of a single sequence alteration to be a haplotype - as long as there is an expectation of low recombination frequency within the haplotype block occupied by the allele. For example, a 'gene allele' is a haplotype representing a particular version of a gene that contains one or more sequence alterations - as a 'gene' is a region of sequence with a low probability of recombination that is generally expeted to be inherited as a unit. \n\n3. As highlighted in https://en.wikipedia.org/wiki/Haplotype, the term 'haplotype' is most commonly used to describe the following scenarios of genetic linkage between 'alleles':\n\na. The first is regions containing multiple linked 'gene alleles' - i.e. specific versions of entire genes that are co-inherited because they reside in tightly linked clusters on a single chromosome. \nb. The second is a region containing multiple linked single nucleotide polymorphisms (SNPs) that tend to occur together on a chromosomal strand (i.e. be statistically associated). This use of 'haplotype' is commonly seen in phasing of patient WGS or WES data, to describe a state where two or more alterations that are believed to occur 'in cis' on the same chromosomal strand. \nc. A third, which is related to the previous case, occurs when the extent of region containing linked SNPs is that of a single gene. In this case, the haplotype represents a 'gene allele' - a version of an entire gene defined by the set of sequence alterations it contains. We may consider this a haplotype as most genes are small enough that there is little chance of recombination events moving cis alterations onto separate chromosomes.\n\nThe GENO definition of 'haplotype' is broadly inclusive of these and any other scenarios where distinct 'alleles' of any kind on the same chromosomal strand are genetically linked, and thus tend to be co-inherited across successive generations." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Former comment: \"Each of these more specific definition serves a purpose for a particular type of genetic analysis or use case - e.g. 'SNP allele' haplotypes are identified and analysed in studies to uncover the genetic basis of common disease by efforts like the International HapMap Project.\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Informed by https://isogg.org/wiki/Haplotype and https://en.wikipedia.org/wiki/Haplotype and http://purl.obolibrary.org/obo/SO_0001024 ! haplotype." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Decided to represent haplotypes as collections of discrete alleles, rather than continuous features defined by such sets.\n\nFormer SC axioms:\n- is_allele_of some 'haplotype block'\n- 'has part' some sequence_alteration" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000916", "lbl" : "obsolete haplotype block", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature representing a region of the genome over which there is little evidence for historical recombination, such that sequences it contain are typically co-inherited/transmitted across generations." }, "comments" : [ "A haplotype block is a class of genomic sequence defined by a lack of evidence for historical recombination, such that sequence alterations within it tend to be co-inherited across successive generations. A haplotype is considered to be one of many possible versions of a 'haplotype block' - defined by the set of co-inherited alterations it contains. In this sense, the relationship between 'haplotype' and 'haplotype block' is analogous to the relationship between 'gene allele' and 'gene'* - a 'gene allele' is one of many possible instances of a 'gene', while a 'haplotype' is one of many possible instances of a 'haplotype block'.\n\nThe boundaries of haplotype blocks are defined in efforts to identify haplotypes that exist in organisms or populations. A haplotype block may span any number of sequence alterations, and may cover small or large chromosomal regions - depending on the number of recombination events that have occurred between the alterations defining the haplotype.\n\n-----------------------\n\n* One difference however is that gene instnaces are necessarily 'functional' - so non-functional alleles of a gene locus wont qualify as gene instances. no such requirement exists for haplotype block instnaces." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Derived from DOI: 10.1126/science.1069424 and http://purl.obolibrary.org/obo/SO_0000355 ! haplotype_block." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Decided to represent haplotypes as collections of discrete alleles, rather than continuous features defined by such sets." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000918", "lbl" : "organellar plasmy", "type" : "CLASS", "meta" : { "definition" : { "val" : "An allelic state that describes the number of different alleles of a gene from an organellar genome (i.e. mitochondrial, plastid) that may exist in a cell." }, "comments" : [ "Cells with a population of organelles from a single origin that all share the same organellar genome will contain only one allele of each organellar gene, while cells with populations of organelles of different origins may contain more than one allele of a given organellar gene." ], "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000919", "lbl" : "qualified sequence feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature whose identity is additionally dependent on the context or state of the material sequence molecule in which the feature is concretized. This context/state describes factors external to the feature's intrinsic sequence and position that can influences its expression, such as being targeted by gene-knockdown reagents, or an epigenetic modification." }, "comments" : [ "GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria.\n1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence.\n2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology).\n3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical state or context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern).", "Modeling sequence entities at this 'qualified' level is useful for distinguishing cases where features with identical sequence and position as separate instances - based on their material bearers being found in different contexts. For example, consider a situation where the zebrafish shha gene (a sequence feature) is targeted in two experimental groups of fish by two different morpholinos, and phenotypes are assessed for each. We want to be able to represent two 'variants' of the shha gene in this scenario as separate 'qualified sequence feature' instances so we can capture data about the phenotypes resulting from each - just as we would separately represent to different sequence variants (alleles) of the shha gene at the sequence feature level so that we can track their associated phenotypes." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Consider wild-type zebrafish shha gene in the context of being targeted by morpholino MO-1 vs morpholino MO-2 in separate experiments. These shha genes share identical sequence and position, but represent distinct instances of a 'qualified sequence feature' because of their different external contexts. This is important because these qualified features could have distinct phenotypes associated with them (just as two different sequence variants (alleles) of the same gene can have potentially different associated phenotypes)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000920", "lbl" : "qualified sequence feature set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of qualified seqeunce features." }, "comments" : [ "'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'matehmatical sets'." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000921", "lbl" : "biological sequence or set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biolocical sequence, or set of such sequences." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "biological sequence or collection" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000922", "lbl" : "biological sequence set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of biological sequences." }, "comments" : [ "'Sets' are used to represent entities that are typically collections of more than one member. But we allow for sets that contain 0 members (an 'empty' set) or 1 member (a 'singleton' or 'unit' set), consistent with the concept of 'mathematical sets'. \n\nA set may also include multiple copies of the same sequence. For example, in a 'copy number complement', members are all copies of this same biological sequence." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000923", "lbl" : "obsolete functional copy number complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of all features representing *functional* versions of a specified sequence (typically that of a gene) in a particular genome." }, "comments" : [ "As for copy number complements, the defining 'sequence' here is specified in terms of a location on a reference sequence - typically the location where a gene or set of genes resides. But the criteria for membership in a functional copy number complement require only that the feature can perform the functions associated with the gene or genes at the defining location. A gene allele that varies by only one nucleotide from the wild-type gene may not qualify if that alteration eliminates the function of the allele. This represents an important distinction between 'copy number' and 'functional copy number'. The former is not concerned with the functionality of sequence copies - only that there is a duplication of sequence in the genome. Thus, the addition of a non-functional allele of a gene will increase its copy number, but not increase its 'functional copy number (aka its dosage).", "The notion of 'functional copy number' (aka 'genetic dosage') describes how many 'functional' copies of a sequence are present in a genome - i.e. sequences that retain their normal activity and/or produce gene products that retain their normal activity. In diploid organisms, the normal dosage is 2 for autosomal genes/regions. Dosage increases if there is a duplication of the gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This latter condition sets it apart from the notion of a 'copy number complement', which reflects how many actual copies of a sequence exist in a genome. Addition of a non-functional allele of a gene will increase its genomic sequence complement count (i.e. its copy number), but not increase its dosage." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Formerly considered modeling this as an informational entity, defined as \"An information entity that describes the total number of functional copies of a gene or region of sequence in a particular genome.\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "functional feature complement" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "genetic dosage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Decided to implement copy number related classes at the sequence level, rather than the sequence feature level. Replaced by GENO:0000963." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000924", "lbl" : "obsolete intrinsic sequence feature attribute", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature attribute that reflects feature-level characteristics that depend only on the sequence, location, or genomic context of a feature or collection, but are independent of how it may be concretized in physical form." }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000925", "lbl" : "obsolete extrinsic sequence feature attribute", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence feature attribute that reflects characteristics of the physical molecule in which the feature is concretized (e.g. its cellular context, source of origin, etc.)" }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000926", "lbl" : "allelic cellular distribution", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality inhering in an allele reflecting whether it is found in all cells of an organism's body, or just some clonal subset (e.g. in mosaicism)." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000927", "lbl" : "constitutional", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cellular distribution in which an allele is found in all cells of an organism's body, typically in virtue of its germline origin." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000928", "lbl" : "clonal", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cellular distribuution in which an allele is found only in some clonal subset of cells in an organism, typically in virtue of its somatic origin." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000929", "lbl" : "multifactorial inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern that depends on a mixture of major and minor genetic determinants (i.e. alleles of more than one contributing genes), possibly together with environmental factors." }, "comments" : [ "Diseases inherited in this manner are termed 'complex diseases'." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001426" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "complex inherritance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "multi-factorial inheritance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "multi-genic inheritance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "multi-locus inheritance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "multigenic inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000930", "lbl" : "digenic inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in two genes." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0010984" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000931", "lbl" : "oligogenic inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles in few genes." }, "comments" : [ "It is recommended this term be used for traits governed by three gene loci, although it is noted that usage of this term in the literature is not uniform." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0010983" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000932", "lbl" : "polygenic inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A multifactorial inheritance pattern that is determined by the simultaneous action of alleles a large number of genes." }, "comments" : [ "Typically used for traits/conditions governed by more than three gene loci." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0010982" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000933", "lbl" : "monogenic inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene, possibly together with environmental factors." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "single-gene inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000934", "lbl" : "autosomal inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a non-sex chromosome." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000935", "lbl" : "allosomal inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a sex chromosome." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0010985" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "gonosomal inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000936", "lbl" : "X-linked inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on an X-chromosome." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001417" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000937", "lbl" : "complete X-linked dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An X-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000938", "lbl" : "incomplete X-linked dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An X-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "semi-dominant X-linked inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000939", "lbl" : "co-dominant X-linked inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An X-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000941", "lbl" : "Y-linked inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Y-chromosome." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001450" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "holandric inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000942", "lbl" : "Z-linked inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a Z-chromosome." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000943", "lbl" : "Z-linked dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A Z-linked inheritance pattern wherein the trait manifests in heterozygotes." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000944", "lbl" : "complete Z-linked dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A Z-linked dominant inheritance pattern wherein the trait associated with one allele completely masks the trait associated with a different allele found at that locus." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000945", "lbl" : "incomplete Z-linked dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A Z-linked dominant inheritance pattern wherein the trait expressed in a heterozygous individual is intermediate between the trait expressed in individuals homozygous for either allele in the heterozygous locus." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "semi-dominant Z-linked inheritance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000946", "lbl" : "co-dominant Z-linked inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An Z-linked dominant inheritance pattern wherein a heterozygous individual simultaneously expresses the distinct traits associated with each allele in the heterozygous locus." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000947", "lbl" : "Z-linked reccessive inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "A Z-linked inheritance pattern wherein a trait caused by alleles of a gene on the Z-chromosome manifests in homozygous but not heterozygote individuals." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000948", "lbl" : "W-linked inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by alleles of a single causal gene on a W-chromosome." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000949", "lbl" : "mitochondrial inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern observed for traits related to a gene encoded on the mitochondrial genome." }, "comments" : [ "Because the mitochondrial genome is essentially always maternally inherited, a mitochondrial condition can only be transmitted by females, although the condition can affect both sexes. The proportion of mutant mitochondria can vary (heteroplasmy)." ], "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001427" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000952", "lbl" : "sex-limited autosomal dominant inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An autosomal dominant inheritance pattern wherein the trait manifests in heterozygotes in a sex-specific manner (i.e. only in males or only in females)." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0001470" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000953", "lbl" : "sex-limited autosomal recessive inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An autosomal recessive inheritance pattern wherein the trait manifests only in homozygotes, and in a sex-specific manner (i.e. only in males or only in females)." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/HP_0031362" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000954", "lbl" : "allele set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of discrete alleles within a particular genome." }, "comments" : [ "'Sets' are used to model entities that can be comprised of multiple discrete elements - but which can also contain zero or a single member. An \"Allele Set' represents any collection of 0 or more discrete alleles found within a particular genome. The alleles in such a set can be located at distant or close locations in the genome, and if on the same chromosome can be in trans, in cis, or even overlapping When the members of such a set are found 'in cis' on the same chromosome, they may constitute a 'haplotype'. When found 'in trans' at the same location on homologous chromosomes, they may constitute a 'single locus complement'." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000955", "lbl" : "obsolete variant copy number complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A copy number complement' that has an abnormal number of members (e.g. more or less than two for an autosomal sequence in a diploid genome, as a result of deletion or duplication event(s)." }, "comments" : [ "In a 'normal' diploid genome, the copy number complement for any feature (on a non-Y chromosome) contains two members. A copy number variation occurs when a complement contains more or less than two members - as the result of deletion or duplication event(s).\n\nNote that the 'copy number variation' class in GENO is related to but ontologically distinct form the SO 'copy_number_variation' class. The GENO class refers to a *set* of all copies of a sequence in a genome, where the number of members in the set is in conflict with the genome's normal ploidy (e.g. not two for a diploid genome). The SO class, which is defined as a sequence feature level concept and therefore represents a single continuous extent of sequence, refers to a single copy of duplicated (or deleted) sequence that comprises the set defined by the GENO CNV class." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "copy number variation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Decided to implement copy number related classes at the sequence level, rather than the sequence feature level." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000956", "lbl" : "obsolete copy number complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set of all features in a particular genome whose sequence aligns with a particular location on a reference genome. Such features are typically on the scale of complete genes or larger." }, "comments" : [ "1. Features described by 'copy number' are larger regions of sequence spanning one or more complete genes, or large chromosomal segment. Copies of these regions often become distributed across a genome at unknown locations. By contrast, short repeats, such as tri-nucelotide 'CAG' repeats in the Huntingtin gene, occur at defined locations (adjacent to the originating 'CAG' sequence), and can therefore be modeled as proper alleles. \n\n2. A copy number complement, like any sequence feature complement, is a set of features in a particular genome that meet some criterion. The criterion in this case is that their sequence maps to that of a particular location in a reference sequence. So a copy number complement is the set of all features that share or align with a specified sequence defined on some reference. The sequence of member sequences need not exactly match that of the reference, as copies may accrue some alterations. What is important is that conceptually they represent exact or inexact copies of the reference sequence at a defining location.\n\n3. In a 'normal' diploid genome, the copy number complement for any feature (on a non-Y chromosome) contains two members. A copy number variation occurs when a complement contains more or less than two members - as the result of deletion or duplication event(s). In GENO, a 'copy number variation' refers to a copy number complement' that has an abnormal number of members." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Decided to implement copy number related classes at the sequence level, rather than the sequence feature level. Replaced by GENO:0000961." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000960", "lbl" : "genomic sequence", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological sequence that is of genomic origin (i.e. carries sequence from the genome of a cell or organism)." }, "comments" : [ "A sequence being 'of genomic origin' here means only that it has been located to the genome of some organism by alignment with some reference genomic sequence. This is because the sequence was originally identified in, or artificially created to replicate, sequence from an organism's genome." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000961", "lbl" : "copy number complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set representing the complement of all copies of a particular biological sequence (typically at the scale of complete genes or larger) present in a particular genome." }, "comments" : [ "The count of how many of a particular sequences are found in a genome is the sequences 'copy number'. In diploid organisms, the normal copy number for sequences at most locations is 2 (a notable exception being those on the X-chromosome where normal copy number is 1). Variations in copy number occur if this count increases due to a duplication of the gene/region, or decreases due to a deletion of a gene/region. A driving use case for representing copy number is to support associations between variation in copy number of a particular sequence, and phenotypes or diseases that can result.\n\nA 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a set may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features, such as 'copy number complements' representing the set of all copies of a particular sequence in a genome. \n\nThe fact that we are counting how many copies of the same *sequence* exist in a genome here, as opposed to how many of the same *feature*, is what sets sequence-level concepts like 'copy number complement' apart from feature-level concepts like 'single locus complement'. To illustrate the difference, consider a duplication event that creates a new copy of the human APOE gene on a different chromosome. This creates an entirely new sequence feature at a distinct locus from that of the original APOE gene. The 'copy number complement' for sequence defined by the APOE gene locus would have a count of three, as this sequence is present three times in the genome. But the 'single locus complement' at the APOE gene locus would still have a count of two - because the duplicated copy is at a different location in the genome, and therefore does not represent a copy of the APOE locus.", "The notion of a 'complement' is useful as a special case of a set, where the members necessarily comprise an exhaustive collection of *all* objects that make up some well-defined set. Here, a 'copy number complement' represents 'represents the set of *all* copies of a specified sequence in a particular genome. Note that sequences can be duplicated in a set (i.e. contain more than one member representing the same sequence). In the 'copy number complement' example, each set member is a copy of this same biological sequence." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The identity of a 'copy number complement' instance is determined by the sequence defining its members, and their count (the number of times this sequence appears in a particular genome). In reality the sequence of each copy may not be identical, given the tendency of large regions to accumulate subtle variations. What matters is that they share a common origin/alignment with a defining location in a reference genome.\n\nWe represent the notion of copy number at the \"sequence level\" (as opposed to the \"sequence feature level\") because we are concerned only with the number of copies of a sequence in a genome, and not the location of the features bearing this sequence. Consider a copy number complement comprised of three copies of the sequence defined by the location Chr8 100000-200000 on a GRCh38.2 reference genome. In one person's genome, this sequence may appear at its normal location on Chromosome 8, as well as in duplications on chromosomes 5, and 12. In another genome the sequence might appear three times as well, but on chromosomes 8, 9, and 15. When representing causal associations linking copy number to disease, it is important that these are considered to be *the same* copy number complement - because what a curator associates with a disease is the presence of three copies of some sequence in a genome, independent of their location. The \"sequence level\" representation here supports this use case. By contrast, a \"feature level\" representation, where identity of a copy number complement would be based on the identity of member *features*), does not - because we have two sets comprised of entirely different features (based on location being tied to their identity)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000962", "lbl" : "variant copy number complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A 'copy number complement' that has an abnormal number of members, as the result of deletion or duplication event(s)." }, "comments" : [ "'Abnormal' is typically more or less than two members for an autosomal sequence in a diploid genome, and more or less than one member for a sequence in a non-homologous region of a sex-chromosome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note that this 'variant copy number complement' class in GENO is related to but ontologically distinct from the SO 'copy number variation' class. The GENO class refers to a *set* of all copies of a sequence in a genome, where the number of members in the set departs from the genome's normal ploidy of sequences at that location. The SO class, which is defined as a \"sequence feature level\" concept (and therefore represents a single continuous extent of sequence), refers to a sequence alteration such as a deletion or duplication that changes the copy number of the affected sequence, and would result in the presence of a 'variant copy number complement'. The presence of an SO 'copy number variation' suggests, but does not guarantee, the existence of a GENO 'variant copy number complement' (e.g. if a second balancing event has occurred).\n\nFor example, the deletion variant reported in the ClinVar record here (https://www.ncbi.nlm.nih.gov/clinvar/variation/21009/) is a copy number variation in the SO sense - a deletion that likely results in a GENO 'variant copy number complement'. Databases like ClinVar and dbVar type such alterations as 'copy number variants'. But ClinVar also describes 'variant copy number complements' that may result from the presence of one or more SO 'copy number variations' in a given genome, e.g. here ( https://www.ncbi.nlm.nih.gov/clinvar/variation/221691/). In this case, the submitter is asserting that a state in which only one copy of the defined sequence (Chr2: 73601366 - 73673202) exists in a genome is pathogenic for 'Premature ovarian failure'. This requires more knowledge of the complete genomic state than an assertion that a specific SO 'copy number variation' (here, a deletion variant) is pathogenic for the condition - as here we know that not only is one copy deleted, but also that only one copy remains." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000963", "lbl" : "functional copy complement", "type" : "CLASS", "meta" : { "definition" : { "val" : "A set representing the complement of all functional versions of a specified sequence (typically that of a gene) in a particular genome." }, "comments" : [ "A 'complement' refers to an exhaustive collection of *all* objects that make up some well-defined set. Such a set may contain 0, 1, or more than one members. The notion of a complement is useful for defining many biologically-relevant sets of sequence features, such as the set of all functional copies of a particular sequence in a genome. This is known as the 'functional copy number' or 'genetic dosage' of the sequence.\n\n'Functional copies' of a sequence are those that exhibit normal activity and/or produce gene products that exhibit normal activity associated with the sequence. The count of functional copies of a gene is often referred to as its 'dosage'. In diploid organisms, the normal 'dosage' is 2 for autosomal genes/regions. Dosage increases if there is a duplication of a functional gene/region. Dosage decreases if there is either a deletion of a gene/region, or an inactivating mutation that eliminates gene function. This sets it apart from the notion of a 'copy number complement', which reflects how many copies of a sequence exist in a genome, regardless of their functionality. Addition of a non-functional allele of a gene will increase its copy number, but not increase its dosage.\n\nAs we saw for 'copy number complement', the defining sequence here is specified in terms of a location on a reference sequence - typically the location where a gene or set of genes resides. But the criteria for membership in a 'functional' copy number complement require only that the feature can perform the functions associated with the gene or genes at the defining location. A gene allele that varies by only one nucleotide from the wild-type gene may not qualify as functional if that alteration eliminates the activity of the allele." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "functional genetic dosage" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000964", "lbl" : "mosaic", "type" : "CLASS", "meta" : { "comments" : [ "A clonal distribution in which an allele arose during embryogenesis and is present in a subset of tissues derived from some common developmental cell or tissue type." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000965", "lbl" : "sequence interval", "type" : "CLASS", "meta" : { "definition" : { "val" : "A pair of integers representing start and end position of a location on a sequence coordinate system." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000969", "lbl" : "chromosomal inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by inheritance of extra, missing, or re-arranged chromosomes possibly together with environmental factors." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "The Alliance of Genomic Resources" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000970", "lbl" : "chromosomal deletion inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by inheritance of missing sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Alliance of Genomic Resources" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000971", "lbl" : "chromosomal duplication inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by inheritance of duplicated sections of one or more chromosomes, encompassing either 0 or multiple genes, possibly together with environmental factors." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Alliance of Genomic Resources" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000972", "lbl" : "chromosomal rearrangement inheritance", "type" : "CLASS", "meta" : { "definition" : { "val" : "An inheritance pattern wherein the trait is determined by inheritance of translocation or inversion of sections of one or more chromosomes, possibly together with environmental factors." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Alliance of Genomic Resources" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000974", "lbl" : "inherited allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that is inherited from a parent." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "exploratory" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Need to consider if/how this is different than 'germline allele origin'.\n\nOne scenario that potentially distinguishes them is the case where a de novo mutation occurs in the germ cells of a parent, and is passed to offspring. This does not qualify as 'germline allele origin', as currently defined. But it would qualify as 'inherited'" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000975", "lbl" : "uniparental allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that is part of an allelic complement where both alleles are inherited from the same parent." }, "comments" : [ "From Wikidedia: Uniparental inheritance is a non-mendelian form of inheritance that consists of the transmission of genotypes from one parental type to all progeny. That is, all the genes in offspring will originate from only the mother or only the father. This phenomenon is most commonly observed in eukaryotic organelles such as mitochondria and chloroplasts. \nhttps://en.wikipedia.org/wiki/Uniparental_inheritance" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "exploratory" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000976", "lbl" : "biparental allele origin", "type" : "CLASS", "meta" : { "definition" : { "val" : "Describes an allele that is part of an allelic complement where one allele is maternally inherited and other paternally inherited." }, "comments" : [ "Biparental inheritance of alleles is typical of normal mendelian inheritance, where offspring inherit a maternal and a paternal copies of a given gene." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "exploratory" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000978", "lbl" : "nullizygous", "type" : "CLASS", "meta" : { "definition" : { "val" : "A disomic zygosity quality inhering in a 'single locus complement' that is comprised of two non-functional copies of a gene. Loss of function may result from the gene being entirely missing via a deletion, or mutated in a way that eliminates its function." }, "subsets" : [ "http://purl.obolibrary.org/obo/geno#agr_zyg" ], "synonyms" : [ { "pred" : "hasNarrowSynonym", "val" : "homozygous null" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GO_0003674", "lbl" : "molecular_function", "type" : "CLASS", "meta" : { "definition" : { "val" : "A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs.", "xrefs" : [ "GOC:pdt" ] }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This is the same as GO molecular function" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GO_0008150", "lbl" : "biological_process", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological process represents a specific objective that the organism is genetically programmed to achieve. Biological processes are often described by their outcome or ending state, e.g., the biological process of cell division results in the creation of two daughter cells (a divided cell) from a single parent cell. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence." }, "xrefs" : [ { "val" : "Wikipedia:Biological_process" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "biological_process" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/go.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GO_0016301", "lbl" : "kinase activity", "type" : "CLASS", "meta" : { "definition" : { "val" : "Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule.", "xrefs" : [ "ISBN:0198506732" ] }, "xrefs" : [ { "val" : "Reactome:R-HSA-6788855" }, { "val" : "Reactome:R-HSA-6788867" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GO_0032502", "lbl" : "developmental process", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological process whose specific outcome is the progression of an integrated living unit: an anatomical structure (which may be a subcellular structure, cell, tissue, or organ), or organism over time from an initial condition to a later condition. [database_cross_reference: GOC:isa_complete]" } } }, { "id" : "http://purl.obolibrary.org/obo/HP_0000118", "lbl" : "human phenotypic abnormality", "type" : "CLASS", "meta" : { "comments" : [ "pulling in HP 'phenotypic abnormality' root here" ] } }, { "id" : "http://purl.obolibrary.org/obo/HsapDv_0000000", "lbl" : "human life cycle stage", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for imports of human developmental stages from the Human Developmental Stages Ontology." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "A spatiotemporal region encompassing some part of the life cycle of an organism." } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000003", "lbl" : "measurement unit label", "type" : "CLASS", "meta" : { "definition" : { "val" : "A measurement unit label is as a label that is part of a scalar measurement datum and denotes a unit of measure." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "measurement unit label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Examples of measurement unit labels are liters, inches, weight per volume." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: provenance: a term measurement unit was\nproposed for OBI (OBI_0000176) , edited by Chris Stoeckert and\nCristian Cocos, and subsequently moved to IAO where the objective for\nwhich the original term was defined was satisfied with the definition\nof this, different, term." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: review of this term done during during the OBI workshop winter 2009 and the current definition was considered acceptable for use in OBI. If there is a need to modify this definition please notify OBI." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000005", "lbl" : "objective specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A directive information entity that describes an intended process endpoint. When part of a plan specification the concretization is realized in a planned process in which the bearer tries to effect the world so that the process endpoint is achieved." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "objective specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "In the protocol of a ChIP assay the objective specification says to identify protein and DNA interaction." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: original definition when imported from OBI read: \"objective is an non realizable information entity which can serve as that proper part of a plan towards which the realization of the plan is directed.\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2014-03-31: In the example of usage (\"In the protocol of a ChIP assay the objective specification says to identify protein and DNA interaction\") there is a protocol which is the ChIP assay protocol. In addition to being concretized on paper, the protocol can be concretized as a realizable entity, such as a plan that inheres in a person. The objective specification is the part that says that some protein and DNA interactions are identified. This is a specification of a process endpoint: the boundary in the process before which they are not identified and after which they are. During the realization of the plan, the goal is to get to the point of having the interactions, and participants in the realization of the plan try to do that." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Answers the question, why did you do this experiment?" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Barry Smith" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "goal specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI Plan and Planned Process/Roles Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000217" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000007", "lbl" : "action specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A directive information entity that describes an action the bearer will take." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Pour the contents of flask 1 into flask 2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI Plan and Planned Process branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000009", "lbl" : "datum label", "type" : "CLASS", "meta" : { "definition" : { "val" : "A label is a symbol that is part of some other datum and is used to either partially define the denotation of that datum or to provide a means for identifying the datum as a member of the set of data with the same label" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "datum label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "http://www.golovchenko.org/cgi-bin/wnsearch?q=label#4n" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: IAO" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "9/22/11 BP: changed the rdfs:label for this class from 'label' to 'datum label' to convey that this class is not intended to cover all kinds of labels (stickers, radiolabels, etc.), and not even all kind of textual labels, but rather the kind of labels occuring in a datum. \n" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000010", "lbl" : "software", "type" : "CLASS", "meta" : { "definition" : { "val" : "Software is a plan specification composed of a series of instructions that can be \ninterpreted by or directly executed by a processing unit." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "software" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "see sourceforge tracker discussion at http://sourceforge.net/tracker/index.php?func=detail&aid=1958818&group_id=177891&atid=886178" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000015", "lbl" : "information carrier", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality of an information bearer that imparts the information content" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "information carrier" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "In the case of a printed paperback novel the physicality of the ink and of the paper form part of the information bearer. The qualities of appearing black and having a certain pattern for the ink and appearing white for the paper form part of the information carrier in this case." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "12/15/09: There is a concern that some ways that carry information may be processes rather than qualities, such as in a 'delayed wave carrier'." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2014-03-10: We are not certain that all information carriers are qualities. There was a discussion of dropping it." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Smith, Ceusters, Ruttenberg, 2000 years of philosophy" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000027", "lbl" : "data item", "type" : "CLASS", "meta" : { "definition" : { "val" : "An information content entity that is intended to be a truthful statement about something (modulo, e.g., measurement precision or other systematic errors) and is constructed/acquired by a method which reliably tends to produce (approximately) truthful statements." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data item" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Data items include counts of things, analyte concentrations, and statistical summaries." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2/2/2009 Alan and Bjoern discussing FACS run output data. This is a data item because it is about the cell population. Each element records an event and is typically further composed a set of measurment data items that record the fluorescent intensity stimulated by one of the lasers." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: data item deliberatly ambiguous: we merged data set and datum to be one entity, not knowing how to define singular versus plural. So data item is more general than datum." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: removed datum as alternative term as datum specifically refers to singular form, and is thus not an exact synonym." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2014-03-31: See discussion at http://odontomachus.wordpress.com/2014/03/30/aboutness-objects-propositions/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "JAR: datum -- well, this will be very tricky to define, but maybe some \ninformation-like stuff that might be put into a computer and that is \nmeant, by someone, to denote and/or to be interpreted by some \nprocess... I would include lists, tables, sentences... I think I might \ndefer to Barry, or to Brian Cantwell Smith\n\nJAR: A data item is an approximately justified approximately true approximate belief" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jonathan Rees" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000030", "lbl" : "information content entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "an information content entity is an entity that is generically dependent on some artifact and stands in relation of aboutness to some entity" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "information content entity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Examples of information content entites include journal articles, data, graphical layouts, and graphs." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2014-03-10: The use of \"thing\" is intended to be general enough to include universals and configurations (see https://groups.google.com/d/msg/information-ontology/GBxvYZCk1oc/-L6B5fSBBTQJ)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "information_content_entity 'is_encoded_in' some digital_entity in obi before split (040907). information_content_entity 'is_encoded_in' some physical_document in obi before split (040907).\n\nPrevious. An information content entity is a non-realizable information entity that 'is encoded in' some digital or physical entity." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000142" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000033", "lbl" : "directive information entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "An information content entity whose concretizations indicate to their bearer how to realize them in a process." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: provenance: a term realizable information entity was proposed for OBI (OBI_0000337) , edited by the PlanAndPlannedProcess branch. Original definition was \"is the specification of a process that can be concretized and realized by an actor\" with alternative term \"instruction\".It has been subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definitionof this, different, term." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2013-05-30 Alan Ruttenberg: What differentiates a directive information entity from an information concretization is that it can have concretizations that are either qualities or realizable entities. The concretizations that are realizable entities are created when an individual chooses to take up the direction, i.e. has the intention to (try to) realize it." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "8/6/2009 Alan Ruttenberg: Changed label from \"information entity about a realizable\" after discussions at ICBO" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Werner pushed back on calling it realizable information entity as it isn't realizable. However this name isn't right either. An example would be a recipe. The realizable entity would be a plan, but the information entity isn't about the plan, it, once concretized, *is* the plan. -Alan" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000037", "lbl" : "dot plot", "type" : "CLASS", "meta" : { "definition" : { "val" : "A dot plot is a report graph which is a graphical representation of data where each data point is represented by a single dot placed on coordinates corresponding to data point values in particular dimensions." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "dot plot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Dot plot of SSC-H and FSC-H." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000002" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Allyson Lister" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000038", "lbl" : "graph", "type" : "CLASS", "meta" : { "definition" : { "val" : "A diagram that presents one or more tuples of information by mapping those tuples in to a two dimensional space in a non arbitrary way." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "graph" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Lawrence Hunter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Allyson Lister" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000240" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000064", "lbl" : "algorithm", "type" : "CLASS", "meta" : { "definition" : { "val" : "A plan specification which describes the inputs and output of mathematical functions as well as workflow of execution for achieving an predefined objective. Algorithms are realized usually by means of implementation as computer programs for execution by automata." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "algorithm" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "PMID: 18378114.Genomics. 2008 Mar 28. LINKGEN: A new algorithm to process data in genetic linkage studies." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PlanAndPlannedProcess Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000270" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "adapted from discussion on OBI list (Matthew Pocock, Christian Cocos, Alan Ruttenberg)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000078", "lbl" : "curation status specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "The curation status of the term. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "curation status specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Better to represent curation as a process with parts and then relate labels to that process (in IAO meeting)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bill Bug" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000266" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000096", "lbl" : "source code module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A source code module is a directive information entity that specifies, using a programming language, some algorithm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "source code module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The written source code that implements part of an algorithm. Test - if you know that it was written in a specific language, then it can be source code module. We mean here, roughly, the wording of a document such as a perl script." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000039" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000098", "lbl" : "data format specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A data format specification is the information content borne by the document published defining the specification.\nExample: The ISO document specifying what encompasses an XML document; The instructions in a XSD file" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data format specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: provenance: term imported from OBI_0000187, which had original definition \"A data format specification is a plan which organizes\ninformation. Example: The ISO document specifying what encompasses an\nXML document; The instructions in a XSD file\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PlanAndPlannedProcess Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI branch derived" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000187" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000100", "lbl" : "data set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A data item that is an aggregate of other data items of the same type that have something in common. Averages and distributions can be determined for data sets." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data set" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Intensity values in a CEL file or from multiple CEL files comprise a data set (as opposed to the CEL files themselves)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009/10/23 Alan Ruttenberg. The intention is that this term represent collections of like data. So this isn't for, e.g. the whole contents of a cel file, which includes parameters, metadata etc. This is more like java arrays of a certain rather specific type" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2014-05-05: Data sets are aggregates and thus must include two or more data items. We have chosen not to add logical axioms to make this restriction." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Allyson Lister" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000042" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000101", "lbl" : "image", "type" : "CLASS", "meta" : { "definition" : { "val" : "An image is an affine projection to a two dimensional surface, of measurements of some quality of an entity or entities repeated at regular intervals across a spatial range, where the measurements are represented as color and luminosity on the projected on surface." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "image" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Allyson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000030" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000102", "lbl" : "data about an ontology part", "type" : "CLASS", "meta" : { "definition" : { "val" : "Data about an ontology part is a data item about a part of an ontology, for example a term" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data about an ontology part" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ontology metadata" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000104", "lbl" : "plan specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A directive information entity with action specifications and objective specifications as parts that, when concretized, is realized in a process in which the bearer tries to achieve the objectives by taking the actions specified." }, "comments" : [ "2/3/2009 Comment from OBI review.\n\nAction specification not well enough specified.\nConditional specification not well enough specified.\nQuestion whether all plan specifications have objective specifications.\n\nRequest that IAO either clarify these or change definitions not to use them" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "plan specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "PMID: 18323827.Nat Med. 2008 Mar;14(3):226.New plan proposed to help resolve conflicting medical advice." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-03-16: provenance: a term a plan was proposed for OBI (OBI_0000344) , edited by the PlanAndPlannedProcess branch. Original definition was \" a plan is a specification of a process that is realized by an actor to achieve the objective specified as part of the plan\". It has been subsequently moved to IAO where the objective for which the original term was defined was satisfied with the definitionof this, different, term." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2014-03-31: A plan specification can have other parts, such as conditional specifications." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Alternative previous definition: a plan is a set of instructions that specify how an objective should be achieved" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI Plan and Planned Process branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000344" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000178", "lbl" : "material information bearer", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity in which a concretization of an information content entity inheres." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material information bearer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A page of a paperback novel with writing on it. The paper itself is a material information bearer, the pattern of ink is the information carrier." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a brain" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a hard drive" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: IAO" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000179", "lbl" : "histogram", "type" : "CLASS", "meta" : { "definition" : { "val" : "A histogram is a report graph which is a statistical description of a\ndistribution in terms of occurrence frequencies of different event classes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "histogram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000180", "lbl" : "heatmap", "type" : "CLASS", "meta" : { "definition" : { "val" : "A heatmap is a report graph which is a graphical representation of data\nwhere the values taken by a variable(s) are shown as colors in a\ntwo-dimensional map." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "heatmap" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000183", "lbl" : "dendrogram", "type" : "CLASS", "meta" : { "definition" : { "val" : "A dendrogram is a report graph which is a tree diagram\nfrequently used to illustrate the arrangement of the clusters produced by a\nclustering algorithm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "dendrogram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Dendrograms are often used in computational biology to\nillustrate the clustering of genes." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://en.wikipedia.org/wiki/Dendrogram" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000184", "lbl" : "scatter plot", "type" : "CLASS", "meta" : { "definition" : { "val" : "A scatterplot is a graph which uses Cartesian coordinates to display values for two variables for a set of data. The data is displayed as a collection of points, each having the value of one variable determining the position on the horizontal axis and the value of the other variable determining the position on the vertical axis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "scatter plot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Comparison of gene expression values in two samples can be displayed in a scatter plot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Chris Stoeckert" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "scattergraph" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://en.wikipedia.org/wiki/Scatterplot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000225", "lbl" : "obsolescence reason specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "The reason for which a term has been deprecated. The allowed values come from an enumerated list of predefined terms. See the specification of these instances for more detailed definitions of each enumerated value." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "obsolescence reason specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The creation of this class has been inspired in part by Werner Ceusters' paper, Applying evolutionary terminology auditing to the Gene Ontology." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000308", "lbl" : "figure", "type" : "CLASS", "meta" : { "definition" : { "val" : "An information content entity consisting of a two dimensional arrangement of information content entities such that the arrangement itself is about something." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "figure" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Any picture, diagram or table" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Lawrence Hunter" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000309", "lbl" : "diagram", "type" : "CLASS", "meta" : { "definition" : { "val" : "A figure that expresses one or more propositions" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "diagram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A molecular structure ribbon cartoon showing helices, turns and sheets and their relations to each other in space." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Lawrence Hunter" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000310", "lbl" : "document", "type" : "CLASS", "meta" : { "definition" : { "val" : "A collection of information content entities intended to be understood together as a whole" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "document" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A journal article, patent application, laboratory notebook, or a book" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Lawrence Hunter" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000409", "lbl" : "denotator type", "type" : "CLASS", "meta" : { "definition" : { "val" : "A denotator type indicates how a term should be interpreted from an ontological perspective." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "denotator type" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The Basic Formal Ontology ontology makes a distinction between Universals and defined classes, where the formal are \"natural kinds\" and the latter arbitrary collections of entities." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Barry Smith, Werner Ceusters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000000", "lbl" : "ontology module", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "I have placed this under 'data about an ontology part', but this can be discussed. I think this is OK if 'part' is interpreted reflexively, as an ontology module is the whole ontology rather than part of it." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ontology file" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "This class and it's subclasses are applied to OWL ontologies. Using an rdf:type triple will result in problems with OWL-DL. I propose that dcterms:type is instead used to connect an ontology URI with a class from this hierarchy. The class hierarchy is not disjoint, so multiple assertions can be made about a single ontology." } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000001", "lbl" : "base ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that comprises only of asserted axioms local to the ontology, excludes import directives, and excludes axioms or declarations from external ontologies." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "base ontology module" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "https://github.com/INCATools/ontology-starter-kit/issues/50" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000002", "lbl" : "editors ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that is intended to be directly edited, typically managed in source control, and typically not intended for direct consumption by end-users." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editors ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "source ontology module" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000003", "lbl" : "main release ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that is intended to be the primary release product and the one consumed by the majority of tools." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "main release ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "TODO: Add logical axioms that state that a main release ontology module is derived from (directly or indirectly) an editors module" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000004", "lbl" : "bridge ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that consists entirely of axioms that connect or bridge two distinct ontology modules. For example, the Uberon-to-ZFA bridge module." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "bridge ontology module" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "https://github.com/obophenotype/uberon/wiki/inter-anatomy-ontology-bridge-ontologies" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000005", "lbl" : "import ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A subset ontology module that is intended to be imported from another ontology." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "import ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "TODO: add axioms that indicate this is the output of a module extraction process." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "import file" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://robot.obolibrary.org/extract" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000006", "lbl" : "subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that is extracted from a main ontology module and includes only a subset of entities or axioms." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "subset ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ontology slim" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "subset ontology" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://robot.obolibrary.org/filter" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://www.geneontology.org/page/go-slim-and-subset-guide" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000007", "lbl" : "curation subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A subset ontology that is intended as a whitelist for curators using the ontology. Such a subset will exclude classes that curators should not use for curation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "curation subset ontology module" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000008", "lbl" : "analysis subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that is intended for usage in analysis or discovery applications." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "analysis ontology module" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000009", "lbl" : "single layer subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A subset ontology that is largely comprised of a single layer or strata in an ontology class hierarchy. The purpose is typically for rolling up for visualization. The classes in the layer need not be disjoint." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "single layer ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ribbon subset" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000010", "lbl" : "exclusion subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A subset of an ontology that is intended to be excluded for some purpose. For example, a blacklist of classes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "exclusion subset ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "antislim" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000011", "lbl" : "external import ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An imported ontology module that is derived from an external ontology. Derivation methods include the OWLAPI SLME approach." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "external import ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "external import" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000012", "lbl" : "species subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A subset ontology that is crafted to either include or exclude a taxonomic grouping of species." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "species subset ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "taxon subset" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "https://github.com/obophenotype/uberon/wiki/Taxon-constraints" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000013", "lbl" : "reasoned ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that contains axioms generated by a reasoner. The generated axioms are typically direct SubClassOf axioms, but other possibilities are available." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "reasoned ontology module" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://robot.obolibrary.org/reason" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000014", "lbl" : "generated ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that is automatically generated, for example via a SPARQL query or via template and a CSV." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "generated ontology module" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "TODO: Add axioms (using PROV-O?) that indicate this is the output-of some reasoning process" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000015", "lbl" : "template generated ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "An ontology module that is automatically generated from a template specification and fillers for slots in that template." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "template generated ontology module" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://robot.obolibrary.org/template" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "https://doi.org/10.1186/s13326-017-0126-0" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "https://github.com/dosumis/dead_simple_owl_design_patterns/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000016", "lbl" : "taxonomic bridge ontology module", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "taxonomic bridge ontology module" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000017", "lbl" : "ontology module subsetted by expressivity", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ontology module subsetted by expressivity" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000018", "lbl" : "obo basic subset ontology module", "type" : "CLASS", "meta" : { "definition" : { "val" : "A subset ontology that is designed for basic applications to continue to make certain simplifying assumptions; many of these simplifying assumptions were based on the initial version of the Gene Ontology, and have become enshrined in many popular and useful tools such as term enrichment tools.\n\nExamples of such assumptions include: traversing the ontology graph ignoring relationship types using a naive algorithm will not lead to cycles (i.e. the ontology is a DAG); every referenced term is declared in the ontology (i.e. there are no dangling clauses).\n\nAn ontology is OBO Basic if and only if it has the following characteristics:\nDAG\nUnidirectional\nNo Dangling Clauses\nFully Asserted\nFully Labeled\nNo equivalence axioms\nSingly labeled edges\nNo qualifier lists\nNo disjointness axioms\nNo owl-axioms header\nNo imports" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "obo basic subset ontology module" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://owlcollab.github.io/oboformat/doc/obo-syntax.html#6.2" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000019", "lbl" : "ontology module subsetted by OWL profile", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ontology module subsetted by OWL profile" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_8000020", "lbl" : "EL++ ontology module", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "EL++ ontology module" } ] } }, { "id" : "http://purl.obolibrary.org/obo/MP_0000001", "lbl" : "mammalian phenotype", "type" : "CLASS", "meta" : { "comments" : [ "where to place this depends on if we take the organismal view or the quality centric view." ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_10090", "lbl" : "Mus musculus", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Mus musculus" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "house mouse" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mouse" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_10239", "lbl" : "Viruses", "type" : "CLASS", "meta" : { "comments" : [ "Stub class to serve as root of hierarchy for imports of virus types from relevant ontologies or terminologies." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Viruses" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_117571", "lbl" : "Euteleostomi", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Euteleostomi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "bony vertebrates" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_2", "lbl" : "Bacteria", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Bacteria" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "eubacteria" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_2157", "lbl" : "Archaea", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Archaea" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_2759", "lbl" : "Eukaryota", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Eukaryota" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "eucaryotes" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "eukaryotes" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_314146", "lbl" : "Euarchontoglires", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Euarchontoglires" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_32523", "lbl" : "Tetrapoda", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Tetrapoda" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "tetrapods" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_32524", "lbl" : "Amniota", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Amniota" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "amniotes" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_33154", "lbl" : "Opisthokonta", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Opisthokonta" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_33208", "lbl" : "Metazoa", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Metazoa" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "metazoans" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "multicellular animals" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_33213", "lbl" : "Bilateria", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Bilateria" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_39107", "lbl" : "Murinae", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Murinae" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_40674", "lbl" : "Mammalia", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Mammalia" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mammals" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_7742", "lbl" : "Vertebrata ", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Vertebrata " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Vertebrata" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "vertebrates" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_7955", "lbl" : "Danio rerio", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Danio rerio" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "leopard danio" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "zebra danio" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "zebra fish" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "zebrafish" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_8090", "lbl" : "Oryzias latipes", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_9606", "lbl" : "Homo sapiens", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Homo sapiens" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "human" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "human being" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/NCBITaxon_9989", "lbl" : "Rodentia", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Rodentia" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "rodent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ncbitaxon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000011", "lbl" : "planned process", "type" : "CLASS", "meta" : { "definition" : { "val" : "A processual entity that realizes a plan which is the concretization of a plan specification." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "planned process" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "planned process" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Injecting mice with a vaccine in order to test its efficacy" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "'Plan' includes a future direction sense. That can be problematic if plans are changed during their execution. There are however implicit contingencies for protocols that an agent has in his mind that can be considered part of the plan, even if the agent didn't have them in mind before. Therefore, a planned process can diverge from what the agent would have said the plan was before executing it, by adjusting to problems encountered during execution (e.g. choosing another reagent with equivalent properties, if the originally planned one has run out.)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for experimental techniques and processes, defined in GENO or imported from ontologies such as OBI and ERO." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We are only considering successfully completed planned processes. A plan may be modified, and details added during execution. For a given planned process, the associated realized plan specification is the one encompassing all changes made during execution. This means that all processes in which an agent acts towards achieving some \nobjectives is a planned process." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "branch derived" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "6/11/9: Edited at workshop. Used to include: is initiated by an agent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "This class merges the previously separated objective driven process and planned process, as they the separation proved hard to maintain. (1/22/09, branch call)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/obi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000014", "lbl" : "regulator role", "type" : "CLASS", "meta" : { "definition" : { "val" : "a regulatory role involved with making and/or enforcing relevant legislation and governmental orders" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "regulator role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Fact sheet - Regulating the companies The role of the regulator. Ofwat is the economic regulator of the water and sewerage industry in England and Wales. http://www.ofwat.gov.uk/aptrix/ofwat/publish.nsf/Content/roleofregulator_factsheet170805" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "regulator" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000017", "lbl" : "regulatory role", "type" : "CLASS", "meta" : { "definition" : { "val" : "a role which inheres in material entities and is realized in the processes of making, enforcing or being defined by legislation or orders issued by a governmental body." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "regulatory role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Regulatory agency, Ethics committee, Approval letter; example: Browse these EPA Regulatory Role subtopics http://www.epa.gov/ebtpages/enviregulatoryrole.html Feb 29, 2008" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: Role branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI, CDISC" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "govt agents responsible for creating regulations; proxies for enforcing regulations. CDISC definition: regulatory authorities. Bodies having the power to regulate. NOTE: In the ICH GCP guideline the term includes the authorities that review submitted clinical data and those that conduct inspections. These bodies are sometimes referred to as competent" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000018", "lbl" : "material supplier role", "type" : "CLASS", "meta" : { "definition" : { "val" : "a role realized through the process of supplying materials such as animal subjects, reagents or other materials used in an investigation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material supplier role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Jackson Labs is an organization which provide mice as experimental material" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Supplier role is a special kind of service, e.g. biobank" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "material provider role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "supplier" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000023", "lbl" : "classified data set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A data set that is produced as the output of a class prediction data transformation and consists of a data set with assigned class labels." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "classified data set" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Monnie McGee" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data set with assigned class labels" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000047", "lbl" : "processed material", "type" : "CLASS", "meta" : { "definition" : { "val" : "Is a material entity that is created or changed during material processing." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "processed material" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Examples include gel matrices, filter paper, parafilm and buffer solutions, mass spectrometer, tissue samples" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000079", "lbl" : "culture medium", "type" : "CLASS", "meta" : { "definition" : { "val" : "a processed material that provides the needed nourishment for microorganisms or cells grown in vitro." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "culture medium" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A growth medium or culture medium is a substance in which microorganisms or cells can grow. Wikipedia, growth medium, Feb 29, 2008" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "changed from a role to a processed material based on on Aug 22, 2011 dev call. Details see the tracker item: http://sourceforge.net/tracker/?func=detail&aid=3325270&group_id=177891&atid=886178\nModification made by JZ." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Jennifer Fostel, Jie Zheng" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000086", "lbl" : "reagent role", "type" : "CLASS", "meta" : { "definition" : { "val" : "A role inhering in a biological or chemical entity that is intended to be applied in a scientific technique to participate (or have molecular components that participate) in a chemical reaction that facilitates the generation of data about some entity distinct from the bearer, or the generation of some specified material output distinct from the bearer." }, "comments" : [ "(copied from ReO)\nReagents are distinguished from instruments or devices that also participate in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in or have parts that participate in some chemical interaction or reaction during their intended participation in some technique. By contrast, instruments do not participate in a chemical reaction/interaction during the technique.\n\nReagents are distinguished from study subjects/evaluants in that study subjects and evaluants are that about which conclusions are drawn and knowledge is sought in an investigation - while reagents, by definition, are not. It should be noted, however, that reagent and study subject/evaluant roles can be borne by instances of the same type of material entity - but a given instance will realize only one of these roles in the execution of a given assay or technique. For example, taq polymerase can bear a reagent role or an evaluant role. In a DNA sequencing assay aimed at generating sequence data about some plasmid, the reagent role of the taq polymerase is realized. In an assay to evaluate the quality of the taq polymerase itself, the evaluant/study subject role of the taq is realized, but not the reagent role since the taq is the subject about which data is generated.\n\nIn regard to the statement that reagents are 'distinct' from the specified outputs of a technique, note that a reagent may be incorporated into a material output of a technique, as long as the IDENTITY of this output is distinct from that of the bearer of the reagent role. For example, dNTPs input into a PCR are reagents that become part of the material output of this technique, but this output has a new identity (ie that of a 'nucleic acid molecule') that is distinct from the identity of the dNTPs that comprise it. Similarly, a biotin molecule input into a cell labeling technique are reagents that become part of the specified output, but the identity of the output is that of some modified cell specimen which shares identity with the input unmodified cell specimen, and not with the biotin label. Thus, we see that an important criteria of 'reagent-ness' is that it is a facilitator, and not the primary focus of an investigation or material processing technique (ie not the specified subject/evaluant about which knowledge is sought, or the specified output material of the technique)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "reagent role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Buffer, dye, a catalyst, a solvating agent." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "reagent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON:Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "Feb 10, 2009. changes after discussion at OBI Consortium Workshop Feb 2-6, 2009. accepted as core term.\n\nMay 28 2013. Updated definition taken from ReO based on discussions initiated in Philly 2011 workshop. Former defnition described a narrower view of reagents in chemistry that restricts bearers of the role to be chemical entities (\"a role played by a molecular entity used to produce a chemical reaction to detect, measure, or produce other substances\"). Updated definition allows for broader view of reagents in the domain of biomedical research to include larger materials that have parts that participate chemically in a molecular reaction or interaction.\n" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000094", "lbl" : "material processing", "type" : "CLASS", "meta" : { "definition" : { "val" : "A planned process which results in physical changes in a specified input material" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material processing" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A cell lysis, production of a cloning vector, creating a buffer." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Frank Gibson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "material transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI branch derived" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000112", "lbl" : "specimen role", "type" : "CLASS", "meta" : { "definition" : { "val" : "a role borne by a material entity that is gained during a specimen collection process and that can be realized by use of the specimen in an investigation" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "specimen role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "liver section; a portion of a culture of cells; a nemotode or other animal once no longer a subject (generally killed); portion of blood from a patient." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "22Jun09. The definition includes whole organisms, and can include a human. The link between specimen role and study subject role has been removed. A specimen taken as part of a case study is not considered to be a population representative, while a specimen taken as representing a population, e.g. person taken from a cohort, blood specimen taken from an animal) would be considered a population representative and would also bear material sample role." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "blood taken from animal: animal continues in study, whereas blood has role specimen.\nsomething taken from study subject, leaves the study and becomes the specimen." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "parasite example\n- when parasite in people we study people, people are subjects and parasites are specimen\n- when parasite extracted, they become subject in the following study\nspecimen can later be subject." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: Role Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/obi-ontology/obi/issues/1013" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000181", "lbl" : "population", "type" : "CLASS", "meta" : { "definition" : { "val" : "a population is a collection of individuals from the same taxonomic class living, counted or sampled at a particular site or in a particular area" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "population" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "PMID12564891. Environ Sci Technol. 2003 Jan 15;37(2):223-8. Effects of historic PCB exposures on the reproductive success of the Hudson River striped bass population." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "1/28/2013, BP, on the call it was raised that we may want to switch to an external ontology for all populatin terms: \nhttp://code.google.com/p/popcomm-ontology/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "adapted from Oxford English Dictionnary" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "rem1: collection somehow always involve a selection process" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000245", "lbl" : "organization", "type" : "CLASS", "meta" : { "definition" : { "val" : "An entity that can bear roles, has members, and has a set of organization rules. Members of organizations are either organizations themselves or individual people. Members can bear specific organization member roles that are determined in the organization rules. The organization rules also determine how decisions are made on behalf of the organization by the organization members." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "organization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "PMID: 16353909.AAPS J. 2005 Sep 22;7(2):E274-80. Review. The joint food and agriculture organization of the United Nations/World Health Organization Expert Committee on Food Additives and its role in the evaluation of the safety of veterinary drug residues in foods." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "BP: The definition summarizes long email discussions on the OBI developer, roles, biomaterial and denrie branches. It leaves open if an organization is a material entity or a dependent continuant, as no consensus was reached on that. The current placement as material is therefore temporary, in order to move forward with development. Here is the entire email summary, on which the definition is based:\n\n1) there are organization_member_roles (president, treasurer, branch\neditor), with individual persons as bearers\n\n2) there are organization_roles (employer, owner, vendor, patent holder)\n\n3) an organization has a charter / rules / bylaws, which specify what roles\nthere are, how they should be realized, and how to modify the\ncharter/rules/bylaws themselves.\n\nIt is debatable what the organization itself is (some kind of dependent\ncontinuant or an aggregate of people). This also determines who/what the\nbearer of organization_roles' are. My personal favorite is still to define\norganization as a kind of 'legal entity', but thinking it through leads to\nall kinds of questions that are clearly outside the scope of OBI.\n\nInterestingly enough, it does not seem to matter much where we place\norganization itself, as long as we can subclass it (University, Corporation,\nGovernment Agency, Hospital), instantiate it (Affymetrix, NCBI, NIH, ISO,\nW3C, University of Oklahoma), and have it play roles.\n\nThis leads to my proposal: We define organization through the statements 1 -\n3 above, but without an 'is a' statement for now. We can leave it in its\ncurrent place in the is_a hierarchy (material entity) or move it up to\n'continuant'. We leave further clarifications to BFO, and close this issue\nfor now." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Susanna Sansone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000450", "lbl" : "regulatory agency", "type" : "CLASS", "meta" : { "definition" : { "val" : "A regulatory agency is a organization that has responsibility over or for the legislation (acts and regulations) for a given sector of the government." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "regulatory agency" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The US Environmental Protection Agency" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: OBI Biomaterial Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: en.wikipedia.org/wiki/Regulator" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000456", "lbl" : "material transformation objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "an objective specifiction that creates an specific output object from input materials." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material transformation objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The objective to create a mouse infected with LCM virus. The objective to create a defined solution of PBS." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Frank Gibson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "artifact creation objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI PlanAndPlannedProcess Branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000457", "lbl" : "manufacturing", "type" : "CLASS", "meta" : { "definition" : { "val" : "Manufacturing is a process with the intent to produce a processed material which will have a function for future use. A person or organization (having manufacturer role) is a participant in this process" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "manufacturing" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Manufacturing implies reproducibility and responsibility AR" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This includes a single scientist making a processed material for personal use." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Frank Gibson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI PlanAndPlannedProcess Branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000458", "lbl" : "manufacturing objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "is the objective to manufacture a material of a certain function (device)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "manufacturing objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Frank Gibson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI PlanAndPlannedProcess Branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000571", "lbl" : "manufacturer role", "type" : "CLASS", "meta" : { "definition" : { "val" : "Manufacturer role is a role which inheres in a person or organization and which is realized by a manufacturing process." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "manufacturer role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "With respect to The Accuri C6 Flow Cytometer System, the organization Accuri bears the role manufacturer role. With respect to a transformed line of tissue culture cells derived by a specific lab, the lab whose personnel isolated the cll line bears the role manufacturer role. With respect to a specific antibody produced by an individual scientist, the scientist who purifies, characterizes and distributes the anitbody bears the role manufacturer role." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: Role Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000639", "lbl" : "material separation objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "is an objective to transform a material entity into spatially separated components." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material separation objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The objective to obtain multiple aliquots of an enzyme preparation. The objective to obtain cells contained in a sample of blood." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PPPB branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PPPB branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000648", "lbl" : "clustered data set", "type" : "CLASS", "meta" : { "definition" : { "val" : "A data set that is produced as the output of a class discovery data transformation and consists of a data set with assigned discovered class labels." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "clustered data set" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A clustered data set is the output of a K means clustering data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Monnie McGee" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data set with assigned discovered class labels" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "AR thinks could be a data item instead" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000659", "lbl" : "specimen collection process", "type" : "CLASS", "meta" : { "definition" : { "val" : "A planned process with the objective of collecting a specimen." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "specimen collection process" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "drawing blood from a patient for analysis, collecting a piece of a plant for depositing in a herbarium, buying meat from a butcher in order to measure its protein content in an investigation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Philly2013: A specimen collection can have as part a material entity acquisition, such as ordering from a bank. The distinction is that specimen collection necessarily involves the creation of a specimen role. However ordering cell lines cells from ATCC for use in an investigation is NOT a specimen collection, because the cell lines already have a specimen role." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Philly2013: The specimen_role for the specimen is created during the specimen collection process." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "label changed to 'specimen collection process' on 10/27/2014, details see tracker:\nhttp://sourceforge.net/p/obi/obi-terms/716/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "specimen collection" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "5/31/2012: This process is not necessarily an acquisition, as specimens may be collected from materials already in posession" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "6/9/09: used at workshop" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000663", "lbl" : "class prediction data transformation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A class prediction data transformation (sometimes called supervised classification) is a data transformation that has objective class prediction." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "class prediction data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "supervised classification data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000678", "lbl" : "portioning objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material separation objective aiming to separate material into multiple portions, each of which contains a similar composition of the input material." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "portioning objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The objective to obtain multiple aliquots of an enzyme preparation." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000681", "lbl" : "separation into different composition objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material separation objective aiming to separate a material entity that has parts of different types, and end with at least one output that is a material with parts of fewer types (modulo impurities)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "separation into different composition objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The objective to obtain cells contained in a sample of blood." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We should be using has the grain relations or concentrations to distinguish the portioning and other sub-objectives" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000684", "lbl" : "specimen collection objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A objective specification to obtain a material entity for potential use as an input during an investigation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "specimen collection objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The objective to collect bits of excrement in the rainforest. The objective to obtain a blood sample from a patient." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000700", "lbl" : "support vector machine", "type" : "CLASS", "meta" : { "definition" : { "val" : "A support vector machine is a data transformation with a class prediction objective based on the construction of a separating hyperplane that maximizes the margin between two data sets of vectors in n-dimensional space." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "support vector machine" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Ryan Brinkman" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "SVM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Ryan Brinkman" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000704", "lbl" : "decision tree induction objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A decision tree induction objective is a data transformation objective in which a tree-like graph of edges and nodes is created and from which the selection of each branch requires that some type of logical decision is made." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "decision tree induction objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000707", "lbl" : "decision tree building data transformation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A decision tree building data transformation is a data transformation that has objective decision tree induction." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "decision tree building data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000713", "lbl" : "GenePattern software", "type" : "CLASS", "meta" : { "definition" : { "val" : "a software that provides access to more than 100 tools for gene expression analysis, proteomics, SNP analysis and common data processing tasks." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern software" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Helen Parkinson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://www.broadinstitute.org/cancer/software/genepattern/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000726", "lbl" : "peak matching", "type" : "CLASS", "meta" : { "definition" : { "val" : "Peak matching is a data transformation performed on a dataset of a graph of ordered data points (e.g. a spectrum) with the objective of pattern matching local maxima above a noise threshold" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "peak matching" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Ryan Brinkman" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Ryan Brinkman" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000727", "lbl" : "k-nearest neighbors", "type" : "CLASS", "meta" : { "definition" : { "val" : "A k-nearest neighbors is a data transformation which achieves a class discovery or partitioning objective, in which an input data object with vector y is assigned to a class label based upon the k closest training data set points to y; where k is the largest value that class label is assigned." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "k-nearest neighbors" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "k-NN" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000749", "lbl" : "CART", "type" : "CLASS", "meta" : { "definition" : { "val" : "A CART (classification and regression trees) is a data transformation method for producing a classification or regression model with a tree-based structure." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "CART" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "classification and regression trees" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "BOOK: David J. Hand, Heikki Mannila and Padhraic Smyth (2001) Principles of Data Mining." } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000792", "lbl" : "statistical model validation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A data transformation which assesses how the results of a statistical analysis will generalize to an independent data set." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "statistical model validation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Using the expression levels of 20 proteins to predict whether a cancer patient will respond to a drug. A practical goal would be to determine which subset of the 20 features should be used to produce the best predictive model. - wikipedia" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Helen Parkinson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://en.wikipedia.org/wiki/Cross-validation_%28statistics%29" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000806", "lbl" : "material maintenance objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "An objective specification maintains some or all of the qualities of a material over time." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material maintenance objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000835", "lbl" : "manufacturer", "type" : "CLASS", "meta" : { "definition" : { "val" : "A person or organization that has a manufacturer role" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "manufacturer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000838", "lbl" : "material maintenance", "type" : "CLASS", "meta" : { "definition" : { "val" : "a process with that achieves the objective to maintain some or all of the characteristics of an input material over time" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material maintenance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000947", "lbl" : "service provider role", "type" : "CLASS", "meta" : { "definition" : { "val" : "is a role which inheres in a person or organization and is realized in in a planned process which provides access to training, materials or execution of protocols for an organization or person" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "service provider role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Jackson Lab provides experimental animals, EBI provides training on databases, a core facility provides access to a DNA sequencer." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Helen Parkinson" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000953", "lbl" : "processed specimen", "type" : "CLASS", "meta" : { "definition" : { "val" : "A specimen that has been intentionally physically modified." }, "comments" : [ "A tissue sample that has been sliced and stained for a histology study." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "processed specimen" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A tissue sample that has been sliced and stained for a histology study.\nA blood specimen that has been centrifuged to obtain the white blood cells." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000963", "lbl" : "categorical label", "type" : "CLASS", "meta" : { "definition" : { "val" : "A label that is part of a categorical datum and that indicates the value of the data item on the categorical scale." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "categorical label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The labels 'positive' vs. 'negative', or 'left handed', 'right handed', 'ambidexterous', or 'strongly binding', 'weakly binding' , 'not binding', or '+++', '++', '+', '-' etc. form scales of categorical labels. " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001000", "lbl" : "questionnaire", "type" : "CLASS", "meta" : { "definition" : { "val" : "A document with a set of printed or written questions with a choice of answers, devised for the purposes of a survey or statistical study." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "questionnaire" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "JT: It plays a role in collecting data that could be fleshed out more; but I'm thinking it is, in itself, an edited document. \nJZ: based on textual definition of edited document, it can be defined as N&S. I prefer to leave questionnaire as a document now. We can add more restrictions in the future and use that to determine it is an edited document or not. " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Need to clarify if this is a document or a directive information entity (or what their connection is))" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Jessica Turner" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Merriam-Webster" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001866", "lbl" : "secondary cultured cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cultured cell that has been passaged or derives from a cell that has been passaged in culture. " }, "comments" : [ "A secondary cultured cell has been passaged in culture or is a descendant of such a cell that is derived through propagation in culture." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "secondary cultured cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The term 'secondary cell culture' is generally used in biological texts/protocols to refer to any culture following an initial passage. We include it here because there are often a number of passages between a primary culture and the establishment of a stable, homogenous cell line. Such cultures are considered to be 'secondary cultures' but not 'cell lines' during this intermediate passaging/selection period between their derivation from a 'primary cell culture' and derivation into a 'cell line', which is a more specific type of secondary culture." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001867", "lbl" : "establishing cell line", "type" : "CLASS", "meta" : { "definition" : { "val" : "a process whereby a new type of cell line is created, either through passaging of a primary cell culture to relative genetic stability and compositional homogeneity, or through some experimental modification of an existing cell line to produce a new line with novel characteristics (e.g. immortalization or some other stable genetic modification, or selection of some defined subset)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "establishing cell line" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2013-4-20 MHB: For cases of initial establilshment of a line from a primary culture, successive passaging and/or selection processes can confer increasing degrees of genetic stability and compositional homogeneity as compared to the input primary culture. Historically, many texts consider the first passage as the clearest point to define the beginning of a line. However, in practice it is more often that case that more than one passage, and possibly additional selective techniques, may be required before a culture is deemed to have sufficient stability and homogeneity to be considered cell line. This is the view taken in OBI. Regardless, what is important is that some intentional, experimental step has been taken to establish a more homogenous and stable culture that can be characterized and progatated over time." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON:Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001879", "lbl" : "reagent", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological or chemical entity that bears a reagent role in virtue of it being intended for application in a scientific technique to participate in (or have molecular parts that participate in) a chemical reaction that facilitates the generation of data about some distinct entity, or the generation of some distinct material specified output." }, "comments" : [ "(copied from ReO)\nReagents are distinguished from devices/instruments that also serve as facilitators in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in or have parts that participate in some chemical interaction or reaction during their intended participation in some technique. By contrast, devices do not participate in a chemical reaction/interaction during the technique.\n\nReagents are distinguished from study subjects/evaluants in that study subjects and evaluants are that about which conclusions are drawn and knowledge is sought in an investigation - while reagents, by definition, are not. It should be noted, however, that reagent and study subject/evaluant roles can be borne by instances of the same type of material entity - but a given instance can only realize one of these roles in the execution of a given assay. For example, taq polymerase can bear a reagent role or an evaluant role. In a DNA sequencing assay aimed at generating sequence data about some plasmid, the reagent role of the taq polymerase is realized. In an assay to evaluate the quality of the taq polymerase itself, the evaluant/study subject role of the taq is realized, but not the reagent role since the taq is the subject about which data is generated.\n\nIn regard to the statement that reagents are 'distinct' from the specified outputs of a technique: note that a reagent may be incorporated into a material output of a technique, as long as the IDENTITY of this output is distinct from that of the bearer of the reagent role. For example, dNTPs input into a PCR are reagents that become part of the material output of this technique, but this output has a new identity (ie that of a 'nucleic acid molecule') that is distinct from the identity of the dNTPs that comprise it. Similarly, a biotin molecule input into a cell labeling technique are reagents that become part of the specified output, but the identity of the output is that of some modified cell specimen which shares identity with the input unmodified cell specimen, and not with the biotin label. Thus, we see that an important criteria of 'reagent-ness' is that it is a facilitator, and not the primary focus of an investigation or material processing technique (ie not the specified subject/evaluant about which knowledge is sought, or the specified output material of the technique)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "reagent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2013-6-5 MHB: Clarifications regarding the distinction between reagetns and devices were made at the May 2013 Philly Workshop. Reagents are distinguished from devices that also participate in scientific techniques by the fact that reagents are chemical or biological in nature and necessarily participate in some chemical interaction or reaction during the realization of their experimental role. By contrast, devices do not participate in such chemical reactions/interactions. Note that there are cases where devices use reagent components during their operation, where the reagent-device distinction is less clear. For examples, see editor note on OBI:device." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON:Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001905", "lbl" : "secondary cultured cell population", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cultured cell population that is derived through one or more passages in culture." }, "comments" : [ "The concept of a 'secondary cultured cell population' covers cell lines as well as cultured cell populations more immediately derived from a primary culture which have yet to achieve adequate genetic stability and compositional homogeneity to be considered a cell line. The extent of the collection of cells in a 'secondary cultured cell population' is restricted only in that all cell members must share a propagation history (ie be derived through a common lineage of passages from an initial culture). Secondary cultured cell populations can be under active culture, stored in a quiescent state for future use, or applied experimentally." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "secondary cultured cell population" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The term 'secondary cell culture' is generally used in biological texts/protocols to refer to any culture of cells following an initial passage. We include it here because there are often a number of passages between a primary culture and the establishment of a stable, homogenous cell line. Such cultures are considered to be 'secondary cultures' but not 'cell lines' during this intermediate passaging/selection period between their derivation from a 'primary cell culture' and derivation into a 'cell line', which is a more specific type of secondary culture." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "secondary cell culture sample" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON:Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001912", "lbl" : "cell freezing medium", "type" : "CLASS", "meta" : { "definition" : { "val" : "A processed material that serves as a liquid vehicle for freezing cells for long term quiescent stroage, which contains chemicls needed to sustain cell viability across freeze-thaw cycles. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cell freezing medium" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001930", "lbl" : "categorical value specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A value specification that is specifies one category out of a fixed number of nominal categories" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "categorical value specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001933", "lbl" : "value specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "An information content entity that specifies a value within a classification scheme or on a quantitative scale." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "value specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The value of 'positive' in a classification scheme of \"positive or negative\"; the value of '20g' on the quantitative scale of mass." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This term is currently a descendant of 'information content entity', which requires that it 'is about' something. A value specification of '20g' for a measurement data item of the mass of a particular mouse 'is about' the mass of that mouse. However there are cases where a value specification is not clearly about any particular. In the future we may change 'value specification' to remove the 'is about' requirement." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002076", "lbl" : "collection of specimens", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity that has two or more specimens as its parts." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "collection of specimens" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Blood cells collected from multiple donors over the course of a study." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Details see tracker: https://sourceforge.net/p/obi/obi-terms/778/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Chris Stoeckert, Jie Zheng" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBIB, OBI" }, { "pred" : "http://purl.org/dc/elements/1.1/source", "val" : "Biobank" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002205", "lbl" : "histologic grade according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the American Joint Committee on Cancer (AJCC) 7th Edition grading system." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "histologic grade according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "G1:Well differentiated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "G4: Undifferentiated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002210", "lbl" : "histologic grade according to the Fuhrman Nuclear Grading System", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a histologic grade assigned to a tumor slide specimen according to the Fuhrman Nuclear Grading System." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "histologic grade according to the Fuhrman Nuclear Grading System" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Histologic Grade (Fuhrman Nuclear Grading System)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002215", "lbl" : "histologic grade for ovarian tumor", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a histologic grade assigned to a ovarian tumor." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "histologic grade for ovarian tumor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002216", "lbl" : "histologic grade for ovarian tumor according to a two-tier grading system", "type" : "CLASS", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor that is from a two-tier histological classification of tumors. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "histologic grade for ovarian tumor according to a two-tier grading system" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002219", "lbl" : "histologic grade for ovarian tumor according to the World Health Organization", "type" : "CLASS", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor that is from a histological classification by the World Health Organization (WHO)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "histologic grade for ovarian tumor according to the World Health Organization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002224", "lbl" : "pathologic primary tumor stage for colon and rectum according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic primary tumor stage for colon and rectum according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pT: Pathologic spread colorectal primary tumor (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002232", "lbl" : "pathologic primary tumor stage for lung according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM American Joint Committee on Cancer (AJCC) version 7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic primary tumor stage for lung according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pT: Pathologic spread lung primary tumor (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002243", "lbl" : "pathologic primary tumor stage for kidney according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic primary tumor stage for kidney according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pT: Pathologic spread kidney primary tumor (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002256", "lbl" : "pathologic primary tumor stage for ovary according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of the primary tumor. TNM pathologic primary tumor findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic primary tumor stage for ovary according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pT: Pathologic spread ovarian primary tumor (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002270", "lbl" : "pathologic lymph node stage for colon and rectum according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of colorectal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic lymph node stage for colon and rectum according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pN: Pathologic spread colon lymph nodes (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002279", "lbl" : "pathologic lymph node stage for lung according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic lymph node stage for lung according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pN: Pathologic spread colon lymph nodes (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002284", "lbl" : "pathologic lymph node stage for kidney according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic lymph node stage for kidney according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pN: Pathologic spread kidney lymph nodes (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002287", "lbl" : "pathologic lymph node stage for ovary according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to staging of regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic lymph node stage for ovary according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pN: Pathologic spread ovarian lymph nodes (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002290", "lbl" : "pathologic distant metastases stage for colon according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of colon cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic distant metastases stage for colon according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "M: colon distant metastases (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002298", "lbl" : "pathologic distant metastases stage for lung according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of lung cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic distant metastases stage for lung according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "M: lung distant metastases (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002306", "lbl" : "pathologic distant metastases stage for kidney according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of renal cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic distant metastases stage for kidney according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "M: kidney distant Metastases (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002310", "lbl" : "pathologic distant metastases stage for ovary according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the TNM AJCC v7 classification system as they pertain to distant metastases. TNM pathologic distant metastasis findings are based on clinical findings supplemented by histopathologic examination of one or more tissue specimens acquired during surgery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pathologic distant metastases stage for ovary according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "M: ovarian distant metastases (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002314", "lbl" : "clinical tumor stage group according to AJCC 7th edition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is an assessment of the stage of a cancer according to the American Joint Committee on Cancer (AJCC) v7 staging systems." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "clinical tumor stage group according to AJCC 7th edition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Clinical tumor stage group (AJCC 7th Edition)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002326", "lbl" : "International Federation of Gynecology and Obstetrics cervical cancer stage value specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is an assessment of the stage of a gynecologic cancer according to the International Federation of Gynecology and Obstetrics (FIGO) staging systems." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "International Federation of Gynecology and Obstetrics cervical cancer stage value specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Clinical FIGO stage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002341", "lbl" : "International Federation of Gynecology and Obstetrics ovarian cancer stage value specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is a pathologic finding about one or more characteristics of ovarian cancer following the rules of the FIGO classification system." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "International Federation of Gynecology and Obstetrics ovarian cancer stage value specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Pathologic Tumor Stage Grouping for ovarian cancer (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002356", "lbl" : "performance status value specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A categorical value specification that is an assessment of a participant's performance status (general well-being and activities of daily life)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "performance status value specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Performance Status Scale" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Performance_status" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002357", "lbl" : "Eastern Cooperative Oncology Group score value specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A performance status value specification designed by the Eastern Cooperative Oncology Group to assess disease progression and its affect on the daily living abilities of the patient." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Eastern Cooperative Oncology Group score value specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ECOG score" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002363", "lbl" : "Karnofsky score vaue specification", "type" : "CLASS", "meta" : { "definition" : { "val" : "A performance status value specification designed for classifying patients 16 years of age or older by their functional impairment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Karnofsky score vaue specification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Karnofsky Score" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002989", "lbl" : "material supplier", "type" : "CLASS", "meta" : { "definition" : { "val" : "A person or organization that provides material supplies to other people or organizations." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material supplier" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Rebecca Jackson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/obi-ontology/obi/issues/1289" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0100010", "lbl" : "Epstein Barr virus transformed B cell", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity which results from viral transformation process using EBV as transformation agent when applied to B-cell entity" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Epstein Barr virus transformed B cell" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "PMID: 8777380. Expression of thyroid peroxidase in EBV-transformed B cell lines using adenovirus.Thyroid. 1996 Feb;6(1):23-8." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Susanna Sansone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI Biomaterial Branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0100026", "lbl" : "organism", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "organism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "animal" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "fungus" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "plant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "virus" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "10/21/09: This is a placeholder term, that should ideally be imported from the NCBI taxonomy, but the high level hierarchy there does not suit our needs (includes plasmids and 'other organisms')" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "13-02-2009:\nOBI doesn't take position as to when an organism starts or ends being an organism - e.g. sperm, foetus.\nThis issue is outside the scope of OBI." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for imports from NCBI Taxonomy." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP: OBI Biomaterial Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://en.wikipedia.org/wiki/Organism" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0100051", "lbl" : "specimen", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity that has the specimen role." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "specimen" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Biobanking of blood taken and stored in a freezer for potential future investigations stores specimen." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note: definition is in specimen creation objective which is defined as an objective to obtain and store a material entity for potential use as an input during an investigation." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP: OBI Biomaterial Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/obi-ontology/obi/issues/1013" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0100060", "lbl" : "cultured cell population", "type" : "CLASS", "meta" : { "definition" : { "val" : "A processed material comprised of a collection of cultured cells that has been continuously maintained together in culture and shares a common propagation history." }, "comments" : [ "The extent of a 'cultured cell population' is restricted only in that all cell members must share a propagation history (ie be derived through a common lineage of passages from an initial culture). In being defined in this way, this class can be used to refer to the populations that researchers actually use in the practice of science - ie are the inputs to culturing, experimentation, and sharing. The cells in such populations will be a relatively uniform population as they have experienced similar selective pressures due to their continuous co-propagation. And this population will also have a single passage number, again owing to their common passaging history. Cultured cell populations represent only a collection of cells (ie do not include media, culture dishes, etc), and include populations of cultured unicellular organisms or cultured multicellular organism cells. They can exist under active culture, stored in a quiescent state for future use, or applied experimentally." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cultured cell population" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A cultured cell population applied in an experiment: \"293 cells expressing TrkA were serum-starved for 18 hours and then neurotrophins were added for 10 min before cell harvest.\" (Lee, Ramee, et al. \"Regulation of cell survival by secreted proneurotrophins.\" Science 294.5548 (2001): 1945-1948).\n\nA cultured cell population maintained in vitro: \"Rat cortical neurons from 15 day embryos are grown in dissociated cell culture and maintained in vitro for 8–12 weeks\" (Dichter, Marc A. \"Rat cortical neurons in cell culture: culture methods, cell morphology, electrophysiology, and synapse formation.\" Brain Research 149.2 (1978): 279-293)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2013-6-5 MHB: This OBI class was formerly called 'cell culture', but label changed and definition updated following CLO alignment efforts in spring 2013, during which the intent of this class was clarified to refer to portions of a culture or line rather than a complete cell culture or line." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "cell culture sample" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON:Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200000", "lbl" : "data transformation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A planned process that produces output data from input data." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The application of a clustering protocol to microarray data or the application of a statistical testing method on a primary data set to determine a p-value." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Helen Parkinson" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Richard Scheuermann" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Ryan Brinkman" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Tina Hernandez-Boussard" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data analysis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data processing" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Branch editors" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/obi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200033", "lbl" : "leave one out cross validation method", "type" : "CLASS", "meta" : { "definition" : { "val" : "is a data transformation : leave-one-out cross-validation (LOOCV) involves using a single observation from the original sample as the validation data, and the remaining observations as the training data. This is repeated such that each observation in the sample is used once as the validation data" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "leave one out cross validation method" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The authors conducted leave-one-out cross validation to estimate the strength and accuracy of the differentially expressed filtered genes. http://bioinformatics.oxfordjournals.org/cgi/content/abstract/19/3/368" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-11-10. Tracker: https://sourceforge.net/tracker/?func=detail&aid=2893049&group_id=177891&atid=886178" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Helen Parkinson" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200041", "lbl" : "k-means clustering", "type" : "CLASS", "meta" : { "definition" : { "val" : "A k-means clustering is a data transformation which achieves a class discovery or partitioning objective, which takes as input a collection of objects (represented as points in multidimensional space) and which partitions them into a specified number k of clusters. The algorithm attempts to find the centers of natural clusters in the data. The most common form of the algorithm starts by partitioning the input points into k initial sets, either at random or using some heuristic data. It then calculates the mean point, or centroid, of each set. It constructs a new partition by associating each point with the closest centroid. Then the centroids are recalculated for the new clusters, and the algorithm repeated by alternate applications of these two steps until convergence, which is obtained when the points no longer switch clusters (or alternatively centroids are no longer changed)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "k-means clustering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://en.wikipedia.org/wiki/K-means" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200042", "lbl" : "hierarchical clustering", "type" : "CLASS", "meta" : { "definition" : { "val" : "A hierarchical clustering is a data transformation which achieves a class discovery objective, which takes as input data item and builds a hierarchy of clusters. The traditional representation of this hierarchy is a tree (visualized by a dendrogram), with the individual input objects at one end (leaves) and a single cluster containing every object at the other (root)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "hierarchical clustering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://en.wikipedia.org/wiki/Data_clustering#Hierarchical_clustering" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200050", "lbl" : "dimensionality reduction", "type" : "CLASS", "meta" : { "definition" : { "val" : "A dimensionality reduction is data partitioning which transforms each input m-dimensional vector (x_1, x_2, ..., x_m) into an output n-dimensional vector (y_1, y_2, ..., y_n), where n is smaller than m." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "dimensionality reduction" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data projection" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Melanie Courtot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200051", "lbl" : "principal components analysis dimensionality reduction", "type" : "CLASS", "meta" : { "definition" : { "val" : "A principal components analysis dimensionality reduction is a dimensionality reduction achieved by applying principal components analysis and by keeping low-order principal components and excluding higher-order ones." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "principal components analysis dimensionality reduction" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pca data reduction" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Melanie Courtot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200111", "lbl" : "data visualization", "type" : "CLASS", "meta" : { "definition" : { "val" : "An planned process that creates images, diagrams or animations from the input data." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data visualization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Generation of a heatmap from a microarray dataset" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Tina Boussard" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "data encoding as image" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "visualization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Tina Boussard" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "Possible future hierarchy might include this:\ninformation_encoding\n>data_encoding\n>>image_encoding" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200166", "lbl" : "data transformation objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "An objective specification to transformation input data into output data" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "data transformation objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "normalize objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Modified definition in 2013 Philly OBI workshop" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200171", "lbl" : "partitioning data transformation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A partitioning data transformation is a data transformation that has objective partitioning." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "partitioning data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200172", "lbl" : "partitioning objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A partitioning objective is a data transformation objective where the aim is to generate a collection of disjoint non-empty subsets whose union equals a non-empty input set." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "partitioning objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A k-means clustering which has partitioning objective is a data transformation in which the input data is partitioned into k output sets." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Elisabetta Manduchi" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200175", "lbl" : "class discovery data transformation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A class discovery data transformation (sometimes called unsupervised classification) is a data transformation that has objective class discovery." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "class discovery data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "clustering data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "unsupervised classification data transformation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200178", "lbl" : "class discovery objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A class discovery objective (sometimes called unsupervised classification) is a data transformation objective where the aim is to organize input data (typically vectors of attributes) into classes, where the number of classes and their specifications are not known a priori. Depending on usage, the class assignment can be definite or probabilistic." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "class discovery objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "clustering objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "discriminant analysis objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "unsupervised classification objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200179", "lbl" : "class prediction objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A class prediction objective (sometimes called supervised classification) is a data transformation objective where the aim is to create a predictor from training data through a machine learning technique. The training data consist of pairs of objects (typically vectors of attributes) and\nclass labels for these objects. The resulting predictor can be used to attach class labels to any valid novel input object. Depending on usage, the prediction can be definite or probabilistic. A classification is learned from the training data and can then be tested on test data." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "class prediction objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "classification objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "supervised classification objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: Elisabetta Manduchi" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200188", "lbl" : "cross validation objective", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cross validation objective is a data transformation objective in which the aim is to partition a sample of data into subsets such that the analysis is initially performed on a single subset, while the other subset(s) are retained for subsequent use in confirming and validating the initial analysis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cross validation objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "rotation estimation objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB: http://en.wikipedia.org/wiki/Cross_validation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0200190", "lbl" : "clustered data visualization", "type" : "CLASS", "meta" : { "definition" : { "val" : "A data visualization which has input of a clustered data set and produces an output of a report graph which is capable of rendering data of this type." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "clustered data visualization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0600014", "lbl" : "material component separation", "type" : "CLASS", "meta" : { "definition" : { "val" : "a material processing in which components of an input material become segregated in space" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "material component separation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Using a cell sorter to separate a mixture of T cells into two fractions; one with surface receptor CD8 and the other lacking the receptor, or purification" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "IEDB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0600024", "lbl" : "maintaining cell culture", "type" : "CLASS", "meta" : { "definition" : { "val" : "a protocol application in which cells are kept alive in a defined environment outside of an organism. part of cell_culturing" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "maintaining cell culture" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "When harvesting blood from a human, isolating T cells, and then limited dilution cloning of the cells, the maintaining_cell_culture step comprises all steps after the initial dilution and plating of the cells into culture, e.g. placing the culture into an incubator, changing or adding media, and splitting a cell culture" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PlanAndPlannedProcess Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI branch derived" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0600036", "lbl" : "establishing cell culture", "type" : "CLASS", "meta" : { "definition" : { "val" : "a process through which a new type of cell culture or cell line is created, either through the isolation and culture of one or more cells from a fresh source, or the deliberate experimental modification of an existing cell culture (e.g passaging a primary culture to become a secondary culture or line, or the immortalization or stable genetic modification of an existing culture or line)." }, "comments" : [ "A 'cell culture' as used here referes to a new lineage of cells in culture deriving from a single biological source.. New cultures are established through the initial isolation and culturing of cells from an organismal source, or through changes in an existing cell culture or line that result in a new culture with unique characteristics. This can occur through the passaging/selection of a primary culture into a secondary culture or line, or experimental modifications of an existing cell culture or line such as an immortalization process or other stable genetic modification. This class covers establishment of cultures of either multicellular organism cells or unicellular organisms." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "'establishing cell culture'" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON:Matthew Brush" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0600037", "lbl" : "cell culture splitting", "type" : "CLASS", "meta" : { "definition" : { "val" : "The act of taking part of a homogeneous cell culture and creating one or more additional separate cultures of similar qualities. input: cell_culture, output cell_culture min cardinality 2. part of cell culturing" }, "comments" : [ "An active cell culture is typically split when it has grown to confluence in its culture dish. Cell culture splitting of a cell culture sample results in an increase in its passage number, which measures how long a sample has been propagated in vitro, and therefore how many selective or genetic changes it is likely to have undergone." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cell culture splitting" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The act of taking a cell culture of high density, counting the cells, removing part of the cells, and re-seeding a select number of the cells into new flasks with fresh tissue culture media." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PlanAndPlannedProcess Branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "cell culture passaging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI branch derived" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OGMS_0000031", "lbl" : "disease", "type" : "CLASS", "meta" : { "definition" : { "val" : "A disposition (i) to undergo pathological processes that (ii) exists in an organism because of one or more disorders in that organism." } } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0000001", "lbl" : "quality", "type" : "CLASS", "meta" : { "definition" : { "val" : "A dependent entity that inheres in a bearer by virtue of how the bearer is related to other entities", "xrefs" : [ "PATOC:GVG" ] } } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0000016", "lbl" : "obsolete color brightness", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "'Value' label chosen here according to http://www.uwgb.edu/heuerc/2D/ColorTerms.html" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Was parent of chromosomal band intensity before moving this class to live as a sequence feature attribute." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "color value" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0000047", "lbl" : "biological sex", "type" : "CLASS", "meta" : { "definition" : { "val" : "An organismal quality inhering in a bearer by virtue of the bearer's ability to undergo sexual reproduction in order to differentiate the individuals or types involved." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "biological sex" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0000383", "lbl" : "female", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological sex quality inhering in an individual or a population that only produces gametes that can be fertilised by male gametes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "female" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0000384", "lbl" : "male", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological sex quality inhering in an individual or a population whose sex organs contain only male gametes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "male" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0001241", "lbl" : "physical object quality", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality which inheres in a continuant." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "physical object quality" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0001894", "lbl" : "phenotypic sex", "type" : "CLASS", "meta" : { "definition" : { "val" : "An organismal quality inhering in a bearer by virtue of the bearer's physical expression of sexual characteristics." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "phenotypic sex" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/PATO_0001995", "lbl" : "organismal quality", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quality that inheres in an entire organism or part of an organism." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "organismal quality" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/pato.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/PCO_0000000", "lbl" : "collection of organisms", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity that consists of two or more organisms, viruses, or viroids." }, "comments" : [ "A group of organisms of the same taxonomic group grouped together in virtue of their sharing some commonality (either an inherent attribute or an externally assigned role)." ] } }, { "id" : "http://purl.obolibrary.org/obo/PCO_0000020", "lbl" : "family", "type" : "CLASS", "meta" : { "definition" : { "val" : "A domestic group, or a number of domestic groups linked through descent (demonstrated or stipulated) from a common ancestor, marriage, or adoption." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002532", "lbl" : "sequentially ordered entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "Any entity that is ordered in discrete units along a linear axis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002533", "lbl" : "sequence atomic unit", "type" : "CLASS", "meta" : { "definition" : { "val" : "Any individual unit of a collection of like units arranged in a linear order" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002577", "lbl" : "system", "type" : "CLASS", "meta" : { "definition" : { "val" : "A material entity consisting of multiple components that are causally integrated." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "May be replaced by a BFO class, as discussed in http://www.jbiomedsem.com/content/4/1/43" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.jbiomedsem.com/content/4/1/43" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000001", "lbl" : "region", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence_feature with an extent greater than zero. A nucleotide region is composed of bases and a polypeptide region is composed of amino acids." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "region" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "primary structure of sequence macromolecule" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sequence" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000034", "lbl" : "morpholino_oligo", "type" : "CLASS", "meta" : { "definition" : { "val" : "Morpholino oligos are synthesized from four different Morpholino subunits, each of which contains one of the four genetic bases (A, C, G, T) linked to a 6-membered morpholine ring. Eighteen to 25 subunits of these four subunit types are joined in a specific order by non-ionic phosphorodiamidate intersubunit linkages to give a Morpholino." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000105", "lbl" : "chromosome arm", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region of the chromosome between the centromere and the telomere. Human chromosomes have two arms, the p arm (short) and the q arm (long) which are separated from each other by the centromere." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Formerly http://purl.obolibrary.org/obo/GENO_0000613, replaced by SO term." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here:\nchromosome > arm > region > band > sub-band\n\nNote that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html):\nchromosome > arm > band > sub-band > sub-sub-band" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000110", "lbl" : "sequence_feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "Any extent of continuous biological sequence." }, "comments" : [ "A sequence feature is an extent of 'located' biological sequence, whose identity is determined by both its inherent sequence (ordering of monomeric units) and its position (start and end coordinates based on alignment with some reference). By contrast, 'biological sequences' are identified and distinguished only by their inehrent sequence, and not their position. Accordingly, the 'ATG' start codon in the coding DNA sequence of the human AKT gene is the same 'sequence' as the 'ATG' start codon in the human SHH gene, but these represent two distinct 'sequence features' in virtue of their different positions in the genome." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "GENO defines three levels of sequence-related artifacts, which are distinguished by their identity criteria.\n1. 'Biological sequence' identity is dependent only on the ordering of units that comprise the sequence.\n2. 'Sequence feature' identity is dependent on its sequence and the genomic location of the sequence (this is consistent with the definition of 'sequence feature' in the Sequence Ontology).\n3. 'Qualified sequence feature' identity is additionally dependent on some aspect of the physical context of the genetic material in which the feature is concretized. This third criteria is extrinsic to its sequence and its genomic location. For example, the feature's physical concretization being targeted by a gene knockdown reagent in a cell (e.g. the zebrafish Shha gene as targeted by the morpholino 'Shha-MO1'), or its being transiently expressed from a recombinant expression construct (e.g. the human SHH gene as expressed in a mouse Shh knock-out cell line), or its having been epigenetically modified in a way that alters its expression level or pattern (e.g. the human SHH gene with a specific methylation pattern)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000143", "lbl" : "obsolete assembly_component", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region of known length which may be used to manufacture a longer region." }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000149", "lbl" : "obsolete contig", "type" : "CLASS", "meta" : { "definition" : { "val" : "A contiguous sequence derived from sequence assembly. Has no gaps, but may contain N's from unavailable bases." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "contig" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000159", "lbl" : "deletion", "type" : "CLASS", "meta" : { "definition" : { "val" : "The point at which one or more contiguous nucleotides were excised." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "deleted_sequence" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nucleotide deletion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nucleotide_deletion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_alt_id", "val" : "SO:1000033" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0000159" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_xref", "val" : "http://en.wikipedia.org/wiki/Nucleotide_deletion" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000165", "lbl" : "enhancer", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/SO_0000167", "lbl" : "promoter", "type" : "CLASS", "meta" : { "definition" : { "val" : "A regulatory_region composed of the TSS(s) and binding sites for TF_complexes of the basal transcription machinery." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000199", "lbl" : "translocation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region of nucleotide sequence that has translocated to a new position." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "transchr" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "translocated sequence" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0000199" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000207", "lbl" : "simple_sequence_length_variation", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "SSLP" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "simple sequence length polymorphism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "simple sequence length variation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0000207" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000248", "lbl" : "sequence_length_variation", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sequence length variation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0000248" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000281", "lbl" : "engineered_foreign_gene", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "See here for a list of engineered foreign genes in ZFIN: https://zfin.org/search?q=&fq=type_1%3A%22Engineered+Foreign+Gene%22&category=Any, See here for a list of engineered regions in ZFIN: https://zfin.org/search?q=&fq=type%3A%22Engineered+Region%22&category=Any\n\nIncludes things like loxP sites, inducible promoters, ires elements, etc." } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000289", "lbl" : "microsatellite", "type" : "CLASS", "meta" : { "definition" : { "val" : "A repeat_region containing repeat_units of 2 to 10 bp repeated in tandem." }, "comments" : [ "A defined feature that includes any type of VNTR or SSLP locus." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://en.wikipedia.org/wiki/Microsatellite_%28genetics%29" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000337", "lbl" : "RNAi_reagent", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/SO_0000340", "lbl" : "chromosome", "type" : "CLASS", "meta" : { "definition" : { "val" : "Structural unit composed of a nucleic acid molecule which controls its own replication through the interaction of specific proteins at one or more origins of replication." }, "comments" : [ "A complete chromosome sequence." ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000341", "lbl" : "chromosome band", "type" : "CLASS", "meta" : { "definition" : { "val" : "A cytologically distinguishable feature of a chromosome, often made visible by staining, and usually alternating light and dark." }, "comments" : [ "\"Band' is a term of convenience in order to hierarchically organize morphologically defined chromosome features: chromosome > arm > region > band > sub-band." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The descriptor 1p22.3 = chromosome 1, short arm, region 2, band 2, sub-band 3. This is read as \"one q two-two point three\", not \"one q twenty-two point three\"." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://ghr.nlm.nih.gov/handbook/howgeneswork/genelocation and http://people.rit.edu/rhrsbi/GeneticsPages/Handouts/ChromosomeNomenclature.pdf, both of which define the nomenclature for the banding hierarchy we use here:\nchromosome > arm > region > band > sub-band\n\nNote that an alternate nomenclature for this hierarchy is here (http://www.ncbi.nlm.nih.gov/Class/MLACourse/Original8Hour/Genetics/chrombanding.html):\nchromosome > arm > band > sub-band > sub-sub-band\n" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000353", "lbl" : "sequence_assembly", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence of nucleotides that has been algorithmically derived from an alignment of two or more different sequences." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "sequence_assembly" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000577", "lbl" : "centromere", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/SO_0000637", "lbl" : "obsolete engineered_plasmid", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Obsoleted as we didnt want to commit to constructs being plasmids - but rather wanted a classification of more general types of engineered regions used to replicate and deliver sequence to target cells/genomes. Replaced by GENO:0000856 ! engineered genetic construct." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000667", "lbl" : "insertion", "type" : "CLASS", "meta" : { "definition" : { "val" : "The sequence of one or more nucleotides added between two adjacent nucleotides in the sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "insertion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nucleotide insertion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nucleotide_insertion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_alt_id", "val" : "SO:1000034" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0000667" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000694", "lbl" : "SNP", "type" : "CLASS", "meta" : { "definition" : { "val" : "SNPs are single base pair positions in genomic DNA at which different sequence alternatives exist in normal individuals in some population(s), wherein the least frequent variant has an abundance of 1% or greater." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "single nucleotide polymorphism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0000694" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000699", "lbl" : "junction", "type" : "CLASS", "meta" : { "comments" : [ "A junction is a boundary between regions. A boundary has an extent of zero." ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000704", "lbl" : "gene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region (or regions) that includes all of the sequence elements necessary to encode a functional transcript. A gene may include regulatory regions, transcribed regions and/or other functional sequence regions." }, "comments" : [ "A gene is any 'gene allele' that produces a functional transcript (ie one capable of translation into a protein, or independent functioning as an RNA), when encoded in the genome of some cell or virion." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Regarding the distinction between a 'gene' and a 'gene allele': \nEvery zebrafish genome contains a 'gene allele' for every zebrafish gene. Many will be 'wild-type' or at least functional gene alleles. But some may be alleles that are mutated or truncated so as to lack functionality. According to current SO criteria defining genes, a 'gene' no longer exists in the case of a non-functional or deleted variant. But the 'gene allele' does exist - and its extent is that of the remaining/altered sequence based on alignment with a reference gene. Even for completely deleted genes, an allele of the gene exists (and here is equivalent to the junction corresponding to the where gene would live based on a reference alignment)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000771", "lbl" : "QTL", "type" : "CLASS", "meta" : { "definition" : { "val" : "A quantitative trait locus (QTL) is a polymorphic locus which contains alleles that differentially affect the expression of a continuously distributed phenotypic trait. Usually it is a marker described by statistical association to quantitative variation in the particular phenotypic trait that is thought to be controlled by the cumulative action of alleles at multiple loci." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "quantitative trait locus" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000783", "lbl" : "engineered", "type" : "CLASS", "meta" : { "definition" : { "val" : "An attribute to describe a region that was modified in vitro." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000804", "lbl" : "engineered_region", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "construct" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000830", "lbl" : "chromosome part", "type" : "CLASS", "meta" : { "definition" : { "val" : "An extended region of sequence corresponding to a defined feature that is a proper part of a chromosome, e.g. a chromosomal 'arm', 'region', or 'band'." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "chromosomal feature" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "gross chromosomal part" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0000902", "lbl" : "transgene", "type" : "CLASS", "meta" : { "definition" : { "val" : "A gene that has been transferred naturally or by any of a number of genetic engineering techniques into a cell or organism where it is foreign (i.e. does not belong to the host genome)." }, "comments" : [ "On the relationship between 'transgenic insertions', 'transgenes', and 'alleles'\nTransgenic insertions are sequence alterations comprised of foreign/exogenous sequence. This sequence can be from the same or different species as the host cell or genome - it is exogenous in virtue of it being additional sequence inserted into the original host genome. A given transgenic insertion may create one or more transgenes when introduced into a host genome. The extent of a transgene is spans all features needed to drive its expression in the host genome. In most cases a transgenic insertion completely contains one or more transgenes that are fully competent to drive expression in the host genome. But in some cases, a transgenic insertion may carry only part of the final transgene it creates - which requires additional endogenous sequences in the vicinity of its insertion site to complete a functional gene (e.g. this is the case for enhancer traps or gene traps) to complete.\n\nIn addition to the transgenes they create upon genomic integration, transgenic insertions can create variant alleles by disrupting a known endogenous gene/locus. Variant alleles are versions of a particular genomic features (typically genes), that are altered in their sequence relative to some reference. An insertion that disrupts an endogenous gene would be considered a 'sequence alteration' (sensu SO) which creates a 'variant gene allele'. From the perspective of this disrupted gene, the origin or transgenic nature of this insertion is irrelevant - what matters here is that the gene's sequence has been altered to create an allele. \n\nFor the purposes of modeling, any transgene(s) created when an endogenous gene is interrupted by an insertion is considered/modeled separately from the allele of the endogenous gene that is created by the insertion. The transgenic insertion, which is simply a sequence alteration in the host genome, is then linked to any transgenes that it contributes to or overlaps with or contains. The model of the Flybase example HERE illustrates this approach.", "Transgenes can exist as integrated into the host genome, or extra-chromosomally on replicons or transiently carried/expressed vectors. What matters is that they are active in the context of a foreign biological system (typically a cell or organism).\n\nNote that transgenes as defined here are not necessarily from a different taxon than that of the host genome. For example, a Mus musculus gene over-expressed from a chromosomally-integrated expression construct in a Mus musculus genome qualifies as a transgene because it is exogenous to the host genome." ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001013", "lbl" : "MNP", "type" : "CLASS", "meta" : { "definition" : { "val" : "A multiple nucleotide polymorphism with alleles of common length > 1, for example AAA/TTT." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "multiple nucleotide polymorphism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001013" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001019", "lbl" : "copy_number_variation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A variation that increases or decreases the copy number of a given region." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "CNP" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "CNV" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "copy number polymorphism" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "copy number variation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001019" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_xref", "val" : "http://en.wikipedia.org/wiki/Copy_number_variation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001026", "lbl" : "genome", "type" : "CLASS", "meta" : { "definition" : { "val" : "A collection of sequence features (typically a collection of chromosomes) that covers the sum genetic material within a cell or virion (where 'genetic material' refers to any nucleic acid that is part of a cell or virion and has been inherited from an ancestor cell or virion, and/or can be replicated and inherited by its progeny)" }, "comments" : [ "A genome is considered the complement of all heritable sequence features in a given cell or organism (chromosomal or extrachromosomal). This is typically a collection of >1 sequence molecules (e.g. chromosomes), but in some organisms (e.g. bacteria) it may be a single sequence macromolecule (e.g. a circular plasmid). For this reason 'genome' classifies under 'sequence feature complement'." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Genotype vs Genome in GENO: An (genomic) genotype is an information artifact representing a shorthand syntax for specifying what is known about variation in a genome sequence. This syntax has reference and variant components - a 'reference genome' and 'genomic variation complement' - that must be operated on to resolve a final genome sequence (i.e. substituting all sequences specified by the 'genomic variation complement' for the corresponding sequences in the 'reference genome'). So, while the total sequence content represented in a genotype may be greater than that in a genome, the intended resolution of these sequences is to arrive at a single genome sequence." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "'genome sequence'" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001059", "lbl" : "sequence_alteration", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence_alteration is a sequence_feature whose extent is the deviation from another sequence." }, "comments" : [ "1. A 'sequence alteration' is an allele whose sequence deviates in its entirety from that of other features found at the same genomic location (i.e. it deviates along its entire extent). In this sense, 'sequence alterations' represent the minimal extent an allele can take - i.e. that which is variable with some other feature along its entire sequence). An example is a SNP or insertion. \n\nAlleles whose extent goes beyond the specific sequence that is known to be variable are not sequence alterations. These are alleles that represent alternate versions of some larger, named feature. The classic example here is a 'gene allele', which spans the extent of an entire gene, and contains one or more sequence alterations (regions known to vary) as part.\n\n2. Sequence alterations are not necessarily 'variant' in the sense defined in GENO (i.e. being 'variant with' some reference sequence). In any comparison of alleles at a particular location, the choice of a 'reference' is context-dependent - as comparisons in other contexts might consider a different allele to be the reference. So while sequence alterations are usually considered 'variant' in the context in which they are considered, this variant status may not hold at all times. For this reason, the 'sequence alteration' class is not made an rdfs:subClassOf 'variant allele'. \n\nFor a particular instance of a sequence alteration, howver, we may in some cases be able to rdf:type it as a 'varaint allele' and a 'sequence alteration', in situations where we can be confident that the feature will *never* be considered a reference. For example, experimentally generated mutations in model organism genes that are created expressly to vary from an established reference.\n\n3. Note that we consider novel features gained in a genome to be sequence alterations, including aneusomic chromosomes gained through a non-disjunction event during replication, or extrachromosomal replicons that become part of the heritable genome of a cell or organism." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A few examples highlighting the distinction of 'sequence alterations' from their parent 'variant allele': \n\n1. Consider NM_000059.3(BRCA2):c.631G>A variation in the BRCA2 gene. This mutation of a single nucleotide creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a 'variant allele', while the extent of sequence spanning just the single altered base is a 'sequence alteration'. See https://www.ncbi.nlm.nih.gov/snp/80358871.\n\n2. Consider the NM_000059.3(BRCA2):c.132_133ins8 variation in the BRCA2 gene. This 8 bp insertion creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a 'variant allele', while the extent of sequence spanning just the 8 bp insertion is a 'sequence alteration'. See https://www.ncbi.nlm.nih.gov/snp/483353112.\n\n3. Consider the NM_000059.3(BRCA2):c.22_23delAG variation in the BRCA2 gene. This 2 bp deletion creates a gene allele whose extent is that of the entire BRCA2 gene. This version of the full BRCA2 gene is a 'variant allele', while the junction where the deletion occured is a 'sequence alteration' with an extent of zero. See https://www.ncbi.nlm.nih.gov/snp/483353112." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sequence variation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_alt_id", "val" : "SO:1000004" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_alt_id", "val" : "SO:1000007" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001059" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001218", "lbl" : "transgenic_insertion", "type" : "CLASS", "meta" : { "definition" : { "val" : "An insertion that derives from another organism, via the use of recombinant DNA technology." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "transgenic insertion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001218" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001248", "lbl" : "assembly", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region of the genome of known length that is composed by ordering and aligning two or more different regions." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "assembly" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001410", "lbl" : "obsolete experimental_feature", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region which is the result of some arbitrary experimental procedure. The procedure may be carried out with biological material or inside a computer." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "experimental_feature" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "not currently needed to support modeling use cases. can re-introduce if becomes necessary." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001477", "lbl" : "gene_trap_construct", "type" : "CLASS", "meta" : { "definition" : { "val" : "A construct which is designed to integrate into a genome and produce a fusion transcript between exons of the gene into which it inserts and a reporter element in the construct. Gene traps contain a splice acceptor, do not contain promoter elements for the reporter, and are mutagenic. Gene traps may be bicistronic with the second cassette containing a promoter driving an a selectable marker." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001478", "lbl" : "promoter_trap_construct", "type" : "CLASS", "meta" : { "definition" : { "val" : "A construct which is designed to integrate into a genome and express a reporter when inserted in close proximity to a promoter element. Promoter traps typically do not contain promoter elements and are mutagenic." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001479", "lbl" : "enhancer_trap_construct", "type" : "CLASS", "meta" : { "definition" : { "val" : "A construct which is designed to integrate into a genome and express a reporter when the expression from a basic minimal promoter is enhanced by genomic enhancer elements. Enhancer traps contain promoter elements and are not usually mutagenic." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001483", "lbl" : "SNV", "type" : "CLASS", "meta" : { "definition" : { "val" : "SNVs are single base pair positions in genomic DNA at which different sequence alternatives exist." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "single nucleotide variant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Thu Oct 08 11:37:49 PDT 2009" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001483" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001500", "lbl" : "heritable_phenotypic_marker", "type" : "CLASS", "meta" : { "definition" : { "val" : "A biological_region characterized as a single heritable trait in a phenotype screen. The heritable phenotype may be mapped to a chromosome but generally has not been characterized to a specific gene locus." } } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001505", "lbl" : "reference genome sequence", "type" : "CLASS", "meta" : { "definition" : { "val" : "A genome sequence that is used as a standard against which other genome sequences are compared, or into which alterations are intentionally introduced." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "'GRCh37.p10' (a human reference genome build)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001742", "lbl" : "copy_number_gain", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence alteration whereby the copy number of a given regions is greater than the reference sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "copy number gain" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "gain" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Mon Feb 28 01:54:09 PST 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001742" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001743", "lbl" : "copy_number_loss", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence alteration whereby the copy number of a given region is less than the reference sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "copy number loss" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "loss" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Mon Feb 28 01:55:02 PST 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001743" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001744", "lbl" : "UPD", "type" : "CLASS", "meta" : { "definition" : { "val" : "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from one parent and no copies of the same chromosome or region from the other parent." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "UPD" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "uniparental disomy" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Mon Feb 28 02:01:05 PST 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001744" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_xref", "val" : "http:http\\://en.wikipedia.org/wiki/Uniparental_disomy" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001745", "lbl" : "maternal_uniparental_disomy", "type" : "CLASS", "meta" : { "definition" : { "val" : "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the mother and no copies of the same chromosome or region from the father." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "maternal uniparental disomy" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Mon Feb 28 02:03:01 PST 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001745" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001746", "lbl" : "paternal_uniparental_disomy", "type" : "CLASS", "meta" : { "definition" : { "val" : "Uniparental disomy is a sequence_alteration where a diploid individual receives two copies for all or part of a chromosome from the father and no copies of the same chromosome or region from the mother." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "paternal uniparental disomy" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Mon Feb 28 02:03:30 PST 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001746" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001784", "lbl" : "complex_structural_alteration", "type" : "CLASS", "meta" : { "definition" : { "val" : "A structural sequence alteration where there are multiple equally plausible explanations for the change." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "complex" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Wed Mar 23 03:21:19 PDT 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001784" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0001785", "lbl" : "structural_alteration", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_created_by", "val" : "kareneilbeck" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_creation_date", "val" : "Fri Mar 25 02:27:41 PDT 2011" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:0001785" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_0005836", "lbl" : "regulatory_region", "type" : "CLASS", "meta" : { "definition" : { "val" : "A region of sequence that is involved in the control of a biological process." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "regulatory_region" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Formerly http://purl.obolibrary.org/obo/GENO_0000067, replaced with SO term." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "regulatory element" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "regulatory gene region" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000002", "lbl" : "substitution", "type" : "CLASS", "meta" : { "definition" : { "val" : "Any change in genomic DNA caused by a single event." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000002" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000005", "lbl" : "complex_substitution", "type" : "CLASS", "meta" : { "definition" : { "val" : "When no simple or well defined DNA mutation event describes the observed DNA change, the keyword \\\"complex\\\" should be used. Usually there are multiple equally plausible explanations for the change." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "complex substitution" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000005" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000008", "lbl" : "point_mutation", "type" : "CLASS", "meta" : { "definition" : { "val" : "A single nucleotide change which has occurred at the same position of a corresponding nucleotide in a reference sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "point mutation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000008" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_xref", "val" : "http://en.wikipedia.org/wiki/Point_mutation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000009", "lbl" : "transition", "type" : "CLASS", "meta" : { "definition" : { "val" : "Change of a pyrimidine nucleotide, C or T, into an other pyrimidine nucleotide, or change of a purine nucleotide, A or G, into an other purine nucleotide." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000009" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000010", "lbl" : "pyrimidine_transition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A substitution of a pyrimidine, C or T, for another pyrimidine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pyrimidine transition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000010" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000011", "lbl" : "C_to_T_transition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transition of a cytidine to a thymine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "C to T transition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000011" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000012", "lbl" : "C_to_T_transition_at_pCpG_site", "type" : "CLASS", "meta" : { "definition" : { "val" : "The transition of cytidine to thymine occurring at a pCpG site as a consequence of the spontaneous deamination of 5'-methylcytidine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "C to T transition at pCpG site" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000012" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000013", "lbl" : "T_to_C_transition", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "T to C transition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000013" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000014", "lbl" : "purine_transition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A substitution of a purine, A or G, for another purine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "purine transition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000014" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000015", "lbl" : "A_to_G_transition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transition of an adenine to a guanine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "A to G transition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000015" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000016", "lbl" : "G_to_A_transition", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transition of a guanine to an adenine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G to A transition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000016" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000017", "lbl" : "transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G, or vice versa." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000017" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_xref", "val" : "http://en.wikipedia.org/wiki/Transversion" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000018", "lbl" : "pyrimidine_to_purine_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "Change of a pyrimidine nucleotide, C or T, into a purine nucleotide, A or G." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pyrimidine to purine transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000018" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000019", "lbl" : "C_to_A_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from cytidine to adenine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "C to A transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000019" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000020", "lbl" : "C_to_G_transversion", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "C to G transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000020" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000021", "lbl" : "T_to_A_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from T to A." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "T to A transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000021" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000022", "lbl" : "T_to_G_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from T to G." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "T to G transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000022" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000023", "lbl" : "purine_to_pyrimidine_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "Change of a purine nucleotide, A or G , into a pyrimidine nucleotide C or T." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "purine to pyrimidine transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000023" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000024", "lbl" : "A_to_C_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from adenine to cytidine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "A to C transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000024" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000025", "lbl" : "A_to_T_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from adenine to thymine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "A to T transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000025" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000026", "lbl" : "G_to_C_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from guanine to cytidine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G to C transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000026" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000027", "lbl" : "G_to_T_transversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A transversion from guanine to thymine." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G to T transversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000027" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000032", "lbl" : "indel", "type" : "CLASS", "meta" : { "definition" : { "val" : "A sequence alteration which included an insertion and a deletion, affecting 2 or more bases." }, "comments" : [ "Indels can have a different number of bases than the corresponding reference sequence." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000032" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_xref", "val" : "http://en.wikipedia.org/wiki/Indel" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000035", "lbl" : "duplication", "type" : "CLASS", "meta" : { "definition" : { "val" : "One or more nucleotides are added between two adjacent nucleotides in the sequence; the inserted sequence derives from, or is identical in sequence to, nucleotides adjacent to insertion point." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nucleotide duplication" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nucleotide_duplication" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000035" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000036", "lbl" : "inversion", "type" : "CLASS", "meta" : { "definition" : { "val" : "A continuous nucleotide sequence is inverted in the same position." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "inversion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000036" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "SOFA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000039", "lbl" : "direct_tandem_duplication", "type" : "CLASS", "meta" : { "definition" : { "val" : "A tandem duplication where the individual regions are in the same orientation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "direct tandem duplication" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000039" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000040", "lbl" : "inverted_tandem_duplication", "type" : "CLASS", "meta" : { "definition" : { "val" : "A tandem duplication where the individual regions are not in the same orientation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "inverted tandem duplication" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mirror duplication" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000040" } ] } }, { "id" : "http://purl.obolibrary.org/obo/SO_1000173", "lbl" : "tandem_duplication", "type" : "CLASS", "meta" : { "definition" : { "val" : "A duplication consisting of 2 identical adjacent regions." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "erverted" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "tandem duplication" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/so.owl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_id", "val" : "SO:1000173" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_subset", "val" : "DBVAR" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UBERON_0000061", "lbl" : "anatomical structure", "type" : "CLASS", "meta" : { "definition" : { "val" : "Material anatomical entity that is a single connected structure with inherent 3D shape generated by coordinated expression of the organism's own genome.", "xrefs" : [ "CARO:0000003" ] }, "xrefs" : [ { "val" : "AAO:0010825" }, { "val" : "AEO:0000003" }, { "val" : "BILA:0000003" }, { "val" : "CARO:0000003" }, { "val" : "EHDAA2:0003003" }, { "val" : "EMAPA:0" }, { "val" : "FMA:305751" }, { "val" : "FMA:67135" }, { "val" : "GAID:781" }, { "val" : "HAO:0000003" }, { "val" : "MA:0003000" }, { "val" : "MESH:D000825" }, { "val" : "SCTID:362889002" }, { "val" : "TAO:0000037" }, { "val" : "TGMA:0001823" }, { "val" : "VHOG:0001759" }, { "val" : "XAO:0003000" }, { "val" : "ZFA:0000037" }, { "val" : "http://dbpedia.org/ontology/AnatomicalStructure" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UBERON_0000105", "lbl" : "life cycle stage", "type" : "CLASS", "meta" : { "definition" : { "val" : "A spatiotemporal region encompassing some part of the life cycle of an organism." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "life cycle stage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for imports of developmental stages from Uberon or taxon specific vocabularies such as ZFIN stages terms)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uberon.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UBERON_0000465", "lbl" : "material anatomical entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "Anatomical entity that has mass.", "xrefs" : [ "http://orcid.org/0000-0001-9114-8737" ] }, "xrefs" : [ { "val" : "AAO:0010264" }, { "val" : "AEO:0000006" }, { "val" : "BILA:0000006" }, { "val" : "CARO:0000006" }, { "val" : "EHDAA2:0003006" }, { "val" : "FMA:67165" }, { "val" : "HAO:0000006" }, { "val" : "TAO:0001836" }, { "val" : "TGMA:0001826" }, { "val" : "VHOG:0001721" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UBERON_0001062", "lbl" : "anatomical entity", "type" : "CLASS", "meta" : { "definition" : { "val" : "Biological entity that is either an individual member of a biological species or constitutes the structural organization of an individual member of a biological species.", "xrefs" : [ "FMA:62955", "http://orcid.org/0000-0001-9114-8737" ] }, "xrefs" : [ { "val" : "AAO:0010841" }, { "val" : "AEO:0000000" }, { "val" : "BFO:0000004" }, { "val" : "BILA:0000000" }, { "val" : "BIRNLEX:6" }, { "val" : "CARO:0000000" }, { "val" : "EHDAA2:0002229" }, { "val" : "FMA:62955" }, { "val" : "HAO:0000000" }, { "val" : "MA:0000001" }, { "val" : "NCIT:C12219" }, { "val" : "TAO:0100000" }, { "val" : "TGMA:0001822" }, { "val" : "WBbt:0000100" }, { "val" : "XAO:0000000" }, { "val" : "ZFA:0100000" }, { "val" : "http://purl.obolibrary.org/obo/CARO_0000000" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub class to serve as root of hierarchy for imports of anatomical entities from UBERON, CARO, or taxon-specific anatomy ontologies." } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000001", "lbl" : "length unit", "type" : "CLASS", "meta" : { "definition" : { "val" : "A unit which is a standard measure of the distance between two points." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "length unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000002", "lbl" : "mass unit", "type" : "CLASS", "meta" : { "definition" : { "val" : "A unit which is a standard measure of the amount of matter/energy of a physical object." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "mass unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000003", "lbl" : "time unit", "type" : "CLASS", "meta" : { "definition" : { "val" : "A unit which is a standard measure of the dimension in which events occur in sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "time unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000005", "lbl" : "temperature unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "temperature unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000006", "lbl" : "substance unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "substance unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000051", "lbl" : "concentration unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "concentration unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000095", "lbl" : "volume unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "volume unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000105", "lbl" : "frequency unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "frequency unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000270", "lbl" : "volumetric flow rate unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "volumetric flow rate unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000280", "lbl" : "rate unit", "type" : "CLASS", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "rate unit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UPHENO_0001001", "lbl" : "phenotype", "type" : "CLASS", "meta" : { "comments" : [ "1. From OGMS: A (combination of) quality(ies) of an organism determined by the interaction of its genetic make-up and environment that differentiates specific instances of a species from other instances of the same species (from OGMS, and used in OBI, but treatment as a quality is at odds with previous OBI discussions and their treatemnt of 'comparative phenotype assessment, where a phenotype is described as a quality or disposition)\n\n2. From OBI calls: quality or disposition inheres in organism or part of an organism towards some growth environment" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Stub node that gathers root classes from various taxon-specific phenotype ontologies, as connectors to bringing classes from these ontolgies into the GENO framework." } ] } }, { "id" : "http://purl.obolibrary.org/obo/WBPhenotype_0000886", "lbl" : "worm phenotype", "type" : "CLASS", "meta" : { "definition" : { "val" : "Animals exhibit variations compared to a given control." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "'Variant' is the given label of the root class in the Worm Phenotype ontology. Renamng it here to be consisent with our hierarchy of phenotype classes." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Variant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "c. elegans phenotype" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ZP_0000199", "lbl" : "abnormal(ly) malformed endocardium cell", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/ZP_0000386", "lbl" : "abnormal(ly) absent dorso-rostral cluster", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/ZP_0000755", "lbl" : "abnormal(ly) disrupted diencephalon development", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/ZP_0005531", "lbl" : "abnormal(ly) disrupted neutrophil aggregation", "type" : "CLASS" }, { "id" : "http://purl.obolibrary.org/obo/ZP_0005692", "lbl" : "abnormal(ly) absent adaxial cell", "type" : "CLASS" }, { "id" : "http://purl.org/oban/association", "lbl" : "association", "type" : "CLASS" }, { "id" : "http://www.ncbi.nlm.nih.gov/gene/20423", "lbl" : "mus musculus shh gene", "type" : "CLASS", "meta" : { "comments" : [ "Equivalent to: http://www.informatics.jax.org/marker/MGI:98297" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000514" } ] } }, { "id" : "http://www.ncbi.nlm.nih.gov/gene/30269", "lbl" : "danio rerio shha gene", "type" : "CLASS", "meta" : { "xrefs" : [ { "val" : "http://zfin.org/ZDB-GENE-980526-166" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000514" } ] } }, { "id" : "http://www.ncbi.nlm.nih.gov/gene/399483", "lbl" : "danio rerio cdkn1ca gene", "type" : "CLASS", "meta" : { "xrefs" : [ { "val" : "http://zfin.org/ZDB-GENE-040123-1" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000514" } ] } }, { "id" : "http://www.ncbi.nlm.nih.gov/gene/6469", "lbl" : "homo sapiens SHH gene", "type" : "CLASS", "meta" : { "comments" : [ "Equivalent to: http://www.ensembl.org/Gene/Summary?g=ENSG00000164690\n\nCodes for: http://www.uniprot.org/uniprot/Q15465" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000514" } ] } }, { "id" : "http://www.w3.org/2002/07/owl#Thing", "type" : "CLASS" }, { "id" : "http://biohackathon.org/resource/faldo#begin", "lbl" : "begin", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://biohackathon.org/resource/faldo#end", "lbl" : "end", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://biohackathon.org/resource/faldo#location", "lbl" : "location", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://biohackathon.org/resource/faldo#reference", "lbl" : "reference (faldo)", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The reference is the resource that the position value is anchored to. For example, a contig or chromosome in a genome assembly." } } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000050", "lbl" : "part of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a core relation that holds between a part and its whole" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "is part of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "my brain is part of my body (continuant parthood, two material entities)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "my stomach cavity is part of my stomach (continuant parthood, immaterial entity is part of material entity)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this day is part of this year (occurrent parthood)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Everything is part of itself. Any part of any part of a thing is itself part of that thing. Two distinct things cannot be part of each other." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See http://purl.obolibrary.org/obo/ro/docs/temporal-semantics/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See https://code.google.com/p/obo-relations/wiki/ROAndTime" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Parthood requires the part and the whole to have compatible classes: only an occurrent can be part of an occurrent; only a process can be part of a process; only a continuant can be part of a continuant; only an independent continuant can be part of an independent continuant; only an immaterial entity can be part of an immaterial entity; only a specifically dependent continuant can be part of a specifically dependent continuant; only a generically dependent continuant can be part of a generically dependent continuant. (This list is not exhaustive.)\n\nA continuant cannot be part of an occurrent: use 'participates in'. An occurrent cannot be part of a continuant: use 'has participant'. A material entity cannot be part of an immaterial entity: use 'has location'. A specifically dependent continuant cannot be part of an independent continuant: use 'inheres in'. An independent continuant cannot be part of a specifically dependent continuant: use 'bearer of'." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "part_of" }, { "pred" : "http://purl.obolibrary.org/obo/RO_0001900", "val" : "http://purl.obolibrary.org/obo/RO_0001901" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#seeAlso", "val" : "http://www.obofoundry.org/ro/#OBO_REL:part_of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000051", "lbl" : "has part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a core relation that holds between a whole and its part" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has part" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "my body has part my brain (continuant parthood, two material entities)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "my stomach has part my stomach cavity (continuant parthood, material entity has part immaterial entity)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this year has part this day (occurrent parthood)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Everything has itself as a part. Any part of any part of a thing is itself part of that thing. Two distinct things cannot have each other as a part." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See http://purl.obolibrary.org/obo/ro/docs/temporal-semantics/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Occurrents are not subject to change and so parthood between occurrents holds for all the times that the part exists. Many continuants are subject to change, so parthood between continuants will only hold at certain times, but this is difficult to specify in OWL. See https://code.google.com/p/obo-relations/wiki/ROAndTime" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Parthood requires the part and the whole to have compatible classes: only an occurrent have an occurrent as part; only a process can have a process as part; only a continuant can have a continuant as part; only an independent continuant can have an independent continuant as part; only a specifically dependent continuant can have a specifically dependent continuant as part; only a generically dependent continuant can have a generically dependent continuant as part. (This list is not exhaustive.)\n\nA continuant cannot have an occurrent as part: use 'participates in'. An occurrent cannot have a continuant as part: use 'has participant'. An immaterial entity cannot have a material entity as part: use 'location of'. An independent continuant cannot have a specifically dependent continuant as part: use 'bearer of'. A specifically dependent continuant cannot have an independent continuant as part: use 'inheres in'." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_part" }, { "pred" : "http://purl.obolibrary.org/obo/RO_0001900", "val" : "http://purl.obolibrary.org/obo/RO_0001901" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000054", "lbl" : "realized in", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "Paraphrase of elucidation: a relation between a realizable entity and a process, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "realized in" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this disease is realized in this disease course" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this fragility is realized in this shattering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this investigator role is realized in this investigation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is realized by" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "realized_in" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "[copied from inverse property 'realizes'] to say that b realizes c at t is to assert that there is some material entity d & b is a process which has participant d at t & c is a disposition or role of which d is bearer_of at t& the type instantiated by b is correlated with the type instantiated by c. (axiom label in BFO2 Reference: [059-003])" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/bfo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000055", "lbl" : "realizes", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "Paraphrase of elucidation: a relation between a process and a realizable entity, where there is some material entity that is bearer of the realizable entity and participates in the process, and the realizable entity comes to be realized in the course of the process" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "realizes" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this disease course realizes this disease" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this investigation realizes this investigator role" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this shattering realizes this fragility" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "to say that b realizes c at t is to assert that there is some material entity d & b is a process which has participant d at t & c is a disposition or role of which d is bearer_of at t& the type instantiated by b is correlated with the type instantiated by c. (axiom label in BFO2 Reference: [059-003])" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000062", "lbl" : "preceded by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x is preceded by y if and only if the time point at which y ends is before or equivalent to the time point at which x starts. Formally: x preceded by y iff ω(y) <= α(x), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "preceded by" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "An example is: translation preceded_by transcription; aging preceded_by development (not however death preceded_by aging). Where derives_from links classes of continuants, preceded_by links classes of processes. Clearly, however, these two relations are not independent of each other. Thus if cells of type C1 derive_from cells of type C, then any cell division involving an instance of C1 in a given lineage is preceded_by cellular processes involving an instance of C. The assertion P preceded_by P1 tells us something about Ps in general: that is, it tells us something about what happened earlier, given what we know about what happened later. Thus it does not provide information pointing in the opposite direction, concerning instances of P1 in general; that is, that each is such as to be succeeded by some instance of P. Note that an assertion to the effect that P preceded_by P1 is rather weak; it tells us little about the relations between the underlying instances in virtue of which the preceded_by relation obtains. Typically we will be interested in stronger relations, for example in the relation immediately_preceded_by, or in relations which combine preceded_by with a condition to the effect that the corresponding instances of P and P1 share participants, or that their participants are connected by relations of derivation, or (as a first step along the road to a treatment of causality) that the one process in some way affects (for example, initiates or regulates) the other." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is preceded by" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "preceded_by" }, { "pred" : "http://purl.org/dc/terms/source", "val" : "http://www.obofoundry.org/ro/#OBO_REL:preceded_by" } ] } }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000063", "lbl" : "precedes", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "precedes" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000207", "lbl" : "has_sequence_attribute", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation used to link sequence entities (sequences, features, qualified features, and collections thereof) to their 'attributes'." }, "xrefs" : [ { "val" : "http://purl.obolibrary.org/obo/so_has_quality" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Used in lieu of RO/BFO has_quality as this relation is definend to apply to independent contiinuant bearers, wheras sequence entities are generically dependent continuants." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000211", "lbl" : "bears_concretization_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a material information bearer or material genetic sequence bearer and generically dependent continuant that carries information or sequence content that the bearer encodes" }, "comments" : [ "Shortcut relation expanding to bearer_of some (concretizes some . . . ), linking a material information bearer or sequence macromolecule to some ICE or GDC sequence." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "materializes" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000220", "lbl" : "is_genotype_of", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000222", "lbl" : "has_genotype", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a biological entity and some level of genetic variation present in its genome." }, "comments" : [ "The biological entity can be an organism, a group of organism that share common genotype, or organism-derived entities such as cell lines or biospecimens. The genotype can be any of the various flavors of genotypes/allelotypes defined in GENO (intrinsic genotype, extrinsic genotype, effective genotype), or any genetic variation component of a genotype including variant alleles or sequence alterations." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This relation aims to be equally as broad/inclusive as RO:0002200 ! has_phenotype." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000231", "lbl" : "has_proper_part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "An antisymmetric, irreflexive (normally transitive) relation between a whole and a distinct part (source: SIO)" }, "xrefs" : [ { "val" : "http://semanticscience.org/resource/SIO_000053" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "No proper part relation anymore in RO/BFO?" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000239", "lbl" : "has_sequence", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity that carries a sequence (e.g. a sequence feature or collection), and the sequence it bears." }, "comments" : [ "'Sequence' in the context of GENO is an abstract entity representing an ordered collection of monomeric units as carried in a biological macromolecule." ], "xrefs" : [ { "val" : "VMC:state" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_sequence_component" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_state" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000242", "lbl" : "obsolete_specifies", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an information content entity representing a specification, and the entity it specifies." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A geno:intrinnsic genotype 'specifies' a SO:genome.\nA geno:karyotype 'specifies' a geno:karyotype feature collection." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000243", "lbl" : "obsolete_approximates_sequence", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Created subproperties 'approximates_sequence' and 'resolves to sequence'. Genotypes and other sequence variant artifacts are not always expected to completely specify a sequence, but rather provide some approximation based on available knowledge. The 'resolves_to_sequence' property can be used when the sequence variant artifact is able to completely resolve a sequence, and the 'approximates_sequence' property can be used when it does not. " } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000244", "lbl" : "obsolete_resolves_to_sequence", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Created subproperties 'approximates_sequence' and 'resolves to sequence'. Genotypes and other sequence variant artifacts are not always expected to completely specify a sequence, but rather provide some approximation based on available knowledge. The 'resolves_to_sequence' property can be used when the sequence variant artifact is able to completely resolve a sequence, and the 'approximates_sequence' property can be used when it does not. " } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000248", "lbl" : "is_proper_part_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "An asymmetric, irreflexive (normally transitive) relation between a part and its distinct whole." }, "xrefs" : [ { "val" : "http://semanticscience.org/resource/SIO_000093" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000251", "lbl" : "is_sequence_of", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000252", "lbl" : "is_subject_of", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000253", "lbl" : "obsolete_is_specified_by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000359", "lbl" : "obsolete_is_phenotype_of_genotype", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "shortcut relation used to link a phenotype directly to a genotype of an organism" }, "comments" : [ "Might expand to something like:\n\nphenotype and (is_phenotype_of some (organism and (has_part some ('material genome' and (is_subject_of some (genome and (is_specified_by some genotype)))))))" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is_phenotype_of_organism_with_genotype" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is_phenotype_with_genotype" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "phenotype_has_genotype" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000368", "lbl" : "obsolete_participates_in_inheritance_process", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation to link variant loci, phenotypes, or disease to the type of inheritance process they are involved in, based on how the genetic interactions between alleles at the causative locus determine the pattern of inheritance of a specific phenotype/disease from one generation to the next." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Exploratory/temporary property, as we formalize our phenotypic inheritance model." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000382", "lbl" : "has_variant_part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is variant in terms of its sequence, position, or expression." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000383", "lbl" : "is_variant_part_of", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000385", "lbl" : "has_reference_part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a sequence entity (i.e. a sequence, feature, or qualified feature) and a part of this entity that is not variant." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_reference_sequence_part" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000387", "lbl" : "is_reference_part_of", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000408", "lbl" : "is_allele_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking an instance of a variable feature (aka an allele) to a genomic location/locus it occupies. This is typically a gene locus, but a feature may be an allele of other types of named loci such as QTLs, or alleles of some unnamed locus of arbitrary size." }, "comments" : [ "To allow users to make important distinctions in discourse and modeling, GENO clearly separates the notions/levels of 'biological sequence', 'sequence feature', and 'sequence location' ('genomic locus' when found in a genome). This sets up an important terminological nuance when it comes to alleles, where we believe it correct to say that a particular genomic feature is an alleles_of some genomic locus (as opposed to an allele_of some sequence or some feature). This is typically a gene locus, but even insertions falling outside of genes are considered alleles_of the locus they alter (e.g. alleles of other types of named loci such as QTLs, or alleles of some unnamed locus of arbitrary size).\n\nWhile conceptually it is most correct to say features are alleles_of some genomic locus, it is common practice to say that they are alleles of the class of feature defined to reside at that locus (typically a gene). Accordingly, we may write things like \"fgf8a is an allele of the Danio rerio fgf8a gene\", and we may create data where fgf8a is asserted as an allele_of the fgf8a gene class IRI. But here we mean more precisely that it is an allele of the locus at which the fgf8a gene resides. Allowing for this means that we dont have to create 'feature-based location/locus' terms mirroing all feature class terms already in exiistence (e.g. for every gene).\n\nIt is important to be clear that the location/locus that a feature is an allele_of is defined exclusively by its genomic position, and not on the sequence it may contains. This is particularly relevant when considering transgenic insertions. For example, this means that the insertion of the S. cerevisiae GAL4 gene sequence within the D. melanogaster Bx gene locus would create an allele of the D. melanogaster Bx gene, but not an allele of the S. cerevisiae GAL4 gene. The transgene that results from such an insertion, while expressing S. cerevisiae GAL4 gene sequence, is not an allele of this gene because it does not reside at the S. cerevisiae GAL4 locus. \n\nThis departs from how some databases use the term 'allele' - where transgenes expressing an exogenous gene are considered to be alleles of the exogenous genes they carry. For example, in the example above, Flybase describes the S. cerevisiae GAL4 transgene as an allele_of the S. cerevisiae GAL4 gene (and gives it the allele identifier FBal0040476). A GENO representation on the other hand would say that the S. cerevisiae GAL4 transgene derives_sequence_from the S. cerevisiae GAL4 gene, but is not an allele_of this gene. In a GENO model, FBal0040476 would be typed as a transgene insertion, but not considered an allele_of the Scer\\GAL4 gene.\n\nAt the end of the day, it's just semantics, but worth clarifying given the ubiquity and variable use of the term 'allele'. The GENO model attempts to define and adhere to the principled notion of positionally-defined 'alleles', and functionally-defined 'transgenes'." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : " is_allele_of the 'danio rerio fgf8a' gene locus." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Domain = allele \nRange = genomic locus (but in practice it is common to use a punned gene class IRI as the subject of this relation)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note that the allele is not necessarily an instance of the danio rerio fgf8a gene class, given that we adopt the SO definition of genes as 'producing a functional product'. If the allele is nonfunctional or null, it is an allele_of the danio rerio fgf8a gene class, but not an instance (rdf:type) of this class. It would, however, bean instance of a 'danio rerio fgf8a gene allele' class - because being a 'gene allele' as defined in GENO requires only occupying the genomic position where for a gene, but not necessarily producing a functional product." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is_sequence_variant_of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000410", "lbl" : "obsolete_is_genetic_variant_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation used to link a variant locus instance to the gene class it is a variant of (in terms of its sequence or expression level)." }, "comments" : [ "Domain = genomic feature instance\nRange = punned gene class IRI" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is_variant_instance_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "formerly grouped is_allele_of and is_expression_variant_of proerpties under feature to class proeprty (now renmaed has_affected_locus)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000411", "lbl" : "obsolete_has_genetic_variant", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a gene class to a sequence-varaint or expression-variant of the gene." }, "comments" : [ "Domain = punned gene class\nRange = genomic feature" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_variant_instance" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "formerly grouped has_allele and has_expression_variant proerpties under cllass to feature property (now renamed locus_affected_by)" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000413", "lbl" : "has_allele", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a gene class to one of its sequence-variant alleles." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Domain = punned gene class\nRange = allele" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_sequence_variant" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000414", "lbl" : "targets_gene", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a gene targeting reagent (e.g. a morpholino or RNAi) and the class of gene it targets." }, "comments" : [ "This is intended to be used as an instance-class relation, used for linking an instance of a gene targeting reagent to the class of gene whose instances it targets." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000418", "lbl" : "has_affected_feature", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation that holds between an instance of a geneetic variation and a genomic feature (typically a gene class) that is affected in its sequence or expression." }, "comments" : [ "This class to organizes all relations used to link genetic variation instances of any type to genomic feature classes they effect. For example, is_allele_of links a gene allele instance to its gene class (genes are represented as classes in our OWL model). Such links support phenotype propagation from alleles to genes for Monarch Initiative use cases. Use of these properties effectively puns gene class IRIs into owl:individuals in a given rdf datset." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000443", "lbl" : "is_expression_variant_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between an expression-variant gene (ie integrated transgenes or knockdown reagent targeted genes), and the class of gene it represents." }, "comments" : [ "This relation links an expression-variant gene instance (targeted or transgenic) to the class of gene that it preresents. For transient transgenes, this is the gene, the coding sequence need only to contain as part an expressed region from a given gene to stand in an is_expression_variant_of relation to the gene class." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Domain = expression variant feature.\nRange = punned gene class" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000445", "lbl" : "is_feature_affected_by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a genomic feature class (typically a gene class) and an instance of a sequence feature or qualified sequence feature that represents or affects some change in the sequence or expression of the genomic feature." }, "comments" : [ "This is an organizational grouping class to collect all relations used to link genomic feature classes (typically genes) to instance of a genomic feature sequence feature or qualified sequence feature. For example, linking a gene class IRI to an instance of an allele of that gene class. Such links support phenotype propagation from features/variants to genes (e.g. for Monarch Initiative use cases)" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "class_to_feature_relation" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000447", "lbl" : "is_gene_target_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a gene class and a gene targeting reagent that targets it." }, "comments" : [ "Domain = punned gene class\nRange = gene knockdown reagent" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is_target_of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000449", "lbl" : "has_expression_variant", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a gene class to one of an expression-variant of that gene.." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Domain = punned gene class\nRange = expression variant feature" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_expression_variant_instance" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000486", "lbl" : "obsolete_is_variant_with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between two sequence features at a given genomic locus that vary in their sequence or level of expression." }, "comments" : [ "This proeprty is most commonly used to relate two different alleles of a given gene. It is not a relation between an allele and the gene it is a variant of." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "Decided there was no need for a contrasting is_expression_variant_with property, so removed it and this parent grouping property." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000488", "lbl" : "obsolete_is_expression_variant_with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between two instances of a given gene that vary in their level of expression as a result of external factors influencing expression (e.g. gnee-knockdown reagents, epigenetic modification, alteration of endogenous gene-regulation pathways)." }, "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000580", "lbl" : "has_qualifier", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation used to describe a context or conditions that define and/or identify an entity." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Used in Monarch Data to link associations to qualifying contexts (e.g. environments or developmental stages) where the association applies. For example, a qualifying environment represents a context where genotype-phenotype associations apply - where the environment is an identity criteria for the association.\n\nUsed in GENO to describe physical context of materialized sequence features that represent identifying criteria for instances of qualified sequence features." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_qualifying_context" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000608", "lbl" : "has_zygosity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation to link a single locus complement to its zygosity." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000610", "lbl" : "is_reference_allele_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a reference locus/allele and the gene class it is an allele of." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000626", "lbl" : "has_staining_intensity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "Used to link a gross chromosomal sequence feature (chromosome part) to a color value quality that inheres in the sequence feature in virtue of the staining pattern of the chromosomal DNA in which the sequence is materialized." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Consider obsoleting - it is likely sufficeint to use the parent has_sequence_attribute property - a separate proeprty to link to the staining intensity attribute is not really needed." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_color_value" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000634", "lbl" : "is_targeted_by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "relation between an molecular agent and its molecular target" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Used to link a gene targeting reagent such as a morpholino, to an instance of a reagent targeted gene variant." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000639", "lbl" : "sequence_derives_from", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Relationship between a sequence feature and a distinct, non-overlapping feature from which it derives part or all of its sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "1. Used to specify derivation of transgene components from a gene class, or a engineered construct instance. \n\n2. Used to specify the genetic background/strain of origin of an allele (i.e. that an allele was originally isolated from a specific background strain, and propagated into new genetic backgrounds.\n\n3. Used to indicate derivation of a variant mouse genotype from an ES cell line used in generating the modified mice (IMPC)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000641", "lbl" : "is_variant_allele_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a variant allele and the gene class it is an allele of." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000650", "lbl" : "has_sex_agnostic_part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Relationship between a sex-qualified genotype and intrinsic genotype, created specifically to support propagation of phenotypes asserted on the former to the later for Monarch Initiative use cases." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000651", "lbl" : "is_mutant_allele_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "A relation between a mutant allele (ie rare variant present in less than 1% of a population, or an experimentally-altered variant such as a knocked-out gene in a model organism), and the gene it is a variant of." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000652", "lbl" : "is_polymorphic_allele_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a polymorphic allele and the gene class it is an allele of." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000653", "lbl" : "is_wild_type_allele_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a wild-type allele and the gene class it is an allele of." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000654", "lbl" : "has_sequence_part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "An organizational class to hold relations of parthood between sequences/features." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000655", "lbl" : "is_sequence_part_of", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000661", "lbl" : "is_sex_agnostic_part_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Relationship between an intrinsic genotype and a sex-qualified genotype, created specifically to support propagation of phenotypes asserted on the latter to the former for Monarch Initiative use cases." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000683", "lbl" : "varies_with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation that holds between two sequence features at a particular genomic location that vary in their sequence. These features will have the same position when mapped onto a reference sequence, but vary in their sequence (in whole or in part)." }, "comments" : [ "This property is most commonly used to relate two different alleles of a given gene (e.g. a wt and mutant instance of the BRCA2 gene). It is not a relation between an allele and the class-level gene it is a variant of (for this use is_allele_of)" ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000708", "lbl" : "faldo properties", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "organizational property to hold imports from faldo." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000726", "lbl" : "has_sequence_feature", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a qualified sequence feature to its component sequence feature." }, "comments" : [ "In GENO we define three levels of sequence artifacts: (1) biological sequences, (2) sequence features, and (3) qualified sequence features. The identify criteria for a 'biological sequence' include only its inherent sequence (the ordered string of units that comprise it). The identity criteria for a 'sequence feature' include its sequence and position (where it resides - i.e. its location based on how it maps to a reference or standard) The identity criteria for a 'qualified sequence feature' include its component sequence feature (defined by its sequence and position), and the material context of its bearer in a cell or organism. This context can include direct epigenetic modification, or being targeted by gene knockdown reagents such as morpholinos or RNAi, or being transiently overexpressed from a transgenic construct in a cell or organism." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_sequence_feature_component" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000740", "lbl" : "has_inferred_phenotype", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000741", "lbl" : "obsolete_has_regulatory_part", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "Proposal for a property linking variants to smaller components that are regulatory, and therefore should not inherit phenotypes." ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000742", "lbl" : "obsolete_is_alteration_within", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a sequence_alteration to the gene it alters." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/GENO_0000484" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is_within_allele_of" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000743", "lbl" : "has_asserted_phenotype", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000761", "lbl" : "is_regulatory_part_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Proposal for a property linking regulatory elements to larger features of which they are a part." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000767", "lbl" : "obsolete_has_position_component", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a sequence feature to its component Position that represents an identifying criteria for sequence feature instances." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "For representing positional data, we advocate use of the FALDO model, which links to positional information through an instance of a Region class that represents the mapping of the feature onto some reference sequence. The positional_component property in GENO is meant primarily to formalize the identity criteria or sequence features and qualified sequence features, to illustrate the distinction between them." } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000783", "lbl" : "has_sequence_unit", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a nucleic acid or amino acid sequence or sequence feature, and one of its monomeric units (nucleotide or amino acid residues)" } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000784", "lbl" : "completely_varies_with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between two seqeunces or features that are considered variant with each other along their entire extents." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000790", "lbl" : "related_condition", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000791", "lbl" : "inferred_to_cause_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note that we currently do not have a property chain to propagate phenotypes to genes across sequence_derives_from relation (e.g. in cases where a Tg insertion derives expressed sequence from some gene)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The property chains below are defined as explicitly as possible, but many could be shortened if we used the inferred_to_cause_condition property to construct the property chains. Where this is the case, it is noted in the annotations on the property chains.\n\nBelow are the different kinds/paths of propagation we desire:\n1. Propagation 'down' a genotype (from larger components to smaller ones)\n2. Propagation 'up' a genotype (from smaller components to larger ones)\n3. From sex-qualified genotypes down to the sex-agnostic genotype and its components (but not 'up' to a sex-qualified genotype).\n4. From an effective genotype to its intrinsic and extrinsic components.\n5. From genotype components to genes (note here that a separate chain is needed to propagate conditions asserted on a sequence alteration to the gene, because of the fact that the link to the gene is from the variant locus/allele).\n6. (Exploratory). There are cases where we may also want inter-genotype propagation (i.e. propagation that extends beyond moving up or down a single genotype). For example, if a phenotype is asserted on a sex-qualified intrinsic genotype, we want it to infer down through its component sex-agnostic intrinsic genotype and then up to any effective genotypes of which this sex-agnostic intrinsic genotype is a part. Given the data in hand, however, the conditions for this will likely never occur, so probably ok not to implement a chain to support this.\n\nNote that we do not want to propagate phenotypes up from sex-agnostic genotyeps to sex-qualified ones (e.g.from shha/shha [AB] to shha/shha [AB](male)) - because it may not be the case that a phenotype assessed without consideratioon to sex will apply on a sex-specific background. So we would not create a property chain to propagate inferred condition associations from sex-agnaostic intrinsic genotypes and their parts to sex-qualified intrinsic genotypes and effective genotypes that contain them (such as: has_variant_part o has_sex_agnostic_part o has_variant_part o 'causes condition')" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000793", "lbl" : "inferred_to_contribute_to_condition", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000794", "lbl" : "inferred_to_correlate_with_condition", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000840", "lbl" : "pathogenic_for_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "xrefs" : [ { "val" : "LOINC:LA6668-3" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000841", "lbl" : "likely_pathogenic_for_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "xrefs" : [ { "val" : "LOINC:LA26332-9" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000842", "lbl" : "non-causal_for_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Relation between an entity and a condition (disease, phenotype) which it does not cause or contribute to." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000843", "lbl" : "benign_for_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "xrefs" : [ { "val" : "LOINC:LA6675-8" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000844", "lbl" : "likely_benign_for_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "xrefs" : [ { "val" : "LOINC:LA26334-5" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000845", "lbl" : "has_uncertain_significance_for_condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "xrefs" : [ { "val" : "LOINC:LA26333-7" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000846", "lbl" : "has_qualifying_process", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation used to describe a process contextualizing the identity of an entity." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000847", "lbl" : "has_qualifying_environment", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation used to describe an environment contextualizing the identity of an entity." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000849", "lbl" : "is_candidate_variant_for", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000903", "lbl" : "has_location", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation linking a sequence feature to the location it occupies on some reference sequence." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "occupies" } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000906", "lbl" : "on strand", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "Can be used to a genomic feature to the chromosomal strand it resides on in the genome (+ or - strand, or both strands). Commonly used to link a gene to the strand it is transcribed from." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000957", "lbl" : "has_defining_location", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between a copy number complement or functional copy number complement, and a genomic location that serves as a proxy for the sequence or functional element that defines the complement." }, "comments" : [ "Copy number complements represent sets of all copies of a particular biological sequence present in a particular genome. Their \"identity\" is based on their defining sequence, and the count of this sequence in the genome.The has_defining_location property is used to specify the sequence defining a copy number complement - by using a 'sequence location' as a proxy for a specific sequence that is found at this location.\n\nFor copy number complements, it is the sequence at this location on some reference that defines sequences in a genome of interest that qualify for membership in the complement. For functional copy number complements (aka genetic dosage), it is the canonical function(s) performed by the sequence at this location (typically that of a gene) that helps to define sequences in a genome of interest that qualify for membership in the complement." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000958", "lbl" : "has_defining_sequence", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between a copy number complement or functional copy number complement, and the biological sequence that defines the complement." }, "comments" : [ "Copy number complements represent sets of all copies of a particular biological sequence present in a particular genome. Their \"identity\" is based on their defining sequence, and the count of this sequence in the genome.The has_defining_sequence property is used to specify the sequence defining a copy number complement." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000959", "lbl" : "has_defining_feature", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between a copy number complement or functional copy number complement and a genomic feature that serves as a proxy for the sequence that defines the complement." }, "comments" : [ "Copy number complements represent sets of all copies of a particular biological sequence present in a particular genome. Their \"identity\" is based on their defining sequence, and the count of this sequence in the genome.The has_defining_feature property is used to specify the sequence defining a copy number complement - by using a 'sequence feature' as a proxy for the specific sequence of this feature on some reference.\n\nFor copy number complements, it is the sequence of this proxy feature on some reference that defines sequences in a genome of interest that qualify for membership in the complement. For functional copy number complements (aka genetic dosage), it is the canonical function(s) performed by the sequence of this proxy feature (typically a gene) that helps to define sequences in a genome of interest that qualify for membership in the complement." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000966", "lbl" : "has_interval", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Relates a sequence feature location to an interval that defines its start and end position." }, "comments" : [ "Can be used when Interval objects are employed in representing sequence location. But start and end positions can also be directly attached to a location, avoiding the use of Interval objects." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000967", "lbl" : "has_reference_sequence", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Relates a 'sequence feature location' to a sequence that it is anchored to." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000968", "lbl" : "sequence role", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A role assigned to a sequence feature, collection, or genotype, e.g. serving as a 'reference' against with other sequences are compared." }, "comments" : [ "The RO:0000087 (has role) property cannot be used here because its domain is explicitly constrained to independent continuants, and sequence features in GENO are generically dependent contnuants." ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000136", "lbl" : "is about", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "is_about is a (currently) primitive relation that relates an information artifact to an entity." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "This document is about information artifacts and their representations" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "7/6/2009 Alan Ruttenberg. Following discussion with Jonathan Rees, and introduction of \"mentions\" relation. Weaken the is_about relationship to be primitive. \n\nWe will try to build it back up by elaborating the various subproperties that are more precisely defined.\n\nSome currently missing phenomena that should be considered \"about\" are predications - \"The only person who knows the answer is sitting beside me\" , Allegory, Satire, and other literary forms that can be topical without explicitly mentioning the topic." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Smith, Ceusters, Ruttenberg, 2000 years of philosophy" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000219", "lbl" : "denotes", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Denotes is a primitive, instance-level, relation obtaining between an information content entity and some portion of reality. Denotation is what happens when someone creates an information content entity E in order to specifically refer to something. The only relation between E and the thing is that E can be used to 'pick out' the thing. This relation connects those two together. Freedictionary.com sense 3: To signify directly; refer to specifically" }, "comments" : [ "" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A person's name denotes the person. A variable name in a computer program denotes some piece of memory. Lexically equivalent strings can denote different things, for instance \"Alan\" can denote different people. In each case of use, there is a case of the denotation relation obtaining, between \"Alan\" and the person that is being named." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2009-11-10 Alan Ruttenberg. Old definition said the following to emphasize the generic nature of this relation. We no longer have 'specifically denotes', which would have been primitive, so make this relation primitive.\ng denotes r =def \nr is a portion of reality\nthere is some c that is a concretization of g \nevery c that is a concretization of g specifically denotes r" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Consdier if this is the best relation for linking genotypes to the genomic entities they specify. We could use the more generic 'is about', or define a new 'specifies' relation that holds between ICEs and something it specifies the nature or creation of." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Conversations with Barry Smith, Werner Ceusters, Bjoern Peters, Michel Dumontier, Melanie Courtot, James Malone, Bill Hogan" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000235", "lbl" : "denoted by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of the relation 'denotes'" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Jie Zheng, Chris Stoeckert, Mike Conlon" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/information-artifact-ontology/IAO/issues/206" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000293", "lbl" : "has_specified_input", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The inverse property of is_specified_input_of" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has_specified_input" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has_specified_input" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "see is_input_of example_of_usage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "8/17/09: specified inputs of one process are not necessarily specified inputs of a larger process that it is part of. This is in contrast to how 'has participant' works." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Larry Hunter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Coutot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/obi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000295", "lbl" : "is_specified_input_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a planned process and a continuant participating in that process that is not created during the process. The presence of the continuant during the process is explicitly specified in the plan specification which the process realizes the concretization of." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "is_specified_input_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "some Autologous EBV(Epstein-Barr virus)-transformed B-LCL (B lymphocyte cell line) is_input_for instance of Chromum Release Assay described at https://wiki.cbil.upenn.edu/obiwiki/index.php/Chromium_Release_assay" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bjoern Peters" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000299", "lbl" : "has_specified_output", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The inverse property of is_specified_output_of" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has_specified_output" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has_specified_output" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Larry Hunter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/obi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000312", "lbl" : "is_specified_output_of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a planned process and a continuant participating in that process. The presence of the continuant at the end of the process is explicitly specified in the objective specification which the process realizes the concretization of." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "is_specified_output_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "is_specified_output_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/obi.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000417", "lbl" : "achieves_planned_objective", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "This relation obtains between a planned process and a objective specification when the criteria specified in the objective specification are met at the end of the planned process." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "achieves_planned_objective" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A cell sorting process achieves the objective specification 'material separation objective'" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "BP, AR, PPPB branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PPPB branch derived" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000232", "val" : "modified according to email thread from 1/23/09 in accordince with DT and PPPB branch" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000643", "lbl" : "has grain", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "the relation of the cells in the finger of the skin to the finger, in which an indeterminate number of grains are parts of the whole by virtue of being grains in a collective that is part of the whole, and in which removing one granular part does not nec- essarily damage or diminish the whole. Ontological Whether there is a fixed, or nearly fixed number of parts - e.g. fingers of the hand, chambers of the heart, or wheels of a car - such that there can be a notion of a single one being missing, or whether, by contrast, the number of parts is indeterminate - e.g., cells in the skin of the hand, red cells in blood, or rubber molecules in the tread of the tire of the wheel of the car." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has grain" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Discussion in Karslruhe with, among others, Alan Rector, Stefan Schulz, Marijke Keet, Melanie Courtot, and Alan Ruttenberg. Definition take from the definition of granular parthood in the cited paper. Needs work to put into standard form" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PAPER: Granularity, scale and collectivity: When size does and does not matter, Alan Rector, Jeremy Rogers, Thomas Bittner, Journal of Biomedical Informatics 39 (2006) 333-349" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000833", "lbl" : "objective_achieved_by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "This relation obtains between an objective specification and a planned process when the criteria specified in the objective specification are met at the end of the planned process." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "objective_achieved_by" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000052", "lbl" : "inheres_in", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between a specifically dependent continuant (the dependent) and an independent continuant (the bearer), in which the dependent specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "inheres in" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this fragility inheres in this vase" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this fragility is a characteristic of this vase" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this red color inheres in this apple" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this red color is a characteristic of this apple" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A dependent inheres in its bearer at all times for which the dependent exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "inheres_in" }, { "pred" : "http://purl.obolibrary.org/obo/RO_0001900", "val" : "http://purl.obolibrary.org/obo/RO_0001901" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000053", "lbl" : "has characteristic", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "bearer of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this apple is bearer of this red color" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this vase is bearer of this fragility" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A bearer can have many dependents, and its dependents can exist for different periods of time, but none of its dependents can exist when the bearer does not exist." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "bearer_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is bearer of" }, { "pred" : "http://purl.obolibrary.org/obo/RO_0001900", "val" : "http://purl.obolibrary.org/obo/RO_0001901" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000056", "lbl" : "participates in", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between a continuant and a process, in which the continuant is somehow involved in the process" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "participates in" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this blood clot participates in this blood coagulation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this input material (or this output material) participates in this process" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this investigator participates in this investigation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "participates_in" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000057", "lbl" : "has participant", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between a process and a continuant, in which the continuant is somehow involved in the process" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has participant" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this blood coagulation has participant this blood clot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this investigation has participant this investigator" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this process has participant this input material (or this output material)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Has_participant is a primitive instance-level relation between a process, a continuant, and a time at which the continuant participates in some way in the process. The relation obtains, for example, when this particular process of oxygen exchange across this particular alveolar membrane has_participant this particular sample of hemoglobin at this particular time." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_participant" }, { "pred" : "http://purl.org/dc/elements/1.1/source", "val" : "http://www.obofoundry.org/ro/#OBO_REL:has_participant" }, { "pred" : "http://purl.org/dc/terms/source", "val" : "http://www.obofoundry.org/ro/#OBO_REL:has_participant" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000058", "lbl" : "is concretized as", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a generically dependent continuant and a specifically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant also depends on that same independent continuant. A generically dependent continuant may be concretized as multiple specifically dependent continuants." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The journal article (a generically dependent continuant) is concretized as the quality (a specifically dependent continuant), and both depend on that copy of the printed journal (an independent continuant)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "An investigator reads a protocol and forms a plan to carry out an assay. The plan is a realizable entity (a specifically dependent continuant) that concretizes the protocol (a generically dependent continuant), and both depend on the investigator (an independent continuant). The plan is then realized by the assay (a process)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000059", "lbl" : "concretizes", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a specifically dependent continuant or process and a generically dependent continuant, in which the generically dependent continuant depends on some independent continuant in virtue of the fact that the specifically dependent continuant or process also depends on that same independent continuant. Multiple specifically dependent continuants or processes can concretize the same generically dependent continuant." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The quality (a specifically dependent continuant) concretizes the journal article (a generically dependent continuant), and both depend on that copy of the printed journal (an independent continuant)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A journal article is an information artifact that inheres in some number of printed journals. For each copy of the printed journal there is some quality that carries the journal article, such as a pattern of ink. The quality (a specifically dependent continuant) concretizes the journal article (a generically dependent continuant), and both depend on that copy of the printed journal (an independent continuant)." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "An investigator reads a protocol and forms a plan to carry out an assay. The plan is a realizable entity (a specifically dependent continuant) that concretizes the protocol (a generically dependent continuant), and both depend on the investigator (an independent continuant). The plan is then realized by the assay (a process)." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000079", "lbl" : "function of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between a function and an independent continuant (the bearer), in which the function specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this catalysis function is a function of this enzyme" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A function inheres in its bearer at all times for which the function exists, however the function need not be realized at all the times that the function exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "function_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is function of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000080", "lbl" : "quality of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between a quality and an independent continuant (the bearer), in which the quality specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this red color is a quality of this apple" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A quality inheres in its bearer at all times for which the quality exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is quality of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "quality_of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000081", "lbl" : "role of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between a role and an independent continuant (the bearer), in which the role specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this investigator role is a role of this person" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A role inheres in its bearer at all times for which the role exists, however the role need not be realized at all the times that the role exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is role of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "role_of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000085", "lbl" : "has function", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between an independent continuant (the bearer) and a function, in which the function specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this enzyme has function this catalysis function (more colloquially: this enzyme has this catalysis function)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A bearer can have many functions, and its functions can exist for different periods of time, but none of its functions can exist when the bearer does not exist. A function need not be realized at all the times that the function exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_function" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000086", "lbl" : "has quality", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between an independent continuant (the bearer) and a quality, in which the quality specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this apple has quality this red color" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A bearer can have many qualities, and its qualities can exist for different periods of time, but none of its qualities can exist when the bearer does not exist." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_quality" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000087", "lbl" : "has role", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this person has role this investigator role (more colloquially: this person has this role of investigator)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "A bearer can have many roles, and its roles can exist for different periods of time, but none of its roles can exist when the bearer does not exist. A role need not be realized at all the times that the role exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_role" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000091", "lbl" : "has disposition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between an independent continuant (the bearer) and a disposition, in which the disposition specifically depends on the bearer for its existence" } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0000092", "lbl" : "disposition of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of has disposition" } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0001000", "lbl" : "derives from", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between two distinct material entities, the new entity and the old entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "derives from" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this cell derives from this parent cell (cell division)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this nucleus derives from this parent nucleus (nuclear division)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This is a very general relation. More specific relations are preferred when applicable, such as 'directly develops from'." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "derives_from" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/ro.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0001001", "lbl" : "derives into", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "a relation between two distinct material entities, the old entity and the new entity, in which the new entity begins to exist when the old entity ceases to exist, and the new entity inherits the significant portion of the matter of the old entity" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this parent cell derives into this cell (cell division)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "this parent nucleus derives into this nucleus (nuclear division)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This is a very general relation. More specific relations are preferred when applicable, such as 'directly develops into'. To avoid making statements about a future that may not come to pass, it is often better to use the backward-looking 'derives from' rather than the forward-looking 'derives into'." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "derives_into" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002013", "lbl" : "has regulatory component activity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A 'has regulatory component activity' B if A and B are GO molecular functions (GO_0003674), A has_component B and A is regulated by B." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002014", "lbl" : "has negative regulatory component activity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a GO molecular function and a component of that molecular function that negatively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is negatively regulated by B." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002015", "lbl" : "has positive regulatory component activity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a GO molecular function and a component of that molecular function that positively regulates the activity of the whole. More formally, A 'has regulatory component activity' B iff :A and B are GO molecular functions (GO_0003674), A has_component B and A is positively regulated by B." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002017", "lbl" : "has component activity", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0002018", "lbl" : "has component process", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "w 'has process component' p if p and w are processes, w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002022", "lbl" : "directly regulated by", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0002023", "lbl" : "directly negatively regulated by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Process(P2) is directly negatively regulated by process(P1) iff: P1 negatively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding negatively regulates the kinase activity (P2) of protein B then P2 directly negatively regulated by P1.", "xrefs" : [ "https://orcid.org/0000-0002-7073-9172" ] } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002024", "lbl" : "directly positively regulated by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Process(P2) is directly postively regulated by process(P1) iff: P1 positively regulates P2 via direct physical interaction between an agent executing P1 (or some part of P1) and an agent executing P2 (or some part of P2). For example, if protein A has protein binding activity(P1) that targets protein B and this binding positively regulates the kinase activity (P2) of protein B then P2 is directly postively regulated by P1.", "xrefs" : [ "https://orcid.org/0000-0002-7073-9172" ] } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002025", "lbl" : "has effector activity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A 'has effector activity' B if A and B are GO molecular functions (GO_0003674), A 'has component activity' B and B is the effector (output function) of B. Each compound function has only one effector activity.", "xrefs" : [ "https://orcid.org/0000-0002-7073-9172" ] } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002084", "lbl" : "during which ends", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002086", "lbl" : "ends after", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002087", "lbl" : "immediately preceded by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "starts_at_end_of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002088", "lbl" : "during which starts", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002090", "lbl" : "immediately precedes", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ends_at_start_of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "meets" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002091", "lbl" : "starts during", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "io" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002093", "lbl" : "ends during", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "o" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "overlaps" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002131", "lbl" : "overlaps", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x overlaps y if and only if there exists some z such that x has part z and z part of y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002162", "lbl" : "in taxon", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x is in taxon y if an only if y is an organism, and the relationship between x and y is one of: part of (reflexive), developmentally preceded by, derives from, secreted by, expressed." }, "synonyms" : [ { "pred" : "hasNarrowSynonym", "val" : "life cycle stage of" } ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0001-9227-417X" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/17921072" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/20973947" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002180", "lbl" : "has component", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "w 'has component' p if w 'has part' p and w is such that it can be directly disassembled into into n parts p, p2, p3, ..., pn, where these parts are of similar type." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The definition of 'has component' is still under discussion. The challenge is in providing a definition that does not imply transitivity." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002200", "lbl" : "has phenotype", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a biological entity and a phenotype. Here a phenotype is construed broadly as any kind of quality of an organism part, a collection of these qualities, or a change in quality or qualities (e.g. abnormally increased temperature). The subject of this relationship can be an organism (where the organism has the phenotype, i.e. the qualities inhere in parts of this organism), a genomic entity such as a gene or genotype (if modifications of the gene or the genotype causes the phenotype), or a condition such as a disease (such that if the condition inheres in an organism, then the organism has the phenotype)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002201", "lbl" : "phenotype of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of has phenotype" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002202", "lbl" : "develops from", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x develops from y if and only if either (a) x directly develops from y or (b) there exists some z such that x directly develops from z and z develops from y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0001-9114-8737" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-1980-3228" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002203", "lbl" : "develops into", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of develops from" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-7073-9172" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-1980-3228" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002211", "lbl" : "regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p regulates q iff p is causally upstream of q, the execution of p is not constant and varies according to specific conditions, and p influences the rate or magnitude of execution of q due to an effect either on some enabler of q or some enabler of a part of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0001-7476-6306" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-3837-8864" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GO" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "false" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002212", "lbl" : "negatively regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p negatively regulates q iff p regulates q, and p decreases the rate or magnitude of execution of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002213", "lbl" : "positively regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p positively regulates q iff p regulates q, and p increases the rate or magnitude of execution of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002215", "lbl" : "capable of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation between a material entity (such as a cell) and a process, in which the material entity has the ability to carry out the process. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "mechanosensory neuron capable of detection of mechanical stimulus involved in sensory perception (GO:0050974)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "osteoclast SubClassOf 'capable of' some 'bone resorption'" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has function realized in" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/20123131" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/21208450" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002216", "lbl" : "capable of part of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c stands in this relationship to p if and only if there exists some p' such that c is capable_of p', and p' is part_of p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has function in" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002222", "lbl" : "temporally related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "comments" : [ "A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "move to BFO?" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Allen%27s_interval_algebra" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Allen" }, { "pred" : "http://purl.org/dc/terms/source", "val" : "https://docs.google.com/document/d/1kBv1ep_9g3sTR-SD3jqzFqhuwo9TPNF-l-9fUDbO6rM/edit?pli=1" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002233", "lbl" : "has input", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p has input c iff: p is a process, c is a material entity, c is a participant in p, c is present at the start of p, and the state of c is modified during p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "consumes" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002234", "lbl" : "has output", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p has output c iff c is a participant in p, c is present at the end of p, and c is not present in the same state at the beginning of p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "produces" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002254", "lbl" : "has developmental contribution from", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x has developmental contribution from y iff x has some part z such that z develops from y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Mammalian thymus has developmental contribution from some pharyngeal pouch 3; Mammalian thymus has developmental contribution from some pharyngeal pouch 4 [Kardong]" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002255", "lbl" : "developmentally contributes to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of has developmental contribution from" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002258", "lbl" : "developmentally preceded by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Candidate definition: x developmentally related to y if and only if there exists some developmental process (GO:0032502) p such that x and y both participates in p, and x is the output of p and y is the input of p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "false" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002263", "lbl" : "acts upstream of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c acts upstream of p if and only if c enables some f that is involved in p' and p' occurs chronologically before p, is not part of p, and affects the execution of p. c is a material entity and f, p, p' are processes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A faulty traffic light (material entity) whose malfunctioning (a process) is causally upstream of a traffic collision (a process): the traffic light acts upstream of the collision." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002264", "lbl" : "acts upstream of or within", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c acts upstream of or within p if c is enables f, and f is causally upstream of or within p. c is a material entity and p is an process." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A gene product that has some activity, where that activity may be a part of a pathway or upstream of the pathway." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002286", "lbl" : "developmentally succeeded by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Inverse of developmentally preceded by" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002295", "lbl" : "results in developmental progression of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p results in the developmental progression of s iff p is a developmental process and s is an anatomical entity and p causes s to undergo a change in state at some point along its natural developmental cycle (this cycle starts with its formation, through the mature structure, and ends with its loss)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This property and its subproperties are being used primarily for the definition of GO developmental processes. The property hierarchy mirrors the core GO hierarchy. In future we may be able to make do with a more minimal set of properties, but due to the way GO is currently structured we require highly specific relations to avoid incorrect entailments. To avoid this, the corresponding genus terms in GO should be declared mutually disjoint." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002297", "lbl" : "results in formation of anatomical entity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "an annotation of gene X to anatomical structure formation with results_in_formation_of UBERON:0000007 (pituitary gland) means that at the beginning of the process a pituitary gland does not exist and at the end of the process a pituitary gland exists." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "every \"endocardial cushion formation\" (GO:0003272) results_in_formation_of some \"endocardial cushion\" (UBERON:0002062)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GOC:mtg_berkeley_2013" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002304", "lbl" : "causally upstream of, positive effect", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is causally upstream of, positive effect q iff p is casually upstream of q, and the execution of p is required for the execution of q." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002305", "lbl" : "causally upstream of, negative effect", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is causally upstream of, negative effect q iff p is casually upstream of q, and the execution of p decreases the execution of q." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002314", "lbl" : "characteristic of part of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "q characteristic of part of w if and only if there exists some p such that q inheres in p and p part of w." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Because part_of is transitive, inheres in is a sub-relation of characteristic of part of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "inheres in part of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/20064205" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002320", "lbl" : "evolutionarily related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds via some environmental process" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002323", "lbl" : "mereotopologically related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A mereological relationship or a topological relationship" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002324", "lbl" : "developmentally related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between entities participating in some developmental process (GO:0032502)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002327", "lbl" : "enables", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c enables p iff c is capable of p and c acts to execute p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "a particular instances of akt-2 enables some instance of protein kinase activity" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "catalyzes" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "executes" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is catalyzing" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is executing" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002328", "lbl" : "functionally related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A grouping relationship for any relationship directly involving a function, or that holds because of a function of one of the related entities." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002329", "lbl" : "part of structure that is capable of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "this relation holds between c and p when c is part of some c', and c' is capable of p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "false" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002331", "lbl" : "involved in", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c involved_in p if and only if c enables some process p', and p' is part of p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "actively involved in" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "enables part of" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002333", "lbl" : "enabled by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of enables" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002334", "lbl" : "regulated by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of regulates" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002335", "lbl" : "negatively regulated by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of negatively regulates" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002336", "lbl" : "positively regulated by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of positively regulates" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002350", "lbl" : "member of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "is member of is a mereological relation between a item and a collection." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "An organism that is a member of a population of organisms" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is member of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "member part of" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "SIO" }, { "pred" : "http://purl.obolibrary.org/obo/RO_0001900", "val" : "http://purl.obolibrary.org/obo/RO_0001901" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002351", "lbl" : "has member", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "has member is a mereological relation between a collection and an item." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Example 1: a collection of sequences such as a genome being comprised of separate sequences of chromosomes\n\nExample 2: a collection of information entities such as a genotype being comprised of a background component and a variant component" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "SIO" }, { "pred" : "http://purl.obolibrary.org/obo/RO_0001900", "val" : "http://purl.obolibrary.org/obo/RO_0001901" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002352", "lbl" : "input of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of has input" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002353", "lbl" : "output of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of has output" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002354", "lbl" : "obsolete_formed as result of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002384", "lbl" : "has developmental potential involving", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x has developmental potential involving y iff x is capable of a developmental process with output y. y may be the successor of x, or may be a different structure in the vicinity (as for example in the case of developmental induction)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002385", "lbl" : "has potential to developmentally contribute to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x has potential to developmentrally contribute to y iff x developmentally contributes to y or x is capable of developmentally contributing to y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002387", "lbl" : "has potential to develop into", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x has the potential to develop into y iff x develops into y or if x is capable of developing into y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002388", "lbl" : "has potential to directly develop into", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x has potential to directly develop into y iff x directly develops into y or x is capable of directly developing into y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002404", "lbl" : "causally downstream of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of upstream of" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002405", "lbl" : "immediately causally downstream of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002407", "lbl" : "indirectly positively regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p indirectly positively regulates q iff p is indirectly causally upstream of q and p positively regulates q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "indirectly activates" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002409", "lbl" : "indirectly negatively regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p indirectly negatively regulates q iff p is indirectly causally upstream of q and p negatively regulates q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "indirectly inhibits" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002410", "lbl" : "causally related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "relation that links two events, processes, states, or objects such that one event, process, state, or object (a cause) contributes to the production of another event, process, state, or object (an effect) where the cause is partly or wholly responsible for the effect, and the effect is partly or wholly dependent on the cause.", "xrefs" : [ "https://en.wikipedia.org/wiki/Causality" ] }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This branch of the ontology deals with causal relations between entities. It is divided into two branches: causal relations between occurrents/processes, and causal relations between material entities. We take an 'activity flow-centric approach', with the former as primary, and define causal relations between material entities in terms of causal relations between occurrents.\n\nTo define causal relations in an activity-flow type network, we make use of 3 primitives:\n\n * Temporal: how do the intervals of the two occurrents relate? \n * Is the causal relation regulatory?\n * Is the influence positive or negative?\n\nThe first of these can be formalized in terms of the Allen Interval Algebra. Informally, the 3 bins we care about are 'direct', 'indirect' or overlapping. Note that all causal relations should be classified under a RO temporal relation (see the branch under 'temporally related to'). Note that all causal relations are temporal, but not all temporal relations are causal. Two occurrents can be related in time without being causally connected. We take causal influence to be primitive, elucidated as being such that has the upstream changed, some qualities of the donwstream would necessarily be modified.\n\nFor the second, we consider a relationship to be regulatory if the system in which the activities occur is capable of altering the relationship to achieve some objective. This could include changing the rate of production of a molecule.\n\nFor the third, we consider the effect of the upstream process on the output(s) of the downstream process. If the level of output is increased, or the rate of production of the output is increased, then the direction is increased. Direction can be positive, negative or neutral or capable of either direction. Two positives in succession yield a positive, two negatives in succession yield a positive, otherwise the default assumption is that the net effect is canceled and the influence is neutral.\n\nEach of these 3 primitives can be composed to yield a cross-product of different relation types." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002411", "lbl" : "causally upstream of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is causally upstream of q iff p is causally related to q, the end of p precedes the end of q, and p is not an occurrent part of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002412", "lbl" : "immediately causally upstream of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is immediately causally upstream of q iff p is causally upstream of q, and the end of p is coincident with the beginning of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002413", "lbl" : "provides input for", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p provides input for q iff p is immediately causally upstream of q, and there exists some c such that p has_output c and q has_input c." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "directly provides input for" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002414", "lbl" : "transitively provides input for", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "transitive form of directly_provides_input_for" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000428" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002418", "lbl" : "causally upstream of or within", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is 'causally upstream or within' q iff p is causally related to q, and the end of p precedes, or is coincident with, the end of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "We would like to make this disjoint with 'preceded by', but this is prohibited in OWL2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "influences (processual)" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002427", "lbl" : "causally downstream of or within", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of causally upstream of or within" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002428", "lbl" : "involved in regulation of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c involved in regulation of p if c is involved in some p' and p' regulates some p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002429", "lbl" : "involved in positive regulation of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c involved in regulation of p if c is involved in some p' and p' positively regulates some p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002430", "lbl" : "involved in negative regulation of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c involved in regulation of p if c is involved in some p' and p' negatively regulates some p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002431", "lbl" : "involved in or involved in regulation of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c involved in or regulates p if and only if either (i) c is involved in p or (ii) c is involved in regulation of p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "OWL does not allow defining object properties via a Union" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "involved in or reguates" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002434", "lbl" : "interacts with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between two entities in which the processes executed by the two entities are causally connected." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This relation and all sub-relations can be applied to either (1) pairs of entities that are interacting at any moment of time (2) populations or species of entity whose members have the disposition to interact (3) classes whose members have the disposition to interact." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Considering relabeling as 'pairwise interacts with'" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002436", "lbl" : "molecularly interacts with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "An interaction relationship in which the two partners are molecular entities that directly physically interact with each other for example via a stable binding interaction or a brief interaction during which one modifies the other." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "binds" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "molecularly binds with" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_000244", "lbl" : "molecularly controls", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between molecular entities a and b when the execution of a activates or inhibits the activity of b" } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002447", "lbl" : "phosphorylates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Axiomatization to GO to be added later" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "An interaction relation between x and y in which x catalyzes a reaction in which a phosphate group is added to y." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002448", "lbl" : "directly regulates activity of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The entity A, immediately upstream of the entity B, has an activity that regulates an activity performed by B. For example, A and B may be gene products and binding of B by A regulates the kinase activity of B.\n\nA and B can be physically interacting but not necessarily. Immediately upstream means there are no intermediate entity between A and B." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-4639-4431" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002449", "lbl" : "directly negatively regulates activity of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The entity A, immediately upstream of the entity B, has an activity that negatively regulates an activity performed by B. \nFor example, A and B may be gene products and binding of B by A negatively regulates the kinase activity of B." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-4639-4431" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "directly inhibits" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002450", "lbl" : "directly positively regulates activity of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The entity A, immediately upstream of the entity B, has an activity that positively regulates an activity performed by B. \nFor example, A and B may be gene products and binding of B by A positively regulates the kinase activity of B." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-4639-4431" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "directly activates" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002464", "lbl" : "helper property (not for use in curation)", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002481", "lbl" : "is kinase activity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002500", "lbl" : "causal agent in process", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between a material entity and a process where the material entity has some causal role that influences the process" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002501", "lbl" : "causal relation between processes", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one where the execution of p influences the execution of q. p may be upstream, downstream, part of, or a container of q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002502", "lbl" : "depends on", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002506", "lbl" : "causal relation between entities", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The intent is that the process branch of the causal property hierarchy is primary (causal relations hold between occurrents/processes), and that the material branch is defined in terms of the process branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002514", "lbl" : "sequentially related to", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relation that holds between two entities that have the property of being sequences or having sequences. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/20226267" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002522", "lbl" : "bounds sequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x bounds the sequence of y iff the upstream-most part of x is upstream of or coincident with the upstream-most part of y, and the downstream-most part of x is downstream of or coincident with the downstream-most part of y" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The genomic exons of a transcript bound the sequence of the genomic introns of the same transcript (but the introns are not subsequences of the exons)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Mungall" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002523", "lbl" : "is bound by sequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of bounds sequence of" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002524", "lbl" : "has subsequence", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x has subsequence y iff all of the sequence parts of y are sequence parts of x" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "contains" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.ncbi.nlm.nih.gov/pubmed/20226267" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002525", "lbl" : "is subsequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of has subsequence" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "contained by" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002526", "lbl" : "overlaps sequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x overlaps the sequence of y if and only if x has a subsequence z and z is a subsequence of y." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.org/dc/terms/source", "val" : "http://biorxiv.org/content/early/2014/06/27/006650.abstract" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002527", "lbl" : "does not overlap sequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x does not overlap the sequence of y if and only if there is no z such that x has a subsequence z and z is a subsequence of y." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "disconnected from" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002528", "lbl" : "is upstream of sequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "inverse of downstream of sequence of" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002529", "lbl" : "is downstream of sequence of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "x is downstream of the sequence of y iff either (1) x and y have sequence units, and all units of x are downstream of all units of y, or (2) x and y are sequence units, and x is either immediately downstream of y, or transitively downstream of y." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002559", "lbl" : "causally influenced by", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002563", "lbl" : "interaction relation helper property", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002564", "lbl" : "molecular interaction relation helper property", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002566", "lbl" : "causally influences", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The entity or characteristic A is causally upstream of the entity or characteristic B, A having an effect on B. An entity corresponds to any biological type of entity as long as a mass is measurable. A characteristic corresponds to a particular specificity of an entity (e.g., phenotype, shape, size)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-4639-4431" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002578", "lbl" : "directly regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p directly regulates q iff p is immediately causally upstream of q and p regulates q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002584", "lbl" : "has part structure that is capable of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "s 'has part structure that is capable of' p if and only if there exists some part x such that s 'has part' x and x 'capable of' p" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "gland SubClassOf 'has part structure that is capable of' some 'secretion by cell'" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002595", "lbl" : "causal relation between material entity and a process", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a material entity and a process in which causality is involved, with either the material entity or some part of the material entity exerting some influence over the process, or the process influencing some aspect of the material entity." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-6601-2165" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002596", "lbl" : "capable of regulating", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between c and p if and only if c is capable of some activity a, and a regulates p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "pyrethroid -> growth" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002597", "lbl" : "capable of negatively regulating", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between c and p if and only if c is capable of some activity a, and a negatively regulates p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002598", "lbl" : "capable of positively regulating", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between c and p if and only if c is capable of some activity a, and a positively regulates p." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "renin -> arteriolar smooth muscle contraction" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002608", "lbl" : "process has causal agent", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Inverse of 'causal agent in process'" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002610", "lbl" : "correlated with", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between two entities, where the entities exhibit a statistical dependence relationship. The entities may be statistical variables, or they may be other kinds of entities such as diseases, chemical entities or processes." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002615", "lbl" : "has model", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Inverse of is-model-of" } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002629", "lbl" : "directly positively regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p directly positively regulates q iff p is immediately causally upstream of q, and p positively regulates q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0002630", "lbl" : "directly negatively regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p directly negatively regulates q iff p is immediately causally upstream of q, and p negatively regulates q." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://purl.obolibrary.org/obo/ro/docs/causal-relations" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003301", "lbl" : "is model of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Relation between a research artifact and an entity it is used to study, in virtue of its replicating or approximating features of the studied entity." }, "comments" : [ "The driving use case for this relation was to link a biological model system such as a cell line or model organism to a disease it is used to investigate, in virtue of the model system exhibiting features similar to that of the disease of interest." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "To Do: decide on scope of this relation - inclusive of computational models in domain, or only physical models? Restricted to linking biological systems and phenomena? Inclusive of only diseases in range, or broader?" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0002-1048-5019" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Matthew Brush" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is used to study" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003302", "lbl" : "causes or contributes to condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some causal or contributing role that influences the condition." }, "comments" : [ "Genetic variations can span any level of granularity from a full genome or genotype to an individual gene or sequence alteration. These variations can be represented at the physical level (DNA/RNA macromolecules or their parts, as in the ChEBI ontology and Molecular Sequence Ontology) or at the abstract level (generically dependent continuant sequence features that are carried by these macromolecules, as in the Sequence Ontology and Genotype Ontology). The causal relations in this hierarchy can be used in linking either physical or abstract genetic variations to phenotypes or diseases they cause or contribute to.\n\nEnvironments include natural environments or exposures, experimentally applied conditions, or clinical interventions." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The genetic variant 'NM_007294.3(BRCA1):c.110C>A (p.Thr37Lys)' casues or contributes to the disease 'familial breast-ovarian cancer'.\n\nAn environment of exposure to arsenic causes or contributes to the phenotype of patchy skin hyperpigmentation, and the disease 'skin cancer'." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Note that relationships of phenotypes to organisms/strains that bear them, or diseases they are manifest in, should continue to use RO:0002200 ! 'has phenotype' and RO:0002201 ! 'phenotype of'." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003303", "lbl" : "causes condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some causal role for the condition." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003304", "lbl" : "contributes to condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity has some contributing role that influences the condition." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003305", "lbl" : "contributes to severity of condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity influences the severity with which a condition manifests in an individual." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "contributes to expressivity of condition" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003306", "lbl" : "contributes to frequency of condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the entity influences the frequency of the condition in a population." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "contributes to penetrance of condition" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003307", "lbl" : "is preventative for condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity (e.g. a genotype, genetic variation, chemical, or environmental exposure) and a condition (a phenotype or disease), where the presence of the entity reduces or eliminates some or all aspects of the condition." }, "comments" : [ "Genetic variations can span any level of granularity from a full genome or genotype to an individual gene or sequence alteration. These variations can be represented at the physical level (DNA/RNA macromolecules or their parts, as in the ChEBI ontology and Molecular Sequence Ontology) or at the abstract level (generically dependent continuant sequence features that are carried by these macromolecules, as in the Sequence Ontology and Genotype Ontology). The causal relations in this hierarchy can be used in linking either physical or abstract genetic variations to phenotypes or diseases they cause or contribute to. \n\nEnvironments include natural environments or exposures, experimentally applied conditions, or clinical interventions." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "is preventative for condition" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0003308", "lbl" : "correlated with condition", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship between an entity and a condition (phenotype or disease) with which it exhibits a statistical dependence relationship." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0004031", "lbl" : "enables subfunction", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "Holds between an entity and an process P where the entity enables some larger compound process, and that larger process has-part P." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0004032", "lbl" : "acts upstream of or within, positive effect", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0004033", "lbl" : "acts upstream of or within, negative effect", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0004034", "lbl" : "acts upstream of, positive effect", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c 'acts upstream of, positive effect' p if c is enables f, and f is causally upstream of p, and the direction of f is positive" } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0004035", "lbl" : "acts upstream of, negative effect", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "c 'acts upstream of, negative effect' p if c is enables f, and f is causally upstream of p, and the direction of f is negative" } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0004046", "lbl" : "causally upstream of or within, negative effect", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0004047", "lbl" : "causally upstream of or within, positive effect", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0010001", "lbl" : "generically depends on", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A generically dependent continuant *b* generically depends on an independent continuant *c* at time *t* means: there inheres in *c* a specifically deendent continuant which concretizes *b* at *t*." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Genetic information generically depend on molecules of DNA." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The novel *War and Peace* generically depends on this copy of the novel." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The pattern shared by chess boards generically depends on any chess board." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The score of a symphony g-depends on a copy of the score." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "This pdf file generically depends on this server." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "[072-ISO]" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0010002", "lbl" : "is carrier of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "*b* is carrier of *c* at time *t* if and only if *c* *g-depends on* *b* at *t*" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Molecules of DNA are carriers of genetic information." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "This copy of *War and Peace* is carrier of the novel written by Tolstoy." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "This hard drive is carrier of these data items." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "[072-ISO]" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0011002", "lbl" : "regulates activity of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "The entity A has an activity that regulates an activity of the entity B. For example, A and B are gene products where the catalytic activity of A regulates the kinase activity of B." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "https://orcid.org/0000-0003-4639-4431" } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0012011", "lbl" : "indirectly causally upstream of", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p is indirectly causally upstream of q iff p is causally upstream of q and there exists some process r such that p is causally upstream of r and r is causally upstream of q." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0012012", "lbl" : "indirectly regulates", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "p indirectly regulates q iff p is indirectly causally upstream of q and p regulates q." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0016001", "lbl" : "has phenotype or disease", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.obolibrary.org/obo/RO_0017001", "lbl" : "device utilizes material", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "X device utilizes material Y means X and Y are material entities, and X is capable of some process P that has input Y." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A diagnostic testing device utilizes a specimen." } ] } }, { "id" : "http://purl.obolibrary.org/obo/RO_0019000", "lbl" : "regulates characteristic", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a process and a characteristic in which process (P) regulates characteristic (C) iff: P results in the existence of C OR affects the intensity or magnitude of C." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0019001", "lbl" : "positively regulates characteristic", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a process and a characteristic in which process (P) positively regulates characteristic (C) iff: P results in an increase in the intensity or magnitude of C." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0019002", "lbl" : "negatively regulates characteristic", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "A relationship that holds between a process and a characteristic in which process (P) negatively regulates characteristic (C) iff: P results in a decrease in the intensity or magnitude of C." } } }, { "id" : "http://purl.obolibrary.org/obo/RO_0020105", "lbl" : "is anatomical entity", "type" : "PROPERTY", "propertyType" : "OBJECT", "meta" : { "definition" : { "val" : "This property only applies to anatomical entities." } } }, { "id" : "http://purl.org/oban/association_has_object", "lbl" : "association has object", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.org/oban/association_has_predicate", "lbl" : "association has predicate", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://purl.org/oban/association_has_subject", "lbl" : "association has subject", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://www.geneontology.org/formats/oboInOwl#ObsoleteProperty", "type" : "PROPERTY", "propertyType" : "OBJECT" }, { "id" : "http://biohackathon.org/resource/faldo#position", "lbl" : "position", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "comments" : [ "The position value is the offset along the reference where this position is found. Thus the only the position value in combination with the reference determines where a position is." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000678", "lbl" : "has_extent", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "Property linking a sequence or sequence feature to an integer representing its length in terms of the number of units in the sequence." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000703", "lbl" : "has_sequence_string", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "Shortcut relation linking a sequence feature directly to a string representing the 'state' of its sequence - i.e. the ordering of units that comprise it (e.g. 'atgcagctagctaccgtcgatcg')." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000712", "lbl" : "ObsoleteDataProperty", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000866", "lbl" : "has_quantifier", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "Property to link an assertion or association with some value quantifying its relevance or ranking." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "The 'rank' quantifier in Bgee gene-anatomy associations, that indicates the imporatnace/specificity of a gene expression in a given anatommy relative to expressionin other anatomies for the same gene." } ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000894", "lbl" : "start_position", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "The starting position of a sequence feature or interval." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000895", "lbl" : "end_position", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "The ending position of a sequence feature or interval." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000896", "lbl" : "has_string", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "Property linking a biological sequence to a string representing the ordered units that comprise the sequence (e.g. 'atgcagctagctaccgtcgatcg')." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000917", "lbl" : "has_member_count", "type" : "PROPERTY", "propertyType" : "DATA", "meta" : { "definition" : { "val" : "Describes the number of members in some set." }, "comments" : [ "In GENO, this is used to describe things like the number of sequence features comprising a 'sequence feature set', the number of sequences in a 'biological sequence set', or the number of functional sequences defining a particular 'functional copy number complement'." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "has_count" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001569", "lbl" : "Western Australian Mulga Shrublands Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1310" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1310" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001571", "lbl" : "Australasia Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "https://www.worldwildlife.org/biomes/deserts-and-xeric-shrublands" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001572", "lbl" : "Tirari-Sturt Stony Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1309" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1309" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001573", "lbl" : "Simpson Desert Region", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1308" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1308" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001574", "lbl" : "Pilbara Shrublands Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1307" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1307" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001575", "lbl" : "Carnarvon Xeric Shrublands Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1301" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1301" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001576", "lbl" : "Central Ranges Xeric Shrub Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1302" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1302" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001577", "lbl" : "Gibson Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1303" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1303" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001578", "lbl" : "The Great Sandy-Tanami Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1304" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1304" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001579", "lbl" : "Great Victoria Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1305" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1305" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001580", "lbl" : "Nullarbor Plains Xeric Shrubland Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AA1306" }, { "val" : "https://www.worldwildlife.org/ecoregions/aa1306" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001583", "lbl" : "Afrotropical Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "https://www.worldwildlife.org/biomes/deserts-and-xeric-shrublands" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001584", "lbl" : "Succulent Karoo Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1322" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1322" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001585", "lbl" : "Yemen and Saudi Arabia Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1321" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1321" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001586", "lbl" : "Yemen, Saudi Arabia, and Oman Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1320" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1320" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001587", "lbl" : "Somali Montane Xeric Woodland Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1319" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1319" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001588", "lbl" : "Socotran Archipelago Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1318" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1318" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001589", "lbl" : "Red Sea Coastal Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1317" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1317" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001590", "lbl" : "Namibian Savanna Woodland Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1316" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1316" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001591", "lbl" : "Namib Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1315" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1315" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001592", "lbl" : "Nama Karoo Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1314" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1314" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001593", "lbl" : "Masai Xeric Grasslands and Shrublands Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1313" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1313" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001594", "lbl" : "Madagascar Succulent Woodlands Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1312" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1312" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001595", "lbl" : "Madagascar Spiny Thickets Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1311" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1311" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001596", "lbl" : "Kaokoveld Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1310" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1310" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001597", "lbl" : "Kalahari Xeric Savanna Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1309" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1309" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001598", "lbl" : "Ile Europa and Bassas da India Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1308" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1308" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001599", "lbl" : "Hobyo Grassland and Shrubland Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1307" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1307" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001600", "lbl" : "Oman and United Arab Emirates Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1306" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1306" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001601", "lbl" : "Ethiopian Xeric Grasslands and Shrublands Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1305" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1305" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001602", "lbl" : "Eritrean Coastal Desert Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1304" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1304" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001603", "lbl" : "East Saharan Montane Xeric Woodland Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1303" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1303" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001604", "lbl" : "Oman, Yemen, and Saudi Arabia Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1302" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1302" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001605", "lbl" : "Aldabra Island Xeric Scrub Ecoregion", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:AT1301" }, { "val" : "https://www.worldwildlife.org/ecoregions/at1301" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001626", "lbl" : "Indo-Malay Ecoregion", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://www.geneontology.org/formats/oboInOwl#hasDbXref", "val" : "https://www.worldwildlife.org/biomes/deserts-and-xeric-shrublands" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001627", "lbl" : "Thar Desert", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:IM1304" } ], "basicPropertyValues" : [ { "pred" : "http://www.geneontology.org/formats/oboInOwl#hasDbXref", "val" : "https://www.worldwildlife.org/ecoregions/im1304" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001628", "lbl" : "Northwestern Thorn Scrub Forests", "type" : "INDIVIDUAL", "meta" : { "xrefs" : [ { "val" : "WWF:IM1303" } ], "basicPropertyValues" : [ { "pred" : "http://www.geneontology.org/formats/oboInOwl#hasDbXref", "val" : "https://www.worldwildlife.org/ecoregions/im1303" } ] } }, { "id" : "http://purl.obolibrary.org/obo/ENVO_01001862", "lbl" : "Solar radiation", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Stellar radiation emitted from Sol." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000484", "lbl" : "exploratory term", "type" : "INDIVIDUAL" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000514", "lbl" : "exemplar term", "type" : "INDIVIDUAL" }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000002", "lbl" : "example to be eventually removed", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "example to be eventually removed" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000103", "lbl" : "failed exploratory term", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "The term was used in an attempt to structure part of the ontology but in retrospect failed to do a good job" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "failed exploratory term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000120", "lbl" : "metadata complete", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Class has all its metadata, but is either not guaranteed to be in its final location in the asserted IS_A hierarchy or refers to another class that is not complete." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "metadata complete" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000121", "lbl" : "organizational term", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "The term was created to ease viewing/sorting terms for development purposes, but will not be included in a release." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "organizational term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000122", "lbl" : "ready for release", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Class has undergone final review, is ready for use, and will be included in the next release. Any class lacking \"ready_for_release\" should be considered likely to change place in hierarchy, have its definition refined, or be obsoleted in the next release. Those classes deemed \"ready_for_release\" will also derived from a chain of ancestor classes that are also \"ready_for_release.\"" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ready for release" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000123", "lbl" : "metadata incomplete", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Class is being worked on; however, the metadata (including definition) are not complete or sufficiently clear to the branch editors." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "metadata incomplete" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000124", "lbl" : "uncurated", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Nothing done yet beyond assigning a unique class ID and proposing a preferred term." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "uncurated" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000125", "lbl" : "pending final vetting", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "All definitions, placement in the asserted IS_A hierarchy and required minimal metadata are complete. The class is awaiting a final review by someone other than the term editor." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pending final vetting" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000224", "lbl" : "obsolete_core", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Core is an instance of a grouping of terms from an ontology or ontologies. It is used by the ontology to identify main classes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000231", "val" : "http://purl.obolibrary.org/obo/IAO_0000226" } ], "deprecated" : true } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000226", "lbl" : "placeholder removed", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "placeholder removed" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000227", "lbl" : "terms merged", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "terms merged" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "An editor note should explain what were the merged terms and the reason for the merge." } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000228", "lbl" : "term imported", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "term imported" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This is to be used when the original term has been replaced by a term imported from an other ontology. An editor note should indicate what is the URI of the new term to use." } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000229", "lbl" : "term split", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "term split" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This is to be used when a term has been split in two or more new terms. An editor note should indicate the reason for the split and indicate the URIs of the new terms created." } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000410", "lbl" : "universal", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "universal" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "Hard to give a definition for. Intuitively a \"natural kind\" rather than a collection of any old things, which a class is able to be, formally. At the meta level, universals are defined as positives, are disjoint with their siblings, have single asserted parents." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "A Formal Theory of Substances, Qualities, and Universals, http://ontology.buffalo.edu/bfo/SQU.pdf" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000420", "lbl" : "defined class", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A defined class is a class that is defined by a set of logically necessary and sufficient conditions but is not a universal" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "defined class" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "\"definitions\", in some readings, always are given by necessary and sufficient conditions. So one must be careful (and this is difficult sometimes) to distinguish between defined classes and universal." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000421", "lbl" : "named class expression", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A named class expression is a logical expression that is given a name. The name can be used in place of the expression." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "named class expression" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "named class expressions are used in order to have more concise logical definition but their extensions may not be interesting classes on their own. In languages such as OWL, with no provisions for macros, these show up as actuall classes. Tools may with to not show them as such, and to replace uses of the macros with their expansions" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000423", "lbl" : "to be replaced with external ontology term", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Terms with this status should eventually replaced with a term from another ontology." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "to be replaced with external ontology term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000428", "lbl" : "requires discussion", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A term that is metadata complete, has been reviewed, and problems have been identified that require discussion before release. Such a term requires editor note(s) to identify the outstanding issues." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "requires discussion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "group:OBI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000317", "lbl" : "Transformation-ML", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Transformation-ML is a format standard of a digital entity that is conformant with the Transformation-ML standard.(http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Transformation-ML" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Transformation-ML file describing parameter transformations used in a GvHD experiment." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://wiki.ficcs.org/ficcs/Transformation-ML?action=AttachFile&do=get&target=Transformation-ML_v1.0.26.pdf" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000321", "lbl" : "ACS", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "ACS is a format standard of a digital entity that is conformant with the Analytical Cytometry Standard. (http://www.isac-net.org/content/view/607/150/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ACS" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "d06.acs, ACS1.0 data file of well D06 of plate 2 of part 1 of a GvHD experiment." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.isac-net.org/content/view/607/150/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000322", "lbl" : "XML", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "XML is a format standard of a digital entity that is conformant with the W3C Extensible Markup Language Recommendation.(http://www.w3.org/XML/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "XML" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "RDF/XML file, OWL file, Compensation-ML file, WSDL document, SVG document" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.w3.org/XML/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000324", "lbl" : "RDF", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "RDF is a format standard of a digital entity that is conformant with the W3C Resource Description Framework RDF/XML Syntax specification.(http://www.w3.org/RDF/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "RDF" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "A FOAF file, a SKOS file, an OWL file." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.w3.org/RDF/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000325", "lbl" : "zip", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "zip is a format standard of a digital entity that is conformant with the PKWARE .ZIP file format specification (http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "zip" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "MagicDraw MDZIP archive, Java JAR file." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.pkware.com/index.php?option=com_content&task=view&id=59&Itemid=103/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000326", "lbl" : "tar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "tar is a format standard of a digital entity that is conformant with the tape archive file format as standardized by POSIX.1-1998, POSIX.1-2001, or any other tar format compliant with the GNU tar specification. (http://www.gnu.org/software/tar/manual/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "tar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Example.tar file." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.gnu.org/software/tar/manual/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000327", "lbl" : "FCS", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "FCS is a format standard of a digital entity that is conformant with the Flow Cytometry Data File Standard.(http://www.fcspress.com/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "FCS" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "d01.fcs, FCS3 data file of well D06 of plate 2 of part 1 of a GvHD experiment." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.fcspress.com/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000329", "lbl" : "Compensation-ML", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Compensation-ML is a format standard of a digital entity that is conformant with the Compensation-ML standard. (http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Compensation-ML" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "compfoo.xml, Compensation-ML file describing compensation used in a GvHD experiment" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://wiki.ficcs.org/ficcs/Compensation-ML?action=AttachFile&do=get&target=Compensation-ML_v1.0.24.pdf" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000330", "lbl" : "Gating-ML", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "Gating-ML is a format standard of a digital entity that is conformant with the Gating-ML standard. (http://www.flowcyt.org/gating/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Gating-ML" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "foogate.xml, Gating-ML file describing gates used in a GvHD experiment." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.flowcyt.org/gating/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000332", "lbl" : "OWL", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "OWL is a format standard of a digital entity that is conformant with the W3C Web Ontology Language specification.(http://www.w3.org/2004/OWL/)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "OWL" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "OBI ontology file, Basic Formal Ontology file, BIRNLex file, BioPAX file." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Jennifer Fostel" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "web-page:http://www.w3.org/2004/OWL/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000462", "lbl" : "Affymetrix", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization which supplies technology, tools and protocols for use in high throughput applications" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Affymetrix" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Affymetrix supplied microarray" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000752", "lbl" : "Thermo", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Thermo" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000753", "lbl" : "Waters", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Waters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000754", "lbl" : "BIO-RAD", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "BIO-RAD" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000755", "lbl" : "GenePattern hierarchical clustering", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern hierarchical clustering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000756", "lbl" : "Ambion", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Ambion" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000757", "lbl" : "Helicos", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Helicos" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000758", "lbl" : "Roche", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Roche" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000759", "lbl" : "Illumina", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Illumina" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000760", "lbl" : "GenePattern PCA", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern PCA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000761", "lbl" : "GenePattern module SVM", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module SVM is a GenePattern software module which is used to run a support vector machine data transformation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module SVM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Ryan Brinkman" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000762", "lbl" : "GenePattern k-nearest neighbors", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern k-nearest neighbors" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000763", "lbl" : "GenePattern LOOCV", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern LOOCV" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000764", "lbl" : "GenePattern k-means clustering", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern k-means clustering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000765", "lbl" : "Agilent", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Agilent" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000766", "lbl" : "GenePattern module KMeansClustering", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module KMeansClustering is a GenePattern software module which is used to perform a k Means clustering data transformation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module KMeansClustering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000767", "lbl" : "GenePattern CART", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern CART" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000768", "lbl" : "GenePattern module CARTXValidation", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module CARTXValidation is a GenePattern software module which uses a CART decision tree induction with a leave one out cross validation data transformations." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module CARTXValidation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000769", "lbl" : "Li-Cor", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Li-Cor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000770", "lbl" : "Bruker Corporation", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Bruker Corporation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000771", "lbl" : "GenePattern module KNNXValidation", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module KNNXValidation is a GenePattern software module which uses a k-nearest neighbours clustering with a leave one out cross validation data transformations." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module KNNXValidation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000772", "lbl" : "GenePattern module PeakMatch", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module PeakMatch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000773", "lbl" : "GenePattern module KNN", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module KNN is a GenePattern software module which perform a k-nearest neighbors data transformation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module KNN" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000774", "lbl" : "GenePattern module HierarchicalClustering", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module HierarchicalClustering is a GenePattern software module which is used to perform a hierarchical clustering data transformation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module HierarchicalClustering" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000775", "lbl" : "GenePattern SVM", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern SVM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000776", "lbl" : "Applied Biosystems", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Applied Biosystems" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000777", "lbl" : "GenePattern module PCA", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "GenePattern module PCA is a GenePattern software module which is used to perform a principal components analysis dimensionality reduction data transformation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module PCA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PERSON: James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000778", "lbl" : "GenePattern peak matching", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern peak matching" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Ryan Brinkman" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000779", "lbl" : "Bruker Daltonics", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Bruker Daltonics" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Philippe Rocca-Serra" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000780", "lbl" : "GenePattern HeatMapViewer data visualization", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "The GenePattern process of generating Heat Maps from clustered data." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern HeatMapViewer data visualization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000781", "lbl" : "GenePattern HierarchicalClusteringViewer data visualization", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "The GenePattern process of generating hierarchical clustering visualization from clustered data." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern HierarchicalClusteringViewer data visualization" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000782", "lbl" : "GenePattern module HeatMapViewer", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A GenePattern software module which is used to generate a heatmap view of data." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module HeatMapViewer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000783", "lbl" : "GenePattern module HierarchicalClusteringViewer", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A GenePattern software module which is used to generate a view of data that has been hierarchically clustered." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "GenePattern module HierarchicalClusteringViewer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James Malone" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000829", "lbl" : "Sysmex Corporation, Kobe, Japan", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Sysmex Corporation, Kobe, Japan" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.sysmex.com/@2009/08/06" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000901", "lbl" : "U.S. Food and Drug Administration", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "U.S. Food and Drug Administration" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "FDA" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000958", "lbl" : "right handed", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "right handed" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000979", "lbl" : "ambidexterous", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ambidexterous" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0000998", "lbl" : "left handed", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "left handed" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001004", "lbl" : "Edingburgh handedness inventory", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "The Edinburgh Handedness Inventory is a set of questions used to assess the dominance of a person's right or left hand in everyday activities. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Edingburgh handedness inventory" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Jessica Turner" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "PMID:5146491#Oldfield, R.C. (1971). The assessment and analysis of handedness: The Edinburgh inventory. Neuropsychologia, 9, 97-113" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.cse.yorku.ca/course_archive/2006-07/W/4441/EdinburghInventory.html" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001213", "lbl" : "eBioscience", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "eBioscience" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.ebioscience.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001224", "lbl" : "Cytopeia", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Cytopeia" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.cytopeia.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001287", "lbl" : "Exalpha Biological", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Exalpha Biological" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.exalpha.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001312", "lbl" : "Apogee Flow Systems", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Apogee Flow Systems" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.apogeeflow.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001320", "lbl" : "Exbio Antibodies", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Exbio Antibodies" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.exbio.cz/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001321", "lbl" : "Becton Dickinson (BD Biosciences)", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Becton Dickinson (BD Biosciences)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.bdbiosciences.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001338", "lbl" : "Dako Cytomation", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Dako Cytomation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.dakousa.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001340", "lbl" : "Millipore", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Millipore" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.guavatechnologies.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001347", "lbl" : "Antigenix", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Antigenix" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.antigenix.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001355", "lbl" : "Partec", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Partec" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.partec.de/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001372", "lbl" : "Beckman Coulter", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Beckman Coulter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.beckmancoulter.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001375", "lbl" : "Advanced Instruments Inc. (AI Companies)", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Advanced Instruments Inc. (AI Companies)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.aicompanies.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001424", "lbl" : "Miltenyi Biotec", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Miltenyi Biotec" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.miltenyibiotec.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001428", "lbl" : "AES Chemunex", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "AES Chemunex" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.aeschemunex.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001431", "lbl" : "Bentley Instruments", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Bentley Instruments" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://bentleyinstruments.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001434", "lbl" : "Invitrogen", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Invitrogen" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.invitrogen.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001443", "lbl" : "Luminex", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Luminex" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.luminexcorp.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001458", "lbl" : "CytoBuoy", "type" : "INDIVIDUAL", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "CytoBuoy" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Karin Breuer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:http://www.cytobuoy.com/@2011/04/11" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001855", "lbl" : "Nimblegen", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization that focuses on manufacturing target enrichment probe pools for DNA sequencing." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Nimblegen" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Jie Zheng" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001856", "lbl" : "Pacific Biosciences", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization that supplies tools for studying the synthesis and regulation of DNA, RNA and protein. It developed a powerful technology platform called single molecule real-time (SMRT) technology which enables real-time analysis of biomolecules with single molecule resolution." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Pacific Biosciences" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Jie Zheng" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0001860", "lbl" : "NanoString Technologies", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization that supplies life science tools for translational research and molecular diagnostics based on a novel digital molecular barcoding technology. The NanoString platform can provide simple, multiplexed digital profiling of single molecules." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "NanoString Technologies" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000123" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002193", "lbl" : "Thermo Fisher Scientific", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization that is an American multinational, biotechnology product development company, created in 2006 by the merger of Thermo Electron and Fisher Scientific." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Thermo Fisher Scientific" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Thermo_Fisher_Scientific" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002206", "lbl" : "G1: Well differentiated", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to AJCC 7th edition indicating that the tumor cells and the organization of the tumor tissue appear close to normal." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G1: Well differentiated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002207", "lbl" : "G2: Moderately differentiated", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to AJCC 7th edition indicating that the tumor cells are moderately differentiated and reflect an intermediate grade." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G2: Moderately differentiated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002208", "lbl" : "G3: Poorly differentiated", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to AJCC 7th edition indicating that the tumor cells are poorly differentiated and do not look like normal cells and tissue." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G3: Poorly differentiated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G3" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002209", "lbl" : "G4: Undifferentiated", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to AJCC 7th edition indicating that the tumor cells are undifferentiated and do not look like normal cells and tissue." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G4: Undifferentiated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G4" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://www.cancer.gov/about-cancer/diagnosis-staging/prognosis/tumor-grade-fact-sheet" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002211", "lbl" : "G1 (Fuhrman)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are round, uniform, approximately 10um and that nucleoli are inconspicuous or absent." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G1 (Fuhrman)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Grade 1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002212", "lbl" : "G2 (Fuhrman)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are slightly irregular, approximately 15um and nucleoli are evident." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G2 (Fuhrman)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Grade 2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002213", "lbl" : "G3 (Fuhrman)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei are very irregular, approximately 20um and nucleoli large and prominent." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G3 (Fuhrman)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Grade 3" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002214", "lbl" : "G4 (Fuhrman)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade according to the Fuhrman Nuclear Grading System indicating that nuclei arei bizarre and multilobulated, 20um or greater and nucleoli are prominent and chromatin clumped." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G4 (Fuhrman)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Grade 4" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002217", "lbl" : "Low grade ovarian tumor", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is low grade." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Low grade ovarian tumor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Low grade" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002218", "lbl" : "High grade ovarian tumor", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor according to a two-tier grading system indicating that the tumor is high grade." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "High grade ovarian tumor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "High grade" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002220", "lbl" : "G1 (WHO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is well differentiated." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G1 (WHO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002221", "lbl" : "G2 (WHO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is moderately differentiated." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G2 (WHO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002222", "lbl" : "G3 (WHO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is poorly differentiated." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G3 (WHO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G3" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002223", "lbl" : "G4 (WHO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A histologic grade for ovarian tumor according to the World Health Organization indicating that the tumor is undifferentiated." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "G4 (WHO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "G4" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002225", "lbl" : "pT0 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that there is no evidence of primary tumor." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT0 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002226", "lbl" : "pTis (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating carcinoma in situ (intraepithelial or invasion of lamina propria)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pTis (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002227", "lbl" : "pT1 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades submucosa." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002228", "lbl" : "pT2 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades muscularis propria." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002229", "lbl" : "pT3 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor invades subserosa or into non-peritionealized pericolic or perirectal tissues." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002230", "lbl" : "pT4a (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor perforates visceral peritoneum." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT4a (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002231", "lbl" : "pT4b (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for colon and rectum according to AJCC 7th edition indicating that the tumor directly invades other organs or structures." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT4b (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002233", "lbl" : "pT0 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that there is no evidence of primary tumor." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT0 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002234", "lbl" : "pTis (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating carcinoma in situ." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pTis (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002235", "lbl" : "pT1 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 3 cm or less in greatest dimension, surrounded by lung or visceral pleura without bronchoscopic evidence of invasion more proximal than the lobar bronchus (i.e., not in the main bronchus)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002236", "lbl" : "pT1a (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is 2 cm or less in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1a (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002237", "lbl" : "pT1b (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 2 cm but not more than 3 cm in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1b (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002238", "lbl" : "pT2 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 7 cm or the tumor has any of the following features: involves main bronchus, 2 cm or more distal to the carina, invades visceral pleura, associated with atelectasis or obstructive pneumonitis that extends to the hilar region but does not involve the entire lung." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002239", "lbl" : "pT2a (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 3 cm but not more than 5 cm in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2a (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002240", "lbl" : "pT2b (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 5 cm but not more than 7 cm in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2b (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002241", "lbl" : "pT3 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor is more than 7 cm or one that directly invades any of: parietal pleura, chest wall (including superior sulcus tumors), diaphragm, phrenic nerve, mediastinal pleura, parietal pericardiu or the tumor is in the main bronchus less than 2 cm distal to the carina but without involvement of the carina or there is associated atelectasis or obstructive pneumonitis of the entire lung or there is separate tumor nodule(s) in the same lobe as the primary." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002242", "lbl" : "pT4 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for lung according to AJCC 7th edition indicating that the tumor of any size that invades any of the following: mediastinum, heart, great vessels, trachea, recurrent laryngeal nerve, esophagus, vertebral body, carina or there is separate tumor nodule(s) in a different ipsilateral lobe to that of the primary." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT4 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002244", "lbl" : "pT0 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that there is no evidence of primary tumor." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT0 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002245", "lbl" : "pT1 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 7 cm or less in greatest dimension and limited to the kidney." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002246", "lbl" : "pT1a (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is 4 cm or less." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1a (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002247", "lbl" : "pT1b (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 4 cm but not more than 7 cm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1b (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002248", "lbl" : "pT2 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm in greatest dimension and limited to the kidney." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002249", "lbl" : "pT2a (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 7 cm but not more than 10 cm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2a (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002250", "lbl" : "pT2b (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor is more than 10 cm and limited to the kidney." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2b (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002251", "lbl" : "pT3 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor extends into major veins or perinephric tissues but not into the ipsilateral adrenal gland and not beyond the Gerota fascia." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002252", "lbl" : "pT3a (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into the renal vein or its segmental (muscle containing) branches, or the tumor invades perirenal and/or renal sinus fat (peripelvic) fat but not beyond Gerota fascia." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3a (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002253", "lbl" : "pT3b (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava below diaphragm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3b (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002254", "lbl" : "pT3c (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor grossly extends into vena cava above the diaphragm or Invades the wall of the vena cava." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3c (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002255", "lbl" : "pT4 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for kidney according to AJCC 7th edition indicating that the tumor invades beyond Gerota fascia (including contiguous extension into the ipsilateral adrenal gland)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT4 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002257", "lbl" : "pT0 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that there is no evidence of primary tumor." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT0 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002258", "lbl" : "pT1 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to the ovaries (one or both)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002259", "lbl" : "pT1a (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one ovary; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1a (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002260", "lbl" : "pT1b (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to both ovaries; capsule intact, no tumor on ovarian surface and no malignant cells in ascites or peritoneal washings." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1b (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002261", "lbl" : "pT1c (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor is limited to one or both ovaries with capsule ruptured, tumor on ovarian surface, or malignant cells in ascites or peritoneal washings." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT1c (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002262", "lbl" : "pT2 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with pelvic extension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002263", "lbl" : "pT2a (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension and/or implants on uterus and/or tube(s) and no malignant cells in ascites or peritoneal washings." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2a (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002264", "lbl" : "pT2b (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has extension to other pelvic tissues and no malignant cells in ascites or peritoneal washings." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2b (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002265", "lbl" : "pT2c (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has pelvic extension with malignant cells in ascites or peritoneal washings." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT2c (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002266", "lbl" : "pT3 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor involves one or both ovaries with microscopically confirmed peritoneal metastasis outside the pelvis and/or regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002267", "lbl" : "pT3a (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has microscopic peritoneal metastasis beyond pelvis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3a (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002268", "lbl" : "pT3b (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has macroscopic peritoneal, metastatasis beyond pelvis, 2 cm or less in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3b (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002269", "lbl" : "pT3c (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic primary tumor stage for ovary according to AJCC 7th edition indicating that the tumor has peritoneal metastasis beyond pelvis, more than 2 cm in greatest dimension and/or regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pT3c (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_t/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002271", "lbl" : "pN0 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating no regional lymph node metastsis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN0 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002272", "lbl" : "pN1 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1-3 regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002273", "lbl" : "pN1a (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 1 regional lymph node." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1a (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002274", "lbl" : "pN1b (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 2-3 regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1b (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002275", "lbl" : "pN1c (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating tumor deposit(s), i.e., satellites in the subserosa, or in non-peritonealized pericolic or perirectal soft tissue without regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1c (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002276", "lbl" : "pN2 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 or more regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN2 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002277", "lbl" : "pN2a (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 4 to 6 regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN2a (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002278", "lbl" : "pN2b (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for colon and rectum according to AJCC 7th edition indicating metastasis in 7 or more regional lymph nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN2b (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002280", "lbl" : "pN0 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for lung according to AJCC 7th edition indicating no regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN0 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002281", "lbl" : "pN1 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral peribronchial and/or ipsilateral hilar lymph nodes and intrapulmonary nodes, including involvement by direct extension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002282", "lbl" : "pN2 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in ipsilateral mediastinal and/or subcarinal lymph node(s)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN2 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002283", "lbl" : "pN3 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for lung according to AJCC 7th edition indicating metastasis in contralateral mediastinal, contralateral hilar, ipsilateral or contralateral scalene, or supraclavicular lymph node(s)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN3 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002285", "lbl" : "pN0 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is no regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN0 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002286", "lbl" : "pN1 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for kidney according to AJCC 7th edition indicating that there is regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002288", "lbl" : "pN0 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is no regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN0 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002289", "lbl" : "pN1 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic lymph node stage for ovary according to AJCC 7th edition indicating that there is regional lymph node metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pN1 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_n/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002291", "lbl" : "cM0 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there are no symptoms or signs of distant metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM0 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging#Pathological_M_Categorization_.28cM_and_pM.29" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002292", "lbl" : "cM1 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is clinical evidence of distant metastases by history, physical examination, imaging studies, or invasive procedures, but without microscopic evidence of the presumed distant metastases." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging#Pathological_M_Categorization_.28cM_and_pM.29" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002293", "lbl" : "cM1a (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ based on clinical assessment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1a (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002294", "lbl" : "cM1b (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum based on clinical assessment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1b (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002295", "lbl" : "pM1 (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that there is microscopic evidence confirming distant metastatic disease." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1 (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002296", "lbl" : "pM1a (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is confined to one organ and histologically confirmed." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1a (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002297", "lbl" : "pM1b (colon)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for colon according to AJCC 7th edition indicating that metastasis is in more than one organ or the peritoneum and histologically confirmed." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1b (colon)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/colon/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002299", "lbl" : "cM0 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is no distant metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM0 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002300", "lbl" : "cM1 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002301", "lbl" : "cM1a (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is based on clinical assessment and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1a (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002302", "lbl" : "cM1b (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases based on clinical assessment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1b (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002303", "lbl" : "pM1 (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1 (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002304", "lbl" : "pM1a (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that metastasis is histologically confirmed and a separate tumor nodule(s) in a contralateral lobe; tumor with pleural nodules OR malignant pleural or pericardial effusion." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1a (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002305", "lbl" : "pM1b (lung)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for lung according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed and associated with distant lymph nodes or carcinomatosis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1b (lung)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/lung/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002307", "lbl" : "cM0 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is no distant metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM0 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002308", "lbl" : "cM1 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there are distant metastases based on clinical assessment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002309", "lbl" : "pM1 (kidney)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for kidney according to AJCC 7th edition indicating that there is a distant metastases that is histologically confirmed." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1 (kidney)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/kidney_parenchyma/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002311", "lbl" : "cM0 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is no distant metastasis." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM0 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002312", "lbl" : "cM1 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis based on clinical assessment." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cM1 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002313", "lbl" : "pM1 (ovary)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A pathologic distant metastases stage for ovary according to AJCC 7th edition indicating that there is distant metastasis except peritoneal metastasis that is histologically confirmed." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pM1 (ovary)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_m/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002315", "lbl" : "Occult Carcinoma (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating a small carcinoma, either asymptomatic or giving rise to metastases without symptoms due to the primary carcinoma." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Occult Carcinoma (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Occult Carcinoma" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "http://www.medilexicon.com/dictionary/14371" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002316", "lbl" : "Stage 0 (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating a carcinoma in situ (or melanoma in situ for melanoma of the skin or germ cell neoplasia in situ for testicular germ cell tumors) and generally is considered to have no metastatic potential. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 0 (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 0" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002317", "lbl" : "Stage I (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers that are smaller or less deeply invasive without regional disease or nodes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage I (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage I" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002318", "lbl" : "Stage IIA (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIB and IIC." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIA (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002319", "lbl" : "Stage IIB (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIC." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIB (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002320", "lbl" : "Stage IIC (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent but less than in Stage III and with differing characteristics from IIA and IIB." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIC (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIC" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002321", "lbl" : "Stage IIIA (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIB and IIIC." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIIA (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIIA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002322", "lbl" : "Stage IIIB (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIC." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIIB (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIIB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002323", "lbl" : "Stage IIIC (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers with increasing tumor or nodal extent greater than in Stage II and with differing characteristics from IIIA and IIIB." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIIC (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIIC" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002324", "lbl" : "Stage IVA (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVB." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IVA (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IVA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002325", "lbl" : "Stage IVB (AJCC 7th)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A clinical tumor stage group according to AJCC 7th edition indicating cancers in patients who present with distant metastases at diagnosis and with differing characteristics from IVA." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IVB (AJCC 7th)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IVB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002327", "lbl" : "Stage IA (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating invasive carcinoma which can be diagnosed only by microscopy, with deepest invasion <5 mm and the largest extension <7 mm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IA (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002328", "lbl" : "Stage IA1 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of <3.0 mm in depth and extension of <7.0 mm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IA1 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IA1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002329", "lbl" : "Stage IA2 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating measured stromal invasion of >3.0 mm and not >5.0 mm with an extension of not >7.0 mm." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IA2 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IA2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002330", "lbl" : "Stage IB (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesions limited to the cervix uteri or pre-clinical cancers greater than stage IA" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IB (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002331", "lbl" : "Stage IB1 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA <4.0 cm in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IB1 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IB1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002332", "lbl" : "Stage IB2 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating clinically visible lesion limited to the cervix uteri or pre-clinical cancers greater than stage IA >4.0 cm in greatest dimension." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IB2 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IB2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002333", "lbl" : "Stage IIA (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIA (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002334", "lbl" : "Stage IIA1 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion <4.0 cm in greatest dimension. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIA1 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIA1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002335", "lbl" : "Stage IIA2 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina without parametrial invasion and clinically visible lesion >4.0 cm in greatest dimension. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIA2 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIA2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002336", "lbl" : "Stage IIB (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating cervical carcinoma invades beyond the uterus, but not to the pelvic wall or to the lower third of the vagina with obvious parametrial invasion. " }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIB (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002337", "lbl" : "Stage IIIA (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating tumour involves lower third of the vagina, with no extension to the pelvic wall." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIIA (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIIA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002338", "lbl" : "Stage IIIB (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating extension to the pelvic wall and/or hydronephrosis or non-functioning kidney." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IIIB (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IIIB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002339", "lbl" : "Stage IVA (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread of the growth to adjacent organs." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IVA (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IVA" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002340", "lbl" : "Stage IVB (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An International Federation of Gynecology and Obstetrics cervical cancer stage value specification indicating spread to distant organs." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage IVB (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage IVB" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Cervical_cancer_staging" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002342", "lbl" : "Stage 1 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 1 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 1" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002343", "lbl" : "Stage 1A (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1a, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 1A (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 1A" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002344", "lbl" : "Stage 1B (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1b, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 1B (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 1B" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002345", "lbl" : "Stage 1C (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T1c, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 1C (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 1C" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002346", "lbl" : "Stage 2 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 2 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 2" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002347", "lbl" : "Stage 2A (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2a, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 2A (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 2A" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002348", "lbl" : "Stage 2B (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2b, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 2B (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 2B" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002349", "lbl" : "Stage 2C (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T2c, N0, and M0." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 2C (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 2C" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002350", "lbl" : "Stage 3 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3, N0, and M0) or (T3,3a,3b, NX, and M0)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 3 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 3" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002351", "lbl" : "Stage 3A (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3a, N0, and M0 ." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 3A (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 3A" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002352", "lbl" : "Stage 3B (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of T3b, N0, and M0 ." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 3B (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 3B" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002353", "lbl" : "Stage 3C (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T3c, N0,X and M0) or (any T, N1 and M0)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 3C (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 3C" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002354", "lbl" : "Stage 4 (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of any T, any N, and M1." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage 4 (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage 4" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002355", "lbl" : "Stage Unknown (FIGO)", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A International Federation of Gynecology and Obstetrics ovarian cancer stage value specification associated with TNM stage values of (T0, N0, and M0) or (T1,1a-1c,2,2a-2c, NX, and M0) or (TX, N0,X, M0)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Stage Unknown (FIGO)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "Stage Unknown" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://staging.seer.cancer.gov/tnm/input/1.0/ovary/path_stage_group_direct/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002358", "lbl" : "3: symptomatic in bed more than 50% of the day but not bed ridden", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and in bed for more than 50% of the day but is not bed ridden." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "3: symptomatic in bed more than 50% of the day but not bed ridden" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002359", "lbl" : "2: symptomatic but in bed less than 50% of the day", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is in bed for less than 50% of the day." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "2: symptomatic but in bed less than 50% of the day" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002360", "lbl" : "4: bed ridden", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic and is bed ridden." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "4: bed ridden" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002361", "lbl" : "0: asymptomatic", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An Eastern Cooperative Oncology Group score value specification indicating a patient is asymptomatic." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "0: asymptomatic" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002362", "lbl" : "1: symptomatic but fully ambulatory", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An Eastern Cooperative Oncology Group score value specification indicating a patient is symptomatic but is fully ambulatory." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "1: symptomatic but fully ambulatory" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002364", "lbl" : "100: asymptomatic", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A Karnofsky score vaue specification indicating that a patient is asymptomatic." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "100: asymptomatic" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002365", "lbl" : "80-90: symptomatic but fully ambulatory", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A Karnofsky score vaue specification indicating that a patient is symptomatic but fully ambulatory." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "80-90: symptomatic but fully ambulatory" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002366", "lbl" : "60-70: symptomatic but in bed less than 50% of the day", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A Karnofsky score vaue specification indicating that a patient is symptomatic but in bed less than 50% of the day." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "60-70: symptomatic but in bed less than 50% of the day" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002367", "lbl" : "40-50: symptomatic, in bed more than 50% of the day, but not bed ridden", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A Karnofsky score vaue specification indicating that a patient is symptomatic, in bed more than 50% of the day, but not bed ridden." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "40-50: symptomatic, in bed more than 50% of the day, but not bed ridden" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Stoeckert, Helena Ellis" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "NCI BBRB, OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "NCI BBRB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002755", "lbl" : "Oxford Nanopore Technologies", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization that is developing and selling nanopore sequencing products and is based in the UK." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "Oxford Nanopore Technologies" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "James A. Overton" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "https://en.wikipedia.org/wiki/Oxford_Nanopore_Technologies" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OBI_0002903", "lbl" : "BioGents", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "An organization that manufactures mosquito traps and other mosquito control products." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "BioGents" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000120" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "John Judkins" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "WEB:https://eu.biogents.com/about-biogents/" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OMO_0001000", "lbl" : "out of scope", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "The term was added to the ontology on the assumption it was in scope, but it turned out later that it was not." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "This obsolesence reason should be used conservatively. Typical valid examples are: un-necessary grouping classes in disease ontologies, a phenotype term added on the assumption it was a disease." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "http://orcid.org/0000-0001-5208-3432" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/information-artifact-ontology/ontology-metadata/issues/77" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "https://orcid.org/0000-0001-5208-3432" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000008", "lbl" : "meter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A length unit which is equal to the length of the path traveled by light in vacuum during a time interval of 1/299 792 458 of a second." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "meter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "m" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000009", "lbl" : "kilogram", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit which is equal to the mass of the International Prototype Kilogram kept by the BIPM at Svres, France." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "kilogram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "kg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000010", "lbl" : "second", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is equal to the duration of 9 192 631 770 periods of the radiation corresponding to the transition between the two hyperfine levels of the ground state of the caesium 133 atom." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "second" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "s" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "sec" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000015", "lbl" : "centimeter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A length unit which is equal to one hundredth of a meter or 10^[-2] m." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "centimeter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "cm" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000016", "lbl" : "millimeter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A length unit which is equal to one thousandth of a meter or 10^[-3] m." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "millimeter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mm" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000017", "lbl" : "micrometer", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A length unit which is equal to one millionth of a meter or 10^[-6] m." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "micrometer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "um" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000018", "lbl" : "nanometer", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A length unit which is equal to one thousandth of one millionth of a meter or 10^[-9] m." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "nanometer" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nm" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000019", "lbl" : "angstrom", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A length unit which is equal to 10 [-10] m." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "angstrom" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000021", "lbl" : "gram", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit which is equal to one thousandth of a kilogram or 10^[-3] kg." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "gram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "g" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000022", "lbl" : "milligram", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit which is equal to one thousandth of a gram or 10^[-3] g." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "milligram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000023", "lbl" : "microgram", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit which is equal to one millionth of a gram or 10^[-6] g." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "microgram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ug" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000024", "lbl" : "nanogram", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit which is equal to one thousandth of one millionth of a gram or 10^[-9] g." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "nanogram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ng" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000025", "lbl" : "picogram", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit which is equal to 10^[-12] g." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "picogram" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000027", "lbl" : "degree Celsius", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A temperature unit which is equal to one kelvin degree. However, they have their zeros at different points. The centigrade scale has its zero at 273.15 K." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "degree Celsius" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "C" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "degree C" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000031", "lbl" : "minute", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is equal to 60 seconds." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "minute" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "min" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000032", "lbl" : "hour", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is equal to 3600 seconds or 60 minutes." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "hour" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "h" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "hr" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000033", "lbl" : "day", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is equal to 24 hours." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "day" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000034", "lbl" : "week", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is equal to 7 days." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "week" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000035", "lbl" : "month", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is approximately equal to the length of time of one of cycle of the moon's phases which in science is taken to be equal to 30 days." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "month" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000036", "lbl" : "year", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A time unit which is equal to 12 months which is science is taken to be equal to 365.25 days." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "year" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000039", "lbl" : "micromole", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A substance unit equal to a millionth of a mol or 10^[-6] mol." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "micromole" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "umol" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000041", "lbl" : "nanomole", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A substance unit equal to one thousandth of one millionth of a mole or 10^[-9] mol." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "nanomole" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nmol" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000042", "lbl" : "picomole", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A substance unit equal to 10^[-12] mol." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "picomole" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pmol" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000062", "lbl" : "molar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A unit of concentration which expresses a concentration of 1 mole of solute per liter of solution (mol/L)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "molar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "M" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000063", "lbl" : "millimolar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A unit of molarity which is equal to one thousandth of a molar or 10^[-3] M." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "millimolar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000064", "lbl" : "micromolar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A unit of molarity which is equal to one millionth of a molar or 10^[-6] M." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "micromolar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "uM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000065", "lbl" : "nanomolar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A unit of molarity which is equal to one thousandth of one millionth of a molar or 10^[-9] M." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "nanomolar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000066", "lbl" : "picomolar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A unit of molarity which is equal to 10^[-12] M." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "picomolar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pM" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000097", "lbl" : "cubic centimeter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to one millionth of a cubic meter or 10^[-9] m^[3], or to 1 ml." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cubic centimeter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "cc" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000098", "lbl" : "milliliter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to one thousandth of a liter or 10^[-3] L, or to 1 cubic centimeter." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "milliliter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ml" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000099", "lbl" : "liter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to one thousandth of a cubic meter or 10^[-3] m^[3], or to 1 decimeter." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "liter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "L" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000100", "lbl" : "cubic decimeter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to one thousand of a cubic meter or 10^[-3] m^[3], or to 1 L." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "cubic decimeter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000101", "lbl" : "microliter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to one millionth of a liter or 10^[-6] L." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "microliter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ul" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000102", "lbl" : "nanoliter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to one thousandth of one millionth of a liter or 10^[-9] L." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "nanoliter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "nl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000103", "lbl" : "picoliter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume unit which is equal to 10^[-12] L." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "picoliter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "pl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000106", "lbl" : "hertz", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A frequency unit which is equal to 1 complete cycle of a recurring phenomenon in 1 second." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "hertz" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000163", "lbl" : "mass percentage", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A dimensionless concentration unit which denotes the mass of a substance in a mixture as a percentage of the mass of the entire mixture." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "mass percentage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "% w/w" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "percent weight pr weight" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000164", "lbl" : "mass volume percentage", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A dimensionless concentration unit which denotes the mass of the substance in a mixture as a percentage of the volume of the entire mixture." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "mass volume percentage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "% w/v" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "percent vol per vol" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000165", "lbl" : "volume percentage", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A dimensionless concentration unit which denotes the volume of the solute in mL per 100 mL of the resulting solution." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "volume percentage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "% v/v" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "percent vol per vol" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000175", "lbl" : "gram per liter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit density which is equal to mass of an object in grams divided by the volume in liters." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "gram per liter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "g per L" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "g/L" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000176", "lbl" : "milligram per milliliter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit density which is equal to mass of an object in milligrams divided by the volume in milliliters." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "milligram per milliliter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mg per ml" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "mg/ml" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000195", "lbl" : "degree Fahrenheit", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A temperature unit which is equal to 5/9ths of a kelvin. Negative 40 degrees Fahrenheit is equal to negative 40 degrees Celsius." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "degree Fahrenheit" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000196", "lbl" : "pH", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A dimensionless concentration notation which denotes the acidity of a solution in terms of activity of hydrogen ions (H+)." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "pH" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000207", "lbl" : "milliliter per liter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volume per unit volume unit which is equal to one millionth of a liter of solute in one liter of solution." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "milliliter per liter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ml per L" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ml/l" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000208", "lbl" : "gram per deciliter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass density unit which is equal to mass of an object in grams divided by the volume in deciliters." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "gram per deciliter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "g/dl" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000212", "lbl" : "colony forming unit per volume", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A concentration unit which a measure of viable bacterial numbers in a given volume." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "colony forming unit per volume" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000271", "lbl" : "microliters per minute", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A volumetric flow rate unit which is equal to one microliter volume through a given surface in one minute." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "microliters per minute" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000281", "lbl" : "count per nanomolar second", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A rate unit which is equal to one over one nanomolar second." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "count per nanomolar second" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000282", "lbl" : "count per molar second", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A rate unit which is equal to one over one molar second." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "count per molar second" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000284", "lbl" : "count per nanomolar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A rate unit which is equal to one over one nanomolar." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "count per nanomolar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000285", "lbl" : "count per molar", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A rate unit which is equal to one over one molar." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "count per molar" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/UO_0000301", "lbl" : "microgram per liter", "type" : "INDIVIDUAL", "meta" : { "definition" : { "val" : "A mass unit density which is equal to mass of an object in micrograms divided by the volume in liters." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "microgram per liter" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ng/ml" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000118", "val" : "ug/L" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000412", "val" : "http://purl.obolibrary.org/obo/uo.owl" } ] } }, { "id" : "https://www.wikidata.org/wiki/Q525", "type" : "INDIVIDUAL" }, { "id" : "http://protege.stanford.edu/plugins/owl/protege#defaultLanguage", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000179", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/BFO_0000180", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000834", "lbl" : "is_identity_criteria", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Used to annotation axioms that define identity criteria for instances of a class." } } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000867", "lbl" : "proabalistic_quantifier", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000905", "lbl" : "mixin", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "comments" : [ "Used to flag terms that are created for organizational purposes, e.g. to support groupings useful for defining GENO-based data models." ] } }, { "id" : "http://purl.obolibrary.org/obo/GENO_0000909", "lbl" : "gene symbol", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000111", "lbl" : "editor preferred term~editor preferred label", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "The concise, meaningful, and human-friendly name for a class or property preferred by the ontology developers. (US-English)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editor preferred label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editor preferred label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editor preferred term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editor preferred term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editor preferred term~editor preferred label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000112", "lbl" : "example of usage", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "A phrase describing how a term should be used and/or a citation to a work which uses it. May also include other kinds of examples that facilitate immediate understanding, such as widely know prototypes or instances of a class, or cases where a relation is said to hold." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "example of usage" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000113", "lbl" : "in branch", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "An annotation property indicating which module the terms belong to. This is currently experimental and not implemented yet." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "in branch" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "GROUP:OBI" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBI_0000277" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000114", "lbl" : "has curation status", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has curation status" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bill Bug" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000115", "lbl" : "textual definition", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "definition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "definition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "textual definition" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2012-04-05: \nBarry Smith\n\nThe official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible.\n\nCan you fix to something like:\n\nA statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property.\n\nAlan Ruttenberg\n\nYour proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. \n\nOn the specifics of the proposed definition:\n\nWe don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. \n\nPersonally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. \n\nWe also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "2012-04-05: \nBarry Smith\n\nThe official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible.\n\nCan you fix to something like:\n\nA statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property.\n\nAlan Ruttenberg\n\nYour proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. \n\nOn the specifics of the proposed definition:\n\nWe don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. \n\nPersonally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. \n\nWe also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with. " }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000116", "lbl" : "editor note", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "An administrative note intended for its editor. It may not be included in the publication version of the ontology, so it should contain nothing necessary for end users to understand the ontology." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "editor note" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000117", "lbl" : "term editor", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "term editor" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "20110707, MC: label update to term editor and definition modified accordingly. See https://github.com/information-artifact-ontology/IAO/issues/115." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000118", "lbl" : "alternative term", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "An alternative name for a class or property which means the same thing as the preferred name (semantically equivalent)" }, "comments" : [ "Consider re-defing to: An alternative name for a class or property which can mean the same thing as the preferred name (semantically equivalent, narrow, broad or related)." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "alternative label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "alternative term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "OBO Operations committee" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000119", "lbl" : "definition source", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "definition source" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Daniel Schober" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Discussion on obo-discuss mailing-list, see http://bit.ly/hgm99w" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000231", "lbl" : "has obsolescence reason", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relates an annotation property to an obsolescence reason. The values of obsolescence reasons come from a list of predefined terms, instances of the class obsolescence reason specification." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has obsolescence reason" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000232", "lbl" : "curator note", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "An administrative note of use for a curator but of no use for a user" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "curator note" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000122" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000233", "lbl" : "term tracker item", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "An IRI or similar locator for a request or discussion of an ontology term." }, "comments" : [ "The 'tracker item' can associate a tracker with a specific ontology term." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "term tracker item" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "the URI for an OBI Terms ticket at sourceforge, such as https://sourceforge.net/p/obi/obi-terms/772/" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000234", "lbl" : "ontology term requester", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "The name of the person, project, or organization that motivated inclusion of an ontology term by requesting its addition." }, "comments" : [ "The 'term requester' can credit the person, organization or project who request the ontology term." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "ontology term requester" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person: Jie Zheng, Chris Stoeckert, Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000411", "lbl" : "is denotator type", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relates an class defined in an ontology, to the type of it's denotator" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "is denotator type" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "In OWL 2 add AnnotationPropertyRange('is denotator type' 'denotator type')" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000412", "lbl" : "imported from", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "For external terms/classes, the ontology from which the term was imported" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "imported from" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBI:" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000424", "lbl" : "expand expression to", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "A macro expansion tag applied to an object property (or possibly a data property) which can be used by a macro-expansion engine to generate more complex expressions from simpler ones" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "expand expression to" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "ObjectProperty: RO_0002104\nLabel: has plasma membrane part\nAnnotations: IAO_0000424 \"http://purl.obolibrary.org/obo/BFO_0000051 some (http://purl.org/obo/owl/GO#GO_0005886 and http://purl.obolibrary.org/obo/BFO_0000051 some ?Y)\"\n" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Mungall" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000425", "lbl" : "expand assertion to", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "A macro expansion tag applied to an annotation property which can be expanded into a more detailed axiom." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "expand assertion to" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "ObjectProperty: RO???\nLabel: spatially disjoint from\nAnnotations: expand_assertion_to \"DisjointClasses: (http://purl.obolibrary.org/obo/BFO_0000051 some ?X) (http://purl.obolibrary.org/obo/BFO_0000051 some ?Y)\"\n" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Mungall" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000426", "lbl" : "first order logic expression", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "first order logic expression" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000427", "lbl" : "antisymmetric property", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Use boolean value xsd:true to indicate that the property is an antisymmetric property" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "antisymmetric property" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "part_of antisymmetric property xsd:true" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000589", "lbl" : "OBO foundry unique label", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "An alternative name for a class or property which is unique across the OBO Foundry." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "OBO foundry unique label" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000116", "val" : "The intended usage of that property is as follow: OBO foundry unique labels are automatically generated based on regular expressions provided by each ontology, so that SO could specify unique label = 'sequence ' + [label], etc. , MA could specify 'mouse + [label]' etc. Upon importing terms, ontology developers can choose to use the 'OBO foundry unique label' for an imported term or not. The same applies to tools ." }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Bjoern Peters" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Chris Mungall" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Melanie Courtot" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "GROUP:OBO Foundry " } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000596", "lbl" : "has ID digit count", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relates an ontology used to record id policy to the number of digits in the URI. The URI is: the 'has ID prefix\" annotation property value concatenated with an integer in the id range (left padded with \"0\"s to make this many digits)" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has ID digit count" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Ontology: \n Annotations: \n 'has ID prefix': \"http://purl.obolibrary.org/obo/RO_\"\n 'has ID digit count' : 7,\n rdfs:label \"RO id policy\"\n 'has ID policy for': \"RO\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000597", "lbl" : "has ID range allocated to", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relates a datatype that encodes a range of integers to the name of the person or organization who can use those ids constructed in that range to define new terms" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has ID range allocated" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Datatype: idrange:1\nAnnotations: 'has ID range allocated to': \"Chris Mungall\"\nEquivalentTo: xsd:integer[> 2151 , <= 2300]\n" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000598", "lbl" : "has ID policy for", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relating an ontology used to record id policy to the ontology namespace whose policy it manages" }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has ID policy for" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Ontology: \n Annotations: \n 'has ID prefix': \"http://purl.obolibrary.org/obo/RO_\"\n 'has ID digit count' : 7,\n rdfs:label \"RO id policy\"\n 'has ID policy for': \"RO\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000599", "lbl" : "has ID prefix", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relates an ontology used to record id policy to a prefix concatenated with an integer in the id range (left padded with \"0\"s to make this many digits) to construct an ID for a term being created." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has ID prefix" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "Ontology: \n Annotations: \n 'has ID prefix': \"http://purl.obolibrary.org/obo/RO_\"\n 'has ID digit count' : 7,\n rdfs:label \"RO id policy\"\n 'has ID policy for': \"RO\"" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000600", "lbl" : "elucidation", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "elucidation" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person:Barry Smith" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "Primitive terms in a highest-level ontology such as BFO are terms which are so basic to our understanding of reality that there is no way of defining them in a non-circular fashion. For these, therefore, we can provide only elucidations, supplemented by examples and by axioms" }, { "pred" : "http://www.w3.org/2000/01/rdf-schema#isDefinedBy", "val" : "http://purl.obolibrary.org/obo/iao.owl" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000601", "lbl" : "has associated axiom(nl)", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has associated axiom(nl)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "An axiom associated with a term expressed using natural language" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000602", "lbl" : "has associated axiom(fol)", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has associated axiom(fol)" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "An axiom expressed in first order logic using CLIF syntax" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000603", "lbl" : "is allocated id range", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Relates an ontology IRI to an (inclusive) range of IRIs in an OBO name space. The range is give as, e.g. \"IAO_0020000-IAO_0020999\"" }, "comments" : [ "Add as annotation triples in the granting ontology" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "is allocated id range" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "PERSON:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0000700", "lbl" : "has ontology root term", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Ontology annotation property. Relates an ontology to a term that is a designated root term of the ontology. Display tools like OLS can use terms annotated with this property as the starting point for rendering the ontology class hierarchy. There can be more than one root." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has ontology root term" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Nicolas Matentzoglu" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0006011", "lbl" : "may be identical to", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "A annotation relationship between two terms in an ontology that may refer to the same (natural) type but where more evidence is required before terms are merged." }, "comments" : [ "Edges asserting this should be annotated with to record evidence supporting the assertion and its provenance." ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "may be identical to" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "David Osumi-Sutherland" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "#40" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "VFB" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0006012", "lbl" : "scheduled for obsoletion on or after", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Used when the class or object is scheduled for obsoletion/deprecation on or after a particular date." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "scheduled for obsoletion on or after" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Chris Mungall, Jie Zheng" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/geneontology/go-ontology/issues/15532" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000233", "val" : "https://github.com/information-artifact-ontology/ontology-metadata/issues/32" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000234", "val" : "GO ontology" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0010000", "lbl" : "has axiom label", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "has axiom id" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000600", "val" : "A URI that is intended to be unique label for an axiom used for tracking change to the ontology. For an axiom expressed in different languages, each expression is given the same URI" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_0100001", "lbl" : "term replaced by", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Use on obsolete terms, relating the term to another term that can be used as a substitute" }, "comments" : [ "Add as annotation triples in the granting ontology" ], "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000111", "val" : "term replaced by" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000114", "val" : "http://purl.obolibrary.org/obo/IAO_0000125" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000117", "val" : "Person:Alan Ruttenberg" }, { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "Person:Alan Ruttenberg" } ] } }, { "id" : "http://purl.obolibrary.org/obo/IAO_alt_id", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/IAO_created_by", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/IAO_creation_date", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/IAO_id", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/IAO_subset", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/IAO_xref", "type" : "PROPERTY", "propertyType" : "ANNOTATION" }, { "id" : "http://purl.obolibrary.org/obo/OMO_0001001", "lbl" : "logical characteristic of object property", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "This is an annotation used on an object property to indicate a logical characterstic beyond what is possible in OWL." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000119", "val" : "OBO Operations call" }, { "pred" : "http://www.geneontology.org/formats/oboInOwl#created_by", "val" : "http://orcid.org/0000-0001-5208-3432" } ] } }, { "id" : "http://purl.obolibrary.org/obo/OMO_0002000", "lbl" : "defined by construct", "type" : "PROPERTY", "propertyType" : "ANNOTATION", "meta" : { "definition" : { "val" : "Links an annotation property to a SPARQL CONSTRUCT query which is meant to provide semantics for a shortcut relation." }, "basicPropertyValues" : [ { "pred" : "http://purl.obolibrary.org/obo/IAO_0000112", "val" : "'part disjoint with' 'defined by construct' \"\"\"\n PREFIX owl: \n PREFIX :