2.1 01-14-2021 A biological ontology to standardize and integrate Integrative and Conjugative Element (ICE) information and to support computer-assisted reasoning. Meng LIU ICEO: Ontology of Integrative and Conjugative Elements The ICEO Ontology is licensed under CC BY 4.0. Meng LIU A biological ontology in the domain of Integrative and Conjugative Elements. Yongqun He http://creativecommons.org/licenses/by/4.0/ This is an ICE ontology 2.1, representing the information of 271 experimentally verified ICEs from 235 bacterial strains and 311 putative ICEs from 272 Klebsiella pneumoniae. Hong-Yu Ou Relates an entity in the ontology to the name of the variable that is used to represent it in the code that generates the BFO OWL file from the lispy specification. Really of interest to developers only BFO OWL specification label BFO OWL specification label Relates an entity in the ontology to the term that is used to represent it in the the CLIF specification of BFO2 Person:Alan Ruttenberg Really of interest to developers only BFO CLIF specification label BFO CLIF specification label editor preferred label editor preferred label editor preferred term editor preferred term editor preferred term~editor preferred label The concise, meaningful, and human-friendly name for a class or property preferred by the ontology developers. (US-English) PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> editor preferred label editor preferred label editor preferred term editor preferred term editor preferred term~editor preferred label example A phrase describing how a class name should be used. May also include other kinds of examples that facilitate immediate understanding of a class semantics, such as widely known prototypical subclasses or instances of the class. Although essential for high level terms, examples for low level terms (e.g., Affymetrix HU133 array) are not PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> example of usage example of usage has curation status PERSON:Alan Ruttenberg PERSON:Bill Bug PERSON:Melanie Courtot OBI_0000281 has curation status has curation status definition definition definition textual definition textual definition The official OBI definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. The official definition, explaining the meaning of a class or property. Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions. 2012-04-05: Barry Smith The official OBI definition, explaining the meaning of a class or property: 'Shall be Aristotelian, formalized and normalized. Can be augmented with colloquial definitions' is terrible. Can you fix to something like: A statement of necessary and sufficient conditions explaining the meaning of an expression referring to a class or property. Alan Ruttenberg Your proposed definition is a reasonable candidate, except that it is very common that necessary and sufficient conditions are not given. Mostly they are necessary, occasionally they are necessary and sufficient or just sufficient. Often they use terms that are not themselves defined and so they effectively can't be evaluated by those criteria. On the specifics of the proposed definition: We don't have definitions of 'meaning' or 'expression' or 'property'. For 'reference' in the intended sense I think we use the term 'denotation'. For 'expression', I think we you mean symbol, or identifier. For 'meaning' it differs for class and property. For class we want documentation that let's the intended reader determine whether an entity is instance of the class, or not. For property we want documentation that let's the intended reader determine, given a pair of potential relata, whether the assertion that the relation holds is true. The 'intended reader' part suggests that we also specify who, we expect, would be able to understand the definition, and also generalizes over human and computer reader to include textual and logical definition. Personally, I am more comfortable weakening definition to documentation, with instructions as to what is desirable. We also have the outstanding issue of how to aim different definitions to different audiences. A clinical audience reading chebi wants a different sort of definition documentation/definition from a chemistry trained audience, and similarly there is a need for a definition that is adequate for an ontologist to work with. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> definition definition definition textual definition textual definition editor note An administrative note intended for its editor. It may not be included in the publication version of the ontology, so it should contain nothing necessary for end users to understand the ontology. PERSON:Daniel Schober GROUP:OBI:<http://purl.obfoundry.org/obo/obi> editor note editor note term editor Name of editor entering the term in the file. The term editor is a point of contact for information regarding the term. The term editor may be, but is not always, the author of the definition, which may have been worked upon by several people 20110707, MC: label update to term editor and definition modified accordingly. See http://code.google.com/p/information-artifact-ontology/issues/detail?id=115. 20110707, MC: label update to term editor and definition modified accordingly. See https://github.com/information-artifact-ontology/IAO/issues/115. PERSON:Daniel Schober GROUP:OBI:<http://purl.obolibrary.org/obo/obi> term editor term editor Mia alternative term alternative term definition source formal citation, e.g. identifier in external database to indicate / attribute source(s) for the definition. Free text indicate / attribute source(s) for the definition. EXAMPLE: Author Name, URI, MeSH Term C04, PUBMED ID, Wiki uri on 31.01.2007 PERSON:Daniel Schober Discussion on obo-discuss mailing-list, see http://bit.ly/hgm99w GROUP:OBI:<http://purl.obolibrary.org/obo/obi> definition source definition source curator note curator note imported from imported from expand expression to expand expression to OBO foundry unique label OBO foundry unique label elucidation elucidation has associated axiom(nl) has associated axiom(nl) has associated axiom(fol) has associated axiom(fol) An annotation property that represents the ID of oriT sequence in the oriT database oriTDB. Meng LIU (Mia), Oliver He has oriTDB accession An annotation property that represents the ID of a ICE/IME/CIME in the ICE database ICEberg. Meng LIU (Mia), Oliver He has ICEberg accession An annotation property that represents the ID of a T4SS sequence in the T4SS database SecReT4. Meng LIU (Mia), Oliver He has SecReT4 accession has SecReT4 accession An annotation property that represents the hyperlink of a oriT sequence in the oriT database oriTDB. Meng LIU (Mia), Oliver He has oriTDB hyperlink An annotation property that represents the hyperlink of a ICE/IME/CIME in the ICE database ICEberg. Meng LIU (Mia), Oliver He has ICEberg hyperlink has ICEberg hyperlink isolation source of the organism Meng LIU (Mia), Oliver He raw isolation Sequencing Technology of the organism Meng LIU (Mia), Oliver He raw sequencing location source of the organism, inculding continent and country. Meng LIU (Mia), Oliver He raw location Mutilocus sequence typing and serotype of the organism Meng LIU (Mia), Oliver He typing of organism Reannotated signature proteins by ICEberg. protein reannotated role protein reannotated role GI number is a series of digits that are assigned consecutively to each sequence record processed by NCBI. The GI number bears no resemblance to the Accession number of the sequence record. Meng LIU (Mia), Oliver He has NCBI GI number has NCBI GI number An annotation property that represents the length of a sequence or how big something is Meng LIU (Mia), Oliver He has_size has_size An annotation property that represents which species that a ICE or a moblie genetic element can transfer to. Meng LIU (Mia), Oliver He species can be transferred to an annotation property that represents the completeness of the sequence. Meng LIU (Mia), Oliver He sequence status sequence status An annotation property that represents the ID of a ICE sequence or the host genome in the NCBI GeneBank database. Meng LIU (Mia), Oliver He has NCBI GeneBank accession has NCBI GeneBank accession GC-content (or guanine-cytosine content) is the percentage of nitrogenous bases on a DNA or RNA molecule that are either guanine or cytosine (from a possibility of four different ones, also including adenine and thymine in DNA and adenine and uracil in RNA). Meng LIU (Mia), Oliver He the number outside the square brackets are the GC content of the ICE while the number inside the square brackets are the GC content of the host genome GC content[Genome] GC content[Genome] the coordinates of genetic elements or genes in the chromosome Meng LIU (Mia), Oliver He genome coordinates genome coordinates confirmation status inculdes: experimental verified; predicted in silico; not sure Meng LIU (Mia), Oliver He confirmation status An annotation property that represents a ICE or a mobile genetic element has transfer interaction with IME. Meng LIU (Mia), Oliver He has interaction with IME Meng LIU (Mia), Oliver He An annotation property that represents a ICE or a mobile genetic element has transfer interaction with CIME. has interaction with CIME An annotation property that represents the Meng LIU (Mia), Oliver He insertion site insertion site A GeneID in the NCBI Gene database Oliver He, Yue Liu NCBI GeneID NCBI GeneID the NCBI LocusTag name of a gene Oliver He, Yue Liu NCBI LocusTag NCBI LocusTag a date of content modification Oliver He, Yue Liu modification date modification date The NCBITaxon ontology ID of an organism. Oliver He, Yue Liu organism NCBITaxon ID organism NCBITaxon ID A chromosome ID where a gene is located. Oliver He chromosome ID of gene chromosome ID of gene an annotation property that specifies the type of a gene Oliver He type of gene type of gene an annotation property that specifies a nomenclature status Oliver He nomenclature status nomenclature status An annotation property that represents a gene's association with PubMed publication(s). Yongqun He YH: use the format: PMID: pmid1, pmid2, ... where pmid1 and pmid2 are specfic PubMed IDs (PMIDs). has PubMed association has PubMed association An assertion that holds between an OWL Object Property and a temporal interpretation that elucidates how OWL Class Axioms that use this property are to be interpreted in a temporal context. temporal interpretation temporal interpretation https://github.com/oborel/obo-relations/wiki/ROAndTime An assertion that involves at least one OWL object that is intended to be expanded into one or more logical axioms. The logical expansion can yield axioms expressed using any formal logical system, including, but not limited to OWL2-DL. logical macro assertion logical macro assertion https://github.com/oborel/obo-relations/wiki/ShortcutRelations A logical macro assertion whose domain is an IRI for a property logical macro assertion on a property logical macro assertion on a property Used to annotate object properties to describe a logical meta-property or characteristic of the object property. logical macro assertion on an object property logical macro assertion on an object property Used to annotate object properties representing a causal relationship where the value indicates a direction. Should be "+", "-" or "0" cjm 2018-03-13T23:59:29Z is directional form of cjm 2018-03-14T00:03:16Z is positive form of cjm 2018-03-14T00:03:24Z is negative form of A metadata relation between a class and its taxonomic rank (eg species, family) ncbi_taxonomy This is an abstract class for use with the NCBI taxonomy to name the depth of the node within the tree. The link between the node term and the rank is only visible if you are using an obo 1.3 aware browser/editor; otherwise this can be ignored has_rank has_rank Typically, Date will be associated with the creation or availability of the resource. Recommended best practice for encoding the date value is defined in a profile of ISO 8601 [W3CDTF] and follows the YYYY-MM-DD format. A date associated with an event in the life cycle of the resource. Date Date Description may include but is not limited to: an abstract, table of contents, reference to a graphical representation of content or a free-text account of the content. An account of the content of the resource. Description Description Typically, a Subject will be expressed as keywords, key phrases or classification codes that describe a topic of the resource. Recommended best practice is to select a value from a controlled vocabulary or formal classification scheme. The topic of the content of the resource. Subject and Keywords Subject and Keywords Typically, a Title will be a name by which the resource is formally known. A name given to the resource. Title Title description Mark Miller 2018-05-11T13:47:29Z has_alternative_id has_alternative_id has_broad_synonym database_cross_reference database_cross_reference has_exact_synonym has_exact_synonym has_narrow_synonym has_narrow_synonym has_obo_namespace has_obo_namespace has_related_synonym has_related_synonym in_subset in_subset label label part of part of has part has part inheres in at all times realizes precedes x precedes y if and only if the time point at which x ends is before or equivalent to the time point at which y starts. Formally: x precedes y iff ω(x) <= α(y), where α is a function that maps a process to a start point, and ω is a function that maps a process to an end point. precedes occupies spatial region at some time Meng LIU (Mia), Oliver He exists at a has_disposition b at t =Def. b disposition_of a at t. (axiom label in BFO2 Reference: [069-001]) Alan Ruttenberg: This is a binary version of a ternary time-indexed, instance-level, relation. The BFO reading of the binary relation 'has disposition at all times@en' is: forall(t) exists_at(x,t) -> exists_at(y,t) and 'has disposition@en(x,y,t)'. (iff (hasDispositionAt a b t) (dispositionOf b a t)) // axiom label in BFO2 CLIF: [069-001] has disposition at all times specifically depends on at some time has continuant part at some time has continuant part at all times that part exists Meng LIU (Mia), Oliver He has predicted part a relation between a protein and the organism where this protein belongs to the organism. Meng LIU (Mia), Oliver He is protein of organism The organism where the ICE is first identifed from. Meng LIU (Mia), Oliver He is ICE of organism Meng LIU (Mia), Oliver He a relation between a sequence and the organism where this sequence belongs to the organism. is sequence of organism a in silico relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence Meng LIU (Mia), Oliver He has susceptibility role has gene participant has protein participant has sequence participant a relation between a gene and the ICE where this gene belongs to the ICE in nature. It does not include a foreign gene that is transferred to an ICE by a genetic engineering method. Oliver He, Yue Liu is gene of ICE has susceptibility gene participant Meng LIU (Mia), Oliver He transferred as the inverse property of encodes Meng LIU (Mia), Oliver He encoded_by to specify the genetic code for Meng LIU (Mia), Oliver He encodes a relation between a gene and the organism where this gene belongs to the organism in nature. It does not include a foreign gene that is transferred to an organism by a genetic engineering method. Oliver He, Yue Liu is gene of organism is gene of organism inheres in bearer of this apple is bearer of this red color this vase is bearer of this fragility a relation between an independent continuant (the bearer) and a specifically dependent continuant (the dependent), in which the dependent specifically depends on the bearer for its existence A bearer can have many dependents, and its dependents can exist for different periods of time, but none of its dependents can exist when the bearer does not exist. bearer_of is bearer of bearer of participates in this blood clot participates in this blood coagulation this input material (or this output material) participates in this process this investigator participates in this investigation a relation between a continuant and a process, in which the continuant is somehow involved in the process participates_in participates in has participant this blood coagulation has participant this blood clot this investigation has participant this investigator this process has participant this input material (or this output material) a relation between a process and a continuant, in which the continuant is somehow involved in the process Has_participant is a primitive instance-level relation between a process, a continuant, and a time at which the continuant participates in some way in the process. The relation obtains, for example, when this particular process of oxygen exchange across this particular alveolar membrane has_participant this particular sample of hemoglobin at this particular time. has_participant http://www.obofoundry.org/ro/#OBO_REL:has_participant has participant this person has role this investigator role (more colloquially: this person has this role of investigator) a relation between an independent continuant (the bearer) and a role, in which the role specifically depends on the bearer for its existence A bearer can have many roles, and its roles can exist for different periods of time, but none of its roles can exist when the bearer does not exist. A role need not be realized at all the times that the role exists. has_role has role happens during A is spatially_disjoint_from B if and only if they have no parts in common There are two ways to encode this as a shortcut relation. The other possibility to use an annotation assertion between two classes, and expand this to a disjointness axiom. Chris Mungall Note that it would be possible to use the relation to label the relationship between a near infinite number of structures - between the rings of saturn and my left earlobe. The intent is that this is used for parsiomoniously for disambiguation purposes - for example, between siblings in a jointly exhaustive pairwise disjointness hierarchy BFO_0000051 exactly 0 (BFO_0000050 some ?Y) spatially disjoint from https://github.com/obophenotype/uberon/wiki/Part-disjointness-Design-Pattern process(P1) regulates process(P2) iff: P1 results in the initiation or termination of P2 OR affects the frequency of its initiation or termination OR affects the magnitude or rate of output of P2. We use 'regulates' here to specifically imply control. However, many colloquial usages of the term correctly correspond to the weaker relation of 'causally upstream of or within' (aka influences). Consider relabeling to make things more explicit Chris Mungall David Hill Tanya Berardini GO Regulation precludes parthood; the regulatory process may not be within the regulated process. regulates (processual) false regulates Process(P1) negatively regulates process(P2) iff: P1 terminates P2, or P1 descreases the the frequency of initiation of P2 or the magnitude or rate of output of P2. Chris Mungall negatively regulates (process to process) negatively regulates Process(P1) postively regulates process(P2) iff: P1 initiates P2, or P1 increases the the frequency of initiation of P2 or the magnitude or rate of output of P2. Chris Mungall positively regulates (process to process) positively regulates A caterpillar walking on the surface of a leaf is adjacent_to the leaf, if one of the caterpillar appendages is touching the leaf. In contrast, a butterfly flying close to a flower is not considered adjacent, unless there are any touching parts. The epidermis layer of a vertebrate is adjacent to the dermis. The plasma membrane of a cell is adjacent to the cytoplasm, and also to the cell lumen which the cytoplasm occupies. The skin of the forelimb is adjacent to the skin of the torso if these are considered anatomical subdivisions with a defined border. Otherwise a relation such as continuous_with would be used. x adjacent to y if and only if x and y share a boundary. This relation acts as a join point with BSPO Chris Mungall adjacent to Chris Mungall Do not use this relation directly. It is ended as a grouping for relations between occurrents involving the relative timing of their starts and ends. https://docs.google.com/document/d/1kBv1ep_9g3sTR-SD3jqzFqhuwo9TPNF-l-9fUDbO6rM/edit?pli=1 A relation that holds between two occurrents. This is a grouping relation that collects together all the Allen relations. temporally related to Meng LIU (Mia), Oliver He ends with cjm holds between x and y if and only if x is causally upstream of y and the progression of x increases the frequency, rate or extent of y causally upstream of, positive effect cjm holds between x and y if and only if x is causally upstream of y and the progression of x decreases the frequency, rate or extent of y causally upstream of, negative effect A mereological relationship or a topological relationship Chris Mungall Do not use this relation directly. It is ended as a grouping for a diverse set of relations, all involving parthood or connectivity relationships mereotopologically related to regulated by negatively regulated by positively regulated by This relation groups causal relations between material entities and causal relations between processes This branch of the ontology deals with causal relations between entities. It is divided into two branches: causal relations between occurrents/processes, and causal relations between material entities. We take an 'activity flow-centric approach', with the former as primary, and define causal relations between material entities in terms of causal relations between occurrents. To define causal relations in an activity-flow type network, we make use of 3 primitives: * Temporal: how do the intervals of the two occurrents relate? * Is the causal relation regulatory? * Is the influence positive or negative The first of these can be formalized in terms of the Allen Interval Algebra. Informally, the 3 bins we care about are 'direct', 'indirect' or overlapping. Note that all causal relations should be classified under a RO temporal relation (see the branch under 'temporally related to'). Note that all causal relations are temporal, but not all temporal relations are causal. Two occurrents can be related in time without being causally connected. We take causal influence to be primitive, elucidated as being such that has the upstream changed, some qualities of the donwstream would necessarily be modified. For the second, we consider a relationship to be regulatory if the system in which the activities occur is capable of altering the relationship to achieve some objective. This could include changing the rate of production of a molecule. For the third, we consider the effect of the upstream process on the output(s) of the downstream process. If the level of output is increased, or the rate of production of the output is increased, then the direction is increased. Direction can be positive, negative or neutral or capable of either direction. Two positives in succession yield a positive, two negatives in succession yield a positive, otherwise the default assumption is that the net effect is canceled and the influence is neutral. Each of these 3 primitives can be composed to yield a cross-product of different relation types. Chris Mungall Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect. causally related to p is causally upstream of q if and only if p precedes q and p and q are linked in a causal chain Chris Mungall causally upstream of p 'causally upstream or within' q iff (1) the end of p is before the end of q and (2) the execution of p exerts some causal influence over the outputs of q; i.e. if p was abolished or the outputs of p were to be modified, this would necessarily affect q. We would like to make this disjoint with 'preceded by', but this is prohibited in OWL2 Chris Mungall influences (processual) affects causally upstream of or within causally downstream of or within p is causally related to q if and only if p or any part of p and q or any part of q are linked by a chain of events where each event pair is one of direct activation or direct inhibition. p may be upstream, downstream, part of or a container of q. Chris Mungall Do not use this relation directly. It is intended as a grouping for a diverse set of relations, all involving cause and effect. causal relation between processes directly regulates cjm 2018-03-13T23:55:05Z causally upstream of or within, negative effect cjm 2018-03-13T23:55:19Z causally upstream of or within, positive effect Clusters of antibiotic resistance genes. May be regulated by a shared promoter or repressor. antibiotic_resistance ARO:0000010 antibiotic resistance gene cluster, cassette, or operon entity Entity Julius Caesar Verdi’s Requiem the Second World War your body mass index BFO 2 Reference: In all areas of empirical inquiry we encounter general terms of two sorts. First are general terms which refer to universals or types:animaltuberculosissurgical procedurediseaseSecond, are general terms used to refer to groups of entities which instantiate a given universal but do not correspond to the extension of any subuniversal of that universal because there is nothing intrinsic to the entities in question by virtue of which they – and only they – are counted as belonging to the given group. Examples are: animal purchased by the Emperortuberculosis diagnosed on a Wednesdaysurgical procedure performed on a patient from Stockholmperson identified as candidate for clinical trial #2056-555person who is signatory of Form 656-PPVpainting by Leonardo da VinciSuch terms, which represent what are called ‘specializations’ in [81 Entity doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example Werner Ceusters 'portions of reality' include 4 sorts, entities (as BFO construes them), universals, configurations, and relations. It is an open question as to whether entities as construed in BFO will at some point also include these other portions of reality. See, for example, 'How to track absolutely everything' at http://www.referent-tracking.com/_RTU/papers/CeustersICbookRevised.pdf An entity is anything that exists or has existed or will exist. (axiom label in BFO2 Reference: [001-001]) entity continuant Continuant BFO 2 Reference: Continuant entities are entities which can be sliced to yield parts only along the spatial dimension, yielding for example the parts of your table which we call its legs, its top, its nails. ‘My desk stretches from the window to the door. It has spatial parts, and can be sliced (in space) in two. With respect to time, however, a thing is a continuant.’ [60, p. 240 Continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. For example, in an expansion involving bringing in some of Ceuster's other portions of reality, questions are raised as to whether universals are continuants A continuant is an entity that persists, endures, or continues to exist through time while maintaining its identity. (axiom label in BFO2 Reference: [008-002]) if b is a continuant and if, for some t, c has_continuant_part b at t, then c is a continuant. (axiom label in BFO2 Reference: [126-001]) if b is a continuant and if, for some t, cis continuant_part of b at t, then c is a continuant. (axiom label in BFO2 Reference: [009-002]) if b is a material entity, then there is some temporal interval (referred to below as a one-dimensional temporal region) during which b exists. (axiom label in BFO2 Reference: [011-002]) (forall (x y) (if (and (Continuant x) (exists (t) (continuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [009-002] (forall (x y) (if (and (Continuant x) (exists (t) (hasContinuantPartOfAt y x t))) (Continuant y))) // axiom label in BFO2 CLIF: [126-001] (forall (x) (if (Continuant x) (Entity x))) // axiom label in BFO2 CLIF: [008-002] (forall (x) (if (Material Entity x) (exists (t) (and (TemporalRegion t) (existsAt x t))))) // axiom label in BFO2 CLIF: [011-002] continuant occurrent Occurrent BFO 2 Reference: every occurrent that is not a temporal or spatiotemporal region is s-dependent on some independent continuant that is not a spatial region BFO 2 Reference: s-dependence obtains between every process and its participants in the sense that, as a matter of necessity, this process could not have existed unless these or those participants existed also. A process may have a succession of participants at different phases of its unfolding. Thus there may be different players on the field at different times during the course of a football game; but the process which is the entire game s-depends_on all of these players nonetheless. Some temporal parts of this process will s-depend_on on only some of the players. Occurrent doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. An example would be the sum of a process and the process boundary of another process. Simons uses different terminology for relations of occurrents to regions: Denote the spatio-temporal location of a given occurrent e by 'spn[e]' and call this region its span. We may say an occurrent is at its span, in any larger region, and covers any smaller region. Now suppose we have fixed a frame of reference so that we can speak not merely of spatio-temporal but also of spatial regions (places) and temporal regions (times). The spread of an occurrent, (relative to a frame of reference) is the space it exactly occupies, and its spell is likewise the time it exactly occupies. We write 'spr[e]' and `spl[e]' respectively for the spread and spell of e, omitting mention of the frame. An occurrent is an entity that unfolds itself in time or it is the instantaneous boundary of such an entity (for example a beginning or an ending) or it is a temporal or spatiotemporal region which such an entity occupies_temporal_region or occupies_spatiotemporal_region. (axiom label in BFO2 Reference: [077-002]) Every occurrent occupies_spatiotemporal_region some spatiotemporal region. (axiom label in BFO2 Reference: [108-001]) b is an occurrent entity iff b is an entity that has temporal parts. (axiom label in BFO2 Reference: [079-001]) (forall (x) (if (Occurrent x) (exists (r) (and (SpatioTemporalRegion r) (occupiesSpatioTemporalRegion x r))))) // axiom label in BFO2 CLIF: [108-001] (forall (x) (iff (Occurrent x) (and (Entity x) (exists (y) (temporalPartOf y x))))) // axiom label in BFO2 CLIF: [079-001] occurrent ic IndependentContinuant a chair a heart a leg a molecule a spatial region an atom an orchestra. an organism the bottom right portion of a human torso the interior of your mouth b is an independent continuant = Def. b is a continuant which is such that there is no c and no t such that b s-depends_on c at t. (axiom label in BFO2 Reference: [017-002]) For any independent continuant b and any time t there is some spatial region r such that b is located_in r at t. (axiom label in BFO2 Reference: [134-001]) For every independent continuant b and time t during the region of time spanned by its life, there are entities which s-depends_on b during t. (axiom label in BFO2 Reference: [018-002]) (forall (x t) (if (IndependentContinuant x) (exists (r) (and (SpatialRegion r) (locatedInAt x r t))))) // axiom label in BFO2 CLIF: [134-001] (forall (x t) (if (and (IndependentContinuant x) (existsAt x t)) (exists (y) (and (Entity y) (specificallyDependsOnAt y x t))))) // axiom label in BFO2 CLIF: [018-002] (iff (IndependentContinuant a) (and (Continuant a) (not (exists (b t) (specificallyDependsOnAt a b t))))) // axiom label in BFO2 CLIF: [017-002] independent continuant spatial region temporal region process Process a process of cell-division, \ a beating of the heart a process of meiosis a process of sleeping the course of a disease the flight of a bird the life of an organism your process of aging. p is a process = Def. p is an occurrent that has temporal proper parts and for some time t, p s-depends_on some material entity at t. (axiom label in BFO2 Reference: [083-003]) BFO 2 Reference: The realm of occurrents is less pervasively marked by the presence of natural units than is the case in the realm of independent continuants. Thus there is here no counterpart of ‘object’. In BFO 1.0 ‘process’ served as such a counterpart. In BFO 2.0 ‘process’ is, rather, the occurrent counterpart of ‘material entity’. Those natural – as contrasted with engineered, which here means: deliberately executed – units which do exist in the realm of occurrents are typically either parasitic on the existence of natural units on the continuant side, or they are fiat in nature. Thus we can count lives; we can count football games; we can count chemical reactions performed in experiments or in chemical manufacturing. We cannot count the processes taking place, for instance, in an episode of insect mating behavior.Even where natural units are identifiable, for example cycles in a cyclical process such as the beating of a heart or an organism’s sleep/wake cycle, the processes in question form a sequence with no discontinuities (temporal gaps) of the sort that we find for instance where billiard balls or zebrafish or planets are separated by clear spatial gaps. Lives of organisms are process units, but they too unfold in a continuous series from other, prior processes such as fertilization, and they unfold in turn in continuous series of post-life processes such as post-mortem decay. Clear examples of boundaries of processes are almost always of the fiat sort (midnight, a time of death as declared in an operating theater or on a death certificate, the initiation of a state of war) (iff (Process a) (and (Occurrent a) (exists (b) (properTemporalPartOf b a)) (exists (c t) (and (MaterialEntity c) (specificallyDependsOnAt a c t))))) // axiom label in BFO2 CLIF: [083-003] process disposition Disposition an atom of element X has the disposition to decay to an atom of element Y certain people have a predisposition to colon cancer children are innately disposed to categorize objects in certain ways. the cell wall is disposed to filter chemicals in endocitosis and exocitosis the cell wall is disposed to filter chemicals in endocytosis and exocytosis BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type [89 BFO 2 Reference: Dispositions exist along a strength continuum. Weaker forms of disposition are realized in only a fraction of triggering cases. These forms occur in a significant number of cases of a similar type. b is a disposition means: b is a realizable entity & b’s bearer is some material entity & b is such that if it ceases to exist, then its bearer is physically changed, & b’s realization occurs when and because this bearer is in some special physical circumstances, & this realization occurs in virtue of the bearer’s physical make-up. (axiom label in BFO2 Reference: [062-002]) If b is a realizable entity then for all t at which b exists, b s-depends_on some material entity at t. (axiom label in BFO2 Reference: [063-002]) (forall (x t) (if (and (RealizableEntity x) (existsAt x t)) (exists (y) (and (MaterialEntity y) (specificallyDepends x y t))))) // axiom label in BFO2 CLIF: [063-002] (forall (x) (if (Disposition x) (and (RealizableEntity x) (exists (y) (and (MaterialEntity y) (bearerOfAt x y t)))))) // axiom label in BFO2 CLIF: [062-002] disposition realizable RealizableEntity the disposition of this piece of metal to conduct electricity. the disposition of your blood to coagulate the function of your reproductive organs the role of being a doctor the role of this boundary to delineate where Utah and Colorado meet To say that b is a realizable entity is to say that b is a specifically dependent continuant that inheres in some independent continuant which is not a spatial region and is of a type instances of which are realized in processes of a correlated type. (axiom label in BFO2 Reference: [058-002]) All realizable dependent continuants have independent continuants that are not spatial regions as their bearers. (axiom label in BFO2 Reference: [060-002]) (forall (x t) (if (RealizableEntity x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (bearerOfAt y x t))))) // axiom label in BFO2 CLIF: [060-002] (forall (x) (if (RealizableEntity x) (and (SpecificallyDependentContinuant x) (exists (y) (and (IndependentContinuant y) (not (SpatialRegion y)) (inheresIn x y)))))) // axiom label in BFO2 CLIF: [058-002] realizable entity quality Quality the ambient temperature of this portion of air the color of a tomato the length of the circumference of your waist the mass of this piece of gold. the shape of your nose the shape of your nostril a quality is a specifically dependent continuant that, in contrast to roles and dispositions, does not require any further process in order to be realized. (axiom label in BFO2 Reference: [055-001]) If an entity is a quality at any time that it exists, then it is a quality at every time that it exists. (axiom label in BFO2 Reference: [105-001]) (forall (x) (if (Quality x) (SpecificallyDependentContinuant x))) // axiom label in BFO2 CLIF: [055-001] (forall (x) (if (exists (t) (and (existsAt x t) (Quality x))) (forall (t_1) (if (existsAt x t_1) (Quality x))))) // axiom label in BFO2 CLIF: [105-001] quality sdc SpecificallyDependentContinuant Reciprocal specifically dependent continuants: the function of this key to open this lock and the mutually dependent disposition of this lock: to be opened by this key of one-sided specifically dependent continuants: the mass of this tomato of relational dependent continuants (multiple bearers): John’s love for Mary, the ownership relation between John and this statue, the relation of authority between John and his subordinates. the disposition of this fish to decay the function of this heart: to pump blood the mutual dependence of proton donors and acceptors in chemical reactions [79 the mutual dependence of the role predator and the role prey as played by two organisms in a given interaction the pink color of a medium rare piece of grilled filet mignon at its center the role of being a doctor the shape of this hole. the smell of this portion of mozzarella b is a relational specifically dependent continuant = Def. b is a specifically dependent continuant and there are n &gt; 1 independent continuants c1, … cn which are not spatial regions are such that for all 1 i &lt; j n, ci and cj share no common parts, are such that for each 1 i n, b s-depends_on ci at every time t during the course of b’s existence (axiom label in BFO2 Reference: [131-004]) b is a specifically dependent continuant = Def. b is a continuant & there is some independent continuant c which is not a spatial region and which is such that b s-depends_on c at every time t during the course of b’s existence. (axiom label in BFO2 Reference: [050-003]) Specifically dependent continuant doesn't have a closure axiom because the subclasses don't necessarily exhaust all possibilites. We're not sure what else will develop here, but for example there are questions such as what are promises, obligation, etc. (iff (RelationalSpecificallyDependentContinuant a) (and (SpecificallyDependentContinuant a) (forall (t) (exists (b c) (and (not (SpatialRegion b)) (not (SpatialRegion c)) (not (= b c)) (not (exists (d) (and (continuantPartOfAt d b t) (continuantPartOfAt d c t)))) (specificallyDependsOnAt a b t) (specificallyDependsOnAt a c t)))))) // axiom label in BFO2 CLIF: [131-004] (iff (SpecificallyDependentContinuant a) (and (Continuant a) (forall (t) (if (existsAt a t) (exists (b) (and (IndependentContinuant b) (not (SpatialRegion b)) (specificallyDependsOnAt a b t))))))) // axiom label in BFO2 CLIF: [050-003] specifically dependent continuant role Role John’s role of husband to Mary is dependent on Mary’s role of wife to John, and both are dependent on the object aggregate comprising John and Mary as member parts joined together through the relational quality of being married. the priest role the role of a boundary to demarcate two neighboring administrative territories the role of a building in serving as a military target the role of a stone in marking a property boundary the role of subject in a clinical trial the student role BFO 2 Reference: One major family of examples of non-rigid universals involves roles, and ontologies developed for corresponding administrative purposes may consist entirely of representatives of entities of this sort. Thus ‘professor’, defined as follows,b instance_of professor at t =Def. there is some c, c instance_of professor role & c inheres_in b at t.denotes a non-rigid universal and so also do ‘nurse’, ‘student’, ‘colonel’, ‘taxpayer’, and so forth. (These terms are all, in the jargon of philosophy, phase sortals.) By using role terms in definitions, we can create a BFO conformant treatment of such entities drawing on the fact that, while an instance of professor may be simultaneously an instance of trade union member, no instance of the type professor role is also (at any time) an instance of the type trade union member role (any more than any instance of the type color is at any time an instance of the type length).If an ontology of employment positions should be defined in terms of roles following the above pattern, this enables the ontology to do justice to the fact that individuals instantiate the corresponding universals – professor, sergeant, nurse – only during certain phases in their lives. b is a role means: b is a realizable entity & b exists because there is some single bearer that is in some special physical, social, or institutional set of circumstances in which this bearer does not have to be& b is not such that, if it ceases to exist, then the physical make-up of the bearer is thereby changed. (axiom label in BFO2 Reference: [061-001]) (forall (x) (if (Role x) (RealizableEntity x))) // axiom label in BFO2 CLIF: [061-001] role three-dimensional spatial region site Site Manhattan Canyon) a hole in the interior of a portion of cheese a rabbit hole an air traffic control region defined in the airspace above an airport the Grand Canyon the Piazza San Marco the cockpit of an aircraft the hold of a ship the interior of a kangaroo pouch the interior of the trunk of your car the interior of your bedroom the interior of your office the interior of your refrigerator the lumen of your gut your left nostril (a fiat part – the opening – of your left nasal cavity) b is a site means: b is a three-dimensional immaterial entity that is (partially or wholly) bounded by a material entity or it is a three-dimensional immaterial part thereof. (axiom label in BFO2 Reference: [034-002]) (forall (x) (if (Site x) (ImmaterialEntity x))) // axiom label in BFO2 CLIF: [034-002] site bfo BFO:0000030 object gdc GenericallyDependentContinuant The entries in your database are patterns instantiated as quality instances in your hard drive. The database itself is an aggregate of such patterns. When you create the database you create a particular instance of the generically dependent continuant type database. Each entry in the database is an instance of the generically dependent continuant type IAO: information content entity. the pdf file on your laptop, the pdf file that is a copy thereof on my laptop the sequence of this protein molecule; the sequence that is a copy thereof in that protein molecule. b is a generically dependent continuant = Def. b is a continuant that g-depends_on one or more other entities. (axiom label in BFO2 Reference: [074-001]) (iff (GenericallyDependentContinuant a) (and (Continuant a) (exists (b t) (genericallyDependsOnAt a b t)))) // axiom label in BFO2 CLIF: [074-001] generically dependent continuant function Function the function of a hammer to drive in nails the function of a heart pacemaker to regulate the beating of a heart through electricity the function of amylase in saliva to break down starch into sugar BFO 2 Reference: In the past, we have distinguished two varieties of function, artifactual function and biological function. These are not asserted subtypes of BFO:function however, since the same function – for example: to pump, to transport – can exist both in artifacts and in biological entities. The asserted subtypes of function that would be needed in order to yield a separate monoheirarchy are not artifactual function, biological function, etc., but rather transporting function, pumping function, etc. A function is a disposition that exists in virtue of the bearer’s physical make-up and this physical make-up is something the bearer possesses because it came into being, either through evolution (in the case of natural biological entities) or through intentional design (in the case of artifacts), in order to realize processes of a certain sort. (axiom label in BFO2 Reference: [064-001]) (forall (x) (if (Function x) (Disposition x))) // axiom label in BFO2 CLIF: [064-001] function material MaterialEntity a flame a forest fire a human being a hurricane a photon a puff of smoke a sea wave a tornado an aggregate of human beings. an energy wave an epidemic the undetached arm of a human being BFO 2 Reference: Material entities (continuants) can preserve their identity even while gaining and losing material parts. Continuants are contrasted with occurrents, which unfold themselves in successive temporal parts or phases [60 BFO 2 Reference: Object, Fiat Object Part and Object Aggregate are not intended to be exhaustive of Material Entity. Users are invited to propose new subcategories of Material Entity. BFO 2 Reference: ‘Matter’ is intended to encompass both mass and energy (we will address the ontological treatment of portions of energy in a later version of BFO). A portion of matter is anything that includes elementary particles among its proper or improper parts: quarks and leptons, including electrons, as the smallest particles thus far discovered; baryons (including protons and neutrons) at a higher level of granularity; atoms and molecules at still higher levels, forming the cells, organs, organisms and other material entities studied by biologists, the portions of rock studied by geologists, the fossils studied by paleontologists, and so on.Material entities are three-dimensional entities (entities extended in three spatial dimensions), as contrasted with the processes in which they participate, which are four-dimensional entities (entities extended also along the dimension of time).According to the FMA, material entities may have immaterial entities as parts – including the entities identified below as sites; for example the interior (or ‘lumen’) of your small intestine is a part of your body. BFO 2.0 embodies a decision to follow the FMA here. A material entity is an independent continuant that has some portion of matter as proper or improper continuant part. (axiom label in BFO2 Reference: [019-002]) Every entity which has a material entity as continuant part is a material entity. (axiom label in BFO2 Reference: [020-002]) every entity of which a material entity is continuant part is also a material entity. (axiom label in BFO2 Reference: [021-002]) (forall (x) (if (MaterialEntity x) (IndependentContinuant x))) // axiom label in BFO2 CLIF: [019-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt x y t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [021-002] (forall (x) (if (and (Entity x) (exists (y t) (and (MaterialEntity y) (continuantPartOfAt y x t)))) (MaterialEntity x))) // axiom label in BFO2 CLIF: [020-002] bfo BFO:0000040 material entity material entity immaterial ImmaterialEntity BFO 2 Reference: Immaterial entities are divided into two subgroups:boundaries and sites, which bound, or are demarcated in relation, to material entities, and which can thus change location, shape and size and as their material hosts move or change shape or size (for example: your nasal passage; the hold of a ship; the boundary of Wales (which moves with the rotation of the Earth) [38, 7, 10 immaterial entity Any constitutionally or isotopically distinct atom, molecule, ion, ion pair, radical, radical ion, complex, conformer etc., identifiable as a separately distinguishable entity. chebi_ontology CHEBI:23367 molecular entity A chemical entity is a physical entity of interest in chemistry including molecular entities, parts thereof, and chemical substances. chebi_ontology CHEBI:24431 chemical entity A compound formally derived from ammonia by replacing one, two or three hydrogen atoms by organyl groups. chebi_ontology CHEBI:50047 organic amino compound The removal of the oligonucleotide that contains the DNA damage. The oligonucleotide is formed by dual incisions that flank the site of DNA damage. biological_process GO:0000718 nucleotide-excision repair, DNA damage removal The union or introduction of genetic information from compatible mating types that results in a genetically different individual. Conjugation requires direct cellular contact between the organisms. Wikipedia:Conjugation biological_process GO:0000746 conjugation The cellular metabolic process in which a cell duplicates one or more molecules of DNA. DNA replication begins when specific sequences, known as origins of replication, are recognized and bound by initiation proteins, and ends when the original DNA molecule has been completely duplicated and the copies topologically separated. The unit of replication usually corresponds to the genome of the cell, an organelle, or a virus. The template for replication can either be an existing DNA molecule or RNA. GO:0055133 MIPS_funcat:10.01.03 Wikipedia:DNA_replication biological_process GO:0006260 DNA biosynthesis is only part of this process. See also the biological process terms 'DNA-dependent DNA replication ; GO:0006261' and 'RNA-dependent DNA replication ; GO:0006278'. DNA replication A biological process represents a specific objective that the organism is genetically programmed to achieve. Biological processes are often described by their outcome or ending state, e.g., the biological process of cell division results in the creation of two daughter cells (a divided cell) from a single parent cell. A biological process is accomplished by a particular set of molecular functions carried out by specific gene products (or macromolecular complexes), often in a highly regulated manner and in a particular temporal sequence. janelomax 2012-09-19T15:05:24Z GO:0000004 GO:0007582 GO:0044699 Wikipedia:Biological_process biological process physiological process biological_process single organism process single-organism process GO:0008150 Note that, in addition to forming the root of the biological process ontology, this term is recommended for use for the annotation of gene products whose biological process is unknown. When this term is used for annotation, it indicates that no information was available about the biological process of the gene product annotated as of the date the annotation was made; the evidence code "no data" (ND), is used to indicate this. biological_process Catalysis of the integration of one segment of DNA into another. Reactome:R-HSA-164523 molecular_function GO:0008907 integrase activity Catalysis of the formation of new phosphodiester bonds between a pair of short, unique DNA target sequences; occurs through a phosphotyrosyl intermediate in which the target sequence is first cleaved by the nucleophilic attack by a tyrosine in the active site. tyrosine recombinase site-specific tyrosine recombinase activity molecular_function GO:0009037 tyrosine-based site-specific recombinase activity The process in which a segment of DNA is incorporated into another, usually larger, DNA molecule such as a chromosome. MIPS_funcat:10.01.05.03.05 biological_process GO:0015074 DNA integration The removal of a section of DNA from a larger DNA molecule by the making of dual incisions that flank the section to be excised. janelomax 2011-08-03T10:56:37Z biological_process GO:0044349 DNA excision Any process that modulates a measurable attribute of any biological process, quality or function. regulation biological_process GO:0065007 biological regulation A DNA-dependent DNA replication process in which a single-stranded DNA molecule is synthesized from a circular duplex template. Replication typically does not cease when one circumference has been replicated, but continues around the circumference several more times, producing a long single strand comprising multimers of the replicon. midori 2009-04-22T02:53:52Z rolling circle replication biological_process GO:0070581 rolling circle DNA replication A bacterial protein complex that neutralises its own toxin by complexing the toxin with the antitoxin. The antitoxin can be either a protein or an RNA. The neutralising toxin-antitoxin complex also acts as a transcriptional repressor of the toxin-antitoxin operon. toxin-antitoxin system kmv IntAct:EBI-10919614 IntAct:EBI-13949147 IntAct:EBI-13949218 IntAct:EBI-13949593 IntAct:EBI-13949715 IntAct:EBI-13949851 cellular_component GO:0110001 An example is YoeB (P69348) in Escherichia coli in PMID:16109374 (inferred by direct evidence). toxin-antitoxin complex highly modular mobile genetic element, which has both plasmid-and bacteriophage-like features, encodes gene and proteins for its excision, its transfer by conjugation and its integration. Meng LIU (Mia), Oliver He ICE http://db-mml.sjtu.edu.cn/ICEberg/ integrative and conjugative element Meng LIU (Mia), Oliver He - Pseudomonas aeruginosa PSE9 Meng LIU (Mia), Oliver He - Pseudomonas syringae pv. phaseolicola 1302A Meng LIU (Mia), Oliver He 40 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=40 80.6 kb AM942759 46.73[38.9] 2649499..2730130 ICE with experimental support prfC (PMI2422) ICEPmiUSA1 the integration and excision module of ICE ICEPmiUSA1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiUSA1 IEM the conjugation module of ICE ICEPmiUSA1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiUSA1 CM the regulation module of ICE ICEPmiUSA1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiUSA1 RM the accessory module of ICE ICEPmiUSA1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiUSA1 AM Meng LIU (Mia), Oliver He 39 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=39 111.2 kb Shewanella putrefaciens CP000503 48.28[44.63] 1224492..1335682 ICE with experimental support prfC (Sputw3181_1184) ICESpuPO1 the integration and excision module of ICE ICESpuPO1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpuPO1 IEM the conjugation module of ICE ICESpuPO1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpuPO1 CM the regulation module of ICE ICESpuPO1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpuPO1 RM the accessory module of ICE ICESpuPO1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpuPO1 AM Meng LIU (Mia), Oliver He 16 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=16 107.7 kb CP001485 36.4 2958347..3066049 ICE with experimental support prfC (VCD_003660) ICEVchBan9 the integration and excision module of ICE ICEVchBan9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan9 IEM the conjugation module of ICE ICEVchBan9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan9 CM the regulation module of ICE ICEVchBan9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan9 RM the accessory module of ICE ICEVchBan9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan9 AM Meng LIU (Mia), Oliver He 12 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=12 102.1 kb Bacteroides spp. GQ463140 47.28 1..102122 ICE with experimental support prfC ICEVchBan5 the integration and excision module of ICE ICEVchBan5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan5 IEM the conjugation module of ICE ICEVchBan5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan5 CM the regulation module of ICE ICEVchBan5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan5 RM the accessory module of ICE ICEVchBan5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan5 AM Meng LIU (Mia), Oliver He 22 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=22 98 kb GQ463142 46.73 1..97952 ICE with experimental support prfC ICEVchInd5 [ICEVchHai1] the integration and excision module of ICE ICEVchInd5 [ICEVchHai1]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd5 [ICEVchHai1] IEM the conjugation module of ICE ICEVchInd5 [ICEVchHai1]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd5 [ICEVchHai1] CM the regulation module of ICE ICEVchInd5 [ICEVchHai1]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd5 [ICEVchHai1] RM the accessory module of ICE ICEVchInd5 [ICEVchHai1]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd5 [ICEVchHai1] AM Meng LIU (Mia), Oliver He 23 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=23 83.2 kb GQ463143 46.73 1..83194 ICE with experimental support prfC ICEVchMex1 the integration and excision module of ICE ICEVchMex1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMex1 IEM the conjugation module of ICE ICEVchMex1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMex1 CM the regulation module of ICE ICEVchMex1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMex1 RM the accessory module of ICE ICEVchMex1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMex1 AM Meng LIU (Mia), Oliver He 21 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=21 95.3 kb GQ463141 46.87 1..95326 ICE with experimental support prfC ICEVchInd4 the integration and excision module of ICE ICEVchInd4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd4 IEM the conjugation module of ICE ICEVchInd4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd4 CM the regulation module of ICE ICEVchInd4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd4 RM the accessory module of ICE ICEVchInd4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd4 AM Meng LIU (Mia), Oliver He 36 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=36 114.2 kb GQ463144 47.59 1..114195 ICE with experimental support MGIVglInd1 MGIVglInd1 can be mobilized in trans by ICEVflInd1 from Vibrio fluvialis/ E. coli CAG18439 to Escherichia coli. (PMID: 20807202; 23204461) prfC ICEVflInd1 the integration and excision module of ICE ICEVflInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflInd1 IEM the conjugation module of ICE ICEVflInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflInd1 CM the regulation module of ICE ICEVflInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflInd1 RM the accessory module of ICE ICEVflInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflInd1 AM Meng LIU (Mia), Oliver He 37 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=37 96.7 kb GQ463139 47.09 1..96676 ICE with experimental support prfC ICEPalBan1 the integration and excision module of ICE ICEPalBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPalBan1 IEM the conjugation module of ICE ICEPalBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPalBan1 CM the regulation module of ICE ICEPalBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPalBan1 RM the accessory module of ICE ICEPalBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPalBan1 AM Meng LIU (Mia), Oliver He 38 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=38 103 kb Escherichia coli AJ870986 46.34 1..102985 ICE with experimental support prfC ICEPdaSpa1 the integration and excision module of ICE ICEPdaSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPdaSpa1 IEM the conjugation module of ICE ICEPdaSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPdaSpa1 CM the regulation module of ICE ICEPdaSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPdaSpa1 RM the accessory module of ICE ICEPdaSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPdaSpa1 AM Meng LIU (Mia), Oliver He 43 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=43 88.5 kb Escherichia coli; Bacteroides spp. AY090559 46.48 1..88532 ICE with experimental support prfC R391 the integration and excision module of ICE R391. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R391 IEM the conjugation module of ICE R391. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R391 CM the regulation module of ICE R391. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R391 RM the accessory module of ICE R391. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R391 AM Meng LIU (Mia), Oliver He 44 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=44 99.5 kb Vibrio cholerae; Escherichia coli; Salmonella enterica serovar Typhimurium AY055428 47.05 1..99483 ICE with experimental support MGIVchUSA1 MGIVchUSA1 can be mobilized in trans by SXT(MO10) from E. coli CAG18420 to E. coli VB112. (PMID: 20807202) MGIVflInd1 MGIVflInd1 can be mobilized in trans by SXT(MO10) from E. coli AD64 to E. coli CAG18439. (PMID: 20807202) MGIVvuTai1 MGIVvuTai1 can be mobilized in trans by SXT(MO10) from E. coli CAG18420 to E. coli VB112. (PMID: 20807202) prfC Resistance to the antibiotics sulfamethoxazole, trimethoprim, chloramphenicol, and streptomycin; Toxin-Antitoxin System SXT(MO10) the integration and excision module of ICE SXT(MO10). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MO10) IEM the conjugation module of ICE SXT(MO10). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MO10) CM the regulation module of ICE SXT(MO10). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MO10) RM the accessory module of ICE SXT(MO10). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MO10) AM Meng LIU (Mia), Oliver He 1016 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1016 92.8 kb Escherichia coli 48.01 ICE with experimental support prfC ICEPmiChn1 the integration and excision module of ICE ICEPmiChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn1 IEM the conjugation module of ICE ICEPmiChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn1 CM the regulation module of ICE ICEPmiChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn1 RM the accessory module of ICE ICEPmiChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn1 AM Meng LIU (Mia), Oliver He - Escherichia coli ECOR31 Meng LIU (Mia), Oliver He 200013 http://202.120.12.135/oriTDB/browse_oriT_result.php?acc=200013 250 nt intact experimental 17981959 oriT_ ICEKp1 Meng LIU (Mia), Oliver He - Pseudomonas aeruginosa FFUP_PS_690 gene that encodes a protein which nicks the dsDNA and remains covalently bound to the resulting ssDNA Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Relaxase relaxase gene Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/nuccore/AM180355 604427..606028 272563 - protein-coding PMID: 16804543 Recombinase site-specific resolvase family Tn5397, CTn3-Orf3 CD630_05110(tndx) A role played by gene that encodes a protein which has the ability to neutralize a specific toxin. Meng LIU (Mia), Oliver He antitoxin gene role A role played by a material entity that has the ability to neutralize a specific toxin. Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Antitoxin antitoxin role Meng LIU (Mia), Oliver He T4SS gene component type IV secretion system gene component A relaxase is a single-strand DNA transesterase enzyme produced by some prokaryotes and viruses, which nicks the dsDNA and remains covalently bound to the resulting ssDNA. Relaxases are responsible for site- and strand-specific nicks in double-stranded DNA. Meng LIU (Mia), Oliver He MOB https://en.wikipedia.org/wiki/Relaxase relaxase A role played by gene that encodes a protein which is poisonous. Meng LIU (Mia), Oliver He toxin gene role Meng LIU (Mia), Oliver He recombinase gene gene encoding products that mediate an exchange reaction between two DNA templates, resulting in integration of DNA from one of the templates into the other. integrase gene a protein component of T4SS Meng LIU (Mia), Oliver He T4SS protein component https://academic.oup.com/nar/article/47/D1/D660/5165266 type IV secretion system protein component A role played by a protein which is part of T4SS (a cell envelope-spanning complexes that form a channel through which DNA and proteins can travel from the cytoplasm of the donor cell to the cytoplasm of the recipient cell. ) Meng LIU (Mia), Oliver He T4SS protein component role type IV secretion system protein component role A role played by a gene that encodes products to mediate an exchange reaction between two DNA templates and result in integration of DNA from one of the templates into the other. Meng LIU (Mia), Oliver He integrase gene role gene that encodes a transposase enzyme with the DDE motif. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2991504/ DDE transposase gene gene encoding one family of recombinases that use serine to attack and covalently link the DNA during strand exchange. Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Site-specific_recombination serine recombinase gene gene encoding one family of recombinases that use tyrosine to attack and covalently link the DNA during strand exchange. Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Site-specific_recombination tyrosine recombinase gene ICE from Klebsiella pneumoniae Meng LIU (Mia), Oliver He ICEberg database http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp ICE The integration and excision module refers to those genes and sequence within the ICE responsible for the integration and excision of the element from the host chromosome, including genes encoding the integrase and or recombination directionality factor (also known as excisionase, which influences the direction of recombination mediated by the integrase to favor excision). Meng LIU (Mia), Oliver He recombination module component https://academic.oup.com/nar/article/47/D1/D660/5165266 ICE IEM for integration A role played by a gene that encodes a protein for nicking the dsDNA. Meng LIU (Mia), Oliver He relaxase gene role A role played by a gene that encodes products for controlling the directionality of integrase-mediated site-specific recombination reactions. Meng LIU (Mia), Oliver He RDF gene role recombination directionality factor gene role Gene encoding products that involved in controlling the directionality of integrase-mediated site-specific recombination reactions. Meng LIU (Mia), Oliver He RDF gene https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55702/ recombination directionality factor gene gene encoding products that link translocating substrates to the transenvelope secretion conduit. Meng LIU (Mia), Oliver He gene of T4CP https://www.nature.com/articles/nmicrobiol2017114 gene of type IV coupling protein Meng LIU (Mia), Oliver He gene of T4CP role a role played by a gene that encodes a protein which links translocating substrates to the transenvelope secretion conduit. gene of type IV coupling protein role a role played by a gene that encodes a protein for energizing the T4SS system from the cytoplasm and driving the complex assembly and substrate translocation through the channel. Meng LIU (Mia), Oliver He T4SS ATPase gene role Meng LIU (Mia), Oliver He gene of T4SS ATPase A role played by a material entity that contributes to the integration and excision of the element from the host chromosome. Meng LIU (Mia), Oliver He integration and excision module component role The integration and excision module refers to those genes and sequence within the ICE responsible for the integration and excision of the element from the host chromosome, including genes encoding the integrase and or recombination directionality factor (also known as excisionase, which influences the direction of recombination mediated by the integrase to favor excision). Meng LIU (Mia), Oliver He recombination module component https://academic.oup.com/nar/article/47/D1/D660/5165266 ICE IEM for excision Meng LIU (Mia), Oliver He strain An enzyme that mediates an exchange reaction between two DNA templates, resulting in integration of DNA from one of the templates into the other. Meng LIU (Mia), Oliver He Int recombinase https://jb.asm.org/content/185/17/5045 integrase Meng LIU (Mia), Oliver He 46 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=46 54.7 kb Cupriavidus metallidurans AJ536756 63.49 1..54657 ICE with experimental support TTTTTCAT Tn4371 the integration and excision module of ICE Tn4371. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn4371 IEM the conjugation module of ICE Tn4371. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn4371 CM the regulation module of ICE Tn4371. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn4371 RM the accessory module of ICE Tn4371. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn4371 AM Accessory module component refers to genes such as virulence factor (VF) genes and acquired antibiotic resistance genes (ARG) that often exist inside ICEs as the cargo genes and can confer the hosts with selective advantages, which make ICEs a vital role in the process of bacterial adaptation and evolution. Meng LIU (Mia), Oliver He https://academic.oup.com/nar/article/47/D1/D660/5165266 ICE accessory module Meng LIU (Mia), Oliver He 166 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=166 61.8 kb AB546270 63.97 1..61807 ICE with experimental support ICE-KKS the integration and excision module of ICE ICE-KKS. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-KKS IEM the conjugation module of ICE ICE-KKS. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-KKS CM the regulation module of ICE ICE-KKS. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-KKS RM the accessory module of ICE ICE-KKS. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-KKS AM Meng LIU (Mia), Oliver He 2 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=2 52 kb Bacteroides spp. AY515263 49.49 1..51993 ICE with experimental support Tn4555 Tn4555 can be mobilized in trans by CTn341 from Bacteroides vulgatus to Escherichia coli. (PMID: 14702313) CTn341 the integration and excision module of ICE CTn341. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn341 IEM the conjugation module of ICE CTn341. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn341 CM the regulation module of ICE CTn341. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn341 RM the accessory module of ICE CTn341. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn341 AM Meng LIU (Mia), Oliver He 219 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=219 255.5 kb AM902716 61.73[65.48] 1083989..1339502 ICE with experimental support tRNA-Gly (tRNA-10) ICE-GI1 the integration and excision module of ICE ICE-GI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI1 IEM the conjugation module of ICE ICE-GI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI1 CM the regulation module of ICE ICE-GI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI1 RM the accessory module of ICE ICE-GI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI1 AM gene encoding products that can confer the the ability of bacteria and other microorganisms to resist the effects of an antibiotic to which they were once sensitive. Meng LIU (Mia), Oliver He https://www.medicinenet.com/script/main/art.asp?articlekey=2276 Antibiotic resistance is a major concern of overuse of antibiotics. antibiotic resistance gene Meng LIU (Mia), Oliver He 220 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=220 143.4 kb AM902716 60.59[65.48] 1350129..1493558 ICE with experimental support ICE-GI2 the integration and excision module of ICE ICE-GI2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI2 IEM the conjugation module of ICE ICE-GI2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI2 CM the regulation module of ICE ICE-GI2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI2 RM the accessory module of ICE ICE-GI2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI2 AM Meng LIU (Mia), Oliver He 221 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=221 102.1 kb AM902716 63.02[65.48] 1493541..1595651 ICE with experimental support tRNA-Gly (tRNA-11) ICE-GI3 the integration and excision module of ICE ICE-GI3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI3 IEM the conjugation module of ICE ICE-GI3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI3 CM the regulation module of ICE ICE-GI3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI3 RM the accessory module of ICE ICE-GI3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI3 AM Meng LIU (Mia), Oliver He 222 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=222 159.1 kb AM902716 61.15[65.48] 4417743..4576839 ICE with experimental support tRNA-Gly (tRNA-44) ICE-GI6 the integration and excision module of ICE ICE-GI6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI6 IEM the conjugation module of ICE ICE-GI6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI6 CM the regulation module of ICE ICE-GI6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI6 RM the accessory module of ICE ICE-GI6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-GI6 AM Meng LIU (Mia), Oliver He gene encoding products that assist the bacterium colonize the host at the cellular level and are either secretory, membrane associated or cytosolic in nature. https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5243249/ virulence factor gene The conjugation module denotes those genes and sequences involved in the conjugal process, such as genes encoding relaxase and the type IV secretion system (T4SS). Meng LIU (Mia), Oliver He https://academic.oup.com/nar/article/47/D1/D660/5165266 ICE conjugation module Meng LIU (Mia), Oliver He 56 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=56 102.8 kb Pseudomonas putida; Pseudomonas aeruginosa; Cupriavidus necator AJ617740 62.51 60..102843 ICE with experimental support tRNA-Gly ICEclc(B13) the integration and excision module of ICE ICEclc(B13). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(B13) IEM the conjugation module of ICE ICEclc(B13). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(B13) CM the regulation module of ICE ICEclc(B13). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(B13) RM the accessory module of ICE ICEclc(B13). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(B13) AM Meng LIU (Mia), Oliver He 174 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=174 105 kb AF440523 64.71 27286..132240 ICE with experimental support tRNA-Gly PAGI-2 the integration and excision module of ICE PAGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-2 IEM the conjugation module of ICE PAGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-2 CM the regulation module of ICE PAGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-2 RM the accessory module of ICE PAGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-2 AM Meng LIU (Mia), Oliver He 1077 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1077 173.8 kb Azoarcus sp. CIBTRif CP011072 4894159..5067957 ICE with experimental support tRNAGly(TTCGATTCCCATCGCCCGCTCCA) ICEXTD the integration and excision module of ICE ICEXTD. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEXTD IEM the conjugation module of ICE ICEXTD. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEXTD CM the regulation module of ICE ICEXTD. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEXTD RM the accessory module of ICE ICEXTD. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEXTD AM Meng LIU (Mia), Oliver He 1010 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1010 86.2 kb Pseudomonas aeruginosa KY852375 63.05 315..86517 ICE with experimental support tRNAGly ICEPae690 the integration and excision module of ICE ICEPae690. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPae690 IEM the conjugation module of ICE ICEPae690. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPae690 CM the regulation module of ICE ICEPae690. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPae690 RM the accessory module of ICE ICEPae690. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPae690 AM Meng LIU (Mia), Oliver He 59 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=59 20.5 kb Bacillus and Listeria species AL009126 35.7[43.51] 529423..549932 ICE with experimental support tRNA-Leu(BSU_tRNA_51) ICEBs1 the integration and excision module of ICE ICEBs1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEBs1 IEM the conjugation module of ICE ICEBs1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEBs1 CM the regulation module of ICE ICEBs1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEBs1 RM the accessory module of ICE ICEBs1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEBs1 AM Meng LIU (Mia), Oliver He 60 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=60 59.4 kb Haemophilus influenzae; Haemophilus parainfluenzae AJ627386 39.1 1..59393 ICE with experimental support tRNA-Leu ICEHin1056 the integration and excision module of ICE ICEHin1056. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHin1056 IEM the conjugation module of ICE ICEHin1056. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHin1056 CM the regulation module of ICE ICEHin1056. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHin1056 RM the accessory module of ICE ICEHin1056. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHin1056 AM Meng LIU (Mia), Oliver He 960 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=960 56.1 kb Actinobacillus pleuropneumoniae KU551309 27..56176 ICE with experimental support tRNA-Leu (TAA) ICEApl1 the integration and excision module of ICE ICEApl1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl1 IEM the conjugation module of ICE ICEApl1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl1 CM the regulation module of ICE ICEApl1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl1 RM the accessory module of ICE ICEApl1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl1 AM Meng LIU (Mia), Oliver He 175 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=175 108 kb CP000438 59.74[66.29] 5251440..5359392 ICE with experimental support tRNA-Lys (Lys47) PAPI-1 the integration and excision module of ICE PAPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAPI-1 IEM the conjugation module of ICE PAPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAPI-1 CM the regulation module of ICE PAPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAPI-1 RM the accessory module of ICE PAPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAPI-1 AM Meng LIU (Mia), Oliver He 173 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=173 103.5 kb AY257538 60.93 1..103532 ICE with experimental support tRNA-Lys pKLC102 the integration and excision module of ICE pKLC102. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pKLC102 IEM the conjugation module of ICE pKLC102. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pKLC102 CM the regulation module of ICE pKLC102. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pKLC102 RM the accessory module of ICE pKLC102. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pKLC102 AM Meng LIU (Mia), Oliver He 176 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=176 99.3 kb EF611301 59.62 1..99276 ICE with experimental support tRNA-Lys (Lys47) PAGI-5 the integration and excision module of ICE PAGI-5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-5 IEM the conjugation module of ICE PAGI-5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-5 CM the regulation module of ICE PAGI-5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-5 RM the accessory module of ICE PAGI-5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PAGI-5 AM Meng LIU (Mia), Oliver He 78 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=78 35.9 kb AJ278471 34.99 1290..36049 ICE with experimental support fda ICESt1 the integration and excision module of ICE ICESt1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt1 IEM the conjugation module of ICE ICESt1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt1 CM the regulation module of ICE ICESt1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt1 RM the accessory module of ICE ICESt1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt1 AM Meng LIU (Mia), Oliver He 79 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=79 28.1 kb Streptococcus pyogenes; Enterococcus faecalis AJ586568 36.9 204..28293 ICE with experimental support IME_GB00957_oriT IME_GB00957_oriT is predicted to be mobilized in trans by ICESt3 (PMID: 25832353; 28373865) CIME19258 CIME19258 is predicted to be mobilized in cis by ICESt3 (PMID: 21722203) CIME9 CIME9 is predicted to be mobilized in cic by ICESt3 (PMID: 21722203) CIMEL3catR3 CIMEL3catR3 can be mobilized in cis by ICESt3 from Streptococcus thermophilus to Streptococcus thermophilus (PMID: 21722203) fda ICESt3 the integration and excision module of ICE ICESt3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt3 IEM the conjugation module of ICE ICESt3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt3 CM the regulation module of ICE ICESt3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt3 RM the accessory module of ICE ICESt3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESt3 AM Meng LIU (Mia), Oliver He 288 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=288 133.5 kb AL513382 49.68[52.09] 4409574..4543073 ICE with experimental support tRNA-PheU SPI-7 the integration and excision module of ICE SPI-7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SPI-7 IEM the conjugation module of ICE SPI-7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SPI-7 CM the regulation module of ICE SPI-7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SPI-7 RM the accessory module of ICE SPI-7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SPI-7 AM Meng LIU (Mia), Oliver He 113 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=113 109.4 kb FN298494 51.02 1785..111202 ICE with experimental support tRNA-Phe ICESb1 the integration and excision module of ICE ICESb1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESb1 IEM the conjugation module of ICE ICESb1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESb1 CM the regulation module of ICE ICESb1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESb1 RM the accessory module of ICE ICESb1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESb1 AM Meng LIU (Mia), Oliver He 358 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=358 13.3 kb AB435014 30.14 928..14266 ICE with experimental support Tn6012 the integration and excision module of ICE Tn6012. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6012 IEM the conjugation module of ICE Tn6012. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6012 CM the regulation module of ICE Tn6012. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6012 RM the accessory module of ICE Tn6012. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6012 AM Meng LIU (Mia), Oliver He 68 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=68 19.9 kb Staphylococcus aureus FJ231270 29.62 1..19905 ICE with experimental support ICE6013 the integration and excision module of ICE ICE6013. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6013 IEM the conjugation module of ICE ICE6013. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6013 CM the regulation module of ICE ICE6013. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6013 RM the accessory module of ICE ICE6013. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6013 AM Meng LIU (Mia), Oliver He 160 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=160 47.1 kb NC_004368 37.66[35.63] 385757..432824 ICE with experimental support TnGBS1 the integration and excision module of ICE TnGBS1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS1 IEM the conjugation module of ICE TnGBS1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS1 CM the regulation module of ICE TnGBS1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS1 RM the accessory module of ICE TnGBS1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS1 AM Meng LIU (Mia), Oliver He 165 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=165 61 kb FR670347 33.18 1..61030 ICE with experimental support ICE6094 the integration and excision module of ICE ICE6094. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6094 IEM the conjugation module of ICE ICE6094. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6094 CM the regulation module of ICE ICE6094. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6094 RM the accessory module of ICE ICE6094. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE6094 AM Meng LIU (Mia), Oliver He 377 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=377 54.3 kb AE009948 38.35[35.65] 1256680..1311028 ICE with experimental support ICESa2603 the integration and excision module of ICE ICESa2603. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603 IEM the conjugation module of ICE ICESa2603. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603 CM the regulation module of ICE ICESa2603. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603 RM the accessory module of ICE ICESa2603. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603 AM Meng LIU (Mia), Oliver He 311 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=311 88.9 kb CP000407 38.79[41.11] 872967..961817 ICE with experimental support TTATTTAAGAGTAAC ICESsu05ZYH33-1 the integration and excision module of ICE ICESsu05ZYH33-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05ZYH33-1 IEM the conjugation module of ICE ICESsu05ZYH33-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05ZYH33-1 CM the regulation module of ICE ICESsu05ZYH33-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05ZYH33-1 RM the accessory module of ICE ICESsu05ZYH33-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05ZYH33-1 AM Meng LIU (Mia), Oliver He 76 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=76 63.7 kb Hemolytic Streptococci EU142041 38.14 1..63668 ICE with experimental support ICESde3396 the integration and excision module of ICE ICESde3396. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396 IEM the conjugation module of ICE ICESde3396. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396 CM the regulation module of ICE ICESde3396. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396 RM the accessory module of ICE ICESde3396. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396 AM Meng LIU (Mia), Oliver He 445 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=445 54.9 kb Streptococcus suis v36RF; Streptococcus pyogenes 12RF; Streptococcus pneumoniae R6RF; Streptococcus agalactiae 1357RF FR823304 38.89 1..54879 ICE with experimental support TTATTTAAGAGTAAC ICESsu32457 the integration and excision module of ICE ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu32457 IEM the conjugation module of ICE ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu32457 CM the regulation module of ICE ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu32457 RM the accessory module of ICE ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu32457 AM Meng LIU (Mia), Oliver He 791 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=791 73.4 kb Streptococcus agalactiae Streptococcus pneumoniae; Streptococcus gordonii; Streptococcus pyogenes; Streptococcus agalactiae;Enterococcus faecalis; Bacillus subtilis CP019978 37.73 629058..702486 ICE with experimental support rumA ICESag37 the integration and excision module of ICE ICESag37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag37 IEM the conjugation module of ICE ICESag37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag37 CM the regulation module of ICE ICESag37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag37 RM the accessory module of ICE ICESag37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag37 AM Meng LIU (Mia), Oliver He protein of Bacteria a typical class of ICEs which transfer as single stranded DNA molecules and require T4SS and can both found in Gram-positive bacteria and Gram-negative bacteria Meng LIU (Mia), Oliver He T4SS-type ICE http://db-mml.sjtu.edu.cn/ICEberg/ T4SS-type integrative and conjugative element a T4SS-type ICE of Gram-positive bacteria Meng LIU (Mia), Oliver He T4SS-type ICE in Gram-positive bacteria http://db-mml.sjtu.edu.cn/ICEberg/ T4SS-type integrative and conjugative element in Gram-positive bacteria a T4SS-type ICE of Gram-negative bacteria Meng LIU (Mia), Oliver He T4SS-type ICE in Gram-negative bacteria http://db-mml.sjtu.edu.cn/ICEberg/ T4SS-type integrative and conjugative element in Gram-negative bacteria Meng LIU (Mia), Oliver He 70 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=70 38.9 kb Escherichia coli AY233333 47.73 1..38927 ICE with experimental support tRNA-Asn ICEEc1 the integration and excision module of ICE ICEEc1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc1 IEM the conjugation module of ICE ICEEc1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc1 CM the regulation module of ICE ICEEc1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc1 RM the accessory module of ICE ICEEc1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc1 AM 126 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=126 75935 bp Klebsiella pneumoniae;Escherichia coli 3: complete in a genome file AP006725 52.18[57.68] 3395836..3471770 1: experimental GIE492 GIE492 is predicted to be mobilized in trans by ICEKp1 (PMID: 27375573; 29165361) tRNA-asn(KP1_6086) 19447910; 17981959 ICEKp1 the integration and excision module of ICE ICEKp1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKp1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp1 IEM for integration Meng LIU (Mia), Oliver He The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKp1. http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp1 IEM for excision the conjugation module of ICE ICEKp1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp1 CM the regulation module of ICE ICEKp1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp1 RM the accessory module of ICE ICEKp1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKp1 AM Meng LIU (Mia), Oliver He 961 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=961 92.7 kb Actinobacillus pleuropneumoniae MF187965 46.94 1..92660 ICE with experimental support prfC ICEApl2 the integration and excision module of ICE ICEApl2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl2 IEM the conjugation module of ICE ICEApl2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl2 CM the regulation module of ICE ICEApl2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl2 RM the accessory module of ICE ICEApl2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEApl2 AM Meng LIU (Mia), Oliver He 1017 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1017 99.4 kb KX243404 46.98 1..99355 ICE with experimental support ICEPmiCHN1586 the integration and excision module of ICE ICEPmiCHN1586. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1586 IEM the conjugation module of ICE ICEPmiCHN1586. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1586 CM the regulation module of ICE ICEPmiCHN1586. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1586 RM the accessory module of ICE ICEPmiCHN1586. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1586 AM Meng LIU (Mia), Oliver He 1020 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1020 97.1 kb KX243405 47.03 1..97078 ICE with experimental support ICEPmiCHN2407 the integration and excision module of ICE ICEPmiCHN2407. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN2407 IEM the conjugation module of ICE ICEPmiCHN2407. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN2407 CM the regulation module of ICE ICEPmiCHN2407. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN2407 RM the accessory module of ICE ICEPmiCHN2407. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN2407 AM Meng LIU (Mia), Oliver He 1028 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1028 90.6 kb Escherichia coli J53 KY437728 47.54 1..90566 ICE with experimental support ICEPmiChn4 the integration and excision module of ICE ICEPmiChn4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn4 IEM the conjugation module of ICE ICEPmiChn4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn4 CM the regulation module of ICE ICEPmiChn4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn4 RM the accessory module of ICE ICEPmiChn4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn4 AM Meng LIU (Mia), Oliver He 1019 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1019 104.4 kb Escherichia coli J53 KY437726 47.34 1..104371 ICE with experimental support ICEPmiChn2 the integration and excision module of ICE ICEPmiChn2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn2 IEM the conjugation module of ICE ICEPmiChn2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn2 CM the regulation module of ICE ICEPmiChn2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn2 RM the accessory module of ICE ICEPmiChn2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiChn2 AM Meng LIU (Mia), Oliver He 1018 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1018 76.2 kb KX243413 47.11 1..76218 ICE with experimental support ICEPmiCHN1809 the integration and excision module of ICE ICEPmiCHN1809. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1809 IEM the conjugation module of ICE ICEPmiCHN1809. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1809 CM the regulation module of ICE ICEPmiCHN1809. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1809 RM the accessory module of ICE ICEPmiCHN1809. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN1809 AM Meng LIU (Mia), Oliver He 1027 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1027 90 kb KX243416 47.77 1..89996 ICE with experimental support ICEPmiCHN3335 the integration and excision module of ICE ICEPmiCHN3335. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN3335 IEM the conjugation module of ICE ICEPmiCHN3335. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN3335 CM the regulation module of ICE ICEPmiCHN3335. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN3335 RM the accessory module of ICE ICEPmiCHN3335. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiCHN3335 AM a special class of ICEs, which have the ability to replicate autonomously like a plasmid, transfer as double stranded circular DNA molecules and do not require a genuine T4SS and are only found in Actinobacteria. Meng LIU (Mia), Oliver He AICE http://db-mml.sjtu.edu.cn/ICEberg/ actinomycete integrative and conjugative element Meng LIU (Mia), Oliver He protein of Klebsiella Meng LIU (Mia), Oliver He protein of Klebsiella pneumoniae NTUH-K2044 Meng LIU (Mia), Oliver He 827 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=827 55.3 kb Streptococcus pyogenes; Streptococcus pneumoniae KU056701 39.56 1..55259 ICE with experimental support ICESpy009 the integration and excision module of ICE ICESpy009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy009 IEM the conjugation module of ICE ICESpy009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy009 CM the regulation module of ICE ICESpy009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy009 RM the accessory module of ICE ICESpy009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy009 AM Meng LIU (Mia), Oliver He 406 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=406 98.1 kb AJ627388 47.78 1402..99513 ICE with experimental support tRNA-Phe YAPI the integration and excision module of ICE YAPI. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ YAPI IEM the conjugation module of ICE YAPI. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ YAPI CM the regulation module of ICE YAPI. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ YAPI RM the accessory module of ICE YAPI. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ YAPI AM Meng LIU (Mia), Oliver He 172 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=172 52.5 kb Mycoplasma agalactiae AY657002 39.15 1..52491 ICE with experimental support Tn1207.3 the integration and excision module of ICE Tn1207.3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1207.3 IEM the conjugation module of ICE Tn1207.3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1207.3 CM the regulation module of ICE Tn1207.3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1207.3 RM the accessory module of ICE Tn1207.3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1207.3 AM Meng LIU (Mia), Oliver He 409 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=409 45.5 kb FR691054 31.07 1694..47149 ICE with experimental support 3' end of the rum gene ICESp1108 the integration and excision module of ICE ICESp1108. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1108 IEM the conjugation module of ICE ICESp1108. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1108 CM the regulation module of ICE ICESp1108. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1108 RM the accessory module of ICE ICESp1108. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1108 AM Meng LIU (Mia), Oliver He 69 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=69 27.2 kb Mycoplasma agalactiae FP671138 27.37[29.62] 813253..840487 ICE with experimental support ICEA(5632)-I the integration and excision module of ICE ICEA(5632)-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-I IEM the conjugation module of ICE ICEA(5632)-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-I CM the regulation module of ICE ICEA(5632)-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-I RM the accessory module of ICE ICEA(5632)-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-I AM Meng LIU (Mia), Oliver He 225 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=225 27.2 kb FP671138 27.39[29.62] 343591..370761 ICE with experimental support ICEA(5632)-II the integration and excision module of ICE ICEA(5632)-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-II IEM the conjugation module of ICE ICEA(5632)-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-II CM the regulation module of ICE ICEA(5632)-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-II RM the accessory module of ICE ICEA(5632)-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-II AM Meng LIU (Mia), Oliver He 226 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=226 27.2 kb FP671138 27.37[29.62] 560640..587874 ICE with experimental support ICEA(5632)-III the integration and excision module of ICE ICEA(5632)-III. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-III IEM the conjugation module of ICE ICEA(5632)-III. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-III CM the regulation module of ICE ICEA(5632)-III. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-III RM the accessory module of ICE ICEA(5632)-III. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEA(5632)-III AM Meng LIU (Mia), Oliver He 72 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=72 23.8 kb AY168953 28.63 2674..26451 ICE with experimental support pdhA, orf251 ICEF-I the integration and excision module of ICE ICEF-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-I IEM the conjugation module of ICE ICEF-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-I CM the regulation module of ICE ICEF-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-I RM the accessory module of ICE ICEF-I. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-I AM Meng LIU (Mia), Oliver He 224 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=224 25.6 kb BA000017 35.39[32.88] 436064..461681 ICE with experimental support GMP-synthase gene (SAV0391) Tn5801 the integration and excision module of ICE Tn5801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5801 IEM the conjugation module of ICE Tn5801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5801 CM the regulation module of ICE Tn5801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5801 RM the accessory module of ICE Tn5801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5801 AM Meng LIU (Mia), Oliver He - Bacteroides uniformis WH207 Meng LIU (Mia), Oliver He 159 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=159 33.4 kb Hemolytic Streptococci NC_004368 38.11[35.63] 1163887..1197331 ICE with experimental support Intergenic regions upstream of &sigma;-A promoters TnGBS2 (genomic island X) the integration and excision module of ICE TnGBS2 (genomic island X). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS2 (genomic island X) IEM the conjugation module of ICE TnGBS2 (genomic island X). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS2 (genomic island X) CM the regulation module of ICE TnGBS2 (genomic island X). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS2 (genomic island X) RM the accessory module of ICE TnGBS2 (genomic island X). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnGBS2 (genomic island X) AM Meng LIU (Mia), Oliver He 242 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=242 71 kb AE017125 33.15[35.93] 223218..294244 ICE with experimental support HH0233/HH0302 HHGI1 the integration and excision module of ICE HHGI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ HHGI1 IEM the conjugation module of ICE HHGI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ HHGI1 CM the regulation module of ICE HHGI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ HHGI1 RM the accessory module of ICE HHGI1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ HHGI1 AM Meng LIU (Mia), Oliver He 152 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=152 77.1 kb Bacteroides fragilis CR626927 45.44[43.19] 1727162..1804281 ICE with experimental support CTn9343 the integration and excision module of ICE CTn9343. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn9343 IEM the conjugation module of ICE CTn9343. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn9343 CM the regulation module of ICE CTn9343. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn9343 RM the accessory module of ICE CTn9343. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn9343 AM Meng LIU (Mia), Oliver He 375 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=375 92.5 kb AM942759 44.85[38.9] 2793762..2886224 ICE with experimental support tRNA-Phe (PMIt057) ICEPm1 the integration and excision module of ICE ICEPm1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPm1 IEM the conjugation module of ICE ICEPm1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPm1 CM the regulation module of ICE ICEPm1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPm1 RM the accessory module of ICE ICEPm1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPm1 AM Meng LIU (Mia), Oliver He 394 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=394 51.4 kb CP001834 34.99[34.91] 2295682..2347036 ICE with experimental support TTATACCATAATTAC Tn6098 the integration and excision module of ICE Tn6098. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6098 IEM the conjugation module of ICE Tn6098. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6098 CM the regulation module of ICE Tn6098. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6098 RM the accessory module of ICE Tn6098. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6098 AM Meng LIU (Mia), Oliver He 396 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=396 42.7 kb CP001217 33.95[38.81] 451991..494695 ICE with experimental support type I R-M system R protein (HPP12_0436) ICEHpyP12-1 the integration and excision module of ICE ICEHpyP12-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHpyP12-1 IEM the conjugation module of ICE ICEHpyP12-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHpyP12-1 CM the regulation module of ICE ICEHpyP12-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHpyP12-1 RM the accessory module of ICE ICEHpyP12-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEHpyP12-1 AM Meng LIU (Mia), Oliver He 436 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=436 106 kb AJ870974 54.03 1298..107263 ICE with experimental support tRNA-Lys PPHGI-1 the integration and excision module of ICE PPHGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PPHGI-1 IEM the conjugation module of ICE PPHGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PPHGI-1 CM the regulation module of ICE PPHGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PPHGI-1 RM the accessory module of ICE PPHGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PPHGI-1 AM Meng LIU (Mia), Oliver He 64 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=64 100.9 kb Bacteroides spp.; Escherichia coli AY345595 47.49 1..100903 ICE with experimental support AATCTGNNAAAT CTnBST the integration and excision module of ICE CTnBST. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnBST IEM the conjugation module of ICE CTnBST. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnBST CM the regulation module of ICE CTnBST. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnBST RM the accessory module of ICE CTnBST. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnBST AM Meng LIU (Mia), Oliver He 66 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=66 114.3 kb Escherichia coli FN298496 54.95 11966..126312 ICE with experimental support tRNA-Phe CTnscr94 the integration and excision module of ICE CTnscr94. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnscr94 IEM the conjugation module of ICE CTnscr94. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnscr94 CM the regulation module of ICE CTnscr94. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnscr94 RM the accessory module of ICE CTnscr94. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnscr94 AM Meng LIU (Mia), Oliver He 67 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=67 33.3 kb Enterococcus faecium FN555436 34.69 1..33262 ICE with experimental support ribosomal L31 gene Tn6000 (EfcTn1) the integration and excision module of ICE Tn6000 (EfcTn1). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6000 (EfcTn1) IEM the conjugation module of ICE Tn6000 (EfcTn1). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6000 (EfcTn1) CM the regulation module of ICE Tn6000 (EfcTn1). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6000 (EfcTn1) RM the accessory module of ICE Tn6000 (EfcTn1). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6000 (EfcTn1) AM Meng LIU (Mia), Oliver He 71 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=71 93.9 kb Salmonella enterica serovar Typhimurium and Yersinia pseudotuberculosis GU725392 50.84 77..93971 ICE with experimental support tRNA-Phe ICEEc2 the integration and excision module of ICE ICEEc2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc2 IEM the conjugation module of ICE ICEEc2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc2 CM the regulation module of ICE ICEEc2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc2 RM the accessory module of ICE ICEEc2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEc2 AM Meng LIU (Mia), Oliver He 74 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=74 54.4 kb Enterobacteriaceae AM229678 53.06 292..54752 ICE with experimental support tRNA-Asn ICEEcIHE3034-1 the integration and excision module of ICE ICEEcIHE3034-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEcIHE3034-1 IEM the conjugation module of ICE ICEEcIHE3034-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEcIHE3034-1 CM the regulation module of ICE ICEEcIHE3034-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEcIHE3034-1 RM the accessory module of ICE ICEEcIHE3034-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEcIHE3034-1 AM Meng LIU (Mia), Oliver He 77 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=77 63.1 kb Streptococcus equi FM204883 30.6[41.28] 1206317..1269371 ICE with experimental support ICESe2 the integration and excision module of ICE ICESe2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESe2 IEM the conjugation module of ICE ICESe2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESe2 CM the regulation module of ICE ICESe2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESe2 RM the accessory module of ICE ICESe2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESe2 AM Meng LIU (Mia), Oliver He 92 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=92 33.8 kb Enterococcus faecalis; Enterococcus faecium; Clostridium symbiosum AF192329 52.83 1..33805 ICE with experimental support Tn1549 the integration and excision module of ICE Tn1549. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1549 IEM the conjugation module of ICE Tn1549. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1549 CM the regulation module of ICE Tn1549. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1549 RM the accessory module of ICE Tn1549. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1549 AM Meng LIU (Mia), Oliver He 102 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=102 29.2 kb DQ321786 39.98 67..29238 ICE with experimental support Tn5386 the integration and excision module of ICE Tn5386. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5386 IEM the conjugation module of ICE Tn5386. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5386 CM the regulation module of ICE Tn5386. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5386 RM the accessory module of ICE Tn5386. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5386 AM Meng LIU (Mia), Oliver He 438 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=438 240.8 kb NC_015563 66.26[66.72] 1833691..2074538 ICE with experimental support DelCs14_1618 phn Island the integration and excision module of ICE phn Island. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ phn Island IEM the conjugation module of ICE phn Island. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ phn Island CM the regulation module of ICE phn Island. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ phn Island RM the accessory module of ICE phn Island. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ phn Island AM Meng LIU (Mia), Oliver He 439 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=439 65.6 kb Streptococcus pyogenes 24RF FR691055 36.4 1659..67233 ICE with experimental support IMESp2907 IMESp2907 is predicted to be mobilized in cis by ICESp2905 (PMID: 26679245) Tet(O) element Tet(O) element is predicted to be mobilized in trans by ICESp2905 (PMID: 29165361) rum (23S rRNA m(5)U 1939 methyltransferase) ICESp2905 the integration and excision module of ICE ICESp2905. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2905 IEM the conjugation module of ICE ICESp2905. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2905 CM the regulation module of ICE ICESp2905. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2905 RM the accessory module of ICE ICESp2905. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2905 AM Meng LIU (Mia), Oliver He 440 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=440 82.2 kb Escherichia coli HK22511; Pasteurella multocida E348-08 (capsular type F); Mannheimia haemolytica 39229 CP003022 41.9 273284..355497 ICE with experimental support tRNA-Leu [DRs: GATTTTGAATCAA] ICEPmu1 the integration and excision module of ICE ICEPmu1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmu1 IEM the conjugation module of ICE ICEPmu1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmu1 CM the regulation module of ICE ICEPmu1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmu1 RM the accessory module of ICE ICEPmu1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmu1 AM Meng LIU (Mia), Oliver He 937 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=937 131.5 kb Bacteroides fragilis 638R KJ816753 46.08 1..131471 ICE with experimental support GAAAGTGAA or TTTGA CTnHyb the integration and excision module of ICE CTnHyb. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnHyb IEM the conjugation module of ICE CTnHyb. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnHyb CM the regulation module of ICE CTnHyb. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnHyb RM the accessory module of ICE CTnHyb. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnHyb AM Meng LIU (Mia), Oliver He 861 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=861 28 kb Clostridium difficile; Enterococcus faecalis HG475346 39.06 1..28014 ICE with experimental support 7 different instertion sites in Clostridium difficile ;tRNAArg(in Enterococcus faecalis) Tn6194-like the integration and excision module of ICE Tn6194-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194-like IEM the conjugation module of ICE Tn6194-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194-like CM the regulation module of ICE Tn6194-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194-like RM the accessory module of ICE Tn6194-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194-like AM Meng LIU (Mia), Oliver He 1079 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1079 64.4 kb Legionella pneumophila JR32 CP000675 39 2781725..2846914 ICE with experimental support tRNAMet LpcGI-2 the integration and excision module of ICE LpcGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpcGI-2 IEM the conjugation module of ICE LpcGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpcGI-2 CM the regulation module of ICE LpcGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpcGI-2 RM the accessory module of ICE LpcGI-2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpcGI-2 AM Meng LIU (Mia), Oliver He 1091 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1091 42.7 kb Legionella pneumophila JR32 Sm; Legionella micdadei (ATCC 33218) CP000675 39.44 614497..656813 ICE with experimental support tRNAPro (lpc2778) Trb-1 the integration and excision module of ICE Trb-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Trb-1 IEM the conjugation module of ICE Trb-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Trb-1 CM the regulation module of ICE Trb-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Trb-1 RM the accessory module of ICE Trb-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Trb-1 AM Type IV coupling protein (T4CP) is a hexameric ATPase that links translocating substrates to the transenvelope secretion conduit. Meng LIU (Mia), Oliver He T4CP https://www.nature.com/articles/nmicrobiol2017114 type IV coupling protein Meng LIU (Mia), Oliver He 1096 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1096 445.2 kb NC_014923 5680050..6125270 ICE with experimental support ICEMcSym(1271)-alpha the integration and excision module of ICE ICEMcSym(1271)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-alpha IEM the conjugation module of ICE ICEMcSym(1271)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-alpha CM the regulation module of ICE ICEMcSym(1271)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-alpha RM the accessory module of ICE ICEMcSym(1271)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-alpha AM Meng LIU (Mia), Oliver He 1101 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1101 23 kb NC_014923 2669947..2692919 ICE with experimental support ICEMcSym(1271)-beta the integration and excision module of ICE ICEMcSym(1271)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-beta IEM the conjugation module of ICE ICEMcSym(1271)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-beta CM the regulation module of ICE ICEMcSym(1271)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-beta RM the accessory module of ICE ICEMcSym(1271)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-beta AM The mating pair formation (Mpf) system functions as a secretion machinery for intercellular DNA transfer during bacterial conjugation. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pubmed/15907535 mating pair formation MPF(F) is one of four MPF familes that have been described in Proteobacteria based on plasmid F. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4027160/ MPF(F) MPF(T) is one of four MPF familes that have been described in Proteobacteria based on the T-DNA conjugation system of A. tumefaciens plasmid Ti. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4027160/ VirB-like mating pair systems (MPF(T)) are the most numerous among the four MPF classes encompassing the conjugation systems of Proteobacteria and closely related taxa. MPF(T) MPF(I) is one of four MPF familes that have been described in Proteobacteria based on the IncI plasmid R64. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4027160/ MPF(I) MPF(G) is one of four MPF familes that have been described in Proteobacteria based on ICEHIN1056. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4027160/ MPF(G) T4SS ATPase is the enzyme which energizes the T4SS system from the cytoplasm, driving the complex assembly and substrate translocation through the channel. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3070162/ VirB4 and TraU are the major ATPases founded in ICEs. T4SS ATPase Meng LIU (Mia), Oliver He 1106 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1106 7.8 kb NC_014923 2444639..2452398 ICE with experimental support ICEMcSym(1271)-gamma the integration and excision module of ICE ICEMcSym(1271)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-gamma IEM the conjugation module of ICE ICEMcSym(1271)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-gamma CM the regulation module of ICE ICEMcSym(1271)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-gamma RM the accessory module of ICE ICEMcSym(1271)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMcSym(1271)-gamma AM Meng LIU (Mia), Oliver He - Streptococcus thermophilus CNRZ368 T4SS are cell envelope-spanning complexes that form a channel through which DNA and proteins can travel from the cytoplasm of the donor cell to the cytoplasm of the recipient cell. T4SS is one of important secretion systems and usually consists of several components: mating-pair formation proteins (MPFs), which serve to establish physical contacts with a recipient bacterium; and, finally, a coupling protein (T4cp), which binds MOB and ssDNA to MPF . Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/SecReT4/ https://en.wikipedia.org/wiki/Secretion type IV secretion system T4SS in Gram negative bacteria Meng LIU (Mia), Oliver He Due to differences in cell membrane structure, Gram-positive and Gram-negative bacteria may have different T4SS organization and features. type IV secretion system in Gram negative bacteria T4SS in Gram positive bacteria Meng LIU (Mia), Oliver He Due to differences in cell membrane structure, Gram-positive and Gram-negative bacteria may have different T4SS organization and features. type IV secretion system in Gram positive bacteria The integration and excision module refers to those genes and sequence within the ICE responsible for the integration and excision of the element from the host chromosome, including genes encoding the integrase and or recombination directionality factor (also known as excisionase, which influences the direction of recombination mediated by the integrase to favor excision). Meng LIU (Mia), Oliver He recombination module component https://academic.oup.com/nar/article/47/D1/D660/5165266 ICE integration and excision module One family of recombinases based on amino acid sequence homology and mechanistic relatedness. Tyrosine is the conserved nucleophilic amino acid residue that tyrosine recombinases use to attack the DNA and which becomes covalently linked to it during strand exchange. Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Site-specific_recombination tyrosine recombinase is the most common integrase seen in T4SS-type ICEs tyrosine recombinase One family of recombinases based on amino acid sequence homology and mechanistic relatedness. Serine is the conserved nucleophilic amino acid residue that serine recombinases use to attack the DNA and which becomes covalently linked to it during strand exchange. Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Site-specific_recombination serine recombinase is the second most common integrase seen in T4SS-type ICEs serine recombinase A transposase enzyme with the DDE motif. Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2991504/ DDE transposase is the third most common integrase seen in T4SS-type ICEs DDE transposase The oriT region, which is usually tens to hundreds of base pairs in length, contains a conserved nick region (flanking the nic site) and variable numbers of inverted repeats (IRs) Meng LIU (Mia), Oliver He oriT origin of transfer http://bioinfo-mml.sjtu.edu.cn/oriTDB origin of transfer sequence A short DNA sequence that recombinases recognize, bind to and then cleave the DNA backbone, exchange the two DNA helices involved and rejoin the DNA strands. Meng LIU (Mia), Oliver He https://en.wikipedia.org/wiki/Site-specific_recombination recombination attachment site The integration reaction is catalyzed by the integrase and, as a result of the site-specific recombination, will lead to direct repeats (typically between 10 and 60 bp) forming on either end of the integrated element, that are now named attL (left end) and attR (right end). Meng LIU (Mia), Oliver He https://academic.oup.com/femsre/article/41/4/512/3089980 attL The integration reaction is catalyzed by the integrase and, as a result of the site-specific recombination, will lead to direct repeats (typically between 10 and 60 bp) forming on either end of the integrated element, that are nownamed attL (left end) and attR (right end). Meng LIU (Mia), Oliver He https://academic.oup.com/femsre/article/41/4/512/3089980 attR attB is the attachment site in the host chromosome during the recombination. Meng LIU (Mia), Oliver He https://academic.oup.com/femsre/article/41/4/512/3089980 attB Meng LIU (Mia), Oliver He attP attI (or attP) is the attachment site on the circular ICE during the recombination. attI After transfer, the circular ICE integrates into a replicon, mainly at the 3' end of a tRNA or protein-encoding gene, which is called insertion site Meng LIU (Mia), Oliver He https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2566197/ 3 end of a tRNA gene (tRNALeu, tRNAThr, or tRNALys), a gene encoding a ribosomal protein (rpsI, rplL, or rpmG-3), or the guaA gene are the common insertion site of ICE. insertion site Meng LIU (Mia), Oliver He 1098 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1098 528.5 kb CP016079 6351798..6880279 ICE with experimental support ICEMlSym(NZP2037)-alpha the integration and excision module of ICE ICEMlSym(NZP2037)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-alpha IEM the conjugation module of ICE ICEMlSym(NZP2037)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-alpha CM the regulation module of ICE ICEMlSym(NZP2037)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-alpha RM the accessory module of ICE ICEMlSym(NZP2037)-alpha. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-alpha AM Meng LIU (Mia), Oliver He 1103 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1103 27.6 kb CP016079 3031358..3058942 ICE with experimental support ICEMlSym(NZP2037)-beta the integration and excision module of ICE ICEMlSym(NZP2037)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-beta IEM the conjugation module of ICE ICEMlSym(NZP2037)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-beta CM the regulation module of ICE ICEMlSym(NZP2037)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-beta RM the accessory module of ICE ICEMlSym(NZP2037)-beta. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-beta AM Meng LIU (Mia), Oliver He 1108 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1108 6.2 kb CP016079 2577929..2584131 ICE with experimental support ICEMlSym(NZP2037)-gamma the integration and excision module of ICE ICEMlSym(NZP2037)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-gamma IEM the conjugation module of ICE ICEMlSym(NZP2037)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-gamma CM the regulation module of ICE ICEMlSym(NZP2037)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-gamma RM the accessory module of ICE ICEMlSym(NZP2037)-gamma. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(NZP2037)-gamma AM Meng LIU (Mia), Oliver He 811 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=811 94.2 kb HE963029 43.96 1..94189 ICE with experimental support tRNA (uracil-5)-methyltransferase rumA; CACGTGGAGTGCGTAGTGTT(attL); TTCTCAAGGACCAGACAACA(attR) ICESluvan the integration and excision module of ICE ICESluvan. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESluvan IEM the conjugation module of ICE ICESluvan. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESluvan CM the regulation module of ICE ICESluvan. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESluvan RM the accessory module of ICE ICESluvan. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESluvan AM Meng LIU (Mia), Oliver He 812 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=812 49.2 kb Streptococcus pyogenes HE802677 35.24 1..49160 ICE with experimental support rpmH ICESp1116 the integration and excision module of ICE ICESp1116. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1116 IEM the conjugation module of ICE ICESp1116. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1116 CM the regulation module of ICE ICESp1116. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1116 RM the accessory module of ICE ICESp1116. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp1116 AM Meng LIU (Mia), Oliver He 743 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=743 29.7 kb Streptococcus salivarius; Streptococcus thermophilus; Enterococcus faecalis LT622827 35.33 1..29716 ICE with experimental support fda ICE_SsaF1-4_fda the integration and excision module of ICE ICE_SsaF1-4_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF1-4_fda IEM the conjugation module of ICE ICE_SsaF1-4_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF1-4_fda CM the regulation module of ICE ICE_SsaF1-4_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF1-4_fda RM the accessory module of ICE ICE_SsaF1-4_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF1-4_fda AM Meng LIU (Mia), Oliver He 745 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=745 30.2 kb Streptococcus salivarius; Streptococcus thermophilus; Enterococcus faecalis LT622829 35.61 1..30222 ICE with experimental support fda ICE_SsaF4-2_fda the integration and excision module of ICE ICE_SsaF4-2_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF4-2_fda IEM the conjugation module of ICE ICE_SsaF4-2_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF4-2_fda CM the regulation module of ICE ICE_SsaF4-2_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF4-2_fda RM the accessory module of ICE ICE_SsaF4-2_fda. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SsaF4-2_fda AM Meng LIU (Mia), Oliver He 829 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=829 88.9 kb Streptococcus suis P1/7RF; Streptococcus suis SS-1RF KX077888 36.81 875..89748 ICE with experimental support rplL ICESsu05SC260 the integration and excision module of ICE ICESsu05SC260. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05SC260 IEM the conjugation module of ICE ICESsu05SC260. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05SC260 CM the regulation module of ICE ICESsu05SC260. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05SC260 RM the accessory module of ICE ICESsu05SC260. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsu05SC260 AM Meng LIU (Mia), Oliver He 837 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=837 29.7 kb KU215704 34.14 1..29661 ICE with experimental support ICESsuNC28 the integration and excision module of ICE ICESsuNC28. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuNC28 IEM the conjugation module of ICE ICESsuNC28. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuNC28 CM the regulation module of ICE ICESsuNC28. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuNC28 RM the accessory module of ICE ICESsuNC28. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuNC28 AM Meng LIU (Mia), Oliver He - Streptococcus thermophilus CNRZ385 Meng LIU (Mia), Oliver He - Haemophilus influenzae 1056 Meng LIU (Mia), Oliver He - Ralstonia oxalatica A5 Meng LIU (Mia), Oliver He - Streptococcus parauberis NUF1049 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae 05P294 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae DP1322 Recombination directionality factors (RDFs) are a diverse group of proteins involved in controlling the directionality of integrase-mediated site-specific recombination reactions. Meng LIU (Mia), Oliver He RDF Xis https://www.ncbi.nlm.nih.gov/pmc/articles/PMC55702/ Typically, RDFs are small DNA-binding proteins acting as accessory factors to influence the choice of substrates that are recombined by their cognate recombinase recombination directionality factor Meng LIU (Mia), Oliver He - Streptococcus pneumoniae Ar4 Meng LIU (Mia), Oliver He - Streptococcus oralis F.MI.5 The regulation module refers to those genes and sequence contributing to stabilization and maintenance of ICEs. Meng LIU (Mia), Oliver He https://academic.oup.com/nar/article/47/D1/D660/5165266 ICE regulation module toxin–antitoxin system is small genetic element composed of a stable toxin protein and a labile cognate antitoxin encoded by a bicistronic locus. TA system is involved in regulation of bacterial metabolic activity and plays important role in plasmid maintenance and ICE post-segregational killing systems. Meng LIU (Mia), Oliver He http://bioinfo-mml.sjtu.edu.cn/TADB2/ https://academic.oup.com/femspd/article/70/3/240/567411 Toxin-antitoxin (TA) loci play a role in bacterial stress physiology and the stabilisation of horizontally acquired elements. TA loci are found abundantly distributed among free-living Bacteria and Archaea. toxin–antitoxin system true Restriction-modification system is a defense system developed by bacteria to defend themselves from invasions of phage (or viruses ). Restriction-modification system composed of a restriction endonuclease enzyme and a methylase enzyme and each bacterial species and strain has their own combination of restriction and methylating enzymes. Meng LIU (Mia), Oliver He https://www.ndsu.edu/pubweb/~mcclean/plsc731/dna/dna5.htm DNA restriction-modification system true Meng LIU (Mia), Oliver He Listeria monocytogenes TTH-2007 - Listeria monocytogenes strain TTH-2007 Meng LIU (Mia), Oliver He - Staphylococcus rostri RST11 Meng LIU (Mia), Oliver He - Photobacterium damselae subsp. piscicida PC554.2 Meng LIU (Mia), Oliver He - Proteus mirabilis 08MAS1586 Meng LIU (Mia), Oliver He - Proteus mirabilis TJ1809 A role played by a material entity where the circular ICE integrates into a replicon after transfer. Meng LIU (Mia), Oliver He insertion site role Meng LIU (Mia), Oliver He - Proteus mirabilis JN7 Meng LIU (Mia), Oliver He - Proteus mirabilis 09MAS2407 Meng LIU (Mia), Oliver He 1035 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1035 94.3 kb KX243403 46.77 1..94340 ICE with experimental support ICEPvuCHN2213 the integration and excision module of ICE ICEPvuCHN2213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPvuCHN2213 IEM the conjugation module of ICE ICEPvuCHN2213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPvuCHN2213 CM the regulation module of ICE ICEPvuCHN2213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPvuCHN2213 RM the accessory module of ICE ICEPvuCHN2213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPvuCHN2213 AM Meng LIU (Mia), Oliver He 1068 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1068 97.4 kb KC886257 46.79 528..97877 ICE with experimental support ICEVchNep1 the integration and excision module of ICE ICEVchNep1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNep1 IEM the conjugation module of ICE ICEVchNep1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNep1 CM the regulation module of ICE ICEVchNep1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNep1 RM the accessory module of ICE ICEVchNep1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNep1 AM Meng LIU (Mia), Oliver He 1069 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1069 97 kb KC886258 46.79 528..97570 ICE with experimental support ICEVchNig1 the integration and excision module of ICE ICEVchNig1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNig1 IEM the conjugation module of ICE ICEVchNig1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNig1 CM the regulation module of ICE ICEVchNig1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNig1 RM the accessory module of ICE ICEVchNig1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchNig1 AM Meng LIU (Mia), Oliver He 103 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=103 20.7 kb Bacillus subtilis; Clostridium difficile AM180355 38.32[29.06] 585384..606040 ICE with experimental support Tn5398 Tn5398 is predicted to be mobilized in cis by Tn5397. AT rich regions Tn5397 the integration and excision module of ICE Tn5397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5397 IEM the conjugation module of ICE Tn5397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5397 CM the regulation module of ICE Tn5397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5397 RM the accessory module of ICE Tn5397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5397 AM the integration and excision module of ICE Tn916(pAM120). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(pAM120) IEM the conjugation module of ICE Tn916(pAM120). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(pAM120) CM the regulation module of ICE Tn916(pAM120). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(pAM120) RM the accessory module of ICE Tn916(pAM120). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(pAM120) AM Meng LIU (Mia), Oliver He 306 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=306 18 kb AY855841 38.73[36.1] 40068..58099 ICE with experimental support AT rich regions this ICE was found in Enterococcus faecalis plasmid pCF10 Tn925 the integration and excision module of ICE Tn925. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn925 IEM the conjugation module of ICE Tn925. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn925 CM the regulation module of ICE Tn925. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn925 RM the accessory module of ICE Tn925. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn925 AM Meng LIU (Mia), Oliver He 307 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=307 18 kb FN550102 38.7 1..18032 ICE with experimental support AT rich regions Tn916(RST11) the integration and excision module of ICE Tn916(RST11). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(RST11) IEM the conjugation module of ICE Tn916(RST11). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(RST11) CM the regulation module of ICE Tn916(RST11). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(RST11) RM the accessory module of ICE Tn916(RST11). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916(RST11) AM Meng LIU (Mia), Oliver He 308 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=308 18 kb AB468159 38.71 3016..21046 ICE with experimental support AT rich regions ICESpaNUF1049 the integration and excision module of ICE ICESpaNUF1049. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpaNUF1049 IEM the conjugation module of ICE ICESpaNUF1049. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpaNUF1049 CM the regulation module of ICE ICESpaNUF1049. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpaNUF1049 RM the accessory module of ICE ICESpaNUF1049. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpaNUF1049 AM Meng LIU (Mia), Oliver He 318 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=318 20.8 kb 38.46 ICE with experimental support AT rich regions Tn6085b the integration and excision module of ICE Tn6085b. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085b IEM the conjugation module of ICE Tn6085b. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085b CM the regulation module of ICE Tn6085b. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085b RM the accessory module of ICE Tn6085b. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085b AM Meng LIU (Mia), Oliver He 319 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=319 20.8 kb HM243621 38.46 6653..27441 ICE with experimental support AT rich regions Tn6085a the integration and excision module of ICE Tn6085a. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085a IEM the conjugation module of ICE Tn6085a. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085a CM the regulation module of ICE Tn6085a. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085a RM the accessory module of ICE Tn6085a. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6085a AM Meng LIU (Mia), Oliver He 328 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=328 22.3 kb HM243622 38.42 34197..56508 ICE with experimental support AT rich regions Tn6084 the integration and excision module of ICE Tn6084. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6084 IEM the conjugation module of ICE Tn6084. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6084 CM the regulation module of ICE Tn6084. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6084 RM the accessory module of ICE Tn6084. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6084 AM Meng LIU (Mia), Oliver He 321 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=321 25.1 kb AM410044 37.98 1..25101 ICE with experimental support AT rich regions Tn6003 the integration and excision module of ICE Tn6003. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6003 IEM the conjugation module of ICE Tn6003. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6003 CM the regulation module of ICE Tn6003. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6003 RM the accessory module of ICE Tn6003. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6003 AM Meng LIU (Mia), Oliver He 325 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=325 26.4 kb AB426620 37.89 1..26390 ICE with experimental support AT rich regions Tn2010 the integration and excision module of ICE Tn2010. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn2010 IEM the conjugation module of ICE Tn2010. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn2010 CM the regulation module of ICE Tn2010. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn2010 RM the accessory module of ICE Tn2010. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn2010 AM a role played by a material entity that often involves in the conjugal process. Meng LIU (Mia), Oliver He conjugation module component role a role played by a protein which links translocating substrates to the transenvelope secretion conduit. Meng LIU (Mia), Oliver He T4CP role type IV coupling protein role Meng LIU (Mia), Oliver He - Proteus mirabilis TJ3335 Meng LIU (Mia), Oliver He - Proteus mirabilis JN14 a role played by a protein that energizes the T4SS system from the cytoplasm and drives the complex assembly and substrate translocation through the channel. Meng LIU (Mia), Oliver He T4SS ATPase role Meng LIU (Mia), Oliver He - Amycolatopsis mediterranei LBG A3136 Meng LIU (Mia), Oliver He - Proteus vulgaris 08MAS2213 A role played by a gene that encodes a protein which is part of T4SS (a cell envelope-spanning complexes that form a channel through which DNA and proteins can travel from the cytoplasm of the donor cell to the cytoplasm of the recipient cell. ) Meng LIU (Mia), Oliver He T4SS gene component role type IV secretion system gene component role Meng LIU (Mia), Oliver He - Shewanella putrefaciens W3-18-1 Meng LIU (Mia), Oliver He - Bacteroides fragilis 86-5443-2-2 Meng LIU (Mia), Oliver He Clostridium difficile CII7 - Clostridium difficile strain CII7 A role played by a protein that mediates an exchange reaction between two DNA templates and results in integration of DNA from one of the templates into the other. Meng LIU (Mia), Oliver He integrase role A role played by a material entity that contains a conserved nick region (flanking the nic site) and variable numbers of inverted repeats (IRs) and served as origin site of transfer. Meng LIU (Mia), Oliver He oriT role origin of transfer role A role played by a short DNA sequence that recombinases recognize, bind to and then cleave the DNA backbone, exchange the two DNA helices involved and rejoin the DNA strands. Meng LIU (Mia), Oliver He recombination attachment site role Meng LIU (Mia), Oliver He protein of Escherichia coli ECOR31 Meng LIU (Mia), Oliver He - Enterococcus casseliflavus 664.1H1 Meng LIU (Mia), Oliver He - Enterococcus faecalis BM4382 Meng LIU (Mia), Oliver He - Enterococcus faecium D344R Meng LIU (Mia), Oliver He - Escherichia coli BEN374 Meng LIU (Mia), Oliver He - Salmonella bongori CEIM46082 Meng LIU (Mia), Oliver He Salmonella enterica subsp. enterica serovar Senftenberg, strain 5494-57 - Salmonella enterica subsp. enterica serovar Senftenberg, 5494-57 Meng LIU (Mia), Oliver He - Staphylococcus aureus JCSC6826 Meng LIU (Mia), Oliver He - Staphylococcus aureus HDG2 Meng LIU (Mia), Oliver He - Streptococcus agalactiae Sag37 Meng LIU (Mia), Oliver He - Streptococcus dysgalactiae subsp. equisimilis NS3396 Meng LIU (Mia), Oliver He - Streptococcus lutetiensis 5-F9 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae Pn19 Meng LIU (Mia), Oliver He - Streptococcus pyogenes C1 Meng LIU (Mia), Oliver He - Streptococcus pyogenes iB21 Meng LIU (Mia), Oliver He - Streptococcus pyogenes MB56Spyo009 A role played by a protein that controlls the directionality of integrase-mediated site-specific recombination reactions. Meng LIU (Mia), Oliver He RDF role recombination directionality factor role a role played by a material entity that involves in stabilization and maintenance of ICEs. Meng LIU (Mia), Oliver He regulation module component role a role played by a material entity that often exists inside ICEs as the cargo genes and can confer the hosts with selective advantages. Meng LIU (Mia), Oliver He accessory module component role a role played by a material entity that can confer the the ability of bacteria and other microorganisms to resist the effects of an antibiotic to which they were once sensitive. Meng LIU (Mia), Oliver He antibiotic resistance gene role A role played by a gene that encodes products which assist the bacterium colonize the host at the cellular level and are either secretory, membrane associated or cytosolic in nature. Meng LIU (Mia), Oliver He VF gene role virulence factor gene role Meng LIU (Mia), Oliver He - Streptococcus pyogenes strain A-3 Streptococcus pyogenes 2812A Meng LIU (Mia), Oliver He - Streptococcus salivarius strain F1-4 Meng LIU (Mia), Oliver He - Streptococcus salivarius strain F4-2 gene of Escherichia coli ECOR31 protein-coding gene of Escherichia coli ECOR31 RNA gene of Escherichia coli ECOR31 A role played by a protein that nicks the dsDNA and remains covalently bound to the resulting ssDNA Meng LIU (Mia), Oliver He relaxase role a ICE of Gammaproteobacteria Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE in Gammaproteobacteria Meng LIU (Mia), Oliver He 326 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=326 21.2 kb HQ663849 38.23 1..21169 ICE with experimental support AT rich regions Tn6087 the integration and excision module of ICE Tn6087. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6087 IEM the conjugation module of ICE Tn6087. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6087 CM the regulation module of ICE Tn6087. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6087 RM the accessory module of ICE Tn6087. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6087 AM Meng LIU (Mia), Oliver He 47 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=47 18 kb Streptococcus pneumoniae; Streptococcus gordonii; Streptococcus pyogenes; Streptococcus agalactiae;Enterococcus faecalis; Bacillus subtilis FJ711160 38.85 1..18033 ICE with experimental support AT rich regions Tn5251 (part of Tn5253) the integration and excision module of ICE Tn5251 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5251 (part of Tn5253) IEM the conjugation module of ICE Tn5251 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5251 (part of Tn5253) CM the regulation module of ICE Tn5251 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5251 (part of Tn5253) RM the accessory module of ICE Tn5251 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5251 (part of Tn5253) AM Meng LIU (Mia), Oliver He 45 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=45 18 kb Enterococcus faecalis; Butyrivibrio proteoclasticus; Streptococcus spp.; Lactococcus lactis; Lactobacillus paracasei; Neisseria sp.; Escherichia coli; Desulfitobacterium dehalogenans; Bacillus subtilis; Bacillus thuringiensis subsp. Israelensis U09422 38.75 1..18032 ICE with experimental support IME_GB00957_oriT IME_GB00957_oriT is predicted to be mobilized in trans by Tn916 (PMID: 25832353; 26410170) MTnSag1 [tISSag10] MTnSag1 [tISSag10] can be mobilized in trans by Tn916 from Streptococcus agalactiae UCN36 to Streptococcus agalactiae BM134/Streptococcus agalactiae BM132. (PMID: 17416666) tISCpe8 tISCpe8 can be mobilized in trans by Tn916 from Clostridium perfringens JIR4225 to Clostridium perfringens JIR4394. (PMID: 19684139) AT rich regions Tn916 the integration and excision module of ICE Tn916. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916 IEM the conjugation module of ICE Tn916. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916 CM the regulation module of ICE Tn916. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916 RM the accessory module of ICE Tn916. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916 AM Meng LIU (Mia), Oliver He 62 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=62 20.9 kb Streptococcus cristatus; Streptococcus sanguinis AY898750 38.23 1..20880 ICE with experimental support CTn6002 the integration and excision module of ICE CTn6002. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn6002 IEM the conjugation module of ICE CTn6002. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn6002 CM the regulation module of ICE CTn6002. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn6002 RM the accessory module of ICE CTn6002. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn6002 AM Meng LIU (Mia), Oliver He 862 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=862 21.3 kb JX120102 37.93 1..21322 ICE with experimental support Tn6198 the integration and excision module of ICE Tn6198. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6198 IEM the conjugation module of ICE Tn6198. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6198 CM the regulation module of ICE Tn6198. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6198 RM the accessory module of ICE Tn6198. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6198 AM Meng LIU (Mia), Oliver He - Streptococcus suis 32457 Meng LIU (Mia), Oliver He - Streptococcus suis 05SC260 Meng LIU (Mia), Oliver He - Streptococcus suis strain nc286A7 Meng LIU (Mia), Oliver He - Yersinia pseudotuberculosis 32777 Meng LIU (Mia), Oliver He T4ASS type T4SS gene Meng LIU (Mia), Oliver He type F T4SS gene Meng LIU (Mia), Oliver He type I T4SS gene Meng LIU (Mia), Oliver He type P T4SS gene Meng LIU (Mia), Oliver He T4BSS type T4SS gene Meng LIU (Mia), Oliver He BAH64175.1(Int) BAH64176.1(YbtS) BAH64177.1(YbtX) BAH64178.1(YbtQ) BAH64179.1(YbtP) BAH64180.1(YbtA) BAH64181.1(Irp2) BAH64182.1(Irp1) BAH64183.1(YbtU) BAH64184.1(YbtT) yersiniabactin siderophore biosynthetic protein BAH64185.1(YbtE) BAH64186.1(FyuA) BAH64187.1 BAH64188.1(AlpA2) BAH64189.1 BAH64190.1 BAH64191.1 BAH64192.1 BAH64193.1 BAH64194.1 BAH64195.1 BAH64196.1(VagC) BAH64197.1(VagD) BAH64198.1 BAH64199.1(IroN) BAH64200.1(IroB) BAH64201.1(IroC) BAH64202.1(IroD) BAH64203.1(PagO) BAH64204.1 BAH64205.1 BAH64206.1(RmpA) BAH64207.1 BAH64208.1 BAH64209.1 BAH64210.1 BAH64211.1 BAH64212.1(VirB1) BAH64213.1(VirB2) BAH64214.1(VirB3-4) BAH64215.1(VirB5) BAH64216.1 BAH64217.1(VirB6) BAH64218.1(VirB8) BAH64219.1(VirB9) BAH64220.1(VirB10) BAH64221.1(VirB11) BAH64222.1 BAH64223.1 BAH64224.1 BAH64225.1 BAH64226.1(MobB) BAH64227.1(MobC) BAH64228.1(ArdC) BAH64229.1 BAH64230.1 BAH64231.1 BAH64232.1 BAH64233.1 BAH64234.1 BAH64235.1 BAH64236.1 Meng LIU (Mia), Oliver He - Bacteroides fragilis LV23 Meng LIU (Mia), Oliver He - Bacteroides thetaiotaomicron 7853 Meng LIU (Mia), Oliver He - Butyrivibrio fibrisolvens 1.230 Meng LIU (Mia), Oliver He - Clostridium perfringens CW459 Meng LIU (Mia), Oliver He - Elizabethkingia anophelis CSID_3015183678 Meng LIU (Mia), Oliver He - Enterococcus faecalis JH2-7 Meng LIU (Mia), Oliver He - Enterococcus faecium 9830414-1 Meng LIU (Mia), Oliver He - Klebsiella pneumoniae 41 Meng LIU (Mia), Oliver He - Lactococcus lactis 11454 Meng LIU (Mia), Oliver He - Lactococcus lactis FI5876 Meng LIU (Mia), Oliver He - Lactococcus lactis R5 Meng LIU (Mia), Oliver He - Lactococcus lactis subsp. lactis ML3 Meng LIU (Mia), Oliver He - Micromonospora rosaria SCC2095 Meng LIU (Mia), Oliver He - Pectobacterium carotovorum subsp. brasiliensis ICMP Meng LIU (Mia), Oliver He - Proteus mirabilis TUM4660 Meng LIU (Mia), Oliver He - Pseudomonas putida KF715 Meng LIU (Mia), Oliver He - Saccharopolyspora endophytica YIM 61095 Meng LIU (Mia), Oliver He - Staphylococcus aureus 1591 Meng LIU (Mia), Oliver He - Staphylococcus aureus 21995 Meng LIU (Mia), Oliver He - Staphylococcus aureus 22034 Meng LIU (Mia), Oliver He - Staphylococcus aureus 34801 Meng LIU (Mia), Oliver He - Staphylococcus aureus 35366 Meng LIU (Mia), Oliver He - Staphylococcus aureus 35414 Meng LIU (Mia), Oliver He - Staphylococcus aureus 35679 Meng LIU (Mia), Oliver He - Staphylococcus aureus 4520 Meng LIU (Mia), Oliver He - Staphylococcus aureus 4865 Meng LIU (Mia), Oliver He - Staphylococcus aureus 5331 Meng LIU (Mia), Oliver He - Staphylococcus aureus 5377 Meng LIU (Mia), Oliver He - Staphylococcus aureus 617 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7215190-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7215311-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7312330-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7412791-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7413093-4 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7413714-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7512166-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7512986-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7611280-5 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7612628-4 Meng LIU (Mia), Oliver He - Staphylococcus aureus 7711730-1 Meng LIU (Mia), Oliver He - Staphylococcus aureus 8797 Meng LIU (Mia), Oliver He - Staphylococcus aureus 9877324-3_H39 Meng LIU (Mia), Oliver He - Staphylococcus aureus SW356 Meng LIU (Mia), Oliver He - Staphylococcus aureus USA42 Meng LIU (Mia), Oliver He - Streptococcus agalactiae Sag236 Meng LIU (Mia), Oliver He - Streptococcus agalactiae SagTR7 Meng LIU (Mia), Oliver He - Streptococcus dysgalactiae subsp. equisimilis (Sde5580) Meng LIU (Mia), Oliver He - Streptococcus intermedius 15.3T.2 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae BM4200 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae BM6001 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae J93/183 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae J93/292 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae KD6 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae N24 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae PN02/2531 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae SP1000 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae SpnA213 Meng LIU (Mia), Oliver He - Streptococcus pneumoniae SpnF21 Meng LIU (Mia), Oliver He - Streptococcus pyogenes 12SN-Tc Meng LIU (Mia), Oliver He - Streptococcus pyogenes C-105 Meng LIU (Mia), Oliver He - Streptococcus pyogenes Spy005 Meng LIU (Mia), Oliver He - Streptococcus sanguinis FC1 Meng LIU (Mia), Oliver He - Streptococcus suis HB1011 Meng LIU (Mia), Oliver He - Streptomyces ambofaciens ATCC 15154 B3 Meng LIU (Mia), Oliver He - Streptomyces cyaneus ATCC 14921 Meng LIU (Mia), Oliver He - Streptomyces glaucescens GLA000 Meng LIU (Mia), Oliver He - Vibrio alginolyticus V86 Meng LIU (Mia), Oliver He - Vibrio cholerae 00LA1 Meng LIU (Mia), Oliver He - Vibrio cholerae 15AMOZ Meng LIU (Mia), Oliver He - Vibrio cholerae 16AMOZ Meng LIU (Mia), Oliver He - Vibrio cholerae 204 Meng LIU (Mia), Oliver He - Vibrio cholerae 3AMOZ Meng LIU (Mia), Oliver He - Vibrio cholerae 5556 Meng LIU (Mia), Oliver He - Vibrio cholerae 5594 Meng LIU (Mia), Oliver He - Vibrio cholerae 7698 Meng LIU (Mia), Oliver He - Vibrio cholerae 8AMOZ Meng LIU (Mia), Oliver He - Vibrio cholerae Chn108 Meng LIU (Mia), Oliver He - Vibrio cholerae HKO139-SXT Meng LIU (Mia), Oliver He - Vibrio cholerae MCV09 Meng LIU (Mia), Oliver He - Vibrio cholerae Non-O1 698 Meng LIU (Mia), Oliver He - Vibrio cholerae Non-O1 7AMOZ Meng LIU (Mia), Oliver He - Vibrio cholerae O1 175 Meng LIU (Mia), Oliver He - Vibrio cholerae O1 582 Meng LIU (Mia), Oliver He - Vibrio cholerae O1 90 Meng LIU (Mia), Oliver He - Vibrio cholerae O1 AC1923 Meng LIU (Mia), Oliver He - Vibrio cholerae O1 AC1924 Meng LIU (Mia), Oliver He - Vibrio cholerae O1 BI142 Meng LIU (Mia), Oliver He - Vibrio cholerae O1 biovar El Tor 1999 Meng LIU (Mia), Oliver He - Vibrio cholerae V21 Meng LIU (Mia), Oliver He - Vibrio fluvialis H-08942 Meng LIU (Mia), Oliver He - Vibrio parahaemolyticus Chn25 Meng LIU (Mia), Oliver He - Vibrio scophthalmi ACC7 Meng LIU (Mia), Oliver He - Vibrio scophthalmi NC1 Meng LIU (Mia), Oliver He - Vibrio scophthalmi YF7 Meng LIU (Mia), Oliver He - Vibrio splendidus V69 Meng LIU (Mia), Oliver He 458 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=458 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEEniSpa1 the integration and excision module of ICE ICEEniSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa1 IEM the conjugation module of ICE ICEEniSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa1 CM the regulation module of ICE ICEEniSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa1 RM the accessory module of ICE ICEEniSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa1 AM Meng LIU (Mia), Oliver He 459 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=459 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEEniSpa2 the integration and excision module of ICE ICEEniSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa2 IEM the conjugation module of ICE ICEEniSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa2 CM the regulation module of ICE ICEEniSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa2 RM the accessory module of ICE ICEEniSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEniSpa2 AM Meng LIU (Mia), Oliver He 41 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=41 Escherichia coli; Klebsiella pneumoniae; Salmonella enterica serovar Typhimurium; Citrobacter koseri ICE with experimental support prfC ICEPmiJpn1 the integration and excision module of ICE ICEPmiJpn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiJpn1 IEM the conjugation module of ICE ICEPmiJpn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiJpn1 CM the regulation module of ICE ICEPmiJpn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiJpn1 RM the accessory module of ICE ICEPmiJpn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPmiJpn1 AM Meng LIU (Mia), Oliver He 109 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=109 ~85 kb ICE with experimental support prfC R997 the integration and excision module of ICE R997. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R997 IEM the conjugation module of ICE R997. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R997 CM the regulation module of ICE R997. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R997 RM the accessory module of ICE R997. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R997 AM Meng LIU (Mia), Oliver He 144 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=144 Proteus hauseri ICE with experimental support prfC R705 the integration and excision module of ICE R705. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R705 IEM the conjugation module of ICE R705. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R705 CM the regulation module of ICE R705. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R705 RM the accessory module of ICE R705. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R705 AM Meng LIU (Mia), Oliver He 145 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=145 Proteus hauseri ICE with experimental support prfC R706 the integration and excision module of ICE R706. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R706 IEM the conjugation module of ICE R706. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R706 CM the regulation module of ICE R706. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R706 RM the accessory module of ICE R706. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R706 AM Meng LIU (Mia), Oliver He 142 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=142 ICE with experimental support prfC R392 the integration and excision module of ICE R392. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R392 IEM the conjugation module of ICE R392. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R392 CM the regulation module of ICE R392. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R392 RM the accessory module of ICE R392. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R392 AM Meng LIU (Mia), Oliver He 143 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=143 ICE with experimental support prfC R397 the integration and excision module of ICE R397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R397 IEM the conjugation module of ICE R397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R397 CM the regulation module of ICE R397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R397 RM the accessory module of ICE R397. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R397 AM Meng LIU (Mia), Oliver He 146 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=146 ICE with experimental support prfC R748 the integration and excision module of ICE R748. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R748 IEM the conjugation module of ICE R748. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R748 CM the regulation module of ICE R748. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R748 RM the accessory module of ICE R748. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R748 AM Meng LIU (Mia), Oliver He 147 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=147 ICE with experimental support prfC R749 the integration and excision module of ICE R749. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R749 IEM the conjugation module of ICE R749. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R749 CM the regulation module of ICE R749. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R749 RM the accessory module of ICE R749. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ R749 AM Meng LIU (Mia), Oliver He 1034 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1034 ICE with experimental support ICEPspSpa1 the integration and excision module of ICE ICEPspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPspSpa1 IEM the conjugation module of ICE ICEPspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPspSpa1 CM the regulation module of ICE ICEPspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPspSpa1 RM the accessory module of ICE ICEPspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEPspSpa1 AM Meng LIU (Mia), Oliver He 461 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=461 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEShaPor1 the integration and excision module of ICE ICEShaPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEShaPor1 IEM the conjugation module of ICE ICEShaPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEShaPor1 CM the regulation module of ICE ICEShaPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEShaPor1 RM the accessory module of ICE ICEShaPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEShaPor1 AM Meng LIU (Mia), Oliver He 42 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=42 ICE with experimental support prfC pMERPH the integration and excision module of ICE pMERPH. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMERPH IEM the conjugation module of ICE pMERPH. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMERPH CM the regulation module of ICE pMERPH. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMERPH RM the accessory module of ICE pMERPH. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMERPH AM Meng LIU (Mia), Oliver He 1036 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1036 110.3 kb [46.3] ICE with experimental support ICESh95 the integration and excision module of ICE ICESh95. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESh95 IEM the conjugation module of ICE ICESh95. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESh95 CM the regulation module of ICE ICESh95. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESh95 RM the accessory module of ICE ICESh95. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESh95 AM Meng LIU (Mia), Oliver He 460 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=460 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEValPor1 the integration and excision module of ICE ICEValPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValPor1 IEM the conjugation module of ICE ICEValPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValPor1 CM the regulation module of ICE ICEValPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValPor1 RM the accessory module of ICE ICEValPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValPor1 AM Meng LIU (Mia), Oliver He 447 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=447 ICE with experimental support prfC ICEValSpa1 the integration and excision module of ICE ICEValSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValSpa1 IEM the conjugation module of ICE ICEValSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValSpa1 CM the regulation module of ICE ICEValSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValSpa1 RM the accessory module of ICE ICEValSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEValSpa1 AM Meng LIU (Mia), Oliver He 136 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=136 ICE with experimental support prfC ICEVchLao1 the integration and excision module of ICE ICEVchLao1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchLao1 IEM the conjugation module of ICE ICEVchLao1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchLao1 CM the regulation module of ICE ICEVchLao1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchLao1 RM the accessory module of ICE ICEVchLao1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchLao1 AM Meng LIU (Mia), Oliver He 28 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=28 ICE with experimental support prfC ICEVchMoz5 the integration and excision module of ICE ICEVchMoz5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz5 IEM the conjugation module of ICE ICEVchMoz5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz5 CM the regulation module of ICE ICEVchMoz5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz5 RM the accessory module of ICE ICEVchMoz5. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz5 AM Meng LIU (Mia), Oliver He 29 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=29 ICE with experimental support MGIVchMoz6 MGIVchMoz6 can be mobilized in trans by ICEVchMoz6 from Vibrio cholerae to Escherichia coli. (PMID: 23204461) prfC ICEVchMoz6 the integration and excision module of ICE ICEVchMoz6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz6 IEM the conjugation module of ICE ICEVchMoz6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz6 CM the regulation module of ICE ICEVchMoz6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz6 RM the accessory module of ICE ICEVchMoz6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz6 AM Meng LIU (Mia), Oliver He 108 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=108 Escherichia coli ICE with experimental support prfC pJY1 the integration and excision module of ICE pJY1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pJY1 IEM the conjugation module of ICE pJY1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pJY1 CM the regulation module of ICE pJY1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pJY1 RM the accessory module of ICE pJY1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pJY1 AM Meng LIU (Mia), Oliver He 25 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=25 ICE with experimental support MGIVchMoz2 MGIVchMoz2 is predicted to be mobilized in trans by ICEVchMoz2 (PMID: 23204461) prfC ICEVchMoz2 the integration and excision module of ICE ICEVchMoz2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz2 IEM the conjugation module of ICE ICEVchMoz2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz2 CM the regulation module of ICE ICEVchMoz2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz2 RM the accessory module of ICE ICEVchMoz2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz2 AM Meng LIU (Mia), Oliver He 31 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=31 ICE with experimental support prfC ICEVchMoz8 the integration and excision module of ICE ICEVchMoz8. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz8 IEM the conjugation module of ICE ICEVchMoz8. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz8 CM the regulation module of ICE ICEVchMoz8. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz8 RM the accessory module of ICE ICEVchMoz8. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz8 AM Meng LIU (Mia), Oliver He 30 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=30 ICE with experimental support prfC ICEVchMoz7 the integration and excision module of ICE ICEVchMoz7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz7 IEM the conjugation module of ICE ICEVchMoz7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz7 CM the regulation module of ICE ICEVchMoz7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz7 RM the accessory module of ICE ICEVchMoz7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz7 AM Meng LIU (Mia), Oliver He 32 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=32 ICE with experimental support prfC ICEVchMoz9 the integration and excision module of ICE ICEVchMoz9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz9 IEM the conjugation module of ICE ICEVchMoz9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz9 CM the regulation module of ICE ICEVchMoz9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz9 RM the accessory module of ICE ICEVchMoz9. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz9 AM Meng LIU (Mia), Oliver He 27 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=27 ICE with experimental support MGIVchMoz4 MGIVchMoz4 is predicted to be mobilized in trans by ICEVchMoz4 (PMID: 23204461) prfC ICEVchMoz4 the integration and excision module of ICE ICEVchMoz4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz4 IEM the conjugation module of ICE ICEVchMoz4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz4 CM the regulation module of ICE ICEVchMoz4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz4 RM the accessory module of ICE ICEVchMoz4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz4 AM Meng LIU (Mia), Oliver He 1062 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1062 Escherichia coli MG1655 ICE with experimental support prfC ICEVchChn6 the integration and excision module of ICE ICEVchChn6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchChn6 IEM the conjugation module of ICE ICEVchChn6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchChn6 CM the regulation module of ICE ICEVchChn6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchChn6 RM the accessory module of ICE ICEVchChn6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchChn6 AM Meng LIU (Mia), Oliver He 135 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=135 ICE with experimental support prfC ICEVchHKo1 the integration and excision module of ICE ICEVchHKo1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchHKo1 IEM the conjugation module of ICE ICEVchHKo1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchHKo1 CM the regulation module of ICE ICEVchHKo1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchHKo1 RM the accessory module of ICE ICEVchHKo1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchHKo1 AM Meng LIU (Mia), Oliver He 274 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=274 ICE with experimental support prfC SXT(MCV09) the integration and excision module of ICE SXT(MCV09). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MCV09) IEM the conjugation module of ICE SXT(MCV09). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MCV09) CM the regulation module of ICE SXT(MCV09). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MCV09) RM the accessory module of ICE SXT(MCV09). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(MCV09) AM Meng LIU (Mia), Oliver He 6 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=6 ICE with experimental support prfC ICEVchAng2 the integration and excision module of ICE ICEVchAng2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng2 IEM the conjugation module of ICE ICEVchAng2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng2 CM the regulation module of ICE ICEVchAng2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng2 RM the accessory module of ICE ICEVchAng2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng2 AM Meng LIU (Mia), Oliver He 26 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=26 ICE with experimental support MGIVchMoz3 MGIVchMoz3 is predicted to be mobilized in trans by ICEVchMoz3 (PMID: 23204461) prfC ICEVchMoz3 the integration and excision module of ICE ICEVchMoz3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz3 IEM the conjugation module of ICE ICEVchMoz3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz3 CM the regulation module of ICE ICEVchMoz3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz3 RM the accessory module of ICE ICEVchMoz3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchMoz3 AM Meng LIU (Mia), Oliver He 7 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=7 ICE with experimental support prfC ICEVchAng3 the integration and excision module of ICE ICEVchAng3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng3 IEM the conjugation module of ICE ICEVchAng3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng3 CM the regulation module of ICE ICEVchAng3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng3 RM the accessory module of ICE ICEVchAng3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng3 AM Meng LIU (Mia), Oliver He 5 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=5 ICE with experimental support prfC ICEVchAng1 the integration and excision module of ICE ICEVchAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng1 IEM the conjugation module of ICE ICEVchAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng1 CM the regulation module of ICE ICEVchAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng1 RM the accessory module of ICE ICEVchAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchAng1 AM Meng LIU (Mia), Oliver He 139 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=139 ICE with experimental support prfC ICEVchVie0 the integration and excision module of ICE ICEVchVie0. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie0 IEM the conjugation module of ICE ICEVchVie0. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie0 CM the regulation module of ICE ICEVchVie0. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie0 RM the accessory module of ICE ICEVchVie0. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie0 AM Meng LIU (Mia), Oliver He 9 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=9 ICE with experimental support prfC ICEVchBan2 the integration and excision module of ICE ICEVchBan2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan2 IEM the conjugation module of ICE ICEVchBan2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan2 CM the regulation module of ICE ICEVchBan2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan2 RM the accessory module of ICE ICEVchBan2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan2 AM Meng LIU (Mia), Oliver He 10 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=10 ICE with experimental support prfC ICEVchBan3 the integration and excision module of ICE ICEVchBan3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan3 IEM the conjugation module of ICE ICEVchBan3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan3 CM the regulation module of ICE ICEVchBan3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan3 RM the accessory module of ICE ICEVchBan3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan3 AM Meng LIU (Mia), Oliver He 18 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=18 ICE with experimental support prfC ICEVchInd1 the integration and excision module of ICE ICEVchInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd1 IEM the conjugation module of ICE ICEVchInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd1 CM the regulation module of ICE ICEVchInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd1 RM the accessory module of ICE ICEVchInd1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd1 AM Meng LIU (Mia), Oliver He 89 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=89 ICE with experimental support prfC SXT(ET) the integration and excision module of ICE SXT(ET). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(ET) IEM the conjugation module of ICE SXT(ET). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(ET) CM the regulation module of ICE SXT(ET). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(ET) RM the accessory module of ICE SXT(ET). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SXT(ET) AM Meng LIU (Mia), Oliver He 8 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=8 ICE with experimental support prfC ICEVchBan1 the integration and excision module of ICE ICEVchBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan1 IEM the conjugation module of ICE ICEVchBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan1 CM the regulation module of ICE ICEVchBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan1 RM the accessory module of ICE ICEVchBan1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan1 AM Meng LIU (Mia), Oliver He 11 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=11 ICE with experimental support prfC ICEVchBan4 the integration and excision module of ICE ICEVchBan4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan4 IEM the conjugation module of ICE ICEVchBan4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan4 CM the regulation module of ICE ICEVchBan4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan4 RM the accessory module of ICE ICEVchBan4. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan4 AM Meng LIU (Mia), Oliver He 13 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=13 ICE with experimental support prfC ICEVchBan6 the integration and excision module of ICE ICEVchBan6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan6 IEM the conjugation module of ICE ICEVchBan6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan6 CM the regulation module of ICE ICEVchBan6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan6 RM the accessory module of ICE ICEVchBan6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan6 AM Meng LIU (Mia), Oliver He 19 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=19 ICE with experimental support prfC ICEVchInd2 the integration and excision module of ICE ICEVchInd2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd2 IEM the conjugation module of ICE ICEVchInd2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd2 CM the regulation module of ICE ICEVchInd2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd2 RM the accessory module of ICE ICEVchInd2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd2 AM Meng LIU (Mia), Oliver He 20 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=20 ICE with experimental support prfC ICEVchInd3 the integration and excision module of ICE ICEVchInd3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd3 IEM the conjugation module of ICE ICEVchInd3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd3 CM the regulation module of ICE ICEVchInd3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd3 RM the accessory module of ICE ICEVchInd3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchInd3 AM Meng LIU (Mia), Oliver He 137 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=137 ICE with experimental support prfC ICEVchSaf1 the integration and excision module of ICE ICEVchSaf1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSaf1 IEM the conjugation module of ICE ICEVchSaf1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSaf1 CM the regulation module of ICE ICEVchSaf1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSaf1 RM the accessory module of ICE ICEVchSaf1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSaf1 AM Meng LIU (Mia), Oliver He 14 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=14 ICE with experimental support prfC ICEVchBan7 the integration and excision module of ICE ICEVchBan7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan7 IEM the conjugation module of ICE ICEVchBan7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan7 CM the regulation module of ICE ICEVchBan7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan7 RM the accessory module of ICE ICEVchBan7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchBan7 AM Meng LIU (Mia), Oliver He 34 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=34 ICE with experimental support prfC ICEVchSL1 the integration and excision module of ICE ICEVchSL1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSL1 IEM the conjugation module of ICE ICEVchSL1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSL1 CM the regulation module of ICE ICEVchSL1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSL1 RM the accessory module of ICE ICEVchSL1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchSL1 AM Meng LIU (Mia), Oliver He 35 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=35 ICE with experimental support prfC ICEVchVie1 the integration and excision module of ICE ICEVchVie1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie1 IEM the conjugation module of ICE ICEVchVie1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie1 CM the regulation module of ICE ICEVchVie1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie1 RM the accessory module of ICE ICEVchVie1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVchVie1 AM Meng LIU (Mia), Oliver He 149 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=149 Escherichia coli ICE with experimental support prfC ICEVflH-08942 the integration and excision module of ICE ICEVflH-08942. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflH-08942 IEM the conjugation module of ICE ICEVflH-08942. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflH-08942 CM the regulation module of ICE ICEVflH-08942. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflH-08942 RM the accessory module of ICE ICEVflH-08942. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVflH-08942 AM Meng LIU (Mia), Oliver He 1072 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1072 Escherichia coli MG1655 ICE with experimental support ICEVpaChn1 the integration and excision module of ICE ICEVpaChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaChn1 IEM the conjugation module of ICE ICEVpaChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaChn1 CM the regulation module of ICE ICEVpaChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaChn1 RM the accessory module of ICE ICEVpaChn1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaChn1 AM Meng LIU (Mia), Oliver He 141 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=141 ICE with experimental support prfC ICEVpaAng1 the integration and excision module of ICE ICEVpaAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaAng1 IEM the conjugation module of ICE ICEVpaAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaAng1 CM the regulation module of ICE ICEVpaAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaAng1 RM the accessory module of ICE ICEVpaAng1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVpaAng1 AM Meng LIU (Mia), Oliver He 450 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=450 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVscSpa1 the integration and excision module of ICE ICEVscSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa1 IEM the conjugation module of ICE ICEVscSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa1 CM the regulation module of ICE ICEVscSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa1 RM the accessory module of ICE ICEVscSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa1 AM Meng LIU (Mia), Oliver He 451 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=451 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVscSpa2 the integration and excision module of ICE ICEVscSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa2 IEM the conjugation module of ICE ICEVscSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa2 CM the regulation module of ICE ICEVscSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa2 RM the accessory module of ICE ICEVscSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa2 AM Meng LIU (Mia), Oliver He 452 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=452 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVscSpa3 the integration and excision module of ICE ICEVscSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa3 IEM the conjugation module of ICE ICEVscSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa3 CM the regulation module of ICE ICEVscSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa3 RM the accessory module of ICE ICEVscSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVscSpa3 AM Meng LIU (Mia), Oliver He 453 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=453 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVspPor1 the integration and excision module of ICE ICEVspPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor1 IEM the conjugation module of ICE ICEVspPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor1 CM the regulation module of ICE ICEVspPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor1 RM the accessory module of ICE ICEVspPor1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor1 AM Meng LIU (Mia), Oliver He 454 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=454 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVspPor2 the integration and excision module of ICE ICEVspPor2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor2 IEM the conjugation module of ICE ICEVspPor2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor2 CM the regulation module of ICE ICEVspPor2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor2 RM the accessory module of ICE ICEVspPor2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor2 AM Meng LIU (Mia), Oliver He 455 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=455 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVspSpa1 the integration and excision module of ICE ICEVspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa1 IEM the conjugation module of ICE ICEVspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa1 CM the regulation module of ICE ICEVspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa1 RM the accessory module of ICE ICEVspSpa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa1 AM Meng LIU (Mia), Oliver He 456 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=456 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVspSpa2 the integration and excision module of ICE ICEVspSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa2 IEM the conjugation module of ICE ICEVspSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa2 CM the regulation module of ICE ICEVspSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa2 RM the accessory module of ICE ICEVspSpa2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa2 AM Meng LIU (Mia), Oliver He 457 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=457 Escherichia coli CAG18420; Escherichia coli BI533 ICE with experimental support prfC ICEVspSpa3 the integration and excision module of ICE ICEVspSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa3 IEM the conjugation module of ICE ICEVspSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa3 CM the regulation module of ICE ICEVspSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa3 RM the accessory module of ICE ICEVspSpa3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspSpa3 AM Meng LIU (Mia), Oliver He 446 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=446 Escherichia coli CAG18420; Photobacterium damselae subsp. damselae; Edwardsiella tarda; Shewanella putrefaciens; Vibrio anguillarum ICE with experimental support prfC ICEVspPor3 the integration and excision module of ICE ICEVspPor3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor3 IEM the conjugation module of ICE ICEVspPor3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor3 CM the regulation module of ICE ICEVspPor3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor3 RM the accessory module of ICE ICEVspPor3. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEVspPor3 AM Meng LIU (Mia), Oliver He - Vibrio splendidus ZD4 Meng LIU (Mia), Oliver He - Vibrio splendidus ZD5 Meng LIU (Mia), Oliver He - Vibrio splendidus ZF2 Meng LIU (Mia), Oliver He - Vibrio splendidus EB5 Meng LIU (Mia), Oliver He - Vibrio splendidus 14-3 Meng LIU (Mia), Oliver He 125 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=125 ICE with experimental support gene encoding a GMP-synthase CW459tet(M) the integration and excision module of ICE CW459tet(M). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CW459tet(M) IEM the conjugation module of ICE CW459tet(M). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CW459tet(M) CM the regulation module of ICE CW459tet(M). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CW459tet(M) RM the accessory module of ICE CW459tet(M). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CW459tet(M) AM Meng LIU (Mia), Oliver He 383 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=383 ICE with experimental support ICEEfa9830414 the integration and excision module of ICE ICEEfa9830414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEfa9830414 IEM the conjugation module of ICE ICEEfa9830414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEfa9830414 CM the regulation module of ICE ICEEfa9830414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEfa9830414 RM the accessory module of ICE ICEEfa9830414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEfa9830414 AM Meng LIU (Mia), Oliver He 243 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=243 ICE with experimental support AT rich regions this ICE was found in Lactococcus lactis subsp. lactis plasmid pAA211 ICELlapAA211 the integration and excision module of ICE ICELlapAA211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA211 IEM the conjugation module of ICE ICELlapAA211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA211 CM the regulation module of ICE ICELlapAA211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA211 RM the accessory module of ICE ICELlapAA211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA211 AM Meng LIU (Mia), Oliver He 244 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=244 ICE with experimental support AT rich regions this ICE was found in Lactococcus lactis subsp. lactis plasmid pAA291 ICELlapAA291 the integration and excision module of ICE ICELlapAA291. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA291 IEM the conjugation module of ICE ICELlapAA291. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA291 CM the regulation module of ICE ICELlapAA291. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA291 RM the accessory module of ICE ICELlapAA291. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICELlapAA291 AM Meng LIU (Mia), Oliver He 261 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=261 ICE with experimental support AT rich regions ICESau1591 the integration and excision module of ICE ICESau1591. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau1591 IEM the conjugation module of ICE ICESau1591. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau1591 CM the regulation module of ICE ICESau1591. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau1591 RM the accessory module of ICE ICESau1591. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau1591 AM Meng LIU (Mia), Oliver He 246 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=246 ICE with experimental support AT rich regions ICESau21995 the integration and excision module of ICE ICESau21995. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau21995 IEM the conjugation module of ICE ICESau21995. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau21995 CM the regulation module of ICE ICESau21995. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau21995 RM the accessory module of ICE ICESau21995. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau21995 AM Meng LIU (Mia), Oliver He 269 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=269 ICE with experimental support AT rich regions ICESau22034 the integration and excision module of ICE ICESau22034. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau22034 IEM the conjugation module of ICE ICESau22034. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau22034 CM the regulation module of ICE ICESau22034. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau22034 RM the accessory module of ICE ICESau22034. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau22034 AM Meng LIU (Mia), Oliver He 263 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=263 ICE with experimental support AT rich regions ICESau34801 the integration and excision module of ICE ICESau34801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau34801 IEM the conjugation module of ICE ICESau34801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau34801 CM the regulation module of ICE ICESau34801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau34801 RM the accessory module of ICE ICESau34801. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau34801 AM Meng LIU (Mia), Oliver He 247 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=247 ICE with experimental support AT rich regions ICESau35366 the integration and excision module of ICE ICESau35366. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35366 IEM the conjugation module of ICE ICESau35366. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35366 CM the regulation module of ICE ICESau35366. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35366 RM the accessory module of ICE ICESau35366. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35366 AM Meng LIU (Mia), Oliver He 260 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=260 ICE with experimental support AT rich regions ICESau35414 the integration and excision module of ICE ICESau35414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35414 IEM the conjugation module of ICE ICESau35414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35414 CM the regulation module of ICE ICESau35414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35414 RM the accessory module of ICE ICESau35414. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35414 AM Meng LIU (Mia), Oliver He 252 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=252 ICE with experimental support AT rich regions ICESau35679 the integration and excision module of ICE ICESau35679. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35679 IEM the conjugation module of ICE ICESau35679. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35679 CM the regulation module of ICE ICESau35679. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35679 RM the accessory module of ICE ICESau35679. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau35679 AM Meng LIU (Mia), Oliver He 272 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=272 ICE with experimental support AT rich regions ICESau4520 the integration and excision module of ICE ICESau4520. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4520 IEM the conjugation module of ICE ICESau4520. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4520 CM the regulation module of ICE ICESau4520. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4520 RM the accessory module of ICE ICESau4520. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4520 AM Meng LIU (Mia), Oliver He 271 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=271 ICE with experimental support AT rich regions ICESau4865 the integration and excision module of ICE ICESau4865. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4865 IEM the conjugation module of ICE ICESau4865. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4865 CM the regulation module of ICE ICESau4865. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4865 RM the accessory module of ICE ICESau4865. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau4865 AM Meng LIU (Mia), Oliver He 270 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=270 ICE with experimental support AT rich regions ICESau5331 the integration and excision module of ICE ICESau5331. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5331 IEM the conjugation module of ICE ICESau5331. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5331 CM the regulation module of ICE ICESau5331. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5331 RM the accessory module of ICE ICESau5331. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5331 AM Meng LIU (Mia), Oliver He 265 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=265 ICE with experimental support AT rich regions ICESau5377 the integration and excision module of ICE ICESau5377. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5377 IEM the conjugation module of ICE ICESau5377. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5377 CM the regulation module of ICE ICESau5377. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5377 RM the accessory module of ICE ICESau5377. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau5377 AM Meng LIU (Mia), Oliver He 264 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=264 ICE with experimental support AT rich regions ICESau617 the integration and excision module of ICE ICESau617. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau617 IEM the conjugation module of ICE ICESau617. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau617 CM the regulation module of ICE ICESau617. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau617 RM the accessory module of ICE ICESau617. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau617 AM Meng LIU (Mia), Oliver He 268 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=268 ICE with experimental support AT rich regions ICESau7215190 the integration and excision module of ICE ICESau7215190. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215190 IEM the conjugation module of ICE ICESau7215190. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215190 CM the regulation module of ICE ICESau7215190. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215190 RM the accessory module of ICE ICESau7215190. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215190 AM Meng LIU (Mia), Oliver He 254 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=254 ICE with experimental support AT rich regions ICESau7215311 the integration and excision module of ICE ICESau7215311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215311 IEM the conjugation module of ICE ICESau7215311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215311 CM the regulation module of ICE ICESau7215311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215311 RM the accessory module of ICE ICESau7215311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7215311 AM Meng LIU (Mia), Oliver He 250 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=250 ICE with experimental support AT rich regions ICESau7312330 the integration and excision module of ICE ICESau7312330. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7312330 IEM the conjugation module of ICE ICESau7312330. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7312330 CM the regulation module of ICE ICESau7312330. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7312330 RM the accessory module of ICE ICESau7312330. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7312330 AM Meng LIU (Mia), Oliver He 253 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=253 ICE with experimental support AT rich regions ICESau7412791 the integration and excision module of ICE ICESau7412791. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7412791 IEM the conjugation module of ICE ICESau7412791. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7412791 CM the regulation module of ICE ICESau7412791. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7412791 RM the accessory module of ICE ICESau7412791. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7412791 AM Meng LIU (Mia), Oliver He 248 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=248 ICE with experimental support AT rich regions ICESau7413093 the integration and excision module of ICE ICESau7413093. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413093 IEM the conjugation module of ICE ICESau7413093. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413093 CM the regulation module of ICE ICESau7413093. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413093 RM the accessory module of ICE ICESau7413093. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413093 AM Meng LIU (Mia), Oliver He 257 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=257 ICE with experimental support AT rich regions ICESau7413714 the integration and excision module of ICE ICESau7413714. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413714 IEM the conjugation module of ICE ICESau7413714. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413714 CM the regulation module of ICE ICESau7413714. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413714 RM the accessory module of ICE ICESau7413714. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7413714 AM Meng LIU (Mia), Oliver He 249 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=249 ICE with experimental support AT rich regions ICESau7512166 the integration and excision module of ICE ICESau7512166. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512166 IEM the conjugation module of ICE ICESau7512166. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512166 CM the regulation module of ICE ICESau7512166. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512166 RM the accessory module of ICE ICESau7512166. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512166 AM Meng LIU (Mia), Oliver He 258 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=258 ICE with experimental support AT rich regions ICESau7512986 the integration and excision module of ICE ICESau7512986. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512986 IEM the conjugation module of ICE ICESau7512986. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512986 CM the regulation module of ICE ICESau7512986. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512986 RM the accessory module of ICE ICESau7512986. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7512986 AM Meng LIU (Mia), Oliver He 267 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=267 ICE with experimental support AT rich regions ICESau7611280 the integration and excision module of ICE ICESau7611280. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7611280 IEM the conjugation module of ICE ICESau7611280. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7611280 CM the regulation module of ICE ICESau7611280. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7611280 RM the accessory module of ICE ICESau7611280. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7611280 AM Meng LIU (Mia), Oliver He 259 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=259 ICE with experimental support AT rich regions ICESau7612628 the integration and excision module of ICE ICESau7612628. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7612628 IEM the conjugation module of ICE ICESau7612628. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7612628 CM the regulation module of ICE ICESau7612628. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7612628 RM the accessory module of ICE ICESau7612628. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7612628 AM Meng LIU (Mia), Oliver He 256 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=256 ICE with experimental support AT rich regions ICESau7711730 the integration and excision module of ICE ICESau7711730. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7711730 IEM the conjugation module of ICE ICESau7711730. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7711730 CM the regulation module of ICE ICESau7711730. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7711730 RM the accessory module of ICE ICESau7711730. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau7711730 AM Meng LIU (Mia), Oliver He 245 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=245 ICE with experimental support AT rich regions ICESau8797 the integration and excision module of ICE ICESau8797. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau8797 IEM the conjugation module of ICE ICESau8797. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau8797 CM the regulation module of ICE ICESau8797. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau8797 RM the accessory module of ICE ICESau8797. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau8797 AM Meng LIU (Mia), Oliver He 251 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=251 ICE with experimental support AT rich regions ICESau9877324 the integration and excision module of ICE ICESau9877324. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau9877324 IEM the conjugation module of ICE ICESau9877324. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau9877324 CM the regulation module of ICE ICESau9877324. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau9877324 RM the accessory module of ICE ICESau9877324. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESau9877324 AM Meng LIU (Mia), Oliver He 262 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=262 ICE with experimental support AT rich regions ICESauST398 the integration and excision module of ICE ICESauST398. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauST398 IEM the conjugation module of ICE ICESauST398. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauST398 CM the regulation module of ICE ICESauST398. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauST398 RM the accessory module of ICE ICESauST398. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauST398 AM Meng LIU (Mia), Oliver He 255 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=255 ICE with experimental support AT rich regions ICESauSW356 the integration and excision module of ICE ICESauSW356. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauSW356 IEM the conjugation module of ICE ICESauSW356. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauSW356 CM the regulation module of ICE ICESauSW356. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauSW356 RM the accessory module of ICE ICESauSW356. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauSW356 AM Meng LIU (Mia), Oliver He 266 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=266 ICE with experimental support AT rich regions ICESauUSA42 the integration and excision module of ICE ICESauUSA42. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauUSA42 IEM the conjugation module of ICE ICESauUSA42. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauUSA42 CM the regulation module of ICE ICESauUSA42. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauUSA42 RM the accessory module of ICE ICESauUSA42. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESauUSA42 AM Meng LIU (Mia), Oliver He 91 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=91 Enterococcus faecalis; Listeria monocytogenes;Enterococcus faecium ICE with experimental support Tn1545 the integration and excision module of ICE Tn1545. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1545 IEM the conjugation module of ICE Tn1545. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1545 CM the regulation module of ICE Tn1545. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1545 RM the accessory module of ICE Tn1545. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1545 AM Meng LIU (Mia), Oliver He 330 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=330 ICE with experimental support AT rich regions Tn3872 the integration and excision module of ICE Tn3872. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn3872 IEM the conjugation module of ICE Tn3872. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn3872 CM the regulation module of ICE Tn3872. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn3872 RM the accessory module of ICE Tn3872. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn3872 AM Meng LIU (Mia), Oliver He 857 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=857 ICE with experimental support A+T rich Tn5031 the integration and excision module of ICE Tn5031. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5031 IEM the conjugation module of ICE Tn5031. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5031 CM the regulation module of ICE Tn5031. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5031 RM the accessory module of ICE Tn5031. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5031 AM Meng LIU (Mia), Oliver He 858 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=858 ICE with experimental support A+T rich Tn5032 the integration and excision module of ICE Tn5032. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5032 IEM the conjugation module of ICE Tn5032. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5032 CM the regulation module of ICE Tn5032. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5032 RM the accessory module of ICE Tn5032. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5032 AM Meng LIU (Mia), Oliver He 859 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=859 ICE with experimental support A+T rich Tn5033 the integration and excision module of ICE Tn5033. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5033 IEM the conjugation module of ICE Tn5033. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5033 CM the regulation module of ICE Tn5033. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5033 RM the accessory module of ICE Tn5033. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5033 AM Meng LIU (Mia), Oliver He 99 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=99 ~19 kb ICE with experimental support Tn5381 the integration and excision module of ICE Tn5381. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5381 IEM the conjugation module of ICE Tn5381. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5381 CM the regulation module of ICE Tn5381. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5381 RM the accessory module of ICE Tn5381. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5381 AM Meng LIU (Mia), Oliver He 100 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=100 ~20 kb ICE with experimental support Tn5383 the integration and excision module of ICE Tn5383. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5383 IEM the conjugation module of ICE Tn5383. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5383 CM the regulation module of ICE Tn5383. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5383 RM the accessory module of ICE Tn5383. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5383 AM Meng LIU (Mia), Oliver He 104 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=104 Klebsiella pneumoniae; Serratia liquefaciens; Pseudomonas sp.; Enterococcus sp. and Streptococcus sp. ICE with experimental support Tn6009 the integration and excision module of ICE Tn6009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6009 IEM the conjugation module of ICE Tn6009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6009 CM the regulation module of ICE Tn6009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6009 RM the accessory module of ICE Tn6009. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6009 AM Meng LIU (Mia), Oliver He 860 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=860 ICE with experimental support Tn6194 [CTnCD11] the integration and excision module of ICE Tn6194 [CTnCD11]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194 [CTnCD11] IEM the conjugation module of ICE Tn6194 [CTnCD11]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194 [CTnCD11] CM the regulation module of ICE Tn6194 [CTnCD11]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194 [CTnCD11] RM the accessory module of ICE Tn6194 [CTnCD11]. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn6194 [CTnCD11] AM Meng LIU (Mia), Oliver He 105 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=105 Streptococcus spp. ICE with experimental support Tn916S the integration and excision module of ICE Tn916S. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916S IEM the conjugation module of ICE Tn916S. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916S CM the regulation module of ICE Tn916S. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916S RM the accessory module of ICE Tn916S. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn916S AM Meng LIU (Mia), Oliver He 106 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=106 ~23 kb Streptococcus faecalis; Steptococcus lactis ICE with experimental support Tn919 the integration and excision module of ICE Tn919. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn919 IEM the conjugation module of ICE Tn919. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn919 CM the regulation module of ICE Tn919. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn919 RM the accessory module of ICE Tn919. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn919 AM Meng LIU (Mia), Oliver He 4 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=4 ~52 kb Bacteroides spp. ICE with experimental support NBU1 NBU1 can be mobilized in trans by CTnERL from Bacteroides uniformis to Bacteroides thetaiotaomicron 5482 or Escherichia coli. (PMID: 8407835; 7608064) NBU2 NBU2 can be mobilized in trans by CTnERL from Bacteroides uniformis/Bacteroides fragilis/Bacteroides thetaiotaomicron to Bacteroides thetaiotaomicron 5482/Escherichia coli/Bacteroides uniformis. (PMID: 8407835; 7608064;10852890) ermF region ermF region can be mobilized in trans by CTnERL from Bacteroides thetaiotaomicron to Bacteroides thetaiotaomicron. (PMID: 11472924) Few sites CTnERL the integration and excision module of ICE CTnERL. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnERL IEM the conjugation module of ICE CTnERL. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnERL CM the regulation module of ICE CTnERL. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnERL RM the accessory module of ICE CTnERL. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnERL AM Meng LIU (Mia), Oliver He 3 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=3 ~65 kb Bacteroides thetaiotaomicron; Bacteroides spp.; Escherichia coli ICE with experimental support NBU1 NBU1 can be mobilized in trans by CTnDOT from Bacteroides uniformis to Bacteroides thetaiotaomicron 5482. (PMID: 8407835) NBU2 NBU2 can be mobilized in trans by CTnDOT from Bacteroides uniformis to Bacteroides thetaiotaomicron 5482. (PMID: 8407835) Tn4399 Tn4399 can be mobilized in trans by CTnDOT from Bacteroides to Bacteroides. (PMID: 8397185) ermF region ermF region can be mobilized in trans by CTnDOT from Bacteroides thetaiotaomicron to Bacteroides thetaiotaomicron. (PMID: 11472924) TTTGCNNNNN CTnDOT the integration and excision module of ICE CTnDOT. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnDOT IEM the conjugation module of ICE CTnDOT. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnDOT CM the regulation module of ICE CTnDOT. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnDOT RM the accessory module of ICE CTnDOT. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnDOT AM Meng LIU (Mia), Oliver He 57 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=57 Pseudomonas putida; Pseudomonas aeruginosa; Cupriavidus necator ICE with experimental support tRNA-Gly ICEclc(JS705) the integration and excision module of ICE ICEclc(JS705). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(JS705) IEM the conjugation module of ICE ICEclc(JS705). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(JS705) CM the regulation module of ICE ICEclc(JS705). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(JS705) RM the accessory module of ICE ICEclc(JS705). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEclc(JS705) AM Meng LIU (Mia), Oliver He 75 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=75 501.8 kb 59.3 ICE with experimental support tRNA-Phe ICEMlSym(R7A) the integration and excision module of ICE ICEMlSym(R7A). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(R7A) IEM the conjugation module of ICE ICEMlSym(R7A). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(R7A) CM the regulation module of ICE ICEMlSym(R7A). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(R7A) RM the accessory module of ICE ICEMlSym(R7A). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMlSym(R7A) AM Meng LIU (Mia), Oliver He 95 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=95 ~47.5 kb ICE with experimental support Tn5252 (part of Tn5253) the integration and excision module of ICE Tn5252 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252 (part of Tn5253) IEM the conjugation module of ICE Tn5252 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252 (part of Tn5253) CM the regulation module of ICE Tn5252 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252 (part of Tn5253) RM the accessory module of ICE Tn5252 (part of Tn5253). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252 (part of Tn5253) AM Meng LIU (Mia), Oliver He 367 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=367 ICE with experimental support ICESpnJ93183 the integration and excision module of ICE ICESpnJ93183. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93183 IEM the conjugation module of ICE ICESpnJ93183. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93183 CM the regulation module of ICE ICESpnJ93183. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93183 RM the accessory module of ICE ICESpnJ93183. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93183 AM Meng LIU (Mia), Oliver He 368 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=368 ICE with experimental support ICESpnJ93292 the integration and excision module of ICE ICESpnJ93292. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93292 IEM the conjugation module of ICE ICESpnJ93292. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93292 CM the regulation module of ICE ICESpnJ93292. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93292 RM the accessory module of ICE ICESpnJ93292. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnJ93292 AM Meng LIU (Mia), Oliver He 365 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=365 ICE with experimental support ICESpnKD6 the integration and excision module of ICE ICESpnKD6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnKD6 IEM the conjugation module of ICE ICESpnKD6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnKD6 CM the regulation module of ICE ICESpnKD6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnKD6 RM the accessory module of ICE ICESpnKD6. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnKD6 AM Meng LIU (Mia), Oliver He 366 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=366 ICE with experimental support ICESpnN24 the integration and excision module of ICE ICESpnN24. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnN24 IEM the conjugation module of ICE ICESpnN24. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnN24 CM the regulation module of ICE ICESpnN24. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnN24 RM the accessory module of ICE ICESpnN24. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnN24 AM Meng LIU (Mia), Oliver He 369 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=369 ICE with experimental support ICESpn2531 the integration and excision module of ICE ICESpn2531. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpn2531 IEM the conjugation module of ICE ICESpn2531. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpn2531 CM the regulation module of ICE ICESpn2531. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpn2531 RM the accessory module of ICE ICESpn2531. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpn2531 AM Meng LIU (Mia), Oliver He 370 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=370 ICE with experimental support Tn5252(SP1000) the integration and excision module of ICE Tn5252(SP1000). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252(SP1000) IEM the conjugation module of ICE Tn5252(SP1000). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252(SP1000) CM the regulation module of ICE Tn5252(SP1000). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252(SP1000) RM the accessory module of ICE Tn5252(SP1000). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5252(SP1000) AM Meng LIU (Mia), Oliver He 363 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=363 >67 kb ICE with experimental support ICESpnA213 the integration and excision module of ICE ICESpnA213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnA213 IEM the conjugation module of ICE ICESpnA213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnA213 CM the regulation module of ICE ICESpnA213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnA213 RM the accessory module of ICE ICESpnA213. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpnA213 AM Meng LIU (Mia), Oliver He 362 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=362 >75 kb ICE with experimental support Tn1311 the integration and excision module of ICE Tn1311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1311 IEM the conjugation module of ICE Tn1311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1311 CM the regulation module of ICE Tn1311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1311 RM the accessory module of ICE Tn1311. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn1311 AM Meng LIU (Mia), Oliver He 826 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=826 ~50 kb Streptococcus pyogenes; Streptococcus agalactiae; Streptococcus pneumoniae; Streptococcus dysgalactiae; Streptococcus gordonii; Streptococcus oralis ICE with experimental support ICESpy005IQ the integration and excision module of ICE ICESpy005IQ. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy005IQ IEM the conjugation module of ICE ICESpy005IQ. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy005IQ CM the regulation module of ICE ICESpy005IQ. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy005IQ RM the accessory module of ICE ICESpy005IQ. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESpy005IQ AM Meng LIU (Mia), Oliver He 805 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=805 ~63 kb Streptococcus pyogenes 12RF; Streptococcus agalactiae 1357RF; Streptococcus suis v36RF ICE with experimental support rplL ICESde3396-like the integration and excision module of ICE ICESde3396-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396-like IEM the conjugation module of ICE ICESde3396-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396-like CM the regulation module of ICE ICESde3396-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396-like RM the accessory module of ICE ICESde3396-like. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESde3396-like AM Meng LIU (Mia), Oliver He 832 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=832 89 kb ICE with experimental support TTATTTAAGAGTAAC ICESsuHB1011 the integration and excision module of ICE ICESsuHB1011. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuHB1011 IEM the conjugation module of ICE ICESsuHB1011. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuHB1011 CM the regulation module of ICE ICESsuHB1011. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuHB1011 RM the accessory module of ICE ICESsuHB1011. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESsuHB1011 AM Meng LIU (Mia), Oliver He 73 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=73 22.3 kb ICE with experimental support pdhA, orf251 ICEF-II the integration and excision module of ICE ICEF-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-II IEM the conjugation module of ICE ICEF-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-II CM the regulation module of ICE ICEF-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-II RM the accessory module of ICE ICEF-II. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEF-II AM Meng LIU (Mia), Oliver He 110 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=110 ~90 kb ICE with experimental support bph-sal the integration and excision module of ICE bph-sal. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ bph-sal IEM the conjugation module of ICE bph-sal. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ bph-sal CM the regulation module of ICE bph-sal. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ bph-sal RM the accessory module of ICE bph-sal. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ bph-sal AM Meng LIU (Mia), Oliver He 1 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1 ~52 kb Bacteroides spp.; Escherichia coli ICE with experimental support BTF-37 the integration and excision module of ICE BTF-37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ BTF-37 IEM the conjugation module of ICE BTF-37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ BTF-37 CM the regulation module of ICE BTF-37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ BTF-37 RM the accessory module of ICE BTF-37. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ BTF-37 AM Meng LIU (Mia), Oliver He 63 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=63 Bacteroides fragilis ICE with experimental support CTn86 the integration and excision module of ICE CTn86. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn86 IEM the conjugation module of ICE CTn86. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn86 CM the regulation module of ICE CTn86. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn86 RM the accessory module of ICE CTn86. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTn86 AM Meng LIU (Mia), Oliver He 65 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=65 ~75 kb Bacteroides spp. ICE with experimental support CTnGERM1 the integration and excision module of ICE CTnGERM1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnGERM1 IEM the conjugation module of ICE CTnGERM1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnGERM1 CM the regulation module of ICE CTnGERM1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnGERM1 RM the accessory module of ICE CTnGERM1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ CTnGERM1 AM Meng LIU (Mia), Oliver He 1078 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1078 65 kb Legionella pneumophila JR32 pcsrT(MB1384) ICE with experimental support tRNAArg ICE-&beta;ox the integration and excision module of ICE ICE-&beta;ox. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-&beta;ox IEM the conjugation module of ICE ICE-&beta;ox. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-&beta;ox CM the regulation module of ICE ICE-&beta;ox. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-&beta;ox RM the accessory module of ICE ICE-&beta;ox. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE-&beta;ox AM Meng LIU (Mia), Oliver He 942 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=942 87.6 kb other rhizobia ICE with experimental support gly-tRNA ICE(Ac) the integration and excision module of ICE ICE(Ac). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE(Ac) IEM the conjugation module of ICE ICE(Ac). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE(Ac) CM the regulation module of ICE ICE(Ac). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE(Ac) RM the accessory module of ICE ICE(Ac). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE(Ac) AM Meng LIU (Mia), Oliver He 669 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=669 Streptococcus agalactiae Nem316; Streptococcus agalactiae COH1; Streptococcus pyogenes (ATCC 12202) ICE with experimental support CIME_Nem316_tRNALys CIME_Nem316_tRNALys can be mobilized in cis by ICE_515_tRNALys from Streptococcus agalactiae to Streptococcus agalactiae/Streptococcus pyogenes (PMID: 23275243) tRNALys ICE_515_tRNALys the integration and excision module of ICE ICE_515_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_515_tRNALys IEM the conjugation module of ICE ICE_515_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_515_tRNALys CM the regulation module of ICE ICE_515_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_515_tRNALys RM the accessory module of ICE ICE_515_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_515_tRNALys AM Meng LIU (Mia), Oliver He 673 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=673 42.8 kb only in Streptococcus agalactiae ICE with experimental support tRNALys ICE_FSLS3-026_tRNALys the integration and excision module of ICE ICE_FSLS3-026_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_FSLS3-026_tRNALys IEM the conjugation module of ICE ICE_FSLS3-026_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_FSLS3-026_tRNALys CM the regulation module of ICE ICE_FSLS3-026_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_FSLS3-026_tRNALys RM the accessory module of ICE ICE_FSLS3-026_tRNALys. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_FSLS3-026_tRNALys AM Meng LIU (Mia), Oliver He 876 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=876 47.1 kb ICE with experimental support intergenic ICE_SagNEM316_TnGBS1_1 the integration and excision module of ICE ICE_SagNEM316_TnGBS1_1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SagNEM316_TnGBS1_1 IEM the conjugation module of ICE ICE_SagNEM316_TnGBS1_1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SagNEM316_TnGBS1_1 CM the regulation module of ICE ICE_SagNEM316_TnGBS1_1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SagNEM316_TnGBS1_1 RM the accessory module of ICE ICE_SagNEM316_TnGBS1_1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICE_SagNEM316_TnGBS1_1 AM Meng LIU (Mia), Oliver He 966 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=966 62.8 kb ICE with experimental support mutY ICEEa1 the integration and excision module of ICE ICEEa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEa1 IEM the conjugation module of ICE ICEEa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEa1 CM the regulation module of ICE ICEEa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEa1 RM the accessory module of ICE ICEEa1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEEa1 AM Meng LIU (Mia), Oliver He 987 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=987 92.3 kb Pasteurella multocida 40.18[41.05] ICE with experimental support tRNALeu (DR:5'-GATTTTGAATC-3') ICEMh1 the integration and excision module of ICE ICEMh1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMh1 IEM the conjugation module of ICE ICEMh1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMh1 CM the regulation module of ICE ICEMh1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMh1 RM the accessory module of ICE ICEMh1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEMh1 AM Meng LIU (Mia), Oliver He 787 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=787 Streptococcus pyogenes RF12 ICE with experimental support ICESa2603/ICESsu32457 the integration and excision module of ICE ICESa2603/ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603/ICESsu32457 IEM the conjugation module of ICE ICESa2603/ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603/ICESsu32457 CM the regulation module of ICE ICESa2603/ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603/ICESsu32457 RM the accessory module of ICE ICESa2603/ICESsu32457. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESa2603/ICESsu32457 AM Meng LIU (Mia), Oliver He 790 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=790 ~110 kb Streptococcus agalactiae 1357RF; Streptococcus pyogenes 12RF ICE with experimental support 3' end of the rplL ICESag236 the integration and excision module of ICE ICESag236. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag236 IEM the conjugation module of ICE ICESag236. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag236 CM the regulation module of ICE ICESag236. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag236 RM the accessory module of ICE ICESag236. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESag236 AM Meng LIU (Mia), Oliver He 793 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=793 ~129 kb Streptococcus agalactiae 1357RF ICE with experimental support IMESp2907 IMESp2907 can be mobilized in cic by ICESagTR7 from Streptococcus agalactiae SagTR7 to Streptococcus agalactiae 1357RF. (PMID: 26679245) rplL ICESagTR7 the integration and excision module of ICE ICESagTR7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESagTR7 IEM the conjugation module of ICE ICESagTR7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESagTR7 CM the regulation module of ICE ICESagTR7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESagTR7 RM the accessory module of ICE ICESagTR7. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESagTR7 AM Meng LIU (Mia), Oliver He 814 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=814 ~53.0 kb Streptococcus pyogenes 24RF ICE with experimental support 3' end of the conserved rum ICESp2906 the integration and excision module of ICE ICESp2906. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2906 IEM the conjugation module of ICE ICESp2906. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2906 CM the regulation module of ICE ICESp2906. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2906 RM the accessory module of ICE ICESp2906. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICESp2906 AM Meng LIU (Mia), Oliver He 1038 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1038 14.9 kb Thermus thermophilus HB8 58[68] ICE with experimental support 3' end of an isoleucine tRNA ICEth1 the integration and excision module of ICE ICEth1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEth1 IEM the conjugation module of ICE ICEth1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEth1 CM the regulation module of ICE ICEth1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEth1 RM the accessory module of ICE ICEth1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEth1 AM Meng LIU (Mia), Oliver He 1080 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1080 Legionella pneumophila JR32 pcsrT(MB1384) ICE with experimental support tRNAMet LpgGI-1 the integration and excision module of ICE LpgGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpgGI-1 IEM the conjugation module of ICE LpgGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpgGI-1 CM the regulation module of ICE LpgGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpgGI-1 RM the accessory module of ICE LpgGI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpgGI-1 AM Meng LIU (Mia), Oliver He 111 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=111 ~65 kb 38 ICE with experimental support tRNA-Phe LpPI-1 the integration and excision module of ICE LpPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpPI-1 IEM the conjugation module of ICE LpPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpPI-1 CM the regulation module of ICE LpPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpPI-1 RM the accessory module of ICE LpPI-1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ LpPI-1 AM Meng LIU (Mia), Oliver He 1088 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1088 98.5 kb ICE with experimental support PbN1_GI15 the integration and excision module of ICE PbN1_GI15. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PbN1_GI15 IEM the conjugation module of ICE PbN1_GI15. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PbN1_GI15 CM the regulation module of ICE PbN1_GI15. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PbN1_GI15 RM the accessory module of ICE PbN1_GI15. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ PbN1_GI15 AM Meng LIU (Mia), Oliver He 542 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=542 14.6 kb Saccharopolyspora spinosa KM260754 67.2 1..14611 ICE with experimental support tRNA(Ser) pCM32 the integration and excision module of ICE pCM32. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pCM32 IEM the conjugation module of ICE pCM32. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pCM32 CM the regulation module of ICE pCM32. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pCM32 RM the accessory module of ICE pCM32. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pCM32 AM Meng LIU (Mia), Oliver He 120 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=120 13.6 kb Streptomyces lividans ICE with experimental support pIJ110 the integration and excision module of ICE pIJ110. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ110 IEM the conjugation module of ICE pIJ110. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ110 CM the regulation module of ICE pIJ110. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ110 RM the accessory module of ICE pIJ110. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ110 AM Meng LIU (Mia), Oliver He 119 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=119 15 kb Streptomyces lividans ICE with experimental support tRNA-Thr pIJ408 the integration and excision module of ICE pIJ408. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ408 IEM the conjugation module of ICE pIJ408. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ408 CM the regulation module of ICE pIJ408. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ408 RM the accessory module of ICE pIJ408. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pIJ408 AM Meng LIU (Mia), Oliver He 122 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=122 23.3 kb EU149765 68.44 1..23290 ICE with experimental support tRNA-Phe pMEA100 the integration and excision module of ICE pMEA100. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA100 IEM the conjugation module of ICE pMEA100. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA100 CM the regulation module of ICE pMEA100. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA100 RM the accessory module of ICE pMEA100. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA100 AM Meng LIU (Mia), Oliver He 123 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=123 13.3 kb L36679 69.35 1..13285 ICE with experimental support tRNA-Ile pMEA300 the integration and excision module of ICE pMEA300. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA300 IEM the conjugation module of ICE pMEA300. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA300 CM the regulation module of ICE pMEA300. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA300 RM the accessory module of ICE pMEA300. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMEA300 AM Meng LIU (Mia), Oliver He 150 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=150 11.2 kb AY860110 67.57 1..11188 ICE with experimental support tRNA-Phe pMR2 the integration and excision module of ICE pMR2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMR2 IEM the conjugation module of ICE pMR2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMR2 CM the regulation module of ICE pMR2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMR2 RM the accessory module of ICE pMR2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pMR2 AM Meng LIU (Mia), Oliver He 124 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=124 48.4 ICE with experimental support pRS01 the integration and excision module of ICE pRS01. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pRS01 IEM the conjugation module of ICE pRS01. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pRS01 CM the regulation module of ICE pRS01. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pRS01 RM the accessory module of ICE pRS01. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pRS01 AM Meng LIU (Mia), Oliver He 118 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=118 9 kb NC_002112 68.73 1..9014 ICE with experimental support pSA1.1 the integration and excision module of ICE pSA1.1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSA1.1 IEM the conjugation module of ICE pSA1.1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSA1.1 CM the regulation module of ICE pSA1.1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSA1.1 RM the accessory module of ICE pSA1.1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSA1.1 AM Meng LIU (Mia), Oliver He 117 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=117 10.9 kb Streptomyces lividans ICE with experimental support tRNA-Pro pSAM2 the integration and excision module of ICE pSAM2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSAM2 IEM the conjugation module of ICE pSAM2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSAM2 CM the regulation module of ICE pSAM2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSAM2 RM the accessory module of ICE pSAM2. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSAM2 AM Meng LIU (Mia), Oliver He 157 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=157 17.3 kb AM420293 68.99[71.15] 7823295..7840549 ICE with experimental support tRNA-Phe(SACE_8046) pSE211 the integration and excision module of ICE pSE211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSE211 IEM the conjugation module of ICE pSE211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSE211 CM the regulation module of ICE pSE211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSE211 RM the accessory module of ICE pSE211. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSE211 AM Meng LIU (Mia), Oliver He 151 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=151 ~16.9 kb ICE with experimental support tRNA-Ser pSG1 the integration and excision module of ICE pSG1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSG1 IEM the conjugation module of ICE pSG1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSG1 CM the regulation module of ICE pSG1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSG1 RM the accessory module of ICE pSG1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ pSG1 AM Meng LIU (Mia), Oliver He 163 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=163 17.2 kb Streptomyces lividans NC_003888 67.94[72.12] 5038594..5055797 ICE with experimental support tRNA-Tyr SLP1 the integration and excision module of ICE SLP1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SLP1 IEM the conjugation module of ICE SLP1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SLP1 CM the regulation module of ICE SLP1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SLP1 RM the accessory module of ICE SLP1. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ SLP1 AM Meng LIU (Mia), Oliver He 93 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=93 70~80 kb ICE with experimental support Tcr Emr 7853 the integration and excision module of ICE Tcr Emr 7853. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tcr Emr 7853 IEM the conjugation module of ICE Tcr Emr 7853. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tcr Emr 7853 CM the regulation module of ICE Tcr Emr 7853. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tcr Emr 7853 RM the accessory module of ICE Tcr Emr 7853. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tcr Emr 7853 AM Meng LIU (Mia), Oliver He 94 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=94 ~150 kb ICE with experimental support Tn5030 the integration and excision module of ICE Tn5030. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5030 IEM the conjugation module of ICE Tn5030. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5030 CM the regulation module of ICE Tn5030. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5030 RM the accessory module of ICE Tn5030. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5030 AM Meng LIU (Mia), Oliver He 96 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=96 ~70 kb Lactococcus lactis ICE with experimental support Tn5276 the integration and excision module of ICE Tn5276. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5276 IEM the conjugation module of ICE Tn5276. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5276 CM the regulation module of ICE Tn5276. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5276 RM the accessory module of ICE Tn5276. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5276 AM Meng LIU (Mia), Oliver He 97 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=97 ICE with experimental support Tn5281 the integration and excision module of ICE Tn5281. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5281 IEM the conjugation module of ICE Tn5281. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5281 CM the regulation module of ICE Tn5281. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5281 RM the accessory module of ICE Tn5281. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5281 AM Meng LIU (Mia), Oliver He 404 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=404 ~70 kb ICE with experimental support TTTTTG Tn5301 the integration and excision module of ICE Tn5301. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5301 IEM the conjugation module of ICE Tn5301. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5301 CM the regulation module of ICE Tn5301. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5301 RM the accessory module of ICE Tn5301. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5301 AM Meng LIU (Mia), Oliver He 98 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=98 ~70 kb ICE with experimental support Tn5307 the integration and excision module of ICE Tn5307. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5307 IEM the conjugation module of ICE Tn5307. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5307 CM the regulation module of ICE Tn5307. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5307 RM the accessory module of ICE Tn5307. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5307 AM Meng LIU (Mia), Oliver He 382 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=382 ICE with experimental support Tn5382(5-F9) the integration and excision module of ICE Tn5382(5-F9). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5382(5-F9) IEM the conjugation module of ICE Tn5382(5-F9). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5382(5-F9) CM the regulation module of ICE Tn5382(5-F9). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5382(5-F9) RM the accessory module of ICE Tn5382(5-F9). Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5382(5-F9) AM Meng LIU (Mia), Oliver He 101 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=101 ~65 kb ICE with experimental support alkyl hydrogen peroxide reductase genes Tn5385 the integration and excision module of ICE Tn5385. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5385 IEM the conjugation module of ICE Tn5385. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5385 CM the regulation module of ICE Tn5385. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5385 RM the accessory module of ICE Tn5385. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ Tn5385 AM Meng LIU (Mia), Oliver He 107 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=107 ICE with experimental support TnB1230 the integration and excision module of ICE TnB1230. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnB1230 IEM the conjugation module of ICE TnB1230. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnB1230 CM the regulation module of ICE TnB1230. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnB1230 RM the accessory module of ICE TnB1230. Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ TnB1230 AM Meng LIU (Mia), Oliver He - Streptomyces parvulus ATCC 12434 Meng LIU (Mia), Oliver He - Streptomyces griseus NRRL3851 BSU_tRNA_51 Meng LIU (Mia), Oliver He Human;Feces PacBio Asia;China -;KL47 CP029216 unpublished Klebsiella pneumoniae L201 Meng LIU (Mia), Oliver He Human;Feces Oxford Nanopore MiniION Africa;Tanzania -;KL127 CP034316 unpublished Klebsiella pneumoniae 6 Meng LIU (Mia), Oliver He Human;blood Oxford Nanopore MiniION; Illumina MiSeq Asia;China Taiwan ST11;KL64 CP040023 https://doi.org/10.1093/jac/dkz431 Klebsiella pneumoniae KPC160132 Meng LIU (Mia), Oliver He Human;pus Oxford Nanopore MiniION; Illumina MiSeq Asia;China Taiwan ST11;KL64 CP040028 https://doi.org/10.1093/jac/dkz431 Klebsiella pneumoniae KPC160121 Meng LIU (Mia), Oliver He Human;urine Oxford Nanopore MiniION; Illumina MiSeq Asia;China Taiwan ST11;KL64 CP040033 https://doi.org/10.1093/jac/dkz431 Klebsiella pneumoniae KPC160117 Meng LIU (Mia), Oliver He Human;urine Oxford Nanopore MiniION; Illumina MiSeq Asia;China Taiwan ST11;KL64 CP040038 https://doi.org/10.1093/jac/dkz431 Klebsiella pneumoniae KPC160125 Meng LIU (Mia), Oliver He Human;blood Illumina; PacBio Asia;China ST11;KL64 CP048933 unpublished Klebsiella pneumoniae KP18-2079 Meng LIU (Mia), Oliver He Env;wastewater Sequel; MiSeq Asia;Japan ST11;KL47 NZ_AP018671 30232165 Klebsiella pneumoniae GSU10-3 DNA Meng LIU (Mia), Oliver He Human;sputum Illumina MiSeq; Oxford Nanopore MiniION Asia;Nepal ST147;KL51 NZ_AP021880 unpublished Klebsiella pneumoniae JUNP254 Meng LIU (Mia), Oliver He Human;blood Illumina; Pacific Biosciences Asia;Nepal ST15;KL112 NZ_CP008929 25267672 Klebsiella pneumoniae PMK1 Meng LIU (Mia), Oliver He Human;clinical urine culture PacBio North America;USA ST395;KL108 NZ_CP009114 24798270 Klebsiella pneumoniae carbapenem-resistant blaNDM-1 Meng LIU (Mia), Oliver He human;urine PacBio RS II North America;USA ST258;KL107 NZ_CP009771 25232178 Klebsiella pneumoniae subsp. pneumoniae KPNIH33 Meng LIU (Mia), Oliver He human;perirectal swab PacBio RS II North America;USA ST258;KL107 NZ_CP009775 25232178 Klebsiella pneumoniae subsp. pneumoniae KPNIH32 Meng LIU (Mia), Oliver He human;perirectal swab PacBio RS II North America;USA ST258;KL106 NZ_CP009872 25232178 Klebsiella pneumoniae subsp. pneumoniae KPNIH30 Meng LIU (Mia), Oliver He human;Excreted bodily substance PacBio RS II North America;USA ST258;KL106 NZ_CP010361 submitted Klebsiella pneumoniae 32192 Meng LIU (Mia), Oliver He human;Bodily fluid PacBio RS II North America;USA ST258;KL63 NZ_CP010392 submitted Klebsiella pneumoniae 34618 Meng LIU (Mia), Oliver He human;Sputum PacBio North America;USA ST11;KL125 NZ_CP011578 submitted Klebsiella pneumoniae CAV1392 Meng LIU (Mia), Oliver He human;Perirectal PacBio North America;USA ST258;KL107 NZ_CP011647 submitted Klebsiella pneumoniae CAV1596 Meng LIU (Mia), Oliver He human;urine PacBio Asia;India ST14;KL2 NZ_CP012043 26872343 Klebsiella pneumoniae U25 Meng LIU (Mia), Oliver He human;central venous catheter Illumina Europe;Belgium ST383;KL30 NZ_CP012743 26968884 Klebsiella pneumoniae subsp. pneumoniae TGH8 Meng LIU (Mia), Oliver He Human;blood PacBio RS II Asia;China ST374;KL2 NZ_CP014008 submitted Klebsiella pneumoniae subsp. pneumoniae RJF293 Meng LIU (Mia), Oliver He Human;blood PacBio RS II Asia;China ST23;KL1 NZ_CP014010 submitted Klebsiella pneumoniae subsp. pneumoniae RJF999 Meng LIU (Mia), Oliver He PacBio North America;USA ST11;KL105 NZ_CP014294 unpublished Klebsiella pneumoniae KP38731 Meng LIU (Mia), Oliver He PacBio RS II North America;USA ST258;KL107 NZ_CP014647 unpublished Klebsiella pneumoniae KPNIH36 Meng LIU (Mia), Oliver He PacBio RS II North America;USA ST147;KL64 NZ_CP014755 submitted Klebsiella pneumoniae AATZP Meng LIU (Mia), Oliver He PacBio; Illumina North America;USA ST340;KL55 NZ_CP015385 unpublished Klebsiella pneumoniae NY9 Meng LIU (Mia), Oliver He PacBio; Illumina North America;USA ST258;KL107 NZ_CP015392 unpublished Klebsiella pneumoniae CR14 Meng LIU (Mia), Oliver He human;urine PacBio Asia;UAE ST147;KL64 NZ_CP015500 submitted Klebsiella pneumoniae SKGH01 Meng LIU (Mia), Oliver He human;blood PacBio Europe;Switzerland ST512;KL107 NZ_CP015822 unpublished Klebsiella pneumoniae isolate blood sample 2 Meng LIU (Mia), Oliver He PacBio Asia;China ST15;KL112 NZ_CP015990 submitted Klebsiella pneumoniae BR Meng LIU (Mia), Oliver He human;blood PacBio Asia;China Taiwan ST23;KL1 NZ_CP016813 unpublished Klebsiella pneumoniae ED2 Meng LIU (Mia), Oliver He human;blood PacBio Asia;China Taiwan ST23;KL1 NZ_CP016814 unpublished Klebsiella pneumoniae ED23 Meng LIU (Mia), Oliver He human;urine PacBio North America;USA ST14;KL2 NZ_CP016923 unpublished Klebsiella pneumoniae isolate 11 Meng LIU (Mia), Oliver He human;urine Asia;China Taiwan ST15;KL64 NZ_CP017385 unpublished Klebsiella pneumoniae KP36 Meng LIU (Mia), Oliver He human;Abdominal Abscess PacBio North America;USA ST45;KL25 NZ_CP017934 25561339 Klebsiella pneumoniae CAV1016 Meng LIU (Mia), Oliver He human;sputum PacBio Asia;China ST23;KL1 NZ_CP017994 submitted Klebsiella pneumoniae P1428 Meng LIU (Mia), Oliver He human;nose PacBio RS II Europe;Germany ST147;KL64 NZ_CP018140 unpublished Klebsiella pneumoniae Kp_Goe_822579 Meng LIU (Mia), Oliver He human;sputum Asia;China ST37;KL11 NZ_CP018306 submitted Klebsiella pneumoniae 459 Meng LIU (Mia), Oliver He human;wound swab PacBio Europe;Germany ST23;KL57 NZ_CP018337 unpublished Klebsiella pneumoniae isolate Kp_Goe_154414 Meng LIU (Mia), Oliver He human;urine PacBio North America;USA ST340;KL55 NZ_CP018352 unpublished Klebsiella pneumoniae CAV1417 Meng LIU (Mia), Oliver He human;Perirectal PacBio North America;USA ST258;KL106 NZ_CP018356 unpublished Klebsiella pneumoniae CAV1453 Meng LIU (Mia), Oliver He human;urine PacBio Europe;Germany ST395;KL108 NZ_CP018364 unpublished Klebsiella pneumoniae Kp_Goe_62629 Meng LIU (Mia), Oliver He human;urine PacBio RS II; Illumina MiSeq North America;USA ST258;KL107 NZ_CP018427 submitted Klebsiella pneumoniae MNCRE69 Meng LIU (Mia), Oliver He human;wound PacBio RS II; Illumina MiSeq North America;USA ST258;KL107 NZ_CP018428 unpublished Klebsiella pneumoniae MNCRE78 Meng LIU (Mia), Oliver He human;wound PacBio RS II; Illumina MiSeq North America;USA ST258;KL107 NZ_CP018437 unpublished Klebsiella pneumoniae MNCRE53 Meng LIU (Mia), Oliver He human;skin swab PacBio Europe;Germany ST11;KL15 NZ_CP018438 submitted Klebsiella pneumoniae Kp_Goe_822917 Meng LIU (Mia), Oliver He human;wound swab PacBio Europe;Germany ST101;KL17 NZ_CP018447 unpublished Klebsiella pneumoniae Kp_Goe_33208 Meng LIU (Mia), Oliver He human;urine PacBio Europe;Germany ST101;KL17 NZ_CP018450 unpublished Klebsiella pneumoniae Kp_Goe_71070 Meng LIU (Mia), Oliver He human;blood Illumina Miseq and PacBio RS Sequencing Asia;China ST11;KL47 NZ_CP018454 unpublished Klebsiella pneumoniae SWU01 Meng LIU (Mia), Oliver He human;urine PacBio North America;USA ST244;KL15 NZ_CP018671 unpublished Klebsiella pneumoniae CAV1042 Meng LIU (Mia), Oliver He human;urine PacBio North America;USA ST340;KL55 NZ_CP018676 unpublished Klebsiella pneumoniae CAV1217 Meng LIU (Mia), Oliver He human;anal swab PacBio Europe;Germany ST11;KL15 NZ_CP018692 unpublished Klebsiella pneumoniae Kp_Goe_821588 Meng LIU (Mia), Oliver He human;urine PacBio Europe;Germany ST101;KL17 NZ_CP018735 unpublished Klebsiella pneumoniae Kp_Goe_121641 Meng LIU (Mia), Oliver He PacBio ST11;KL74 NZ_CP018816 unpublished Klebsiella pneumoniae AR_0049 Meng LIU (Mia), Oliver He human;blood PacBio South America;Brazil ST437;KL36 NZ_CP018883 unpublished Klebsiella pneumoniae subsp. pneumoniae BR7 Meng LIU (Mia), Oliver He human;urine PacBio South America;Brazil ST437;KL36 NZ_CP018885 unpublished Klebsiella pneumoniae subsp. pneumoniae BR21 Meng LIU (Mia), Oliver He Human;sputum Illumina MiSeq; PacBio Asia;China ST23;KL1 NZ_CP019047 unpublished Klebsiella pneumoniae subsp. pneumoniae RJA166 Meng LIU (Mia), Oliver He human;blood PacBio Europe;Switzerland ST512;KL107 NZ_CP019772 28143787 Klebsiella pneumoniae subsp. pneumoniae KPN_KPC_HUG_07 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP020071 unpublished Klebsiella pneumoniae AR_0115 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL106 NZ_CP020108 unpublished Klebsiella pneumoniae AR_0098 Meng LIU (Mia), Oliver He human;urine PacBio North America;USA ST258;KL106 NZ_CP020498 unpublished Klebsiella pneumoniae BWHC1 Meng LIU (Mia), Oliver He PacBio North America;USA ST258;KL107 NZ_CP020837 28512093 Klebsiella pneumoniae BK13043 Meng LIU (Mia), Oliver He human;respiratory PacBio North America;USA ST14;KL2 NZ_CP020853 28512093 Klebsiella pneumoniae KPN528 Meng LIU (Mia), Oliver He human;urine PacBio Europe;Norway ST11;KL24 NZ_CP020901 28684580 Klebsiella pneumoniae K66-45 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP021539 unpublished Klebsiella pneumoniae AR_0047 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP021549 submitted Klebsiella pneumoniae AR_0112 Meng LIU (Mia), Oliver He PacBio RSII ST11;KL24 NZ_CP021685 unpublished Klebsiella pneumoniae AR_0146 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP021718 unpublished Klebsiella pneumoniae AR_0129 Meng LIU (Mia), Oliver He PacBio RSII ST45;KL25 NZ_CP021740 unpublished Klebsiella pneumoniae AR_0126 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP021751 unpublished Klebsiella pneumoniae AR_0113 Meng LIU (Mia), Oliver He PacBio RSII ST147;KL64 NZ_CP021757 unpublished Klebsiella pneumoniae AR_0138 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP021833 unpublished Klebsiella pneumoniae AR_0120 Meng LIU (Mia), Oliver He PacBio RSII ST258;KL107 NZ_CP021859 unpublished Klebsiella pneumoniae AR_0125 Meng LIU (Mia), Oliver He PacBio RSII ST147;KL64 NZ_CP021939 unpublished Klebsiella pneumoniae AR_0145 Meng LIU (Mia), Oliver He PacBio RSII ST147;KL64 NZ_CP021944 unpublished Klebsiella pneumoniae AR_0152 Meng LIU (Mia), Oliver He PacBio RSII ST11;KL24 NZ_CP021950 unpublished Klebsiella pneumoniae AR_0148 Meng LIU (Mia), Oliver He PacBio RSII ST37;KL105 NZ_CP021960 unpublished Klebsiella pneumoniae AR_0139 Meng LIU (Mia), Oliver He Env;wastewater PacBio Europe;Switzerland ST437;KL36 NZ_CP022143 28818913 Klebsiella pneumoniae 704SK6 Meng LIU (Mia), Oliver He human;Endoscope PacBio Europe;France ST258;KL106 NZ_CP022573 29688339 Klebsiella pneumoniae BIC-1 Meng LIU (Mia), Oliver He human;urine PacBio; Illumina NextSeq Oceana;Australia ST258;KL106 NZ_CP022691 unpublished Klebsiella pneumoniae subsp. pneumoniae AUSMDU00008079 Meng LIU (Mia), Oliver He human;urine PacBio Asia;China ST11;KL47 NZ_CP022882 unpublished Klebsiella pneumoniae 911021 Meng LIU (Mia), Oliver He human;urine PacBio Asia;China ST11;KL47 NZ_CP022997 unpublished Klebsiella pneumoniae 721005 Meng LIU (Mia), Oliver He human;wound Illumina MiSeq; PacBio Europe;Sweden ST17;KL25 NZ_CP023441 unpublished Klebsiella pneumoniae CCUG 70747 Meng LIU (Mia), Oliver He human;urine PacBio Africa;South Africa ST101;KL17 NZ_CP023487 28636609 Klebsiella pneumoniae subsp. pneumoniae ST101:960186733 Meng LIU (Mia), Oliver He human;tracheal fluid PacBio Africa;South Africa ST2017;KL17 NZ_CP023553 28636609 Klebsiella pneumoniae subsp. pneumoniae ST2017:950142398 Meng LIU (Mia), Oliver He PacBio Asia;China Taiwan ST11;KL47 NZ_CP023722 29800340 Klebsiella pneumoniae TVGHCRE225 Meng LIU (Mia), Oliver He human;rectal PacBio; Illumina North America;Canada ST11;KL47 NZ_CP023933 https://doi.org/10.1038/s41467-019-11306-6 Klebsiella pneumoniae FDAARGOS_443 Meng LIU (Mia), Oliver He human;wound PacBio; Illumina North America;Canada ST11;KL64 NZ_CP023941 https://doi.org/10.1038/s41467-019-11306-6 Klebsiella pneumoniae FDAARGOS_444 Meng LIU (Mia), Oliver He human;rectal PacBio; Illumina North America;Canada ST340;KL19 NZ_CP023946 https://doi.org/10.1038/s41467-019-11306-6 Klebsiella pneumoniae FDAARGOS_446 Meng LIU (Mia), Oliver He human;Perirectal PacBio; Illumina North America;Canada ST152;KL149 NZ_CP023949 https://doi.org/10.1038/s41467-019-11306-6 Klebsiella pneumoniae FDAARGOS_447 Meng LIU (Mia), Oliver He human;rectal swab Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024191 unpublished Klebsiella pneumoniae isolate KSB1_5D Meng LIU (Mia), Oliver He human;Trachaeal secretion Illumina MiSeq; PacBio Asia;Pakistan ST147;KL64 NZ_CP024429 29220374 Klebsiella pneumoniae DA48896 Meng LIU (Mia), Oliver He human;sputum PacBio; Illumina MiSeq Asia;Thailand ST45;KL7 NZ_CP024458 unpublished Klebsiella pneumoniae QS17-0161 Meng LIU (Mia), Oliver He human;UTI Illumina HiSeq and ONT Oceana;Australia ST29;KL30 NZ_CP024482 29340588 Klebsiella pneumoniae INF322 Meng LIU (Mia), Oliver He human;UTI Illumina HiSeq and ONT Oceana;Australia ST29;KL30 NZ_CP024489 29340588 Klebsiella pneumoniae INF249 Meng LIU (Mia), Oliver He human;cerebrospinal fluid Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024521 29340588 Klebsiella pneumoniae INF158 Meng LIU (Mia), Oliver He human;blood Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024528 29340588 Klebsiella pneumoniae INF157 Meng LIU (Mia), Oliver He human;UTI Illumina HiSeq and ONT Oceana;Australia ST37;KL14 NZ_CP024542 29340588 Klebsiella pneumoniae INF042 Meng LIU (Mia), Oliver He human;UTI Illumina HiSeq and ONT Oceana;Australia ST37;KL14 NZ_CP024545 29340588 Klebsiella pneumoniae INF059 Meng LIU (Mia), Oliver He human;rectal Illumina HiSeq and ONT Oceana;Australia ST37;KL14 NZ_CP024548 29340588 Klebsiella pneumoniae KSB1_7J Meng LIU (Mia), Oliver He human;urine Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024549 29340588 Klebsiella pneumoniae INF163 Meng LIU (Mia), Oliver He human;urine Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024556 29340588 Klebsiella pneumoniae INF164 Meng LIU (Mia), Oliver He human;urine Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024563 29340588 Klebsiella pneumoniae INF278 Meng LIU (Mia), Oliver He human;urine Illumina HiSeq and ONT Oceana;Australia ST340;KL15 NZ_CP024570 29340588 Klebsiella pneumoniae INF274 Meng LIU (Mia), Oliver He human;Peritoneal fluid PacBio Asia;Korea ST147;KL64 NZ_CP024834 unpublished Klebsiella pneumoniae CRKP-2297 Meng LIU (Mia), Oliver He human;Bronchial washing PacBio Asia;Korea ST147;KL64 NZ_CP024838 unpublished Klebsiella pneumoniae CRKP-1215 Meng LIU (Mia), Oliver He human;rectal CANU Asia;Thailand ST147;KL10 NZ_CP024916 unpublished Klebsiella pneumoniae NH54 Meng LIU (Mia), Oliver He human;Sacral swab PacBio Oceana;Australia ST258;KL106 NZ_CP025005 unpublished Klebsiella pneumoniae AUSMDU00003562 Meng LIU (Mia), Oliver He human;urine PacBio Oceana;Australia ST258;KL106 NZ_CP025008 unpublished Klebsiella pneumoniae AUSMDU00008119 Meng LIU (Mia), Oliver He human;urine PacBio; Illumina HiSeq North America;USA ST258;KL107 NZ_CP025037 unpublished Klebsiella pneumoniae NU-CRE047 Meng LIU (Mia), Oliver He human;liver abscess Illumina MiniSeq; Illumina MiSeq; Nanopore Technologies MiniION R9.X Asia;Singapore ST23;KL1 NZ_CP025080 30006589 Klebsiella pneumoniae SGH10 Meng LIU (Mia), Oliver He Illumina MiSeq Asia;China ST23;KL1 NZ_CP025087 unpublished Klebsiella pneumoniae KP6 Meng LIU (Mia), Oliver He Illumina MiSeq Asia;China ST1941;KL1 NZ_CP025088 unpublished Klebsiella pneumoniae KP7 Meng LIU (Mia), Oliver He Illumina MiSeq Asia;China ST23;KL1 NZ_CP025090 unpublished Klebsiella pneumoniae KP9 Meng LIU (Mia), Oliver He Illumina MiSeq Asia;China -;KL1 NZ_CP025092 unpublished Klebsiella pneumoniae KP11 Meng LIU (Mia), Oliver He Illumina MiSeq Asia;China -;KL166 NZ_CP025093 unpublished Klebsiella pneumoniae KP14 Meng LIU (Mia), Oliver He Illumina MiSeq; PacBio Asia;China ST11;KL47 NZ_CP025456 unpublished Klebsiella pneumoniae KP69 Meng LIU (Mia), Oliver He Illumina MiSeq; PacBio Asia;China ST11;KL47 NZ_CP025461 unpublished Klebsiella pneumoniae F44 Meng LIU (Mia), Oliver He Illumina MiSeq; PacBio Asia;China ST11;KL103 NZ_CP025466 unpublished Klebsiella pneumoniae JS187 Meng LIU (Mia), Oliver He Env;soil PacBio Asia;China ST111;KL63 NZ_CP025541 unpublished Klebsiella pneumoniae 2N3 Meng LIU (Mia), Oliver He human;Liver abscess puncture fluid Illumina MiSeq Asia;China -;KL1 NZ_CP025630 32393110 Klebsiella pneumoniae LS359 Meng LIU (Mia), Oliver He human;sputum Illumina MiSeq Asia;China ST23;KL1 NZ_CP025633 unpublished Klebsiella pneumoniae HS102438 Meng LIU (Mia), Oliver He human;Liver abscess puncture fluid Illumina MiSeq Asia;China ST23;KL1 NZ_CP025639 unpublished Klebsiella pneumoniae LS357 Meng LIU (Mia), Oliver He human;Liver abscess puncture fluid Illumina MiSeq Asia;China ST1941;KL1 NZ_CP025641 unpublished Klebsiella pneumoniae LS355 Meng LIU (Mia), Oliver He human;sputum PacBio Asia;China ST11;KL47 NZ_CP025951 29424684 Klebsiella pneumoniae subsp. pneumoniae GD4 Meng LIU (Mia), Oliver He PacBio Asia;China ST23;KL1 NZ_CP026011 unpublished Klebsiella pneumoniae K2044 Meng LIU (Mia), Oliver He human;urine PacBio Asia;China ST11;KL47 NZ_CP026130 unpublished Klebsiella pneumoniae F1 Meng LIU (Mia), Oliver He human;sputum PacBio Asia;China ST11;KL47 NZ_CP026132 unpublished Klebsiella pneumoniae F5 Meng LIU (Mia), Oliver He human;bile PacBio Asia;China ST11;KL47 NZ_CP026136 unpublished Klebsiella pneumoniae F77 Meng LIU (Mia), Oliver He human;ascites PacBio Asia;China ST11;KL47 NZ_CP026140 unpublished Klebsiella pneumoniae F127 Meng LIU (Mia), Oliver He human;end of the catheter PacBio Asia;China ST11;KL47 NZ_CP026145 unpublished Klebsiella pneumoniae F132 Meng LIU (Mia), Oliver He human;blood PacBio Asia;China ST11;KL47 NZ_CP026149 unpublished Klebsiella pneumoniae F138 Meng LIU (Mia), Oliver He human;sputum PacBio Asia;China ST11;KL15 NZ_CP026155 unpublished Klebsiella pneumoniae B12(AN) Meng LIU (Mia), Oliver He Env;wastewater pipe PacBio RSII North America;USA ST252;KL81 NZ_CP026177 10.1128/mBio.02011-17 Klebsiella pneumoniae KPNIH50 Meng LIU (Mia), Oliver He Env;suldge, wastewater pipe PacBio RSII North America;USA ST252;KL81 NZ_CP026392 10.1128/mBio.02011-17 Klebsiella pneumoniae KPNIH48 Meng LIU (Mia), Oliver He human;secreta Illumina HiSeq; MiniION Asia;China ST11;KL64 NZ_CP026585 unpublished Klebsiella pneumoniae WCHKP649 Meng LIU (Mia), Oliver He human;stool Illumina MiSeq/ ONT MiniION Europe;Greece ST11;KL15 NZ_CP027036 unpublished Klebsiella pneumoniae 16_GR_13 Meng LIU (Mia), Oliver He human;stool Illumina MiSeq/ ONT MiniION Europe;Greece ST258;KL106 NZ_CP027048 32016399 Klebsiella pneumoniae 20_GR_12 Meng LIU (Mia), Oliver He human;urine Illumina MiSeq/ ONT MiniION Europe;Greece ST258;KL106 NZ_CP027053 unpublished Klebsiella pneumoniae 2_GR_12 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL47 NZ_CP027068 unpublished Klebsiella pneumoniae WCHKP8F4 Meng LIU (Mia), Oliver He Pacbio; Illumina ST258;KL63 NZ_CP027146 unpublished Klebsiella pneumoniae AR_0363 Meng LIU (Mia), Oliver He Pacbio; Illumina ST258;KL106 NZ_CP027160 unpublished Klebsiella pneumoniae AR_0361 Meng LIU (Mia), Oliver He human;wound PacBio; Illumina HiSeq Asia;China ST23;KL1 NZ_CP027189 unpublished Klebsiella pneumoniae KPHS1249 Meng LIU (Mia), Oliver He PacBio ST258;KL107 NZ_CP027697 unpublished Klebsiella pneumoniae KP30835 Meng LIU (Mia), Oliver He PacBio Europe;Denmark ST512;KL107 NZ_CP028180 unpublished Klebsiella pneumoniae CFSAN054110 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST36;KL62 NZ_CP028391 unpublished Klebsiella pneumoniae WCHKP13F2 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL64 NZ_CP028542 unpublished Klebsiella pneumoniae WCHKP2 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL47 NZ_CP028548 30962338 Klebsiella pneumoniae subsp. pneumoniae SCKP020143 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL64 NZ_CP028583 unpublished Klebsiella pneumoniae WCHKP36 Meng LIU (Mia), Oliver He human;sputum PacBio; Illumina HiSeq Asia;China ST15;KL28 NZ_CP028716 https://doi.org/10.1016/j.diagmicrobio.2018.11.007 Klebsiella pneumoniae SCM96 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL39 NZ_CP028783 unpublished Klebsiella pneumoniae subsp. pneumoniae SCKP020046 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL47 NZ_CP028793 unpublished Klebsiella pneumoniae WCHKP020030 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL47 NZ_CP028797 unpublished Klebsiella pneumoniae WCHKP040035 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL15 NZ_CP028806 unpublished Klebsiella pneumoniae WCHKP7E2 Meng LIU (Mia), Oliver He human;amniotic fluid Illumina MiSeq; MiniION Europe;Spain ST405;KL151 NZ_CP028816 unpublished Klebsiella pneumoniae Kp589 Meng LIU (Mia), Oliver He PacBio RSII ST14;KL2 NZ_CP028932 unpublished Klebsiella pneumoniae AR_0153 Meng LIU (Mia), Oliver He PacBio RSII ST11;KL64 NZ_CP028994 unpublished Klebsiella pneumoniae AR_0079 Meng LIU (Mia), Oliver He Pacbio; Illumina ST512;KL107 NZ_CP029099 unpublished Klebsiella pneumoniae AR438 Meng LIU (Mia), Oliver He human;feces PacBio Asia;China ST11;KL64 NZ_CP029220 unpublished Klebsiella pneumoniae L388 Meng LIU (Mia), Oliver He human;feces PacBio Asia;China ST11;KL47 NZ_CP029226 unpublished Klebsiella pneumoniae L491 Meng LIU (Mia), Oliver He llumina HiSeq; MiniION Asia;China ST11;KL64 NZ_CP029384 unpublished Klebsiella pneumoniae subsp. pneumoniae SCKP020079 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST48;KL62 NZ_CP029388 unpublished Klebsiella pneumoniae subsp. pneumoniae SCKP040074 Meng LIU (Mia), Oliver He PacBio; Illumina MiSeq Europe;Sweden ST147;KL64 NZ_CP029582 30742072 Klebsiella pneumoniae DA33140 Meng LIU (Mia), Oliver He human;urine PacBio; Illumina MiSeq Asia;China Taiwan ST11;KL47 NZ_CP029689 unpublished Klebsiella pneumoniae 160111 Meng LIU (Mia), Oliver He PacBio RSII ST16;KL149 NZ_CP029738 unpublished Klebsiella pneumoniae AR_0087 Meng LIU (Mia), Oliver He PacBio Asia;China ST29;KL54 NZ_CP030172 unpublished Klebsiella pneumoniae subsp. pneumoniae 12208 Meng LIU (Mia), Oliver He human;sputum Nanopore MiniION; illumina Asia;China ST1660;KL1 NZ_CP030269 unpublished Klebsiella pneumoniae subsp. pneumoniae SC-7 Meng LIU (Mia), Oliver He Pacbio; Illumina ST258;KL107 NZ_CP030341 unpublished Klebsiella pneumoniae AR_362 Meng LIU (Mia), Oliver He human;Blood Oxford Nanopore MiniION; Illumina Europe;UK ST101;KL62 NZ_CP031368 unpublished Klebsiella pneumoniae KpvST101_OXA-48 Meng LIU (Mia), Oliver He human;stool PacBio Asia;China ST726;KL14 NZ_CP031562 30662878 Klebsiella pneumoniae 2-1 Meng LIU (Mia), Oliver He Illumina HiSeq; MiniION Asia;China ST11;KL64 NZ_CP031721 unpublished Klebsiella pneumoniae WCHKP3 Meng LIU (Mia), Oliver He Nanopore MiniION; Illumina HiSeq ST45;KL24 NZ_CP031795 unpublished Klebsiella pneumoniae INF125-sc-2279943 Meng LIU (Mia), Oliver He human;urine Illumina; PacBio Asia;china ST11;KL64 NZ_CP032163 unpublished Klebsiella pneumoniae XJ-K1 Meng LIU (Mia), Oliver He PacBio RSII ST2938;KL107 NZ_CP032167 unpublished Klebsiella pneumoniae AR_0076 Meng LIU (Mia), Oliver He PacBio RSII ST36;KL27 NZ_CP032175 unpublished Klebsiella pneumoniae AR_0160 Meng LIU (Mia), Oliver He PacBio RSII ST101;KL17 NZ_CP032178 unpublished Klebsiella pneumoniae AR_0135 Meng LIU (Mia), Oliver He PacBio RSII ST16;KL51 NZ_CP032185 unpublished Klebsiella pneumoniae AR_0075 Meng LIU (Mia), Oliver He human;blood Illumina; PacBio Asia;China ST11;KL64 NZ_CP032240 unpublished Klebsiella pneumoniae XJ-K2 Meng LIU (Mia), Oliver He Oxford Nanopore MiniION ST91;KL4 NZ_CP032833 unpublished Klebsiella pneumoniae INF237 Meng LIU (Mia), Oliver He Illumina Asia;China ST11;KL64 NZ_CP033242 unpublished Klebsiella pneumoniae 675920 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL64 NZ_CP033396 unpublished Klebsiella pneumoniae WCHKP015625 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL64 NZ_CP033405 unpublished Klebsiella pneumoniae WCHKP115069 Meng LIU (Mia), Oliver He human;rectal swab Illumina MiSeq; PacBio RSII Europe;Italy ST1685;KL17 NZ_CP033625 unpublished Klebsiella pneumoniae 4743 Meng LIU (Mia), Oliver He human;UCC isolate Pacbio; Illumina ST252;KL116 NZ_CP033756 https://doi.org/10.1038/s41467-019-11306-6 Klebsiella pneumoniae FDAARGOS_566 Meng LIU (Mia), Oliver He human;Bronchoalveolar lavage from right lung Pacbio; Illumina North America;USA ST25;KL2 NZ_CP033777 https://doi.org/10.1038/s41467-019-11306-7 Klebsiella pneumoniae FDAARGOS_531 Meng LIU (Mia), Oliver He human;stool PacBio Sequel Asia;China ST11;KL64 NZ_CP033954 32576652 Klebsiella pneumoniae L39_2 Meng LIU (Mia), Oliver He human;stool PacBio Sequel Asia;China ST11;KL47 NZ_CP033960 32576652 Klebsiella pneumoniae L482 Meng LIU (Mia), Oliver He human;miscellaneous body fluid Illumina NextSeq; Oxford Nanopore North America;USA ST395;KL2 NZ_CP034039 submitted Klebsiella pneumoniae subsp. pneumoniae CRK0298 Meng LIU (Mia), Oliver He human;blood Illumina Europe;Norway ST15;KL24 NZ_CP034045 unpublished Klebsiella pneumoniae KP_NORM_BLD_2014_104014 Meng LIU (Mia), Oliver He human;blood Illumina Europe;Norway ST15;KL24 NZ_CP034053 unpublished Klebsiella pneumoniae KP_NORM_BLD_2015_112126 Meng LIU (Mia), Oliver He human;blood Illumina; MiniION Asia;China ST15;KL19 NZ_CP034076 unpublished Klebsiella pneumoniae KP17-15 Meng LIU (Mia), Oliver He human;sputum Illumina; MiniION Asia;China ST15;KL19 NZ_CP034077 unpublished Klebsiella pneumoniae KP17-16 Meng LIU (Mia), Oliver He Illumina; MiniION Asia;China ST23;KL1 NZ_CP034082 unpublished Klebsiella pneumoniae subsp. pneumoniae R210-2 Meng LIU (Mia), Oliver He human;respiratory tract Oxford Nanopore GridION; Illumina HiSeq Asia;China ST11;KL64 NZ_CP034123 unpublished Klebsiella pneumoniae BJCFK909 Meng LIU (Mia), Oliver He human;urine PacBio; Illumina Asia;China ST11;KL112 NZ_CP034249 unpublished Klebsiella pneumoniae KP18-29 Meng LIU (Mia), Oliver He human;blood Illumina Asia;China ST11;KL47 NZ_CP034327 unpublished Klebsiella pneumoniae isolate KSH203 Meng LIU (Mia), Oliver He human;sputum PacBio Asia;Thailand ST14;KL2 NZ_CP034408 unpublished Klebsiella pneumoniae NH34 Meng LIU (Mia), Oliver He human;blood PacBio RSII Asia;China ST11;KL64 NZ_CP034415 31713615 Klebsiella pneumoniae C789 Meng LIU (Mia), Oliver He human;Bronchoalveolar lavage fluid PacBio RSII Asia;China ST11;KL64 NZ_CP034420 31713615 Klebsiella pneumoniae C1398 Meng LIU (Mia), Oliver He human;blood Oxford Nanopore MiniION Asia;China ST437;KL107 NZ_CP034760 32724486 Klebsiella pneumoniae NB5306 Meng LIU (Mia), Oliver He human;rectal swab Illumina NextSeq North America;Canada ST86;KL2 NZ_CP034778 30988151 Klebsiella pneumoniae 18CPO060 Meng LIU (Mia), Oliver He human;blood Oxford Nanopore MiniION; IonTorrent Asia;India ST101;KL17 NZ_CP035179 unpublished Klebsiella pneumoniae BA33875 Meng LIU (Mia), Oliver He human;blood PacBio RSII Asia;China ST23;KL1 NZ_CP035383 unpublished Klebsiella pneumoniae AP8555 Meng LIU (Mia), Oliver He human;anal sample PacBio RSII North America;Canada ST11;KL24 NZ_CP035540 unpublished Klebsiella pneumoniae subsp. pneumoniae CCRI-22199 Meng LIU (Mia), Oliver He human;blood IonTorrent; Oxford Nanopore MiniION Asia;India ST15;KL24 NZ_CP036187 unpublished Klebsiella pneumoniae BA1559 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL64 NZ_CP036300 unpublished Klebsiella pneumoniae subsp. pneumoniae WCHKP015093 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL47 NZ_CP036305 unpublished Klebsiella pneumoniae WCHKP020098 Meng LIU (Mia), Oliver He human;blood IonTorrent; Oxford Nanopore MiniION Asia;India ST231;KL51 NZ_CP036320 unpublished Klebsiella pneumoniae VBA2172 Meng LIU (Mia), Oliver He human;blood Oxford Nanopore MiniION; IonTorrent Asia;India ST231;KL51 NZ_CP036327 unpublished Klebsiella pneumoniae BA28434 Meng LIU (Mia), Oliver He human;blood IonTorrent; Oxford Nanopore MiniION Asia;India ST15;KL24 NZ_CP036335 unpublished Klebsiella pneumoniae BP327 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL64 NZ_CP036361 unpublished Klebsiella pneumoniae WCHKP2080 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL64 NZ_CP036365 unpublished Klebsiella pneumoniae WCHKP115068 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION Asia;China ST11;KL64 NZ_CP036371 unpublished Klebsiella pneumoniae WCHKP020037 Meng LIU (Mia), Oliver He PacBio RSII North America;USA ST45;KL24 NZ_CP036442 unpublished Klebsiella pneumoniae ABFPV Meng LIU (Mia), Oliver He PacBio RSII North America;USA ST340;KL55 NZ_CP036450 unpublished Klebsiella pneumoniae KPNIH45 Meng LIU (Mia), Oliver He human;urine Illumina MiSeq; Oxford Nanopore MiniION North America;USA ST23;KL1 NZ_CP037742 unpublished Klebsiella pneumoniae ST23 Meng LIU (Mia), Oliver He human;blood Illumina MiSeq Asia;India ST11;KL103 NZ_CP037927 10.1016/j.jgar.2019.04.008 Klebsiella pneumoniae CRKP I Meng LIU (Mia), Oliver He human;blood Illumina MiSeq; Oxford Nanopore MiniION Europe;Italy ST258;KL107 NZ_CP037928 unpublished Klebsiella pneumoniae subsp. pneumoniae KP-8788 Meng LIU (Mia), Oliver He human;pus PacBio RSII + Illumina NextSeq Asia;China ST11;KL64 NZ_CP039808 31911273 Klebsiella pneumoniae C2660 Meng LIU (Mia), Oliver He human;urine PacBio RSII + Illumina NextSeq Asia;China ST11;KL47 NZ_CP039819 31911273 Klebsiella pneumoniae C2414 Meng LIU (Mia), Oliver He human;blood Oxford Nanopore PromethION North America;USA -;KL107 NZ_CP039968 unpublished Klebsiella pneumoniae R1701 Meng LIU (Mia), Oliver He human;bronchoalveolar lavage Oxford Nanopore PromethION North America;USA -;KL107 NZ_CP039974 unpublished Klebsiella pneumoniae R1761 Meng LIU (Mia), Oliver He human;sputum Illumina HiSeq; PacBio Asia;China ST11;KL47 NZ_CP040122 unpublished Klebsiella pneumoniae LSH-KPN148 Meng LIU (Mia), Oliver He human;sputum Illumina HiSeq; PacBio Asia;China ST11;KL105 NZ_CP040391 unpublished Klebsiella pneumoniae LSH-KPN25 Meng LIU (Mia), Oliver He human;blood Illumina NextSeq 500 Asia;China ST11;KL47 NZ_CP040533 unpublished Klebsiella pneumoniae CR-HvKP1 Meng LIU (Mia), Oliver He human;blood Illumina NextSeq 500 Asia;China ST11;KL47 NZ_CP040539 unpublished Klebsiella pneumoniae CR-HvKP4 Meng LIU (Mia), Oliver He human;blood Illumina NextSeq 500 Asia;China ST11;KL47 NZ_CP040545 unpublished Klebsiella pneumoniae CR-HvKP5 Meng LIU (Mia), Oliver He human;rectal swab Oxford Nanopore MiniION; Illumina HiSeq Europe;UK ST147;KL64 NZ_CP040724 unpublished Klebsiella pneumoniae KpvST147B_SE1_1_NDM Meng LIU (Mia), Oliver He Pacbio; Illumina North America;USA ST3;KL3 NZ_CP040993 unpublished Klebsiella pneumoniae FDAARGOS_775 Meng LIU (Mia), Oliver He Illumina HiSeq; Oxford Nanopore MiniION ST101;KL17 NZ_CP041082 unpublished Klebsiella pneumoniae Kp202 Meng LIU (Mia), Oliver He human;urine Oxford Nanopore GridION; Illumina NextSeq Asia;China ST11;KL64 NZ_CP041373 unpublished Klebsiella pneumoniae KP58 Meng LIU (Mia), Oliver He human;gut Oxford Nanopore Asia;China ST1779;KL38 NZ_CP041644 32582117 Klebsiella pneumoniae NKU_Kleb8A7 Meng LIU (Mia), Oliver He human;urine PacBio RSII Asia;China ST1;KL45 NZ_CP042858 unpublished Klebsiella pneumoniae QD23 Meng LIU (Mia), Oliver He human;sputum PacBio RS North America;USA ST258;KL107 NZ_CP043047 10.1128/mBio.01945-19 Klebsiella pneumoniae KLP268 Meng LIU (Mia), Oliver He Illumina NextSeq Europe;France ST512;KL107 NZ_CP043969 unpublished Klebsiella pneumoniae D1 Meng LIU (Mia), Oliver He human;clinical sample Pacbio; Illumina North America;USA ST231;KL51 NZ_CP044047 unpublished Klebsiella pneumoniae FDAARGOS_629 Meng LIU (Mia), Oliver He human;urine Oxford Nanopore GridION; Illumina NextSeq Asia;China ST11;KL47 NZ_CP044258 unpublished Klebsiella pneumoniae KP65 Meng LIU (Mia), Oliver He human;blood Illumina MiSeq; Oxford Nanopore Asia;Japan ST25;KL2 NZ_CP045661 unpublished Klebsiella pneumoniae SMU18037509 Meng LIU (Mia), Oliver He human;blood PacBio RSII; Illumina MiSeq North America;USA -;KL20 NZ_CP045694 unpublished Klebsiella pneumoniae TK421 Meng LIU (Mia), Oliver He human;blood Illumina HiSeq; PacBio Asia;China ST11;KL47 NZ_CP047160 unpublished Klebsiella pneumoniae KP19-2029 Meng LIU (Mia), Oliver He human;urine PacBio Asia;China ST11;KL64 NZ_CP047192 32156053 Klebsiella pneumoniae Kp36 Meng LIU (Mia), Oliver He chicken;feces Oxford Nanopore MiniION; Illumina HiSeq Asia;China ST395;KL102 NZ_CP047336 32606828 Klebsiella pneumoniae 2019036D Meng LIU (Mia), Oliver He human;blood PacBio RSII Asia;China ST1027;KL20 NZ_CP047633 unpublished Klebsiella pneumoniae K2606 Meng LIU (Mia), Oliver He human;feces Illumina; PacBio Asia;China ST11;KL47 NZ_CP047648 unpublished Klebsiella pneumoniae 156070 Meng LIU (Mia), Oliver He human;blood Illumina HiSeq; PacBio Asia;China ST11;KL47 NZ_CP047649 unpublished Klebsiella pneumoniae 158590 Meng LIU (Mia), Oliver He human;liver abscess Illumina HiSeq Asia;Korea ST23;KL1 NZ_CP047675 submitted Klebsiella pneumoniae subsp. pneumoniae KUH-KPNHVL1 Meng LIU (Mia), Oliver He human;feces Illumina HiSeq Asia;Korea ST23;KL1 NZ_CP047677 submitted Klebsiella pneumoniae subsp. pneumoniae KUH-KPNHVF1 Meng LIU (Mia), Oliver He human;urine Illumina; PacBio Asia;China ST11;KL64 NZ_CP048430 submitted Klebsiella pneumoniae KP18-3-8 Meng LIU (Mia), Oliver He PacBio Sequel North America;USA ST784;KL146 NZ_CP049604 unpublished Klebsiella pneumoniae Kp8701 Meng LIU (Mia), Oliver He shotgun ST66;KL2 NZ_FO834906 25341126 Klebsiella pneumoniae str. Kp52.145 Meng LIU (Mia), Oliver He ST258;KL106 NZ_LR130548 submitted Klebsiella pneumoniae KPC2 Meng LIU (Mia), Oliver He human;feces Europe;UK ST639;KL105 NZ_LR607362 submitted Klebsiella pneumoniae 4928STDY7387736 Meng LIU (Mia), Oliver He human;feces Europe;UK ST35;KL22 NZ_LR607368 submitted Klebsiella pneumoniae 4928STDY7387808 Meng LIU (Mia), Oliver He Europe;France ST86;KL2 NZ_LR745042 submitted Klebsiella pneumoniae kpn154 Meng LIU (Mia), Oliver He ST258;KL106 NZ_LT216436 submitted Klebsiella pneumoniae isolate 207M1D0-sc-2013-04-03T11:21:06Z-1606409 Meng LIU (Mia), Oliver He 1336 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1336 59353 bp CP029216 50.02[57.42] 4155687..4215039 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnL201-1 the integration and excision module of ICE ICEKpnL201-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL201-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnL201-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL201-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnL201-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL201-1 IEM for excision the conjugation module of ICE ICEKpnL201-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL201-1 CM the regulation module of ICE ICEKpnL201-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL201-1 RM the accessory module of ICE ICEKpnL201-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL201-1 AM Meng LIU (Mia), Oliver He 1136 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1136 92344 bp CP034316 50.7[57.14] 4450090..4542433 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn6-1 the integration and excision module of ICE ICEKpn6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn6-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn6-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn6-1 IEM for excision the conjugation module of ICE ICEKpn6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn6-1 CM the regulation module of ICE ICEKpn6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn6-1 RM the accessory module of ICE ICEKpn6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn6-1 AM Meng LIU (Mia), Oliver He 1308 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1308 54943 bp CP040023 50.13[57.26] 739334..794276 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1093/jac/dkz431 ICEKpnKPC160132-1 the integration and excision module of ICE ICEKpnKPC160132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160132-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPC160132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160132-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPC160132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160132-1 IEM for excision the conjugation module of ICE ICEKpnKPC160132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160132-1 CM the regulation module of ICE ICEKpnKPC160132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160132-1 RM the accessory module of ICE ICEKpnKPC160132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160132-1 AM Meng LIU (Mia), Oliver He 1305 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1305 54943 bp CP040028 50.13[57.28] 739321..794263 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1093/jac/dkz431 ICEKpnKPC160121-1 the integration and excision module of ICE ICEKpnKPC160121-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160121-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPC160121-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160121-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPC160121-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160121-1 IEM for excision the conjugation module of ICE ICEKpnKPC160121-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160121-1 CM the regulation module of ICE ICEKpnKPC160121-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160121-1 RM the accessory module of ICE ICEKpnKPC160121-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160121-1 AM Meng LIU (Mia), Oliver He 1304 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1304 54943 bp CP040033 50.13[57.28] 739321..794263 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1093/jac/dkz431 ICEKpnKPC160117-1 the integration and excision module of ICE ICEKpnKPC160117-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160117-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPC160117-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160117-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPC160117-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160117-1 IEM for excision the conjugation module of ICE ICEKpnKPC160117-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160117-1 CM the regulation module of ICE ICEKpnKPC160117-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160117-1 RM the accessory module of ICE ICEKpnKPC160117-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160117-1 AM Meng LIU (Mia), Oliver He 1306 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1306 92344 bp CP040038 50.7[57.26] 2382004..2474347 putative ICE predicted with ICEfinder https://doi.org/10.1093/jac/dkz431 ICEKpnKPC160125-1 the integration and excision module of ICE ICEKpnKPC160125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPC160125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPC160125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-1 IEM for excision the conjugation module of ICE ICEKpnKPC160125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-1 CM the regulation module of ICE ICEKpnKPC160125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-1 RM the accessory module of ICE ICEKpnKPC160125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-1 AM Meng LIU (Mia), Oliver He 1307 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1307 58048 bp CP040038 49.94[57.26] 3572404..3630451 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1093/jac/dkz431 ICEKpnKPC160125-2 the integration and excision module of ICE ICEKpnKPC160125-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPC160125-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPC160125-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-2 IEM for excision the conjugation module of ICE ICEKpnKPC160125-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-2 CM the regulation module of ICE ICEKpnKPC160125-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-2 RM the accessory module of ICE ICEKpnKPC160125-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC160125-2 AM Meng LIU (Mia), Oliver He 1282 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1282 56142 bp CP048933 50.2[57.3] 744196..800337 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP18-2079-1 the integration and excision module of ICE ICEKpnKP18-2079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-2079-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP18-2079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-2079-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP18-2079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-2079-1 IEM for excision the conjugation module of ICE ICEKpnKP18-2079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-2079-1 CM the regulation module of ICE ICEKpnKP18-2079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-2079-1 RM the accessory module of ICE ICEKpnKP18-2079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-2079-1 AM Meng LIU (Mia), Oliver He 1360 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1360 79158 bp NC_012731 51.41[57.68] 566022..645179 putative ICE predicted with ICEfinder tRNA 19447910 ICEKpnNTUH-K2044-1 the integration and excision module of ICE ICEKpnNTUH-K2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNTUH-K2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNTUH-K2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-1 IEM for excision the conjugation module of ICE ICEKpnNTUH-K2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-1 CM the regulation module of ICE ICEKpnNTUH-K2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-1 RM the accessory module of ICE ICEKpnNTUH-K2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-1 AM Meng LIU (Mia), Oliver He 126 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=126 76208 bp NC_012731 52.16[57.68] 3395820..3472027 putative ICE predicted with ICEfinder 19447910 ICEKpnNTUH-K2044-2 the integration and excision module of ICE ICEKpnNTUH-K2044-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNTUH-K2044-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNTUH-K2044-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-2 IEM for excision the conjugation module of ICE ICEKpnNTUH-K2044-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-2 CM the regulation module of ICE ICEKpnNTUH-K2044-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-2 RM the accessory module of ICE ICEKpnNTUH-K2044-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNTUH-K2044-2 AM Meng LIU (Mia), Oliver He 180 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=180 62166 bp NC_016845 52.46[57.48] 3433540..3495705 putative ICE predicted with ICEfinder tRNA 22408243 ICEKpnHS11286-1 the integration and excision module of ICE ICEKpnHS11286-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnHS11286-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnHS11286-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-1 IEM for excision the conjugation module of ICE ICEKpnHS11286-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-1 CM the regulation module of ICE ICEKpnHS11286-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-1 RM the accessory module of ICE ICEKpnHS11286-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-1 AM Meng LIU (Mia), Oliver He 437 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=437 56016 bp NC_016845 50.17[57.48] 4502798..4558813 putative ICE predicted with ICEfinder tRNA 22408243 ICEKpnHS11286-2 the integration and excision module of ICE ICEKpnHS11286-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnHS11286-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnHS11286-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-2 IEM for excision the conjugation module of ICE ICEKpnHS11286-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-2 CM the regulation module of ICE ICEKpnHS11286-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-2 RM the accessory module of ICE ICEKpnHS11286-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS11286-2 AM Meng LIU (Mia), Oliver He 1242 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1242 274275 bp NC_018522 53.3[57.41] 1608318..1882592 putative ICE predicted with ICEfinder 23105059 ICEKpn1084-1 the integration and excision module of ICE ICEKpn1084-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn1084-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn1084-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-1 IEM for excision the conjugation module of ICE ICEKpn1084-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-1 CM the regulation module of ICE ICEKpn1084-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-1 RM the accessory module of ICE ICEKpn1084-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-1 AM Meng LIU (Mia), Oliver He 1243 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1243 79156 bp NC_018522 51.41[57.41] 4708366..4787521 putative ICE predicted with ICEfinder tRNA 23105059 ICEKpn1084-2 the integration and excision module of ICE ICEKpn1084-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn1084-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn1084-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-2 IEM for excision the conjugation module of ICE ICEKpn1084-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-2 CM the regulation module of ICE ICEKpn1084-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-2 RM the accessory module of ICE ICEKpn1084-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1084-2 AM Meng LIU (Mia), Oliver He 1257 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1257 54943 bp NC_022082 50.12[57.53] 780389..835331 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnJM45-1 the integration and excision module of ICE ICEKpnJM45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJM45-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnJM45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJM45-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnJM45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJM45-1 IEM for excision the conjugation module of ICE ICEKpnJM45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJM45-1 CM the regulation module of ICE ICEKpnJM45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJM45-1 RM the accessory module of ICE ICEKpnJM45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJM45-1 AM Meng LIU (Mia), Oliver He 1238 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1238 55718 bp NZ_AP018671 50.15[57.41] 745723..801440 putative ICE predicted with ICEfinder tRNA 30232165 ICEKpnGSU10-3DNA-1 the integration and excision module of ICE ICEKpnGSU10-3DNA-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGSU10-3DNA-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnGSU10-3DNA-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGSU10-3DNA-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnGSU10-3DNA-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGSU10-3DNA-1 IEM for excision the conjugation module of ICE ICEKpnGSU10-3DNA-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGSU10-3DNA-1 CM the regulation module of ICE ICEKpnGSU10-3DNA-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGSU10-3DNA-1 RM the accessory module of ICE ICEKpnGSU10-3DNA-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGSU10-3DNA-1 AM Meng LIU (Mia), Oliver He 1260 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1260 64261 bp NZ_AP021880 51.91[57.28] 1865136..1929396 putative ICE predicted with ICEfinder unpublished ICEKpnJUNP254-1 the integration and excision module of ICE ICEKpnJUNP254-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJUNP254-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnJUNP254-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJUNP254-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnJUNP254-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJUNP254-1 IEM for excision the conjugation module of ICE ICEKpnJUNP254-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJUNP254-1 CM the regulation module of ICE ICEKpnJUNP254-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJUNP254-1 RM the accessory module of ICE ICEKpnJUNP254-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJUNP254-1 AM Meng LIU (Mia), Oliver He 1174 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1174 58048 bp NZ_CP006659 49.94[57.29] 4603840..4661887 putative ICE predicted with ICEfinder tRNA 24905728 ICEKpnATCCBAA-2146-1 the integration and excision module of ICE ICEKpnATCCBAA-2146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnATCCBAA-2146-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnATCCBAA-2146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnATCCBAA-2146-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnATCCBAA-2146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnATCCBAA-2146-1 IEM for excision the conjugation module of ICE ICEKpnATCCBAA-2146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnATCCBAA-2146-1 CM the regulation module of ICE ICEKpnATCCBAA-2146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnATCCBAA-2146-1 RM the accessory module of ICE ICEKpnATCCBAA-2146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnATCCBAA-2146-1 AM Meng LIU (Mia), Oliver He 1369 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1369 109090 bp NZ_CP006722 53.78[57.23] 1886399..1995488 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn1158-1 the integration and excision module of ICE ICEKpn1158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1158-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn1158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1158-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn1158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1158-1 IEM for excision the conjugation module of ICE ICEKpn1158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1158-1 CM the regulation module of ICE ICEKpn1158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1158-1 RM the accessory module of ICE ICEKpn1158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn1158-1 AM Meng LIU (Mia), Oliver He 1239 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1239 62182 bp NZ_CP006738 52.34[57.49] 1804046..1866227 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnHK787-1 the integration and excision module of ICE ICEKpnHK787-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHK787-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnHK787-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHK787-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnHK787-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHK787-1 IEM for excision the conjugation module of ICE ICEKpnHK787-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHK787-1 CM the regulation module of ICE ICEKpnHK787-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHK787-1 RM the accessory module of ICE ICEKpnHK787-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHK787-1 AM Meng LIU (Mia), Oliver He 1128 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1128 54943 bp NZ_CP006918 50.12[57.46] 786130..841072 putative ICE predicted with ICEfinder tRNA 24639510 ICEKpn30684/NJST258_2-1 the integration and excision module of ICE ICEKpn30684/NJST258_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30684/NJST258_2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn30684/NJST258_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30684/NJST258_2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn30684/NJST258_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30684/NJST258_2-1 IEM for excision the conjugation module of ICE ICEKpn30684/NJST258_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30684/NJST258_2-1 CM the regulation module of ICE ICEKpn30684/NJST258_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30684/NJST258_2-1 RM the accessory module of ICE ICEKpn30684/NJST258_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30684/NJST258_2-1 AM Meng LIU (Mia), Oliver He 1127 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1127 56630 bp NZ_CP006923 50.27[57.42] 740709..797338 putative ICE predicted with ICEfinder tRNA 24639510 ICEKpn30660/NJST258_1-1 the integration and excision module of ICE ICEKpn30660/NJST258_1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30660/NJST258_1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn30660/NJST258_1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30660/NJST258_1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn30660/NJST258_1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30660/NJST258_1-1 IEM for excision the conjugation module of ICE ICEKpn30660/NJST258_1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30660/NJST258_1-1 CM the regulation module of ICE ICEKpn30660/NJST258_1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30660/NJST258_1-1 RM the accessory module of ICE ICEKpn30660/NJST258_1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn30660/NJST258_1-1 AM Meng LIU (Mia), Oliver He 1314 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1314 59248 bp NZ_CP007727 50.01[57.42] 4563040..4622287 putative ICE predicted with ICEfinder tRNA 22914622 ICEKpnKPNIH10-1 the integration and excision module of ICE ICEKpnKPNIH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH10-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH10-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH10-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH10-1 CM the regulation module of ICE ICEKpnKPNIH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH10-1 RM the accessory module of ICE ICEKpnKPNIH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH10-1 AM Meng LIU (Mia), Oliver He 1316 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1316 54943 bp NZ_CP008797 50.12[57.36] 1291855..1346797 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKPNIH24-1 the integration and excision module of ICE ICEKpnKPNIH24-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH24-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH24-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH24-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH24-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH24-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH24-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH24-1 CM the regulation module of ICE ICEKpnKPNIH24-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH24-1 RM the accessory module of ICE ICEKpnKPNIH24-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH24-1 AM Meng LIU (Mia), Oliver He 1315 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1315 59248 bp NZ_CP008827 50.01[57.42] 4561833..4621080 putative ICE predicted with ICEfinder tRNA 22914622 ICEKpnKPNIH1-1 the integration and excision module of ICE ICEKpnKPNIH1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH1-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH1-1 CM the regulation module of ICE ICEKpnKPNIH1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH1-1 RM the accessory module of ICE ICEKpnKPNIH1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH1-1 AM Meng LIU (Mia), Oliver He 1326 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1326 58048 bp NZ_CP008831 49.94[57.44] 4479482..4537529 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKPR0928-1 the integration and excision module of ICE ICEKpnKPR0928-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPR0928-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPR0928-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPR0928-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPR0928-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPR0928-1 IEM for excision the conjugation module of ICE ICEKpnKPR0928-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPR0928-1 CM the regulation module of ICE ICEKpnKPR0928-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPR0928-1 RM the accessory module of ICE ICEKpnKPR0928-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPR0928-1 AM Meng LIU (Mia), Oliver He 1368 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1368 120697 bp NZ_CP008929 53.57[57.43] 5176327..5297023 putative ICE predicted with ICEfinder 25267672 ICEKpnPMK1-1 the integration and excision module of ICE ICEKpnPMK1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnPMK1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnPMK1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnPMK1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnPMK1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnPMK1-1 IEM for excision the conjugation module of ICE ICEKpnPMK1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnPMK1-1 CM the regulation module of ICE ICEKpnPMK1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnPMK1-1 RM the accessory module of ICE ICEKpnPMK1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnPMK1-1 AM Meng LIU (Mia), Oliver He 1365 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1365 57990 bp NZ_CP009114 50.22[57.47] 2675897..2733886 putative ICE predicted with ICEfinder tRNA 24798270 ICEKpnNZ_CP009114-1 the integration and excision module of ICE ICEKpnNZ_CP009114-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP009114-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNZ_CP009114-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP009114-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNZ_CP009114-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP009114-1 IEM for excision the conjugation module of ICE ICEKpnNZ_CP009114-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP009114-1 CM the regulation module of ICE ICEKpnNZ_CP009114-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP009114-1 RM the accessory module of ICE ICEKpnNZ_CP009114-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP009114-1 AM Meng LIU (Mia), Oliver He 1320 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1320 137650 bp NZ_CP009771 52.23[57.27] 3473517..3611166 putative ICE predicted with ICEfinder tRNA 25232178 ICEKpnKPNIH33-1 the integration and excision module of ICE ICEKpnKPNIH33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-1 CM the regulation module of ICE ICEKpnKPNIH33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-1 RM the accessory module of ICE ICEKpnKPNIH33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-1 AM Meng LIU (Mia), Oliver He 1321 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1321 58722 bp NZ_CP009771 50.06[57.27] 4725904..4784625 putative ICE predicted with ICEfinder tRNA 25232178 ICEKpnKPNIH33-2 the integration and excision module of ICE ICEKpnKPNIH33-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH33-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH33-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-2 IEM for excision the conjugation module of ICE ICEKpnKPNIH33-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-2 CM the regulation module of ICE ICEKpnKPNIH33-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-2 RM the accessory module of ICE ICEKpnKPNIH33-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH33-2 AM Meng LIU (Mia), Oliver He 1318 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1318 133023 bp NZ_CP009775 52.08[57.28] 3429929..3562951 putative ICE predicted with ICEfinder tRNA 25232178 ICEKpnKPNIH32-1 the integration and excision module of ICE ICEKpnKPNIH32-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH32-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH32-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH32-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-1 CM the regulation module of ICE ICEKpnKPNIH32-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-1 RM the accessory module of ICE ICEKpnKPNIH32-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-1 AM Meng LIU (Mia), Oliver He 1319 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1319 58048 bp NZ_CP009775 49.94[57.28] 4681924..4739971 putative ICE predicted with ICEfinder tRNA 25232178 ICEKpnKPNIH32-2 the integration and excision module of ICE ICEKpnKPNIH32-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH32-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH32-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-2 IEM for excision the conjugation module of ICE ICEKpnKPNIH32-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-2 CM the regulation module of ICE ICEKpnKPNIH32-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-2 RM the accessory module of ICE ICEKpnKPNIH32-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH32-2 AM Meng LIU (Mia), Oliver He 1317 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1317 58048 bp NZ_CP009872 49.94[57.44] 4475595..4533642 putative ICE predicted with ICEfinder tRNA 25232178 ICEKpnKPNIH30-1 the integration and excision module of ICE ICEKpnKPNIH30-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH30-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH30-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH30-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH30-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH30-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH30-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH30-1 CM the regulation module of ICE ICEKpnKPNIH30-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH30-1 RM the accessory module of ICE ICEKpnKPNIH30-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH30-1 AM Meng LIU (Mia), Oliver He 1129 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1129 54943 bp NZ_CP010361 50.12[57.43] 740485..795427 putative ICE predicted with ICEfinder tRNA submitted ICEKpn32192-2 the integration and excision module of ICE ICEKpn32192-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn32192-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn32192-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn32192-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn32192-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn32192-2 IEM for excision the conjugation module of ICE ICEKpn32192-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn32192-2 CM the regulation module of ICE ICEKpn32192-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn32192-2 RM the accessory module of ICE ICEKpn32192-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn32192-2 AM Meng LIU (Mia), Oliver He 1130 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1130 54943 bp NZ_CP010392 50.12[57.5] 739242..794184 putative ICE predicted with ICEfinder tRNA submitted ICEKpn34618-1 the integration and excision module of ICE ICEKpn34618-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn34618-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn34618-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn34618-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn34618-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn34618-1 IEM for excision the conjugation module of ICE ICEKpn34618-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn34618-1 CM the regulation module of ICE ICEKpn34618-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn34618-1 RM the accessory module of ICE ICEKpn34618-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn34618-1 AM Meng LIU (Mia), Oliver He 1199 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1199 58049 bp NZ_CP011578 49.94[57.52] 2652535..2710583 putative ICE predicted with ICEfinder tRNA submitted ICEKpnCAV1392-2 the integration and excision module of ICE ICEKpnCAV1392-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1392-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1392-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1392-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1392-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1392-2 IEM for excision the conjugation module of ICE ICEKpnCAV1392-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1392-2 CM the regulation module of ICE ICEKpnCAV1392-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1392-2 RM the accessory module of ICE ICEKpnCAV1392-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1392-2 AM Meng LIU (Mia), Oliver He 1202 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1202 58048 bp NZ_CP011647 49.94[57.39] 348315..406362 putative ICE predicted with ICEfinder tRNA submitted ICEKpnCAV1596-1 the integration and excision module of ICE ICEKpnCAV1596-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1596-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1596-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1596-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1596-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1596-1 IEM for excision the conjugation module of ICE ICEKpnCAV1596-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1596-1 CM the regulation module of ICE ICEKpnCAV1596-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1596-1 RM the accessory module of ICE ICEKpnCAV1596-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1596-1 AM Meng LIU (Mia), Oliver He 1219 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1219 54943 bp NZ_CP011976 50.12[57.36] 739395..794337 putative ICE predicted with ICEfinder tRNA 24913165 ICEKpnDMC1097-1 the integration and excision module of ICE ICEKpnDMC1097-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDMC1097-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnDMC1097-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDMC1097-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnDMC1097-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDMC1097-1 IEM for excision the conjugation module of ICE ICEKpnDMC1097-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDMC1097-1 CM the regulation module of ICE ICEKpnDMC1097-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDMC1097-1 RM the accessory module of ICE ICEKpnDMC1097-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDMC1097-1 AM Meng LIU (Mia), Oliver He 1135 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1135 37063 bp NZ_CP011980 53[57.49] 740488..777550 putative ICE predicted with ICEfinder tRNA 24913165 ICEKpn500_1420-1 the integration and excision module of ICE ICEKpn500_1420-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn500_1420-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn500_1420-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn500_1420-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn500_1420-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn500_1420-1 IEM for excision the conjugation module of ICE ICEKpn500_1420-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn500_1420-1 CM the regulation module of ICE ICEKpn500_1420-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn500_1420-1 RM the accessory module of ICE ICEKpn500_1420-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn500_1420-1 AM Meng LIU (Mia), Oliver He 1399 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1399 57344 bp NZ_CP011985 50.27[57.45] 740488..797831 putative ICE predicted with ICEfinder tRNA submitted ICEKpnUHKPC07-1 the integration and excision module of ICE ICEKpnUHKPC07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC07-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnUHKPC07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC07-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnUHKPC07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC07-1 IEM for excision the conjugation module of ICE ICEKpnUHKPC07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC07-1 CM the regulation module of ICE ICEKpnUHKPC07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC07-1 RM the accessory module of ICE ICEKpnUHKPC07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC07-1 AM Meng LIU (Mia), Oliver He 1400 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1400 56143 bp NZ_CP011989 50.2[57.44] 740482..796624 putative ICE predicted with ICEfinder tRNA 24913165 ICEKpnUHKPC33-1 the integration and excision module of ICE ICEKpnUHKPC33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC33-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnUHKPC33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC33-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnUHKPC33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC33-1 IEM for excision the conjugation module of ICE ICEKpnUHKPC33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC33-1 CM the regulation module of ICE ICEKpnUHKPC33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC33-1 RM the accessory module of ICE ICEKpnUHKPC33-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnUHKPC33-1 AM Meng LIU (Mia), Oliver He 1398 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1398 66223 bp NZ_CP012043 52.36[57.38] 3705864..3772086 putative ICE predicted with ICEfinder 26872343 ICEKpnU25-1 the integration and excision module of ICE ICEKpnU25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnU25-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnU25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnU25-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnU25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnU25-1 IEM for excision the conjugation module of ICE ICEKpnU25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnU25-1 CM the regulation module of ICE ICEKpnU25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnU25-1 RM the accessory module of ICE ICEKpnU25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnU25-1 AM Meng LIU (Mia), Oliver He 1393 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1393 92662 bp NZ_CP012743 44.85[57.03] 787509..880170 putative ICE predicted with ICEfinder tRNA 26968884 ICEKpnTGH8-1 the integration and excision module of ICE ICEKpnTGH8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTGH8-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnTGH8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTGH8-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnTGH8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTGH8-1 IEM for excision the conjugation module of ICE ICEKpnTGH8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTGH8-1 CM the regulation module of ICE ICEKpnTGH8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTGH8-1 RM the accessory module of ICE ICEKpnTGH8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTGH8-1 AM Meng LIU (Mia), Oliver He 1377 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1377 58975 bp NZ_CP014008 53.13[57.5] 3380804..3439778 putative ICE predicted with ICEfinder submitted ICEKpnRJF293-1 the integration and excision module of ICE ICEKpnRJF293-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF293-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnRJF293-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF293-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnRJF293-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF293-1 IEM for excision the conjugation module of ICE ICEKpnRJF293-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF293-1 CM the regulation module of ICE ICEKpnRJF293-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF293-1 RM the accessory module of ICE ICEKpnRJF293-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF293-1 AM Meng LIU (Mia), Oliver He 1378 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1378 80222 bp NZ_CP014010 51.42[57.44] 566442..646663 putative ICE predicted with ICEfinder tRNA submitted ICEKpnRJF999-1 the integration and excision module of ICE ICEKpnRJF999-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnRJF999-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnRJF999-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-1 IEM for excision the conjugation module of ICE ICEKpnRJF999-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-1 CM the regulation module of ICE ICEKpnRJF999-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-1 RM the accessory module of ICE ICEKpnRJF999-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-1 AM Meng LIU (Mia), Oliver He 1379 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1379 137723 bp NZ_CP014010 52.26[57.44] 3470664..3608386 putative ICE predicted with ICEfinder submitted ICEKpnRJF999-2 the integration and excision module of ICE ICEKpnRJF999-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnRJF999-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnRJF999-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-2 IEM for excision the conjugation module of ICE ICEKpnRJF999-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-2 CM the regulation module of ICE ICEKpnRJF999-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-2 RM the accessory module of ICE ICEKpnRJF999-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJF999-2 AM Meng LIU (Mia), Oliver He 1290 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1290 54930 bp NZ_CP014294 50.13[57.41] 692592..747521 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP38731-1 the integration and excision module of ICE ICEKpnKP38731-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP38731-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP38731-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-1 IEM for excision the conjugation module of ICE ICEKpnKP38731-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-1 CM the regulation module of ICE ICEKpnKP38731-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-1 RM the accessory module of ICE ICEKpnKP38731-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-1 AM Meng LIU (Mia), Oliver He 1291 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1291 58180 bp NZ_CP014294 53.13[57.41] 1784338..1842517 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP38731-2 the integration and excision module of ICE ICEKpnKP38731-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP38731-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP38731-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-2 IEM for excision the conjugation module of ICE ICEKpnKP38731-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-2 CM the regulation module of ICE ICEKpnKP38731-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-2 RM the accessory module of ICE ICEKpnKP38731-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP38731-2 AM Meng LIU (Mia), Oliver He 1322 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1322 59248 bp NZ_CP014647 50.01[57.42] 4563123..4622370 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKPNIH36-1 the integration and excision module of ICE ICEKpnKPNIH36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH36-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH36-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH36-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH36-1 CM the regulation module of ICE ICEKpnKPNIH36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH36-1 RM the accessory module of ICE ICEKpnKPNIH36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH36-1 AM Meng LIU (Mia), Oliver He 1141 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1141 64550 bp NZ_CP014755 51.99[57.43] 3402361..3466910 putative ICE predicted with ICEfinder submitted ICEKpnAATZP-1 the integration and excision module of ICE ICEKpnAATZP-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAATZP-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAATZP-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAATZP-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAATZP-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAATZP-1 IEM for excision the conjugation module of ICE ICEKpnAATZP-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAATZP-1 CM the regulation module of ICE ICEKpnAATZP-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAATZP-1 RM the accessory module of ICE ICEKpnAATZP-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAATZP-1 AM Meng LIU (Mia), Oliver He 1364 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1364 56971 bp NZ_CP015385 50.23[57.53] 742492..799462 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnNY9-1 the integration and excision module of ICE ICEKpnNY9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNY9-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNY9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNY9-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNY9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNY9-1 IEM for excision the conjugation module of ICE ICEKpnNY9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNY9-1 CM the regulation module of ICE ICEKpnNY9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNY9-1 RM the accessory module of ICE ICEKpnNY9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNY9-1 AM Meng LIU (Mia), Oliver He 1206 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1206 56249 bp NZ_CP015392 50.2[57.27] 747023..803271 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCR14-1 the integration and excision module of ICE ICEKpnCR14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCR14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCR14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-1 IEM for excision the conjugation module of ICE ICEKpnCR14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-1 CM the regulation module of ICE ICEKpnCR14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-1 RM the accessory module of ICE ICEKpnCR14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-1 AM Meng LIU (Mia), Oliver He 1207 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1207 208236 bp NZ_CP015392 50.16[57.27] 1776406..1984641 putative ICE predicted with ICEfinder unpublished ICEKpnCR14-2 the integration and excision module of ICE ICEKpnCR14-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCR14-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCR14-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-2 IEM for excision the conjugation module of ICE ICEKpnCR14-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-2 CM the regulation module of ICE ICEKpnCR14-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-2 RM the accessory module of ICE ICEKpnCR14-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR14-2 AM Meng LIU (Mia), Oliver He 1387 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1387 58198 bp NZ_CP015500 53.13[57.29] 1658908..1717105 putative ICE predicted with ICEfinder tRNA submitted ICEKpnSKGH01-1 the integration and excision module of ICE ICEKpnSKGH01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSKGH01-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSKGH01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSKGH01-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSKGH01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSKGH01-1 IEM for excision the conjugation module of ICE ICEKpnSKGH01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSKGH01-1 CM the regulation module of ICE ICEKpnSKGH01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSKGH01-1 RM the accessory module of ICE ICEKpnSKGH01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSKGH01-1 AM Meng LIU (Mia), Oliver He 1366 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1366 58048 bp NZ_CP015822 49.94[57.35] 2761319..2819366 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnNZ_CP015822-1 the integration and excision module of ICE ICEKpnNZ_CP015822-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP015822-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNZ_CP015822-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP015822-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNZ_CP015822-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP015822-1 IEM for excision the conjugation module of ICE ICEKpnNZ_CP015822-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP015822-1 CM the regulation module of ICE ICEKpnNZ_CP015822-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP015822-1 RM the accessory module of ICE ICEKpnNZ_CP015822-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNZ_CP015822-1 AM Meng LIU (Mia), Oliver He 1188 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1188 92344 bp NZ_CP015990 50.7[57.37] 1825388..1917731 putative ICE predicted with ICEfinder tRNA-Asn4 submitted ICEKpnBR-1 the integration and excision module of ICE ICEKpnBR-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBR-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBR-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR-1 IEM for excision the conjugation module of ICE ICEKpnBR-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR-1 CM the regulation module of ICE ICEKpnBR-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR-1 RM the accessory module of ICE ICEKpnBR-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR-1 AM Meng LIU (Mia), Oliver He 1220 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1220 79158 bp NZ_CP016813 51.41[57.42] 566079..645236 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnED2-1 the integration and excision module of ICE ICEKpnED2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnED2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnED2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED2-1 IEM for excision the conjugation module of ICE ICEKpnED2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED2-1 CM the regulation module of ICE ICEKpnED2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED2-1 RM the accessory module of ICE ICEKpnED2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED2-1 AM Meng LIU (Mia), Oliver He 1221 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1221 79158 bp NZ_CP016814 51.41[57.57] 566086..645243 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnED23-1 the integration and excision module of ICE ICEKpnED23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED23-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnED23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED23-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnED23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED23-1 IEM for excision the conjugation module of ICE ICEKpnED23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED23-1 CM the regulation module of ICE ICEKpnED23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED23-1 RM the accessory module of ICE ICEKpnED23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnED23-1 AM Meng LIU (Mia), Oliver He 1361 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1361 66223 bp NZ_CP016923 52.36[57.5] 17308..83530 putative ICE predicted with ICEfinder unpublished ICEKpn11-1 the integration and excision module of ICE ICEKpn11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn11-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn11-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn11-1 IEM for excision the conjugation module of ICE ICEKpn11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn11-1 CM the regulation module of ICE ICEKpn11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn11-1 RM the accessory module of ICE ICEKpn11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn11-1 AM Meng LIU (Mia), Oliver He 1288 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1288 64550 bp NZ_CP017385 51.99[57.38] 3417013..3481562 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP36-1 the integration and excision module of ICE ICEKpnKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP36-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP36-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP36-1 IEM for excision the conjugation module of ICE ICEKpnKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP36-1 CM the regulation module of ICE ICEKpnKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP36-1 RM the accessory module of ICE ICEKpnKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP36-1 AM Meng LIU (Mia), Oliver He 1196 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1196 58199 bp NZ_CP017934 53.13[57.44] 5160854..5219052 putative ICE predicted with ICEfinder tRNA 25561339 ICEKpnCAV1016-1 the integration and excision module of ICE ICEKpnCAV1016-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1016-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1016-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1016-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1016-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1016-1 IEM for excision the conjugation module of ICE ICEKpnCAV1016-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1016-1 CM the regulation module of ICE ICEKpnCAV1016-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1016-1 RM the accessory module of ICE ICEKpnCAV1016-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1016-1 AM Meng LIU (Mia), Oliver He 1367 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1367 79158 bp NZ_CP017994 51.41[57.13] 3493116..3572273 putative ICE predicted with ICEfinder tRNA submitted ICEKpnP1428-1 the integration and excision module of ICE ICEKpnP1428-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnP1428-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnP1428-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnP1428-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnP1428-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnP1428-1 IEM for excision the conjugation module of ICE ICEKpnP1428-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnP1428-1 CM the regulation module of ICE ICEKpnP1428-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnP1428-1 RM the accessory module of ICE ICEKpnP1428-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnP1428-1 AM Meng LIU (Mia), Oliver He 1273 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1273 63552 bp NZ_CP018140 51.66[57.36] 1829156..1892707 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_822579-1 the integration and excision module of ICE ICEKpnKp_Goe_822579-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822579-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_822579-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822579-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_822579-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822579-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_822579-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822579-1 CM the regulation module of ICE ICEKpnKp_Goe_822579-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822579-1 RM the accessory module of ICE ICEKpnKp_Goe_822579-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822579-1 AM Meng LIU (Mia), Oliver He 1131 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1131 58049 bp NZ_CP018306 49.93[57.4] 978886..1036934 putative ICE predicted with ICEfinder tRNA submitted ICEKpn459-1 the integration and excision module of ICE ICEKpn459-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn459-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn459-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn459-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn459-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn459-1 IEM for excision the conjugation module of ICE ICEKpn459-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn459-1 CM the regulation module of ICE ICEKpn459-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn459-1 RM the accessory module of ICE ICEKpn459-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn459-1 AM Meng LIU (Mia), Oliver He 1266 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1266 56249 bp NZ_CP018337 50.2[57.59] 738388..794636 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_154414-1 the integration and excision module of ICE ICEKpnKp_Goe_154414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_154414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_154414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_154414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-1 CM the regulation module of ICE ICEKpnKp_Goe_154414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-1 RM the accessory module of ICE ICEKpnKp_Goe_154414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-1 AM Meng LIU (Mia), Oliver He 1267 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1267 62182 bp NZ_CP018337 52.34[57.59] 1802309..1864490 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_154414-2 the integration and excision module of ICE ICEKpnKp_Goe_154414-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_154414-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_154414-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-2 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_154414-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-2 CM the regulation module of ICE ICEKpnKp_Goe_154414-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-2 RM the accessory module of ICE ICEKpnKp_Goe_154414-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_154414-2 AM Meng LIU (Mia), Oliver He 1200 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1200 56009 bp NZ_CP018352 50.18[57.36] 4189070..4245078 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCAV1417-1 the integration and excision module of ICE ICEKpnCAV1417-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1417-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1417-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1417-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1417-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1417-1 IEM for excision the conjugation module of ICE ICEKpnCAV1417-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1417-1 CM the regulation module of ICE ICEKpnCAV1417-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1417-1 RM the accessory module of ICE ICEKpnCAV1417-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1417-1 AM Meng LIU (Mia), Oliver He 1201 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1201 58048 bp NZ_CP018356 49.94[57.45] 3731253..3789300 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCAV1453-1 the integration and excision module of ICE ICEKpnCAV1453-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1453-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1453-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1453-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1453-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1453-1 IEM for excision the conjugation module of ICE ICEKpnCAV1453-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1453-1 CM the regulation module of ICE ICEKpnCAV1453-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1453-1 RM the accessory module of ICE ICEKpnCAV1453-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1453-1 AM Meng LIU (Mia), Oliver He 1269 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1269 54942 bp NZ_CP018364 50.12[57.36] 744148..799089 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_62629-1 the integration and excision module of ICE ICEKpnKp_Goe_62629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_62629-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_62629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_62629-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_62629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_62629-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_62629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_62629-1 CM the regulation module of ICE ICEKpnKp_Goe_62629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_62629-1 RM the accessory module of ICE ICEKpnKp_Goe_62629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_62629-1 AM Meng LIU (Mia), Oliver He 1352 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1352 143588 bp NZ_CP018427 52.18[57.17] 3355560..3499147 putative ICE predicted with ICEfinder tRNA-Asn2 submitted ICEKpnMNCRE69-1 the integration and excision module of ICE ICEKpnMNCRE69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnMNCRE69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnMNCRE69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-1 IEM for excision the conjugation module of ICE ICEKpnMNCRE69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-1 CM the regulation module of ICE ICEKpnMNCRE69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-1 RM the accessory module of ICE ICEKpnMNCRE69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-1 AM Meng LIU (Mia), Oliver He 1353 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1353 58047 bp NZ_CP018427 49.94[57.17] 4624364..4682410 putative ICE predicted with ICEfinder tRNA submitted ICEKpnMNCRE69-2 the integration and excision module of ICE ICEKpnMNCRE69-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnMNCRE69-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnMNCRE69-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-2 IEM for excision the conjugation module of ICE ICEKpnMNCRE69-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-2 CM the regulation module of ICE ICEKpnMNCRE69-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-2 RM the accessory module of ICE ICEKpnMNCRE69-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE69-2 AM Meng LIU (Mia), Oliver He 1354 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1354 143604 bp NZ_CP018428 52.17[57.17] 3356625..3500228 putative ICE predicted with ICEfinder tRNA-Asn2 unpublished ICEKpnMNCRE78-1 the integration and excision module of ICE ICEKpnMNCRE78-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnMNCRE78-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnMNCRE78-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-1 IEM for excision the conjugation module of ICE ICEKpnMNCRE78-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-1 CM the regulation module of ICE ICEKpnMNCRE78-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-1 RM the accessory module of ICE ICEKpnMNCRE78-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-1 AM Meng LIU (Mia), Oliver He 1355 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1355 58048 bp NZ_CP018428 49.94[57.17] 4625444..4683491 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnMNCRE78-2 the integration and excision module of ICE ICEKpnMNCRE78-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnMNCRE78-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnMNCRE78-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-2 IEM for excision the conjugation module of ICE ICEKpnMNCRE78-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-2 CM the regulation module of ICE ICEKpnMNCRE78-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-2 RM the accessory module of ICE ICEKpnMNCRE78-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE78-2 AM Meng LIU (Mia), Oliver He 1350 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1350 143588 bp NZ_CP018437 52.18[57.18] 3393285..3536872 putative ICE predicted with ICEfinder tRNA-Asn2 unpublished ICEKpnMNCRE53-1 the integration and excision module of ICE ICEKpnMNCRE53-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnMNCRE53-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnMNCRE53-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-1 IEM for excision the conjugation module of ICE ICEKpnMNCRE53-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-1 CM the regulation module of ICE ICEKpnMNCRE53-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-1 RM the accessory module of ICE ICEKpnMNCRE53-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-1 AM Meng LIU (Mia), Oliver He 1351 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1351 58048 bp NZ_CP018437 49.94[57.18] 4662089..4720136 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnMNCRE53-2 the integration and excision module of ICE ICEKpnMNCRE53-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnMNCRE53-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnMNCRE53-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-2 IEM for excision the conjugation module of ICE ICEKpnMNCRE53-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-2 CM the regulation module of ICE ICEKpnMNCRE53-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-2 RM the accessory module of ICE ICEKpnMNCRE53-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnMNCRE53-2 AM Meng LIU (Mia), Oliver He 1274 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1274 56249 bp NZ_CP018438 50.2[57.53] 738966..795214 putative ICE predicted with ICEfinder tRNA submitted ICEKpnKp_Goe_822917-1 the integration and excision module of ICE ICEKpnKp_Goe_822917-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_822917-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_822917-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_822917-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-1 CM the regulation module of ICE ICEKpnKp_Goe_822917-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-1 RM the accessory module of ICE ICEKpnKp_Goe_822917-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-1 AM Meng LIU (Mia), Oliver He 1275 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1275 64550 bp NZ_CP018438 51.99[57.53] 1802317..1866866 putative ICE predicted with ICEfinder tRNA submitted ICEKpnKp_Goe_822917-2 the integration and excision module of ICE ICEKpnKp_Goe_822917-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_822917-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_822917-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-2 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_822917-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-2 CM the regulation module of ICE ICEKpnKp_Goe_822917-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-2 RM the accessory module of ICE ICEKpnKp_Goe_822917-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_822917-2 AM Meng LIU (Mia), Oliver He 1268 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1268 64550 bp NZ_CP018447 51.99[57.09] 1859322..1923871 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_33208-1 the integration and excision module of ICE ICEKpnKp_Goe_33208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_33208-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_33208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_33208-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_33208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_33208-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_33208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_33208-1 CM the regulation module of ICE ICEKpnKp_Goe_33208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_33208-1 RM the accessory module of ICE ICEKpnKp_Goe_33208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_33208-1 AM Meng LIU (Mia), Oliver He 1270 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1270 64550 bp NZ_CP018450 51.99[57.09] 1859309..1923858 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_71070-1 the integration and excision module of ICE ICEKpnKp_Goe_71070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_71070-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_71070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_71070-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_71070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_71070-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_71070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_71070-1 CM the regulation module of ICE ICEKpnKp_Goe_71070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_71070-1 RM the accessory module of ICE ICEKpnKp_Goe_71070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_71070-1 AM Meng LIU (Mia), Oliver He 1392 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1392 58661 bp NZ_CP018454 50.05[57.51] 3130473..3189133 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnSWU01-1 the integration and excision module of ICE ICEKpnSWU01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSWU01-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSWU01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSWU01-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSWU01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSWU01-1 IEM for excision the conjugation module of ICE ICEKpnSWU01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSWU01-1 CM the regulation module of ICE ICEKpnSWU01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSWU01-1 RM the accessory module of ICE ICEKpnSWU01-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSWU01-1 AM Meng LIU (Mia), Oliver He 1197 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1197 102780 bp NZ_CP018671 50.06[57.12] 3304588..3407367 putative ICE predicted with ICEfinder tRNA-phe-2 unpublished ICEKpnCAV1042-1 the integration and excision module of ICE ICEKpnCAV1042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1042-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1042-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1042-1 IEM for excision the conjugation module of ICE ICEKpnCAV1042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1042-1 CM the regulation module of ICE ICEKpnCAV1042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1042-1 RM the accessory module of ICE ICEKpnCAV1042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1042-1 AM Meng LIU (Mia), Oliver He 1198 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1198 59114 bp NZ_CP018676 49.99[57.52] 1870285..1929398 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCAV1217-1 the integration and excision module of ICE ICEKpnCAV1217-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1217-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCAV1217-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1217-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCAV1217-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1217-1 IEM for excision the conjugation module of ICE ICEKpnCAV1217-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1217-1 CM the regulation module of ICE ICEKpnCAV1217-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1217-1 RM the accessory module of ICE ICEKpnCAV1217-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCAV1217-1 AM Meng LIU (Mia), Oliver He 1271 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1271 56249 bp NZ_CP018692 50.2[57.53] 738966..795214 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_821588-1 the integration and excision module of ICE ICEKpnKp_Goe_821588-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_821588-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_821588-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_821588-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-1 CM the regulation module of ICE ICEKpnKp_Goe_821588-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-1 RM the accessory module of ICE ICEKpnKp_Goe_821588-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-1 AM Meng LIU (Mia), Oliver He 1272 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1272 64550 bp NZ_CP018692 51.99[57.53] 1803094..1867643 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_821588-2 the integration and excision module of ICE ICEKpnKp_Goe_821588-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_821588-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_821588-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-2 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_821588-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-2 CM the regulation module of ICE ICEKpnKp_Goe_821588-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-2 RM the accessory module of ICE ICEKpnKp_Goe_821588-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_821588-2 AM Meng LIU (Mia), Oliver He 1265 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1265 64550 bp NZ_CP018735 51.99[57.11] 1880423..1944972 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp_Goe_121641-1 the integration and excision module of ICE ICEKpnKp_Goe_121641-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_121641-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp_Goe_121641-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_121641-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp_Goe_121641-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_121641-1 IEM for excision the conjugation module of ICE ICEKpnKp_Goe_121641-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_121641-1 CM the regulation module of ICE ICEKpnKp_Goe_121641-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_121641-1 RM the accessory module of ICE ICEKpnKp_Goe_121641-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp_Goe_121641-1 AM Meng LIU (Mia), Oliver He 1145 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1145 54943 bp NZ_CP018816 50.12[57.29] 1497597..1552539 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0049-1 the integration and excision module of ICE ICEKpnAR_0049-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0049-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0049-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0049-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0049-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0049-1 IEM for excision the conjugation module of ICE ICEKpnAR_0049-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0049-1 CM the regulation module of ICE ICEKpnAR_0049-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0049-1 RM the accessory module of ICE ICEKpnAR_0049-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0049-1 AM Meng LIU (Mia), Oliver He 1190 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1190 54943 bp NZ_CP018883 50.12[57.53] 4606800..4661742 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBR7-1 the integration and excision module of ICE ICEKpnBR7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR7-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBR7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR7-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBR7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR7-1 IEM for excision the conjugation module of ICE ICEKpnBR7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR7-1 CM the regulation module of ICE ICEKpnBR7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR7-1 RM the accessory module of ICE ICEKpnBR7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR7-1 AM Meng LIU (Mia), Oliver He 1189 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1189 58047 bp NZ_CP018885 49.94[57.48] 649923..707969 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBR21-1 the integration and excision module of ICE ICEKpnBR21-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR21-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBR21-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR21-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBR21-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR21-1 IEM for excision the conjugation module of ICE ICEKpnBR21-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR21-1 CM the regulation module of ICE ICEKpnBR21-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR21-1 RM the accessory module of ICE ICEKpnBR21-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBR21-1 AM Meng LIU (Mia), Oliver He 1375 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1375 76148 bp NZ_CP019047 50.02[57.59] 1806260..1882407 putative ICE predicted with ICEfinder tRNA-Asn2 unpublished ICEKpnRJA166-1 the integration and excision module of ICE ICEKpnRJA166-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnRJA166-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnRJA166-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-1 IEM for excision the conjugation module of ICE ICEKpnRJA166-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-1 CM the regulation module of ICE ICEKpnRJA166-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-1 RM the accessory module of ICE ICEKpnRJA166-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-1 AM Meng LIU (Mia), Oliver He 1376 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1376 79158 bp NZ_CP019047 51.41[57.59] 4668669..4747826 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnRJA166-2 the integration and excision module of ICE ICEKpnRJA166-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnRJA166-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnRJA166-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-2 IEM for excision the conjugation module of ICE ICEKpnRJA166-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-2 CM the regulation module of ICE ICEKpnRJA166-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-2 RM the accessory module of ICE ICEKpnRJA166-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnRJA166-2 AM Meng LIU (Mia), Oliver He 1311 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1311 58047 bp NZ_CP019772 49.94[57.33] 830383..888429 putative ICE predicted with ICEfinder tRNA 28143787 ICEKpnKPN_KPC_HUG_07-1 the integration and excision module of ICE ICEKpnKPN_KPC_HUG_07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN_KPC_HUG_07-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPN_KPC_HUG_07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN_KPC_HUG_07-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPN_KPC_HUG_07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN_KPC_HUG_07-1 IEM for excision the conjugation module of ICE ICEKpnKPN_KPC_HUG_07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN_KPC_HUG_07-1 CM the regulation module of ICE ICEKpnKPN_KPC_HUG_07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN_KPC_HUG_07-1 RM the accessory module of ICE ICEKpnKPN_KPC_HUG_07-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN_KPC_HUG_07-1 AM Meng LIU (Mia), Oliver He 1154 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1154 58048 bp NZ_CP020071 49.94[57.39] 476838..534885 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0115-1 the integration and excision module of ICE ICEKpnAR_0115-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0115-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0115-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0115-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0115-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0115-1 IEM for excision the conjugation module of ICE ICEKpnAR_0115-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0115-1 CM the regulation module of ICE ICEKpnAR_0115-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0115-1 RM the accessory module of ICE ICEKpnAR_0115-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0115-1 AM Meng LIU (Mia), Oliver He 1151 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1151 54943 bp NZ_CP020108 50.12[57.36] 3541597..3596539 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0098-1 the integration and excision module of ICE ICEKpnAR_0098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0098-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0098-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0098-1 IEM for excision the conjugation module of ICE ICEKpnAR_0098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0098-1 CM the regulation module of ICE ICEKpnAR_0098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0098-1 RM the accessory module of ICE ICEKpnAR_0098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0098-1 AM Meng LIU (Mia), Oliver He 1191 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1191 54943 bp NZ_CP020498 50.12[57.53] 741248..796190 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBWHC1-1 the integration and excision module of ICE ICEKpnBWHC1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBWHC1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBWHC1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBWHC1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBWHC1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBWHC1-1 IEM for excision the conjugation module of ICE ICEKpnBWHC1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBWHC1-1 CM the regulation module of ICE ICEKpnBWHC1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBWHC1-1 RM the accessory module of ICE ICEKpnBWHC1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBWHC1-1 AM Meng LIU (Mia), Oliver He 1185 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1185 137618 bp NZ_CP020837 52.23[57.24] 3627680..3765297 putative ICE predicted with ICEfinder tRNA 28512093 ICEKpnBK13043-1 the integration and excision module of ICE ICEKpnBK13043-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBK13043-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBK13043-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-1 IEM for excision the conjugation module of ICE ICEKpnBK13043-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-1 CM the regulation module of ICE ICEKpnBK13043-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-1 RM the accessory module of ICE ICEKpnBK13043-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-1 AM Meng LIU (Mia), Oliver He 1186 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1186 58048 bp NZ_CP020837 49.94[57.24] 4880222..4938269 putative ICE predicted with ICEfinder tRNA 28512093 ICEKpnBK13043-2 the integration and excision module of ICE ICEKpnBK13043-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBK13043-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBK13043-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-2 IEM for excision the conjugation module of ICE ICEKpnBK13043-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-2 CM the regulation module of ICE ICEKpnBK13043-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-2 RM the accessory module of ICE ICEKpnBK13043-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBK13043-2 AM Meng LIU (Mia), Oliver He 1313 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1313 66216 bp NZ_CP020853 52.36[57.48] 3763098..3829313 putative ICE predicted with ICEfinder 28512093 ICEKpnKPN528-1 the integration and excision module of ICE ICEKpnKPN528-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN528-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPN528-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN528-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPN528-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN528-1 IEM for excision the conjugation module of ICE ICEKpnKPN528-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN528-1 CM the regulation module of ICE ICEKpnKPN528-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN528-1 RM the accessory module of ICE ICEKpnKPN528-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPN528-1 AM Meng LIU (Mia), Oliver He 1263 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1263 54943 bp NZ_CP020901 50.12[57.38] 5237175..5292117 putative ICE predicted with ICEfinder tRNA 28684580 ICEKpnK66-45-1 the integration and excision module of ICE ICEKpnK66-45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK66-45-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnK66-45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK66-45-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnK66-45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK66-45-1 IEM for excision the conjugation module of ICE ICEKpnK66-45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK66-45-1 CM the regulation module of ICE ICEKpnK66-45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK66-45-1 RM the accessory module of ICE ICEKpnK66-45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK66-45-1 AM Meng LIU (Mia), Oliver He 1144 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1144 58048 bp NZ_CP021539 49.94[57.38] 5017266..5075313 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0047-1 the integration and excision module of ICE ICEKpnAR_0047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0047-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0047-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0047-1 IEM for excision the conjugation module of ICE ICEKpnAR_0047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0047-1 CM the regulation module of ICE ICEKpnAR_0047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0047-1 RM the accessory module of ICE ICEKpnAR_0047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0047-1 AM Meng LIU (Mia), Oliver He 1152 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1152 58048 bp NZ_CP021549 49.94[57.39] 4155708..4213755 putative ICE predicted with ICEfinder tRNA submitted ICEKpnAR_0112-1 the integration and excision module of ICE ICEKpnAR_0112-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0112-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0112-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0112-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0112-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0112-1 IEM for excision the conjugation module of ICE ICEKpnAR_0112-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0112-1 CM the regulation module of ICE ICEKpnAR_0112-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0112-1 RM the accessory module of ICE ICEKpnAR_0112-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0112-1 AM Meng LIU (Mia), Oliver He 1164 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1164 94806 bp NZ_CP021685 50.85[57.4] 194506..289311 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0146-1 the integration and excision module of ICE ICEKpnAR_0146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-1 IEM for excision the conjugation module of ICE ICEKpnAR_0146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-1 CM the regulation module of ICE ICEKpnAR_0146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-1 RM the accessory module of ICE ICEKpnAR_0146-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-1 AM Meng LIU (Mia), Oliver He 1165 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1165 59114 bp NZ_CP021685 49.99[57.4] 1297863..1356976 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0146-2 the integration and excision module of ICE ICEKpnAR_0146-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0146-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0146-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-2 IEM for excision the conjugation module of ICE ICEKpnAR_0146-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-2 CM the regulation module of ICE ICEKpnAR_0146-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-2 RM the accessory module of ICE ICEKpnAR_0146-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0146-2 AM Meng LIU (Mia), Oliver He 1159 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1159 58047 bp NZ_CP021718 49.94[57.36] 3271274..3329320 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0129-1 the integration and excision module of ICE ICEKpnAR_0129-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0129-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0129-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0129-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0129-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0129-1 IEM for excision the conjugation module of ICE ICEKpnAR_0129-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0129-1 CM the regulation module of ICE ICEKpnAR_0129-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0129-1 RM the accessory module of ICE ICEKpnAR_0129-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0129-1 AM Meng LIU (Mia), Oliver He 1158 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1158 58199 bp NZ_CP021740 53.13[57.44] 4137547..4195745 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0126-1 the integration and excision module of ICE ICEKpnAR_0126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0126-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0126-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0126-1 IEM for excision the conjugation module of ICE ICEKpnAR_0126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0126-1 CM the regulation module of ICE ICEKpnAR_0126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0126-1 RM the accessory module of ICE ICEKpnAR_0126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0126-1 AM Meng LIU (Mia), Oliver He 1153 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1153 58047 bp NZ_CP021751 49.94[57.39] 4479005..4537051 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0113-1 the integration and excision module of ICE ICEKpnAR_0113-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0113-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0113-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0113-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0113-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0113-1 IEM for excision the conjugation module of ICE ICEKpnAR_0113-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0113-1 CM the regulation module of ICE ICEKpnAR_0113-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0113-1 RM the accessory module of ICE ICEKpnAR_0113-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0113-1 AM Meng LIU (Mia), Oliver He 1161 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1161 58199 bp NZ_CP021757 53.13[57.3] 1252085..1310283 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0138-1 the integration and excision module of ICE ICEKpnAR_0138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0138-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0138-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0138-1 IEM for excision the conjugation module of ICE ICEKpnAR_0138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0138-1 CM the regulation module of ICE ICEKpnAR_0138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0138-1 RM the accessory module of ICE ICEKpnAR_0138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0138-1 AM Meng LIU (Mia), Oliver He 1155 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1155 137609 bp NZ_CP021833 52.23[57.29] 2107421..2245029 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0120-1 the integration and excision module of ICE ICEKpnAR_0120-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0120-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0120-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-1 IEM for excision the conjugation module of ICE ICEKpnAR_0120-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-1 CM the regulation module of ICE ICEKpnAR_0120-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-1 RM the accessory module of ICE ICEKpnAR_0120-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-1 AM Meng LIU (Mia), Oliver He 1156 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1156 58048 bp NZ_CP021833 49.94[57.29] 3359975..3418022 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0120-2 the integration and excision module of ICE ICEKpnAR_0120-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0120-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0120-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-2 IEM for excision the conjugation module of ICE ICEKpnAR_0120-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-2 CM the regulation module of ICE ICEKpnAR_0120-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-2 RM the accessory module of ICE ICEKpnAR_0120-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0120-2 AM Meng LIU (Mia), Oliver He 1157 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1157 58048 bp NZ_CP021859 49.94[57.47] 2303268..2361315 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0125-1 the integration and excision module of ICE ICEKpnAR_0125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0125-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0125-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0125-1 IEM for excision the conjugation module of ICE ICEKpnAR_0125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0125-1 CM the regulation module of ICE ICEKpnAR_0125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0125-1 RM the accessory module of ICE ICEKpnAR_0125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0125-1 AM Meng LIU (Mia), Oliver He 1163 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1163 64550 bp NZ_CP021939 51.99[57.41] 4222584..4287133 putative ICE predicted with ICEfinder unpublished ICEKpnAR_0145-1 the integration and excision module of ICE ICEKpnAR_0145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0145-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0145-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0145-1 IEM for excision the conjugation module of ICE ICEKpnAR_0145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0145-1 CM the regulation module of ICE ICEKpnAR_0145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0145-1 RM the accessory module of ICE ICEKpnAR_0145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0145-1 AM Meng LIU (Mia), Oliver He 1167 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1167 64550 bp NZ_CP021944 51.99[57.42] 376688..441237 putative ICE predicted with ICEfinder unpublished ICEKpnAR_0152-1 the integration and excision module of ICE ICEKpnAR_0152-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0152-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0152-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0152-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0152-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0152-1 IEM for excision the conjugation module of ICE ICEKpnAR_0152-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0152-1 CM the regulation module of ICE ICEKpnAR_0152-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0152-1 RM the accessory module of ICE ICEKpnAR_0152-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0152-1 AM Meng LIU (Mia), Oliver He 1166 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1166 54943 bp NZ_CP021950 50.12[57.4] 4078191..4133133 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0148-1 the integration and excision module of ICE ICEKpnAR_0148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0148-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0148-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0148-1 IEM for excision the conjugation module of ICE ICEKpnAR_0148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0148-1 CM the regulation module of ICE ICEKpnAR_0148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0148-1 RM the accessory module of ICE ICEKpnAR_0148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0148-1 AM Meng LIU (Mia), Oliver He 1162 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1162 69219 bp NZ_CP021960 51.78[57] 5228915..5298133 putative ICE predicted with ICEfinder unpublished ICEKpnAR_0139-1 the integration and excision module of ICE ICEKpnAR_0139-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0139-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0139-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0139-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0139-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0139-1 IEM for excision the conjugation module of ICE ICEKpnAR_0139-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0139-1 CM the regulation module of ICE ICEKpnAR_0139-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0139-1 RM the accessory module of ICE ICEKpnAR_0139-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0139-1 AM Meng LIU (Mia), Oliver He 1138 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1138 48712 bp NZ_CP022143 50.11[57.6] 4913786..4962497 putative ICE predicted with ICEfinder tRNA 28818913 ICEKpn704SK6-1 the integration and excision module of ICE ICEKpn704SK6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn704SK6-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn704SK6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn704SK6-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn704SK6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn704SK6-1 IEM for excision the conjugation module of ICE ICEKpn704SK6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn704SK6-1 CM the regulation module of ICE ICEKpn704SK6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn704SK6-1 RM the accessory module of ICE ICEKpn704SK6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn704SK6-1 AM Meng LIU (Mia), Oliver He 1183 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1183 54943 bp NZ_CP022573 50.12[57.39] 3423281..3478223 putative ICE predicted with ICEfinder tRNA 29688339 ICEKpnBIC-1-1 the integration and excision module of ICE ICEKpnBIC-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBIC-1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBIC-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBIC-1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBIC-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBIC-1-1 IEM for excision the conjugation module of ICE ICEKpnBIC-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBIC-1-1 CM the regulation module of ICE ICEKpnBIC-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBIC-1-1 RM the accessory module of ICE ICEKpnBIC-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBIC-1-1 AM Meng LIU (Mia), Oliver He 1176 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1176 54943 bp NZ_CP022691 50.12[57.32] 740471..795413 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAUSMDU00008079-1 the integration and excision module of ICE ICEKpnAUSMDU00008079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008079-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAUSMDU00008079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008079-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAUSMDU00008079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008079-1 IEM for excision the conjugation module of ICE ICEKpnAUSMDU00008079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008079-1 CM the regulation module of ICE ICEKpnAUSMDU00008079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008079-1 RM the accessory module of ICE ICEKpnAUSMDU00008079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008079-1 AM Meng LIU (Mia), Oliver He 1140 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1140 52608 bp NZ_CP022882 51.09[57.46] 3249582..3302189 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn911021-1 the integration and excision module of ICE ICEKpn911021-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn911021-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn911021-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn911021-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn911021-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn911021-1 IEM for excision the conjugation module of ICE ICEKpn911021-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn911021-1 CM the regulation module of ICE ICEKpn911021-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn911021-1 RM the accessory module of ICE ICEKpn911021-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn911021-1 AM Meng LIU (Mia), Oliver He 1139 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1139 54943 bp NZ_CP022997 50.12[57.38] 4471158..4526100 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn721005-1 the integration and excision module of ICE ICEKpn721005-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn721005-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn721005-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn721005-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn721005-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn721005-1 IEM for excision the conjugation module of ICE ICEKpn721005-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn721005-1 CM the regulation module of ICE ICEKpn721005-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn721005-1 RM the accessory module of ICE ICEKpn721005-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn721005-1 AM Meng LIU (Mia), Oliver He 1204 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1204 59300 bp NZ_CP023441 53.03[57.61] 5124948..5184247 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCCUG70747-1 the integration and excision module of ICE ICEKpnCCUG70747-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCUG70747-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCCUG70747-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCUG70747-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCCUG70747-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCUG70747-1 IEM for excision the conjugation module of ICE ICEKpnCCUG70747-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCUG70747-1 CM the regulation module of ICE ICEKpnCCUG70747-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCUG70747-1 RM the accessory module of ICE ICEKpnCCUG70747-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCUG70747-1 AM Meng LIU (Mia), Oliver He 1389 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1389 64548 bp NZ_CP023487 52[57.22] 2308125..2372672 putative ICE predicted with ICEfinder tRNA 28636609 ICEKpnST101:960186733-1 the integration and excision module of ICE ICEKpnST101:960186733-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST101:960186733-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnST101:960186733-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST101:960186733-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnST101:960186733-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST101:960186733-1 IEM for excision the conjugation module of ICE ICEKpnST101:960186733-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST101:960186733-1 CM the regulation module of ICE ICEKpnST101:960186733-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST101:960186733-1 RM the accessory module of ICE ICEKpnST101:960186733-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST101:960186733-1 AM Meng LIU (Mia), Oliver He 1390 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1390 64550 bp NZ_CP023553 52[57.22] 1428965..1493514 putative ICE predicted with ICEfinder tRNA 28636609 ICEKpnST2017:950142398-1 the integration and excision module of ICE ICEKpnST2017:950142398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST2017:950142398-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnST2017:950142398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST2017:950142398-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnST2017:950142398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST2017:950142398-1 IEM for excision the conjugation module of ICE ICEKpnST2017:950142398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST2017:950142398-1 CM the regulation module of ICE ICEKpnST2017:950142398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST2017:950142398-1 RM the accessory module of ICE ICEKpnST2017:950142398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST2017:950142398-1 AM Meng LIU (Mia), Oliver He 1396 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1396 92628 bp NZ_CP023722 44.85[57.21] 1006473..1099100 putative ICE predicted with ICEfinder tRNA 29800340 ICEKpnTVGHCRE225-1 the integration and excision module of ICE ICEKpnTVGHCRE225-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnTVGHCRE225-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnTVGHCRE225-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-1 IEM for excision the conjugation module of ICE ICEKpnTVGHCRE225-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-1 CM the regulation module of ICE ICEKpnTVGHCRE225-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-1 RM the accessory module of ICE ICEKpnTVGHCRE225-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-1 AM Meng LIU (Mia), Oliver He 1397 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1397 58047 bp NZ_CP023722 49.94[57.21] 5312916..5370962 putative ICE predicted with ICEfinder tRNA 29800340 ICEKpnTVGHCRE225-2 the integration and excision module of ICE ICEKpnTVGHCRE225-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnTVGHCRE225-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnTVGHCRE225-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-2 IEM for excision the conjugation module of ICE ICEKpnTVGHCRE225-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-2 CM the regulation module of ICE ICEKpnTVGHCRE225-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-2 RM the accessory module of ICE ICEKpnTVGHCRE225-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTVGHCRE225-2 AM Meng LIU (Mia), Oliver He 1229 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1229 58047 bp NZ_CP023933 49.94[57.4] 1345661..1403707 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1038/s41467-019-11306-6 ICEKpnFDAARGOS_443-1 the integration and excision module of ICE ICEKpnFDAARGOS_443-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_443-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_443-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_443-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_443-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_443-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_443-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_443-1 CM the regulation module of ICE ICEKpnFDAARGOS_443-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_443-1 RM the accessory module of ICE ICEKpnFDAARGOS_443-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_443-1 AM Meng LIU (Mia), Oliver He 1230 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1230 56142 bp NZ_CP023941 50.2[57.38] 643845..699986 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1038/s41467-019-11306-6 ICEKpnFDAARGOS_444-1 the integration and excision module of ICE ICEKpnFDAARGOS_444-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_444-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_444-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_444-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_444-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_444-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_444-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_444-1 CM the regulation module of ICE ICEKpnFDAARGOS_444-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_444-1 RM the accessory module of ICE ICEKpnFDAARGOS_444-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_444-1 AM Meng LIU (Mia), Oliver He 1231 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1231 64550 bp NZ_CP023946 52[57.43] 2616393..2680942 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1038/s41467-019-11306-6 ICEKpnFDAARGOS_446-1 the integration and excision module of ICE ICEKpnFDAARGOS_446-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_446-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_446-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_446-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_446-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_446-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_446-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_446-1 CM the regulation module of ICE ICEKpnFDAARGOS_446-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_446-1 RM the accessory module of ICE ICEKpnFDAARGOS_446-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_446-1 AM Meng LIU (Mia), Oliver He 1232 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1232 58197 bp NZ_CP023949 53.13[57.65] 1781989..1840185 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1038/s41467-019-11306-6 ICEKpnFDAARGOS_447-1 the integration and excision module of ICE ICEKpnFDAARGOS_447-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_447-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_447-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_447-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_447-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_447-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_447-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_447-1 CM the regulation module of ICE ICEKpnFDAARGOS_447-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_447-1 RM the accessory module of ICE ICEKpnFDAARGOS_447-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_447-1 AM Meng LIU (Mia), Oliver He 1329 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1329 57961 bp NZ_CP024191 52.68[57.48] 1767944..1825904 putative ICE predicted with ICEfinder unpublished ICEKpnKSB1_5D-1 the integration and excision module of ICE ICEKpnKSB1_5D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_5D-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKSB1_5D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_5D-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKSB1_5D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_5D-1 IEM for excision the conjugation module of ICE ICEKpnKSB1_5D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_5D-1 CM the regulation module of ICE ICEKpnKSB1_5D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_5D-1 RM the accessory module of ICE ICEKpnKSB1_5D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_5D-1 AM Meng LIU (Mia), Oliver He 1218 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1218 58199 bp NZ_CP024429 53.13[57.29] 3415712..3473910 putative ICE predicted with ICEfinder tRNA 29220374 ICEKpnDA48896-1 the integration and excision module of ICE ICEKpnDA48896-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA48896-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnDA48896-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA48896-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnDA48896-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA48896-1 IEM for excision the conjugation module of ICE ICEKpnDA48896-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA48896-1 CM the regulation module of ICE ICEKpnDA48896-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA48896-1 RM the accessory module of ICE ICEKpnDA48896-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA48896-1 AM Meng LIU (Mia), Oliver He 1370 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1370 58199 bp NZ_CP024458 53.13[57.52] 2858419..2916617 putative ICE predicted with ICEfinder unpublished ICEKpnQS17-0161-1 the integration and excision module of ICE ICEKpnQS17-0161-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQS17-0161-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnQS17-0161-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQS17-0161-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnQS17-0161-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQS17-0161-1 IEM for excision the conjugation module of ICE ICEKpnQS17-0161-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQS17-0161-1 CM the regulation module of ICE ICEKpnQS17-0161-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQS17-0161-1 RM the accessory module of ICE ICEKpnQS17-0161-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQS17-0161-1 AM Meng LIU (Mia), Oliver He 1256 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1256 107437 bp NZ_CP024482 53.73[57.39] 724820..832256 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnINF322-1 the integration and excision module of ICE ICEKpnINF322-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF322-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF322-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF322-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF322-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF322-1 IEM for excision the conjugation module of ICE ICEKpnINF322-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF322-1 CM the regulation module of ICE ICEKpnINF322-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF322-1 RM the accessory module of ICE ICEKpnINF322-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF322-1 AM Meng LIU (Mia), Oliver He 1252 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1252 107437 bp NZ_CP024489 53.73[57.19] 724822..832258 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnINF249-1 the integration and excision module of ICE ICEKpnINF249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-1 IEM for excision the conjugation module of ICE ICEKpnINF249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-1 CM the regulation module of ICE ICEKpnINF249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-1 RM the accessory module of ICE ICEKpnINF249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-1 AM Meng LIU (Mia), Oliver He 1253 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1253 210245 bp NZ_CP024489 52.18[57.19] 5079347..5289591 putative ICE predicted with ICEfinder non Asn/Phe/Leu 29340588 ICEKpnINF249-2 the integration and excision module of ICE ICEKpnINF249-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF249-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF249-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-2 IEM for excision the conjugation module of ICE ICEKpnINF249-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-2 CM the regulation module of ICE ICEKpnINF249-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-2 RM the accessory module of ICE ICEKpnINF249-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF249-2 AM Meng LIU (Mia), Oliver He 1248 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1248 57961 bp NZ_CP024521 52.68[57.48] 440249..498209 putative ICE predicted with ICEfinder 29340588 ICEKpnINF158-1 the integration and excision module of ICE ICEKpnINF158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF158-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF158-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF158-1 IEM for excision the conjugation module of ICE ICEKpnINF158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF158-1 CM the regulation module of ICE ICEKpnINF158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF158-1 RM the accessory module of ICE ICEKpnINF158-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF158-1 AM Meng LIU (Mia), Oliver He 1247 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1247 57961 bp NZ_CP024528 52.68[57.48] 1768053..1826013 putative ICE predicted with ICEfinder 29340588 ICEKpnINF157-1 the integration and excision module of ICE ICEKpnINF157-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF157-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF157-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF157-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF157-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF157-1 IEM for excision the conjugation module of ICE ICEKpnINF157-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF157-1 CM the regulation module of ICE ICEKpnINF157-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF157-1 RM the accessory module of ICE ICEKpnINF157-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF157-1 AM Meng LIU (Mia), Oliver He 1244 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1244 58198 bp NZ_CP024542 53.13[57.41] 1787299..1845496 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnINF042-1 the integration and excision module of ICE ICEKpnINF042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF042-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF042-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF042-1 IEM for excision the conjugation module of ICE ICEKpnINF042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF042-1 CM the regulation module of ICE ICEKpnINF042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF042-1 RM the accessory module of ICE ICEKpnINF042-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF042-1 AM Meng LIU (Mia), Oliver He 1245 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1245 58198 bp NZ_CP024545 53.13[57.41] 1787299..1845496 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnINF059-1 the integration and excision module of ICE ICEKpnINF059-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF059-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF059-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF059-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF059-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF059-1 IEM for excision the conjugation module of ICE ICEKpnINF059-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF059-1 CM the regulation module of ICE ICEKpnINF059-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF059-1 RM the accessory module of ICE ICEKpnINF059-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF059-1 AM Meng LIU (Mia), Oliver He 1330 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1330 54918 bp NZ_CP024548 50.12[57.12] 732252..787169 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnKSB1_7J-1 the integration and excision module of ICE ICEKpnKSB1_7J-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_7J-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKSB1_7J-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_7J-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKSB1_7J-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_7J-1 IEM for excision the conjugation module of ICE ICEKpnKSB1_7J-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_7J-1 CM the regulation module of ICE ICEKpnKSB1_7J-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_7J-1 RM the accessory module of ICE ICEKpnKSB1_7J-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSB1_7J-1 AM Meng LIU (Mia), Oliver He 1249 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1249 57961 bp NZ_CP024549 52.68[57.47] 1768819..1826779 putative ICE predicted with ICEfinder 29340588 ICEKpnINF163-1 the integration and excision module of ICE ICEKpnINF163-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF163-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF163-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF163-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF163-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF163-1 IEM for excision the conjugation module of ICE ICEKpnINF163-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF163-1 CM the regulation module of ICE ICEKpnINF163-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF163-1 RM the accessory module of ICE ICEKpnINF163-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF163-1 AM Meng LIU (Mia), Oliver He 1250 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1250 57961 bp NZ_CP024556 52.68[57.47] 1769048..1827008 putative ICE predicted with ICEfinder 29340588 ICEKpnINF164-1 the integration and excision module of ICE ICEKpnINF164-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF164-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF164-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF164-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF164-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF164-1 IEM for excision the conjugation module of ICE ICEKpnINF164-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF164-1 CM the regulation module of ICE ICEKpnINF164-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF164-1 RM the accessory module of ICE ICEKpnINF164-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF164-1 AM Meng LIU (Mia), Oliver He 1255 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1255 97771 bp NZ_CP024563 50.34[57.48] 2862451..2960221 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnINF278-1 the integration and excision module of ICE ICEKpnINF278-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF278-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF278-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF278-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF278-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF278-1 IEM for excision the conjugation module of ICE ICEKpnINF278-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF278-1 CM the regulation module of ICE ICEKpnINF278-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF278-1 RM the accessory module of ICE ICEKpnINF278-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF278-1 AM Meng LIU (Mia), Oliver He 1254 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1254 97771 bp NZ_CP024570 50.34[57.48] 2862451..2960221 putative ICE predicted with ICEfinder tRNA 29340588 ICEKpnINF274-1 the integration and excision module of ICE ICEKpnINF274-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF274-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF274-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF274-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF274-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF274-1 IEM for excision the conjugation module of ICE ICEKpnINF274-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF274-1 CM the regulation module of ICE ICEKpnINF274-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF274-1 RM the accessory module of ICE ICEKpnINF274-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF274-1 AM Meng LIU (Mia), Oliver He 1213 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1213 58199 bp NZ_CP024834 53.13[57.32] 1396154..1454352 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCRKP-2297-1 the integration and excision module of ICE ICEKpnCRKP-2297-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-2297-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCRKP-2297-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-2297-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCRKP-2297-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-2297-1 IEM for excision the conjugation module of ICE ICEKpnCRKP-2297-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-2297-1 CM the regulation module of ICE ICEKpnCRKP-2297-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-2297-1 RM the accessory module of ICE ICEKpnCRKP-2297-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-2297-1 AM Meng LIU (Mia), Oliver He 1212 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1212 58198 bp NZ_CP024838 53.13[57.32] 4055060..4113257 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCRKP-1215-1 the integration and excision module of ICE ICEKpnCRKP-1215-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-1215-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCRKP-1215-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-1215-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCRKP-1215-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-1215-1 IEM for excision the conjugation module of ICE ICEKpnCRKP-1215-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-1215-1 CM the regulation module of ICE ICEKpnCRKP-1215-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-1215-1 RM the accessory module of ICE ICEKpnCRKP-1215-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-1215-1 AM Meng LIU (Mia), Oliver He 1358 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1358 58197 bp NZ_CP024916 53.13[57.42] 3461245..3519441 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnNH54-1 the integration and excision module of ICE ICEKpnNH54-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH54-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNH54-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH54-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNH54-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH54-1 IEM for excision the conjugation module of ICE ICEKpnNH54-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH54-1 CM the regulation module of ICE ICEKpnNH54-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH54-1 RM the accessory module of ICE ICEKpnNH54-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH54-1 AM Meng LIU (Mia), Oliver He 1175 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1175 54943 bp NZ_CP025005 50.12[57.25] 741716..796658 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAUSMDU00003562-1 the integration and excision module of ICE ICEKpnAUSMDU00003562-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00003562-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAUSMDU00003562-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00003562-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAUSMDU00003562-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00003562-1 IEM for excision the conjugation module of ICE ICEKpnAUSMDU00003562-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00003562-1 CM the regulation module of ICE ICEKpnAUSMDU00003562-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00003562-1 RM the accessory module of ICE ICEKpnAUSMDU00003562-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00003562-1 AM Meng LIU (Mia), Oliver He 1177 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1177 54943 bp NZ_CP025008 50.12[57.32] 740520..795462 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAUSMDU00008119-1 the integration and excision module of ICE ICEKpnAUSMDU00008119-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008119-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAUSMDU00008119-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008119-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAUSMDU00008119-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008119-1 IEM for excision the conjugation module of ICE ICEKpnAUSMDU00008119-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008119-1 CM the regulation module of ICE ICEKpnAUSMDU00008119-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008119-1 RM the accessory module of ICE ICEKpnAUSMDU00008119-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAUSMDU00008119-1 AM Meng LIU (Mia), Oliver He 1362 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1362 54938 bp NZ_CP025037 50.13[57.25] 741894..796831 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnNU-CRE047-1 the integration and excision module of ICE ICEKpnNU-CRE047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNU-CRE047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNU-CRE047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-1 IEM for excision the conjugation module of ICE ICEKpnNU-CRE047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-1 CM the regulation module of ICE ICEKpnNU-CRE047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-1 RM the accessory module of ICE ICEKpnNU-CRE047-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-1 AM Meng LIU (Mia), Oliver He 1363 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1363 109514 bp NZ_CP025037 53.74[57.25] 1912672..2022185 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnNU-CRE047-2 the integration and excision module of ICE ICEKpnNU-CRE047-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNU-CRE047-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNU-CRE047-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-2 IEM for excision the conjugation module of ICE ICEKpnNU-CRE047-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-2 CM the regulation module of ICE ICEKpnNU-CRE047-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-2 RM the accessory module of ICE ICEKpnNU-CRE047-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNU-CRE047-2 AM Meng LIU (Mia), Oliver He 1386 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1386 79159 bp NZ_CP025080 51.41[57.43] 4788591..4867749 putative ICE predicted with ICEfinder tRNA 30006589 ICEKpnSGH10-1 the integration and excision module of ICE ICEKpnSGH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSGH10-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSGH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSGH10-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSGH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSGH10-1 IEM for excision the conjugation module of ICE ICEKpnSGH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSGH10-1 CM the regulation module of ICE ICEKpnSGH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSGH10-1 RM the accessory module of ICE ICEKpnSGH10-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSGH10-1 AM Meng LIU (Mia), Oliver He 1296 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1296 79158 bp NZ_CP025087 51.41[57.51] 302229..381386 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP6-1 the integration and excision module of ICE ICEKpnKP6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP6-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP6-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP6-1 IEM for excision the conjugation module of ICE ICEKpnKP6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP6-1 CM the regulation module of ICE ICEKpnKP6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP6-1 RM the accessory module of ICE ICEKpnKP6-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP6-1 AM Meng LIU (Mia), Oliver He 1299 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1299 79158 bp NZ_CP025088 51.41[57.38] 306011..385168 putative ICE predicted with ICEfinder unpublished ICEKpnKP7-1 the integration and excision module of ICE ICEKpnKP7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-1 IEM for excision the conjugation module of ICE ICEKpnKP7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-1 CM the regulation module of ICE ICEKpnKP7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-1 RM the accessory module of ICE ICEKpnKP7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-1 AM Meng LIU (Mia), Oliver He 1300 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1300 99084 bp NZ_CP025088 53.51[57.38] 3276885..3375968 putative ICE predicted with ICEfinder unpublished ICEKpnKP7-2 the integration and excision module of ICE ICEKpnKP7-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP7-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP7-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-2 IEM for excision the conjugation module of ICE ICEKpnKP7-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-2 CM the regulation module of ICE ICEKpnKP7-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-2 RM the accessory module of ICE ICEKpnKP7-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP7-2 AM Meng LIU (Mia), Oliver He 1303 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1303 92583 bp NZ_CP025090 44.85[57.42] 139457..232039 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP9-1 the integration and excision module of ICE ICEKpnKP9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP9-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP9-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP9-1 IEM for excision the conjugation module of ICE ICEKpnKP9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP9-1 CM the regulation module of ICE ICEKpnKP9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP9-1 RM the accessory module of ICE ICEKpnKP9-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP9-1 AM Meng LIU (Mia), Oliver He 1278 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1278 76619 bp NZ_CP025092 52.03[57.55] 2660688..2737306 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP11-1 the integration and excision module of ICE ICEKpnKP11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP11-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP11-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP11-1 IEM for excision the conjugation module of ICE ICEKpnKP11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP11-1 CM the regulation module of ICE ICEKpnKP11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP11-1 RM the accessory module of ICE ICEKpnKP11-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP11-1 AM Meng LIU (Mia), Oliver He 1279 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1279 104046 bp NZ_CP025093 51.15[57.71] 1787792..1891837 putative ICE predicted with ICEfinder tRNA-phe-2 unpublished ICEKpnKP14-1 the integration and excision module of ICE ICEKpnKP14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP14-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP14-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP14-1 IEM for excision the conjugation module of ICE ICEKpnKP14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP14-1 CM the regulation module of ICE ICEKpnKP14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP14-1 RM the accessory module of ICE ICEKpnKP14-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP14-1 AM Meng LIU (Mia), Oliver He 1298 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1298 58047 bp NZ_CP025456 49.94[57.37] 4694765..4752811 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP69-1 the integration and excision module of ICE ICEKpnKP69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP69-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP69-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP69-1 IEM for excision the conjugation module of ICE ICEKpnKP69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP69-1 CM the regulation module of ICE ICEKpnKP69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP69-1 RM the accessory module of ICE ICEKpnKP69-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP69-1 AM Meng LIU (Mia), Oliver He 1226 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1226 58875 bp NZ_CP025461 49.98[57.38] 4660105..4718979 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF44-1 the integration and excision module of ICE ICEKpnF44-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF44-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF44-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF44-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF44-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF44-1 IEM for excision the conjugation module of ICE ICEKpnF44-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF44-1 CM the regulation module of ICE ICEKpnF44-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF44-1 RM the accessory module of ICE ICEKpnF44-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF44-1 AM Meng LIU (Mia), Oliver He 1258 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1258 62166 bp NZ_CP025466 52.46[57.5] 3461882..3524047 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnJS187-1 the integration and excision module of ICE ICEKpnJS187-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnJS187-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnJS187-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-1 IEM for excision the conjugation module of ICE ICEKpnJS187-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-1 CM the regulation module of ICE ICEKpnJS187-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-1 RM the accessory module of ICE ICEKpnJS187-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-1 AM Meng LIU (Mia), Oliver He 1259 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1259 58048 bp NZ_CP025466 49.94[57.5] 4565787..4623834 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnJS187-2 the integration and excision module of ICE ICEKpnJS187-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnJS187-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnJS187-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-2 IEM for excision the conjugation module of ICE ICEKpnJS187-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-2 CM the regulation module of ICE ICEKpnJS187-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-2 RM the accessory module of ICE ICEKpnJS187-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnJS187-2 AM Meng LIU (Mia), Oliver He 1126 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1126 53441 bp NZ_CP025541 47.56[57.33] 3519217..3572657 putative ICE predicted with ICEfinder tRNA-Asn4 unpublished ICEKpn2N3-1 the integration and excision module of ICE ICEKpn2N3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2N3-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn2N3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2N3-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn2N3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2N3-1 IEM for excision the conjugation module of ICE ICEKpn2N3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2N3-1 CM the regulation module of ICE ICEKpn2N3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2N3-1 RM the accessory module of ICE ICEKpn2N3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2N3-1 AM Meng LIU (Mia), Oliver He 1346 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1346 76619 bp NZ_CP025630 52.03[57.55] 2660576..2737194 putative ICE predicted with ICEfinder tRNA 32393110 ICEKpnLS359-1 the integration and excision module of ICE ICEKpnLS359-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS359-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLS359-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS359-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLS359-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS359-1 IEM for excision the conjugation module of ICE ICEKpnLS359-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS359-1 CM the regulation module of ICE ICEKpnLS359-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS359-1 RM the accessory module of ICE ICEKpnLS359-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS359-1 AM Meng LIU (Mia), Oliver He 1240 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1240 79158 bp NZ_CP025633 51.41[57.4] 533454..612611 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnHS102438-1 the integration and excision module of ICE ICEKpnHS102438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnHS102438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnHS102438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-1 IEM for excision the conjugation module of ICE ICEKpnHS102438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-1 CM the regulation module of ICE ICEKpnHS102438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-1 RM the accessory module of ICE ICEKpnHS102438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-1 AM Meng LIU (Mia), Oliver He 1241 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1241 147005 bp NZ_CP025633 53.5[57.4] 2106923..2253927 putative ICE predicted with ICEfinder unpublished ICEKpnHS102438-2 the integration and excision module of ICE ICEKpnHS102438-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnHS102438-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnHS102438-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-2 IEM for excision the conjugation module of ICE ICEKpnHS102438-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-2 CM the regulation module of ICE ICEKpnHS102438-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-2 RM the accessory module of ICE ICEKpnHS102438-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnHS102438-2 AM Meng LIU (Mia), Oliver He 1111 1111 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1111 92583 bp NZ_CP025639 44.85[57.34] 468487..561069 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnLS357-1 the integration and excision module of ICE ICEKpnLS357-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLS357-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLS357-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-1 IEM for excision the conjugation module of ICE ICEKpnLS357-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-1 CM the regulation module of ICE ICEKpnLS357-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-1 RM the accessory module of ICE ICEKpnLS357-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-1 AM Meng LIU (Mia), Oliver He 1112 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1112 79158 bp NZ_CP025639 51.41[57.34] 729372..808529 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnLS357-2 the integration and excision module of ICE ICEKpnLS357-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLS357-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLS357-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-2 IEM for excision the conjugation module of ICE ICEKpnLS357-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-2 CM the regulation module of ICE ICEKpnLS357-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-2 RM the accessory module of ICE ICEKpnLS357-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-2 AM Meng LIU (Mia), Oliver He 1113 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1113 69206 bp NZ_CP025639 53.35[57.34] 3661462..3730667 putative ICE predicted with ICEfinder unpublished ICEKpnLS357-3 the integration and excision module of ICE ICEKpnLS357-3 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-3 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLS357-3 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-3 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLS357-3 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-3 IEM for excision the conjugation module of ICE ICEKpnLS357-3 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-3 CM the regulation module of ICE ICEKpnLS357-3 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-3 RM the accessory module of ICE ICEKpnLS357-3 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS357-3 AM Meng LIU (Mia), Oliver He 1341 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1341 79158 bp NZ_CP025641 51.41[57.46] 638568..717725 putative ICE predicted with ICEfinder unpublished ICEKpnLS355-1 the integration and excision module of ICE ICEKpnLS355-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLS355-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLS355-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-1 IEM for excision the conjugation module of ICE ICEKpnLS355-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-1 CM the regulation module of ICE ICEKpnLS355-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-1 RM the accessory module of ICE ICEKpnLS355-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-1 AM Meng LIU (Mia), Oliver He 1342 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1342 104574 bp NZ_CP025641 53.69[57.46] 2185383..2289956 putative ICE predicted with ICEfinder tRNA-Asn4 unpublished ICEKpnLS355-2 the integration and excision module of ICE ICEKpnLS355-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLS355-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLS355-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-2 IEM for excision the conjugation module of ICE ICEKpnLS355-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-2 CM the regulation module of ICE ICEKpnLS355-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-2 RM the accessory module of ICE ICEKpnLS355-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLS355-2 AM Meng LIU (Mia), Oliver He 1237 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1237 57208 bp NZ_CP025951 50.24[57.49] 4672706..4729913 putative ICE predicted with ICEfinder tRNA 29424684 ICEKpnGD4-1 the integration and excision module of ICE ICEKpnGD4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGD4-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnGD4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGD4-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnGD4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGD4-1 IEM for excision the conjugation module of ICE ICEKpnGD4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGD4-1 CM the regulation module of ICE ICEKpnGD4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGD4-1 RM the accessory module of ICE ICEKpnGD4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnGD4-1 AM Meng LIU (Mia), Oliver He 1261 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1261 79158 bp NZ_CP026011 51.41[57.68] 4568897..4648054 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnK2044-1 the integration and excision module of ICE ICEKpnK2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2044-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnK2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2044-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnK2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2044-1 IEM for excision the conjugation module of ICE ICEKpnK2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2044-1 CM the regulation module of ICE ICEKpnK2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2044-1 RM the accessory module of ICE ICEKpnK2044-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2044-1 AM Meng LIU (Mia), Oliver He 1222 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1222 56142 bp NZ_CP026130 50.2[57.51] 745273..801414 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF1-1 the integration and excision module of ICE ICEKpnF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF1-1 IEM for excision the conjugation module of ICE ICEKpnF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF1-1 CM the regulation module of ICE ICEKpnF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF1-1 RM the accessory module of ICE ICEKpnF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF1-1 AM Meng LIU (Mia), Oliver He 1227 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1227 56142 bp NZ_CP026132 50.2[57.52] 745401..801542 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF5-1 the integration and excision module of ICE ICEKpnF5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF5-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF5-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF5-1 IEM for excision the conjugation module of ICE ICEKpnF5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF5-1 CM the regulation module of ICE ICEKpnF5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF5-1 RM the accessory module of ICE ICEKpnF5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF5-1 AM Meng LIU (Mia), Oliver He 1228 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1228 56142 bp NZ_CP026136 50.2[57.51] 745404..801545 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF77-1 the integration and excision module of ICE ICEKpnF77-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF77-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF77-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF77-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF77-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF77-1 IEM for excision the conjugation module of ICE ICEKpnF77-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF77-1 CM the regulation module of ICE ICEKpnF77-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF77-1 RM the accessory module of ICE ICEKpnF77-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF77-1 AM Meng LIU (Mia), Oliver He 1223 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1223 56142 bp NZ_CP026140 50.2[57.52] 745273..801414 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF127-1 the integration and excision module of ICE ICEKpnF127-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF127-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF127-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF127-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF127-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF127-1 IEM for excision the conjugation module of ICE ICEKpnF127-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF127-1 CM the regulation module of ICE ICEKpnF127-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF127-1 RM the accessory module of ICE ICEKpnF127-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF127-1 AM Meng LIU (Mia), Oliver He 1224 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1224 56140 bp NZ_CP026145 50.2[57.53] 745382..801521 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF132-1 the integration and excision module of ICE ICEKpnF132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF132-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF132-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF132-1 IEM for excision the conjugation module of ICE ICEKpnF132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF132-1 CM the regulation module of ICE ICEKpnF132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF132-1 RM the accessory module of ICE ICEKpnF132-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF132-1 AM Meng LIU (Mia), Oliver He 1225 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1225 56141 bp NZ_CP026149 50.2[57.51] 746179..802319 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnF138-1 the integration and excision module of ICE ICEKpnF138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF138-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnF138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF138-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnF138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF138-1 IEM for excision the conjugation module of ICE ICEKpnF138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF138-1 CM the regulation module of ICE ICEKpnF138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF138-1 RM the accessory module of ICE ICEKpnF138-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnF138-1 AM Meng LIU (Mia), Oliver He 1178 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1178 54943 bp NZ_CP026155 50.12[57.28] 739377..794319 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnB12-AN-1 the integration and excision module of ICE ICEKpnB12-AN-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnB12-AN-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnB12-AN-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-1 IEM for excision the conjugation module of ICE ICEKpnB12-AN-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-1 CM the regulation module of ICE ICEKpnB12-AN-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-1 RM the accessory module of ICE ICEKpnB12-AN-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-1 AM Meng LIU (Mia), Oliver He 1179 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1179 238167 bp NZ_CP026155 53.96[57.28] 1623163..1861329 putative ICE predicted with ICEfinder unpublished ICEKpnB12-AN-2 the integration and excision module of ICE ICEKpnB12-AN-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnB12-AN-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnB12-AN-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-2 IEM for excision the conjugation module of ICE ICEKpnB12-AN-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-2 CM the regulation module of ICE ICEKpnB12-AN-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-2 RM the accessory module of ICE ICEKpnB12-AN-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnB12-AN-2 AM Meng LIU (Mia), Oliver He 1325 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1325 54806 bp NZ_CP026177 51.43[56.99] 1586780..1641585 putative ICE predicted with ICEfinder tRNA 10.1128/mBio.02011-17 ICEKpnKPNIH50-1 the integration and excision module of ICE ICEKpnKPNIH50-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH50-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH50-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH50-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH50-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH50-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH50-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH50-1 CM the regulation module of ICE ICEKpnKPNIH50-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH50-1 RM the accessory module of ICE ICEKpnKPNIH50-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH50-1 AM Meng LIU (Mia), Oliver He 1324 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1324 56990 bp NZ_CP026392 50.64[57.14] 3657281..3714270 putative ICE predicted with ICEfinder tRNA 10.1128/mBio.02011-17 ICEKpnKPNIH48-1 the integration and excision module of ICE ICEKpnKPNIH48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH48-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH48-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH48-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH48-1 CM the regulation module of ICE ICEKpnKPNIH48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH48-1 RM the accessory module of ICE ICEKpnKPNIH48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH48-1 AM Meng LIU (Mia), Oliver He 1416 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1416 56919 bp NZ_CP026585 50.23[57.4] 744882..801800 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP649-1 the integration and excision module of ICE ICEKpnWCHKP649-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP649-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP649-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP649-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP649-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP649-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP649-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP649-1 CM the regulation module of ICE ICEKpnWCHKP649-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP649-1 RM the accessory module of ICE ICEKpnWCHKP649-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP649-1 AM Meng LIU (Mia), Oliver He 1117 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1117 151942 bp NZ_CP027036 46.87[57.28] 332495..484436 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn16_GR_13-1 the integration and excision module of ICE ICEKpn16_GR_13-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn16_GR_13-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn16_GR_13-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-1 IEM for excision the conjugation module of ICE ICEKpn16_GR_13-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-1 CM the regulation module of ICE ICEKpn16_GR_13-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-1 RM the accessory module of ICE ICEKpn16_GR_13-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-1 AM Meng LIU (Mia), Oliver He 1118 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1118 65616 bp NZ_CP027036 52.01[57.28] 4684844..4750459 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn16_GR_13-2 the integration and excision module of ICE ICEKpn16_GR_13-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn16_GR_13-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn16_GR_13-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-2 IEM for excision the conjugation module of ICE ICEKpn16_GR_13-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-2 CM the regulation module of ICE ICEKpn16_GR_13-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-2 RM the accessory module of ICE ICEKpn16_GR_13-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn16_GR_13-2 AM Meng LIU (Mia), Oliver He 1122 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1122 56143 bp NZ_CP027048 50.2[57.36] 741671..797813 putative ICE predicted with ICEfinder tRNA 32016399 ICEKpn20_GR_12-1 the integration and excision module of ICE ICEKpn20_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn20_GR_12-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn20_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn20_GR_12-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn20_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn20_GR_12-1 IEM for excision the conjugation module of ICE ICEKpn20_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn20_GR_12-1 CM the regulation module of ICE ICEKpn20_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn20_GR_12-1 RM the accessory module of ICE ICEKpn20_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn20_GR_12-1 AM Meng LIU (Mia), Oliver He 1121 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1121 56142 bp NZ_CP027053 50.2[57.3] 4851907..4908048 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn2_GR_12-1 the integration and excision module of ICE ICEKpn2_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2_GR_12-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn2_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2_GR_12-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn2_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2_GR_12-1 IEM for excision the conjugation module of ICE ICEKpn2_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2_GR_12-1 CM the regulation module of ICE ICEKpn2_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2_GR_12-1 RM the accessory module of ICE ICEKpn2_GR_12-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2_GR_12-1 AM Meng LIU (Mia), Oliver He 1419 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1419 57449 bp NZ_CP027068 50.27[57.41] 745237..802685 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP8F4-1 the integration and excision module of ICE ICEKpnWCHKP8F4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP8F4-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP8F4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP8F4-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP8F4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP8F4-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP8F4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP8F4-1 CM the regulation module of ICE ICEKpnWCHKP8F4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP8F4-1 RM the accessory module of ICE ICEKpnWCHKP8F4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP8F4-1 AM Meng LIU (Mia), Oliver He 1171 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1171 54943 bp NZ_CP027146 50.12[57.52] 3001647..3056589 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0363-1 the integration and excision module of ICE ICEKpnAR_0363-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0363-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0363-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0363-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0363-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0363-1 IEM for excision the conjugation module of ICE ICEKpnAR_0363-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0363-1 CM the regulation module of ICE ICEKpnAR_0363-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0363-1 RM the accessory module of ICE ICEKpnAR_0363-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0363-1 AM Meng LIU (Mia), Oliver He 1170 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1170 59249 bp NZ_CP027160 50.01[57.59] 3450254..3509502 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0361-1 the integration and excision module of ICE ICEKpnAR_0361-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0361-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0361-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0361-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0361-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0361-1 IEM for excision the conjugation module of ICE ICEKpnAR_0361-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0361-1 CM the regulation module of ICE ICEKpnAR_0361-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0361-1 RM the accessory module of ICE ICEKpnAR_0361-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0361-1 AM Meng LIU (Mia), Oliver He 1310 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1310 79158 bp NZ_CP027189 51.41[57.44] 205362..284519 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKPHS1249-1 the integration and excision module of ICE ICEKpnKPHS1249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPHS1249-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPHS1249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPHS1249-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPHS1249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPHS1249-1 IEM for excision the conjugation module of ICE ICEKpnKPHS1249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPHS1249-1 CM the regulation module of ICE ICEKpnKPHS1249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPHS1249-1 RM the accessory module of ICE ICEKpnKPHS1249-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPHS1249-1 AM Meng LIU (Mia), Oliver He 1287 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1287 58032 bp NZ_CP027697 49.95[57.36] 4516859..4574890 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP30835-1 the integration and excision module of ICE ICEKpnKP30835-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP30835-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP30835-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP30835-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP30835-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP30835-1 IEM for excision the conjugation module of ICE ICEKpnKP30835-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP30835-1 CM the regulation module of ICE ICEKpnKP30835-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP30835-1 RM the accessory module of ICE ICEKpnKP30835-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP30835-1 AM Meng LIU (Mia), Oliver He 1205 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1205 54943 bp NZ_CP028180 50.13[57.35] 854187..909129 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCFSAN054110-1 the integration and excision module of ICE ICEKpnCFSAN054110-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCFSAN054110-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCFSAN054110-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCFSAN054110-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCFSAN054110-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCFSAN054110-1 IEM for excision the conjugation module of ICE ICEKpnCFSAN054110-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCFSAN054110-1 CM the regulation module of ICE ICEKpnCFSAN054110-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCFSAN054110-1 RM the accessory module of ICE ICEKpnCFSAN054110-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCFSAN054110-1 AM Meng LIU (Mia), Oliver He 1410 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1410 80748 bp NZ_CP028391 50.53[57.47] 1768391..1849138 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP13F2-1 the integration and excision module of ICE ICEKpnWCHKP13F2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP13F2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP13F2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP13F2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-1 CM the regulation module of ICE ICEKpnWCHKP13F2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-1 RM the accessory module of ICE ICEKpnWCHKP13F2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-1 AM Meng LIU (Mia), Oliver He 1411 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1411 62186 bp NZ_CP028391 52.34[57.47] 1867377..1929562 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP13F2-2 the integration and excision module of ICE ICEKpnWCHKP13F2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP13F2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP13F2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-2 IEM for excision the conjugation module of ICE ICEKpnWCHKP13F2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-2 CM the regulation module of ICE ICEKpnWCHKP13F2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-2 RM the accessory module of ICE ICEKpnWCHKP13F2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP13F2-2 AM Meng LIU (Mia), Oliver He 1413 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1413 59084 bp NZ_CP028542 49.98[57.38] 4272131..4331214 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP2-1 the integration and excision module of ICE ICEKpnWCHKP2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2-1 CM the regulation module of ICE ICEKpnWCHKP2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2-1 RM the accessory module of ICE ICEKpnWCHKP2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2-1 AM Meng LIU (Mia), Oliver He 1383 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1383 56142 bp NZ_CP028548 50.2[57.56] 745440..801581 putative ICE predicted with ICEfinder tRNA 30962338 ICEKpnSCKP020143-1 the integration and excision module of ICE ICEKpnSCKP020143-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020143-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSCKP020143-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020143-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSCKP020143-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020143-1 IEM for excision the conjugation module of ICE ICEKpnSCKP020143-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020143-1 CM the regulation module of ICE ICEKpnSCKP020143-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020143-1 RM the accessory module of ICE ICEKpnSCKP020143-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020143-1 AM Meng LIU (Mia), Oliver He 1415 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1415 56142 bp NZ_CP028583 50.2[57.4] 746896..803037 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP36-1 the integration and excision module of ICE ICEKpnWCHKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP36-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP36-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP36-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP36-1 CM the regulation module of ICE ICEKpnWCHKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP36-1 RM the accessory module of ICE ICEKpnWCHKP36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP36-1 AM Meng LIU (Mia), Oliver He 1385 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1385 58200 bp NZ_CP028716 53.13[57.38] 4084953..4143152 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1016/j.diagmicrobio.2018.11.007 ICEKpnSCM96-1 the integration and excision module of ICE ICEKpnSCM96-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCM96-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSCM96-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCM96-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSCM96-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCM96-1 IEM for excision the conjugation module of ICE ICEKpnSCM96-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCM96-1 CM the regulation module of ICE ICEKpnSCM96-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCM96-1 RM the accessory module of ICE ICEKpnSCM96-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCM96-1 AM Meng LIU (Mia), Oliver He 1381 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1381 54944 bp NZ_CP028783 50.13[57.42] 741507..796450 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnSCKP020046-1 the integration and excision module of ICE ICEKpnSCKP020046-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020046-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSCKP020046-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020046-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSCKP020046-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020046-1 IEM for excision the conjugation module of ICE ICEKpnSCKP020046-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020046-1 CM the regulation module of ICE ICEKpnSCKP020046-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020046-1 RM the accessory module of ICE ICEKpnSCKP020046-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020046-1 AM Meng LIU (Mia), Oliver He 1404 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1404 56142 bp NZ_CP028793 50.2[57.55] 780312..836453 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP020030-1 the integration and excision module of ICE ICEKpnWCHKP020030-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020030-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP020030-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020030-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP020030-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020030-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP020030-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020030-1 CM the regulation module of ICE ICEKpnWCHKP020030-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020030-1 RM the accessory module of ICE ICEKpnWCHKP020030-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020030-1 AM Meng LIU (Mia), Oliver He 1407 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1407 68121 bp NZ_CP028797 51.33[57.39] 744852..812972 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP040035-1 the integration and excision module of ICE ICEKpnWCHKP040035-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP040035-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP040035-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP040035-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP040035-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP040035-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP040035-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP040035-1 CM the regulation module of ICE ICEKpnWCHKP040035-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP040035-1 RM the accessory module of ICE ICEKpnWCHKP040035-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP040035-1 AM Meng LIU (Mia), Oliver He 1417 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1417 56250 bp NZ_CP028806 50.2[57.37] 740844..797093 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP7E2-1 the integration and excision module of ICE ICEKpnWCHKP7E2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP7E2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP7E2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP7E2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-1 CM the regulation module of ICE ICEKpnWCHKP7E2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-1 RM the accessory module of ICE ICEKpnWCHKP7E2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-1 AM Meng LIU (Mia), Oliver He 1418 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1418 65326 bp NZ_CP028806 52[57.37] 1806441..1871766 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP7E2-2 the integration and excision module of ICE ICEKpnWCHKP7E2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP7E2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP7E2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-2 IEM for excision the conjugation module of ICE ICEKpnWCHKP7E2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-2 CM the regulation module of ICE ICEKpnWCHKP7E2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-2 RM the accessory module of ICE ICEKpnWCHKP7E2-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP7E2-2 AM Meng LIU (Mia), Oliver He 1294 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1294 49463 bp NZ_CP028816 49.92[57.23] 739279..788741 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp589-1 the integration and excision module of ICE ICEKpnKp589-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp589-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp589-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-1 IEM for excision the conjugation module of ICE ICEKpnKp589-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-1 CM the regulation module of ICE ICEKpnKp589-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-1 RM the accessory module of ICE ICEKpnKp589-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-1 AM Meng LIU (Mia), Oliver He 1295 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1295 267964 bp NZ_CP028816 53.81[57.23] 1643344..1911307 putative ICE predicted with ICEfinder unpublished ICEKpnKp589-2 the integration and excision module of ICE ICEKpnKp589-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp589-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp589-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-2 IEM for excision the conjugation module of ICE ICEKpnKp589-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-2 CM the regulation module of ICE ICEKpnKp589-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-2 RM the accessory module of ICE ICEKpnKp589-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp589-2 AM Meng LIU (Mia), Oliver He 1168 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1168 66224 bp NZ_CP028932 52.36[57.5] 956807..1023030 putative ICE predicted with ICEfinder unpublished ICEKpnAR_0153-1 the integration and excision module of ICE ICEKpnAR_0153-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0153-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0153-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0153-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0153-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0153-1 IEM for excision the conjugation module of ICE ICEKpnAR_0153-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0153-1 CM the regulation module of ICE ICEKpnAR_0153-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0153-1 RM the accessory module of ICE ICEKpnAR_0153-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0153-1 AM Meng LIU (Mia), Oliver He 1148 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1148 92344 bp NZ_CP028994 50.7[57.19] 3941145..4033488 putative ICE predicted with ICEfinder unpublished ICEKpnAR_0079-1 the integration and excision module of ICE ICEKpnAR_0079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-1 IEM for excision the conjugation module of ICE ICEKpnAR_0079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-1 CM the regulation module of ICE ICEKpnAR_0079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-1 RM the accessory module of ICE ICEKpnAR_0079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-1 AM Meng LIU (Mia), Oliver He 1149 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1149 58048 bp NZ_CP028994 49.94[57.19] 5226674..5284721 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0079-2 the integration and excision module of ICE ICEKpnAR_0079-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0079-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0079-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-2 IEM for excision the conjugation module of ICE ICEKpnAR_0079-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-2 CM the regulation module of ICE ICEKpnAR_0079-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-2 RM the accessory module of ICE ICEKpnAR_0079-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0079-2 AM Meng LIU (Mia), Oliver He 1173 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1173 54943 bp NZ_CP029099 50.12[57.34] 742744..797686 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR438-1 the integration and excision module of ICE ICEKpnAR438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR438-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR438-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR438-1 IEM for excision the conjugation module of ICE ICEKpnAR438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR438-1 CM the regulation module of ICE ICEKpnAR438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR438-1 RM the accessory module of ICE ICEKpnAR438-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR438-1 AM Meng LIU (Mia), Oliver He 1337 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1337 59247 bp NZ_CP029220 50.02[57.26] 2086470..2145716 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnL388-1 the integration and excision module of ICE ICEKpnL388-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL388-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnL388-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL388-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnL388-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL388-1 IEM for excision the conjugation module of ICE ICEKpnL388-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL388-1 CM the regulation module of ICE ICEKpnL388-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL388-1 RM the accessory module of ICE ICEKpnL388-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL388-1 AM Meng LIU (Mia), Oliver He 1340 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1340 56248 bp NZ_CP029226 50.2[57.3] 1313394..1369641 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnL491-1 the integration and excision module of ICE ICEKpnL491-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL491-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnL491-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL491-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnL491-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL491-1 IEM for excision the conjugation module of ICE ICEKpnL491-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL491-1 CM the regulation module of ICE ICEKpnL491-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL491-1 RM the accessory module of ICE ICEKpnL491-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL491-1 AM Meng LIU (Mia), Oliver He 1382 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1382 56142 bp NZ_CP029384 50.2[57.32] 746731..802872 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnSCKP020079-1 the integration and excision module of ICE ICEKpnSCKP020079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020079-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSCKP020079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020079-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSCKP020079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020079-1 IEM for excision the conjugation module of ICE ICEKpnSCKP020079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020079-1 CM the regulation module of ICE ICEKpnSCKP020079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020079-1 RM the accessory module of ICE ICEKpnSCKP020079-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP020079-1 AM Meng LIU (Mia), Oliver He 1384 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1384 61770 bp NZ_CP029388 51.34[57.52] 1587852..1649621 putative ICE predicted with ICEfinder unpublished ICEKpnSCKP040074-1 the integration and excision module of ICE ICEKpnSCKP040074-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP040074-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSCKP040074-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP040074-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSCKP040074-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP040074-1 IEM for excision the conjugation module of ICE ICEKpnSCKP040074-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP040074-1 CM the regulation module of ICE ICEKpnSCKP040074-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP040074-1 RM the accessory module of ICE ICEKpnSCKP040074-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSCKP040074-1 AM Meng LIU (Mia), Oliver He 1217 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1217 98927 bp NZ_CP029582 50.35[57.27] 100348..199274 putative ICE predicted with ICEfinder 30742072 ICEKpnDA33140-1 the integration and excision module of ICE ICEKpnDA33140-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA33140-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnDA33140-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA33140-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnDA33140-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA33140-1 IEM for excision the conjugation module of ICE ICEKpnDA33140-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA33140-1 CM the regulation module of ICE ICEKpnDA33140-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA33140-1 RM the accessory module of ICE ICEKpnDA33140-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnDA33140-1 AM Meng LIU (Mia), Oliver He 1119 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1119 59353 bp NZ_CP029689 50.02[57.41] 1412270..1471622 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn160111-1 the integration and excision module of ICE ICEKpn160111-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn160111-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn160111-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn160111-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn160111-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn160111-1 IEM for excision the conjugation module of ICE ICEKpn160111-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn160111-1 CM the regulation module of ICE ICEKpn160111-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn160111-1 RM the accessory module of ICE ICEKpn160111-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn160111-1 AM Meng LIU (Mia), Oliver He 1150 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1150 80853 bp NZ_CP029738 52.65[57.56] 3997336..4078188 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0087-1 the integration and excision module of ICE ICEKpnAR_0087-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0087-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0087-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0087-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0087-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0087-1 IEM for excision the conjugation module of ICE ICEKpnAR_0087-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0087-1 CM the regulation module of ICE ICEKpnAR_0087-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0087-1 RM the accessory module of ICE ICEKpnAR_0087-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0087-1 AM Meng LIU (Mia), Oliver He 1114 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1114 62166 bp NZ_CP030172 52.46[57.59] 1728573..1790738 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn12208-1 the integration and excision module of ICE ICEKpn12208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn12208-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn12208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn12208-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn12208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn12208-1 IEM for excision the conjugation module of ICE ICEKpn12208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn12208-1 CM the regulation module of ICE ICEKpn12208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn12208-1 RM the accessory module of ICE ICEKpn12208-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn12208-1 AM Meng LIU (Mia), Oliver He 1380 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1380 79158 bp NZ_CP030269 51.41[57.56] 2813411..2892568 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnSC-7-1 the integration and excision module of ICE ICEKpnSC-7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSC-7-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSC-7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSC-7-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSC-7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSC-7-1 IEM for excision the conjugation module of ICE ICEKpnSC-7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSC-7-1 CM the regulation module of ICE ICEKpnSC-7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSC-7-1 RM the accessory module of ICE ICEKpnSC-7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSC-7-1 AM Meng LIU (Mia), Oliver He 1172 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1172 54943 bp NZ_CP030341 50.12[57.41] 1033304..1088246 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_362-1 the integration and excision module of ICE ICEKpnAR_362-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_362-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_362-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_362-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_362-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_362-1 IEM for excision the conjugation module of ICE ICEKpnAR_362-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_362-1 CM the regulation module of ICE ICEKpnAR_362-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_362-1 RM the accessory module of ICE ICEKpnAR_362-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_362-1 AM Meng LIU (Mia), Oliver He 1327 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1327 64552 bp NZ_CP031368 51.99[57.14] 5231460..5296011 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKpvST101_OXA-48-1 the integration and excision module of ICE ICEKpnKpvST101_OXA-48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST101_OXA-48-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKpvST101_OXA-48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST101_OXA-48-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKpvST101_OXA-48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST101_OXA-48-1 IEM for excision the conjugation module of ICE ICEKpnKpvST101_OXA-48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST101_OXA-48-1 CM the regulation module of ICE ICEKpnKpvST101_OXA-48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST101_OXA-48-1 RM the accessory module of ICE ICEKpnKpvST101_OXA-48-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST101_OXA-48-1 AM Meng LIU (Mia), Oliver He 1125 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1125 54943 bp NZ_CP031562 50.12[57.57] 739347..794289 putative ICE predicted with ICEfinder tRNA 30662878 ICEKpn2-1-1 the integration and excision module of ICE ICEKpn2-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2-1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn2-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2-1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn2-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2-1-1 IEM for excision the conjugation module of ICE ICEKpn2-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2-1-1 CM the regulation module of ICE ICEKpn2-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2-1-1 RM the accessory module of ICE ICEKpn2-1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2-1-1 AM Meng LIU (Mia), Oliver He 1414 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1414 56142 bp NZ_CP031721 50.2[57.4] 744881..801022 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP3-1 the integration and excision module of ICE ICEKpnWCHKP3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP3-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP3-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP3-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP3-1 CM the regulation module of ICE ICEKpnWCHKP3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP3-1 RM the accessory module of ICE ICEKpnWCHKP3-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP3-1 AM Meng LIU (Mia), Oliver He 1246 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1246 58199 bp NZ_CP031795 53.14[57.52] 1818220..1876418 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnINF125-1 the integration and excision module of ICE ICEKpnINF125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF125-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF125-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF125-1 IEM for excision the conjugation module of ICE ICEKpnINF125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF125-1 CM the regulation module of ICE ICEKpnINF125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF125-1 RM the accessory module of ICE ICEKpnINF125-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF125-1 AM Meng LIU (Mia), Oliver He 1420 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1420 54942 bp NZ_CP032163 50.13[57.33] 746429..801370 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnXJ-K1-1 the integration and excision module of ICE ICEKpnXJ-K1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnXJ-K1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnXJ-K1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K1-1 IEM for excision the conjugation module of ICE ICEKpnXJ-K1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K1-1 CM the regulation module of ICE ICEKpnXJ-K1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K1-1 RM the accessory module of ICE ICEKpnXJ-K1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K1-1 AM Meng LIU (Mia), Oliver He 1147 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1147 42031 bp NZ_CP032167 47.37[57.63] 1396218..1438248 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0076-1 the integration and excision module of ICE ICEKpnAR_0076-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0076-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0076-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0076-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0076-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0076-1 IEM for excision the conjugation module of ICE ICEKpnAR_0076-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0076-1 CM the regulation module of ICE ICEKpnAR_0076-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0076-1 RM the accessory module of ICE ICEKpnAR_0076-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0076-1 AM Meng LIU (Mia), Oliver He 1169 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1169 58976 bp NZ_CP032175 53.13[57.43] 218847..277822 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0160-1 the integration and excision module of ICE ICEKpnAR_0160-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0160-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0160-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0160-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0160-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0160-1 IEM for excision the conjugation module of ICE ICEKpnAR_0160-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0160-1 CM the regulation module of ICE ICEKpnAR_0160-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0160-1 RM the accessory module of ICE ICEKpnAR_0160-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0160-1 AM Meng LIU (Mia), Oliver He 1160 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1160 64550 bp NZ_CP032178 51.99[57.27] 5331010..5395559 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAR_0135-1 the integration and excision module of ICE ICEKpnAR_0135-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0135-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0135-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0135-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0135-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0135-1 IEM for excision the conjugation module of ICE ICEKpnAR_0135-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0135-1 CM the regulation module of ICE ICEKpnAR_0135-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0135-1 RM the accessory module of ICE ICEKpnAR_0135-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0135-1 AM Meng LIU (Mia), Oliver He 1146 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1146 64536 bp NZ_CP032185 51.99[57.5] 2959067..3023602 putative ICE predicted with ICEfinder unpublished ICEKpnAR_0075-1 the integration and excision module of ICE ICEKpnAR_0075-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0075-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAR_0075-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0075-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAR_0075-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0075-1 IEM for excision the conjugation module of ICE ICEKpnAR_0075-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0075-1 CM the regulation module of ICE ICEKpnAR_0075-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0075-1 RM the accessory module of ICE ICEKpnAR_0075-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAR_0075-1 AM Meng LIU (Mia), Oliver He 1421 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1421 56142 bp NZ_CP032240 50.2[57.31] 748768..804909 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnXJ-K2-1 the integration and excision module of ICE ICEKpnXJ-K2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnXJ-K2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnXJ-K2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K2-1 IEM for excision the conjugation module of ICE ICEKpnXJ-K2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K2-1 CM the regulation module of ICE ICEKpnXJ-K2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K2-1 RM the accessory module of ICE ICEKpnXJ-K2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnXJ-K2-1 AM Meng LIU (Mia), Oliver He 1251 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1251 57643 bp NZ_CP032833 54.17[57.13] 440905..498547 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnINF237-1 the integration and excision module of ICE ICEKpnINF237-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF237-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnINF237-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF237-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnINF237-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF237-1 IEM for excision the conjugation module of ICE ICEKpnINF237-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF237-1 CM the regulation module of ICE ICEKpnINF237-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF237-1 RM the accessory module of ICE ICEKpnINF237-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnINF237-1 AM Meng LIU (Mia), Oliver He 1137 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1137 55781 bp NZ_CP033242 50.15[57.32] 4891492..4947272 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn675920-1 the integration and excision module of ICE ICEKpn675920-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn675920-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn675920-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn675920-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn675920-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn675920-1 IEM for excision the conjugation module of ICE ICEKpn675920-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn675920-1 CM the regulation module of ICE ICEKpn675920-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn675920-1 RM the accessory module of ICE ICEKpn675920-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn675920-1 AM Meng LIU (Mia), Oliver He 1403 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1403 56142 bp NZ_CP033396 50.2[57.4] 746887..803028 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP015625-1 the integration and excision module of ICE ICEKpnWCHKP015625-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015625-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP015625-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015625-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP015625-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015625-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP015625-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015625-1 CM the regulation module of ICE ICEKpnWCHKP015625-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015625-1 RM the accessory module of ICE ICEKpnWCHKP015625-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015625-1 AM Meng LIU (Mia), Oliver He 1409 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1409 56142 bp NZ_CP033405 50.2[57.41] 743684..799825 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP115069-1 the integration and excision module of ICE ICEKpnWCHKP115069-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115069-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP115069-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115069-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP115069-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115069-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP115069-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115069-1 CM the regulation module of ICE ICEKpnWCHKP115069-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115069-1 RM the accessory module of ICE ICEKpnWCHKP115069-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115069-1 AM Meng LIU (Mia), Oliver He 1132 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1132 64550 bp NZ_CP033625 51.99[57.28] 1858533..1923082 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn4743-1 the integration and excision module of ICE ICEKpn4743-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4743-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn4743-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4743-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn4743-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4743-1 IEM for excision the conjugation module of ICE ICEKpn4743-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4743-1 CM the regulation module of ICE ICEKpn4743-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4743-1 RM the accessory module of ICE ICEKpn4743-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4743-1 AM Meng LIU (Mia), Oliver He 1234 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1234 57723 bp NZ_CP033756 50.28[57.43] 1823158..1880880 putative ICE predicted with ICEfinder tRNA https://doi.org/10.1038/s41467-019-11306-6 ICEKpnFDAARGOS_566-1 the integration and excision module of ICE ICEKpnFDAARGOS_566-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_566-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_566-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_566-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_566-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_566-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_566-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_566-1 CM the regulation module of ICE ICEKpnFDAARGOS_566-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_566-1 RM the accessory module of ICE ICEKpnFDAARGOS_566-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_566-1 AM Meng LIU (Mia), Oliver He 1233 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1233 64581 bp NZ_CP033777 52.11[57.44] 2510771..2575351 putative ICE predicted with ICEfinder https://doi.org/10.1038/s41467-019-11306-7 ICEKpnFDAARGOS_531-1 the integration and excision module of ICE ICEKpnFDAARGOS_531-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_531-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_531-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_531-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_531-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_531-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_531-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_531-1 CM the regulation module of ICE ICEKpnFDAARGOS_531-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_531-1 RM the accessory module of ICE ICEKpnFDAARGOS_531-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_531-1 AM Meng LIU (Mia), Oliver He 1338 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1338 56919 bp NZ_CP033954 50.23[57.34] 745510..802428 putative ICE predicted with ICEfinder tRNA 32576652 ICEKpnL39_2-1 the integration and excision module of ICE ICEKpnL39_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL39_2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnL39_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL39_2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnL39_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL39_2-1 IEM for excision the conjugation module of ICE ICEKpnL39_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL39_2-1 CM the regulation module of ICE ICEKpnL39_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL39_2-1 RM the accessory module of ICE ICEKpnL39_2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL39_2-1 AM Meng LIU (Mia), Oliver He 1339 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1339 54942 bp NZ_CP033960 50.13[57.38] 794470..849411 putative ICE predicted with ICEfinder tRNA 32576652 ICEKpnL482-1 the integration and excision module of ICE ICEKpnL482-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL482-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnL482-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL482-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnL482-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL482-1 IEM for excision the conjugation module of ICE ICEKpnL482-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL482-1 CM the regulation module of ICE ICEKpnL482-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL482-1 RM the accessory module of ICE ICEKpnL482-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnL482-1 AM Meng LIU (Mia), Oliver He 1211 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1211 56249 bp NZ_CP034039 50.2[57.33] 747649..803897 putative ICE predicted with ICEfinder tRNA submitted ICEKpnCRK0298-1 the integration and excision module of ICE ICEKpnCRK0298-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRK0298-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCRK0298-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRK0298-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCRK0298-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRK0298-1 IEM for excision the conjugation module of ICE ICEKpnCRK0298-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRK0298-1 CM the regulation module of ICE ICEKpnCRK0298-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRK0298-1 RM the accessory module of ICE ICEKpnCRK0298-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRK0298-1 AM Meng LIU (Mia), Oliver He 1276 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1276 58198 bp NZ_CP034045 53.13[57.43] 1831053..1889250 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP_NORM_BLD_2014_104014-1 the integration and excision module of ICE ICEKpnKP_NORM_BLD_2014_104014-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2014_104014-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP_NORM_BLD_2014_104014-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2014_104014-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP_NORM_BLD_2014_104014-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2014_104014-1 IEM for excision the conjugation module of ICE ICEKpnKP_NORM_BLD_2014_104014-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2014_104014-1 CM the regulation module of ICE ICEKpnKP_NORM_BLD_2014_104014-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2014_104014-1 RM the accessory module of ICE ICEKpnKP_NORM_BLD_2014_104014-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2014_104014-1 AM Meng LIU (Mia), Oliver He 1277 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1277 58199 bp NZ_CP034053 53.13[57.48] 1796023..1854221 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP_NORM_BLD_2015_112126-1 the integration and excision module of ICE ICEKpnKP_NORM_BLD_2015_112126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2015_112126-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP_NORM_BLD_2015_112126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2015_112126-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP_NORM_BLD_2015_112126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2015_112126-1 IEM for excision the conjugation module of ICE ICEKpnKP_NORM_BLD_2015_112126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2015_112126-1 CM the regulation module of ICE ICEKpnKP_NORM_BLD_2015_112126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2015_112126-1 RM the accessory module of ICE ICEKpnKP_NORM_BLD_2015_112126-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP_NORM_BLD_2015_112126-1 AM Meng LIU (Mia), Oliver He 1280 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1280 99037 bp NZ_CP034076 50.32[57.32] 1819752..1918788 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP17-15-1 the integration and excision module of ICE ICEKpnKP17-15-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-15-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP17-15-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-15-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP17-15-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-15-1 IEM for excision the conjugation module of ICE ICEKpnKP17-15-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-15-1 CM the regulation module of ICE ICEKpnKP17-15-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-15-1 RM the accessory module of ICE ICEKpnKP17-15-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-15-1 AM Meng LIU (Mia), Oliver He 1281 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1281 99037 bp NZ_CP034077 50.32[57.32] 1819752..1918788 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP17-16-1 the integration and excision module of ICE ICEKpnKP17-16-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-16-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP17-16-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-16-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP17-16-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-16-1 IEM for excision the conjugation module of ICE ICEKpnKP17-16-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-16-1 CM the regulation module of ICE ICEKpnKP17-16-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-16-1 RM the accessory module of ICE ICEKpnKP17-16-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP17-16-1 AM Meng LIU (Mia), Oliver He 1374 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1374 79158 bp NZ_CP034082 51.41[57.46] 4784789..4863946 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnR210-2-1 the integration and excision module of ICE ICEKpnR210-2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR210-2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnR210-2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR210-2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnR210-2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR210-2-1 IEM for excision the conjugation module of ICE ICEKpnR210-2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR210-2-1 CM the regulation module of ICE ICEKpnR210-2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR210-2-1 RM the accessory module of ICE ICEKpnR210-2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR210-2-1 AM Meng LIU (Mia), Oliver He 1184 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1184 56919 bp NZ_CP034123 50.23[57.35] 745498..802416 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBJCFK909-1 the integration and excision module of ICE ICEKpnBJCFK909-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBJCFK909-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBJCFK909-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBJCFK909-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBJCFK909-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBJCFK909-1 IEM for excision the conjugation module of ICE ICEKpnBJCFK909-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBJCFK909-1 CM the regulation module of ICE ICEKpnBJCFK909-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBJCFK909-1 RM the accessory module of ICE ICEKpnBJCFK909-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBJCFK909-1 AM Meng LIU (Mia), Oliver He 1283 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1283 54944 bp NZ_CP034249 50.12[57.48] 741300..796243 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP18-29-1 the integration and excision module of ICE ICEKpnKP18-29-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-29-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP18-29-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-29-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP18-29-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-29-1 IEM for excision the conjugation module of ICE ICEKpnKP18-29-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-29-1 CM the regulation module of ICE ICEKpnKP18-29-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-29-1 RM the accessory module of ICE ICEKpnKP18-29-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-29-1 AM Meng LIU (Mia), Oliver He 1331 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1331 58047 bp NZ_CP034327 49.94[57.47] 1540276..1598322 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKSH203-1 the integration and excision module of ICE ICEKpnKSH203-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSH203-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKSH203-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSH203-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKSH203-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSH203-1 IEM for excision the conjugation module of ICE ICEKpnKSH203-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSH203-1 CM the regulation module of ICE ICEKpnKSH203-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSH203-1 RM the accessory module of ICE ICEKpnKSH203-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKSH203-1 AM Meng LIU (Mia), Oliver He 1357 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1357 66221 bp NZ_CP034408 52.35[57.41] 1652090..1718310 putative ICE predicted with ICEfinder unpublished ICEKpnNH34-1 the integration and excision module of ICE ICEKpnNH34-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH34-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNH34-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH34-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNH34-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH34-1 IEM for excision the conjugation module of ICE ICEKpnNH34-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH34-1 CM the regulation module of ICE ICEKpnNH34-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH34-1 RM the accessory module of ICE ICEKpnNH34-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNH34-1 AM Meng LIU (Mia), Oliver He 1195 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1195 56142 bp NZ_CP034415 50.2[57.34] 744981..801122 putative ICE predicted with ICEfinder tRNA 31713615 ICEKpnC789-1 the integration and excision module of ICE ICEKpnC789-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC789-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnC789-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC789-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnC789-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC789-1 IEM for excision the conjugation module of ICE ICEKpnC789-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC789-1 CM the regulation module of ICE ICEKpnC789-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC789-1 RM the accessory module of ICE ICEKpnC789-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC789-1 AM Meng LIU (Mia), Oliver He 1192 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1192 54942 bp NZ_CP034420 50.12[57.33] 3952975..4007916 putative ICE predicted with ICEfinder tRNA 31713615 ICEKpnC1398-1 the integration and excision module of ICE ICEKpnC1398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC1398-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnC1398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC1398-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnC1398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC1398-1 IEM for excision the conjugation module of ICE ICEKpnC1398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC1398-1 CM the regulation module of ICE ICEKpnC1398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC1398-1 RM the accessory module of ICE ICEKpnC1398-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC1398-1 AM Meng LIU (Mia), Oliver He 1356 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1356 54943 bp NZ_CP034760 50.12[57.62] 739376..794318 putative ICE predicted with ICEfinder tRNA 32724486 ICEKpnNB5306-1 the integration and excision module of ICE ICEKpnNB5306-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNB5306-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNB5306-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNB5306-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNB5306-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNB5306-1 IEM for excision the conjugation module of ICE ICEKpnNB5306-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNB5306-1 CM the regulation module of ICE ICEKpnNB5306-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNB5306-1 RM the accessory module of ICE ICEKpnNB5306-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNB5306-1 AM Meng LIU (Mia), Oliver He 1120 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1120 63244 bp NZ_CP034778 52.35[57.45] 1797187..1860430 putative ICE predicted with ICEfinder tRNA 30988151 ICEKpn18CPO060-1 the integration and excision module of ICE ICEKpn18CPO060-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn18CPO060-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn18CPO060-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn18CPO060-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn18CPO060-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn18CPO060-1 IEM for excision the conjugation module of ICE ICEKpn18CPO060-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn18CPO060-1 CM the regulation module of ICE ICEKpn18CPO060-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn18CPO060-1 RM the accessory module of ICE ICEKpn18CPO060-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn18CPO060-1 AM Meng LIU (Mia), Oliver He 1182 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1182 64538 bp NZ_CP035179 52[56.99] 75155..139692 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBA33875-1 the integration and excision module of ICE ICEKpnBA33875-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA33875-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBA33875-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA33875-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBA33875-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA33875-1 IEM for excision the conjugation module of ICE ICEKpnBA33875-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA33875-1 CM the regulation module of ICE ICEKpnBA33875-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA33875-1 RM the accessory module of ICE ICEKpnBA33875-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA33875-1 AM Meng LIU (Mia), Oliver He 1143 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1143 82673 bp NZ_CP035383 51.5[57.45] 4780731..4863403 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnAP8555-1 the integration and excision module of ICE ICEKpnAP8555-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAP8555-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnAP8555-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAP8555-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnAP8555-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAP8555-1 IEM for excision the conjugation module of ICE ICEKpnAP8555-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAP8555-1 CM the regulation module of ICE ICEKpnAP8555-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAP8555-1 RM the accessory module of ICE ICEKpnAP8555-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnAP8555-1 AM Meng LIU (Mia), Oliver He 1203 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1203 54942 bp NZ_CP035540 50.12[57.51] 739390..794331 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCCRI-22199-1 the integration and excision module of ICE ICEKpnCCRI-22199-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCRI-22199-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCCRI-22199-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCRI-22199-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCCRI-22199-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCRI-22199-1 IEM for excision the conjugation module of ICE ICEKpnCCRI-22199-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCRI-22199-1 CM the regulation module of ICE ICEKpnCCRI-22199-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCRI-22199-1 RM the accessory module of ICE ICEKpnCCRI-22199-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCCRI-22199-1 AM Meng LIU (Mia), Oliver He 1180 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1180 58199 bp NZ_CP036187 53.13[57.26] 2427452..2485650 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBA1559-1 the integration and excision module of ICE ICEKpnBA1559-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA1559-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBA1559-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA1559-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBA1559-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA1559-1 IEM for excision the conjugation module of ICE ICEKpnBA1559-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA1559-1 CM the regulation module of ICE ICEKpnBA1559-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA1559-1 RM the accessory module of ICE ICEKpnBA1559-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA1559-1 AM Meng LIU (Mia), Oliver He 1402 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1402 56142 bp NZ_CP036300 50.2[57.39] 743962..800103 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP015093-1 the integration and excision module of ICE ICEKpnWCHKP015093-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015093-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP015093-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015093-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP015093-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015093-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP015093-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015093-1 CM the regulation module of ICE ICEKpnWCHKP015093-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015093-1 RM the accessory module of ICE ICEKpnWCHKP015093-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP015093-1 AM Meng LIU (Mia), Oliver He 1406 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1406 55719 bp NZ_CP036305 50.16[57.44] 739695..795413 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP020098-1 the integration and excision module of ICE ICEKpnWCHKP020098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020098-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP020098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020098-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP020098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020098-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP020098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020098-1 CM the regulation module of ICE ICEKpnWCHKP020098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020098-1 RM the accessory module of ICE ICEKpnWCHKP020098-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020098-1 AM Meng LIU (Mia), Oliver He 1401 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1401 102927 bp NZ_CP036320 50.89[57.22] 5105553..5208479 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnVBA2172-1 the integration and excision module of ICE ICEKpnVBA2172-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnVBA2172-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnVBA2172-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnVBA2172-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnVBA2172-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnVBA2172-1 IEM for excision the conjugation module of ICE ICEKpnVBA2172-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnVBA2172-1 CM the regulation module of ICE ICEKpnVBA2172-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnVBA2172-1 RM the accessory module of ICE ICEKpnVBA2172-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnVBA2172-1 AM Meng LIU (Mia), Oliver He 1181 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1181 102936 bp NZ_CP036327 50.89[57.2] 2184762..2287697 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBA28434-1 the integration and excision module of ICE ICEKpnBA28434-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA28434-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBA28434-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA28434-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBA28434-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA28434-1 IEM for excision the conjugation module of ICE ICEKpnBA28434-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA28434-1 CM the regulation module of ICE ICEKpnBA28434-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA28434-1 RM the accessory module of ICE ICEKpnBA28434-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBA28434-1 AM Meng LIU (Mia), Oliver He 1187 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1187 58199 bp NZ_CP036335 53.13[57.26] 418812..477010 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnBP327-1 the integration and excision module of ICE ICEKpnBP327-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBP327-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnBP327-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBP327-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnBP327-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBP327-1 IEM for excision the conjugation module of ICE ICEKpnBP327-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBP327-1 CM the regulation module of ICE ICEKpnBP327-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBP327-1 RM the accessory module of ICE ICEKpnBP327-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnBP327-1 AM Meng LIU (Mia), Oliver He 1412 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1412 56142 bp NZ_CP036361 50.2[57.4] 747060..803201 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP2080-1 the integration and excision module of ICE ICEKpnWCHKP2080-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2080-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP2080-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2080-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP2080-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2080-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP2080-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2080-1 CM the regulation module of ICE ICEKpnWCHKP2080-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2080-1 RM the accessory module of ICE ICEKpnWCHKP2080-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP2080-1 AM Meng LIU (Mia), Oliver He 1408 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1408 59247 bp NZ_CP036365 50.01[57.39] 41921..101167 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP115068-1 the integration and excision module of ICE ICEKpnWCHKP115068-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115068-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP115068-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115068-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP115068-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115068-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP115068-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115068-1 CM the regulation module of ICE ICEKpnWCHKP115068-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115068-1 RM the accessory module of ICE ICEKpnWCHKP115068-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP115068-1 AM Meng LIU (Mia), Oliver He 1405 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1405 59247 bp NZ_CP036371 50.01[57.38] 4269244..4328490 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnWCHKP020037-1 the integration and excision module of ICE ICEKpnWCHKP020037-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020037-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnWCHKP020037-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020037-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnWCHKP020037-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020037-1 IEM for excision the conjugation module of ICE ICEKpnWCHKP020037-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020037-1 CM the regulation module of ICE ICEKpnWCHKP020037-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020037-1 RM the accessory module of ICE ICEKpnWCHKP020037-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnWCHKP020037-1 AM Meng LIU (Mia), Oliver He 1142 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1142 58199 bp NZ_CP036442 53.13[57.51] 3553191..3611389 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnABFPV-1 the integration and excision module of ICE ICEKpnABFPV-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnABFPV-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnABFPV-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnABFPV-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnABFPV-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnABFPV-1 IEM for excision the conjugation module of ICE ICEKpnABFPV-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnABFPV-1 CM the regulation module of ICE ICEKpnABFPV-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnABFPV-1 RM the accessory module of ICE ICEKpnABFPV-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnABFPV-1 AM Meng LIU (Mia), Oliver He 1323 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1323 59114 bp NZ_CP036450 49.99[57.44] 4834550..4893663 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKPNIH45-1 the integration and excision module of ICE ICEKpnKPNIH45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH45-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPNIH45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH45-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPNIH45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH45-1 IEM for excision the conjugation module of ICE ICEKpnKPNIH45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH45-1 CM the regulation module of ICE ICEKpnKPNIH45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH45-1 RM the accessory module of ICE ICEKpnKPNIH45-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPNIH45-1 AM Meng LIU (Mia), Oliver He 1391 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1391 79158 bp NZ_CP037742 51.41[57.52] 4713596..4792753 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnST23-1 the integration and excision module of ICE ICEKpnST23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST23-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnST23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST23-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnST23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST23-1 IEM for excision the conjugation module of ICE ICEKpnST23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST23-1 CM the regulation module of ICE ICEKpnST23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST23-1 RM the accessory module of ICE ICEKpnST23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnST23-1 AM Meng LIU (Mia), Oliver He 1214 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1214 62166 bp NZ_CP037927 52.46[57.48] 3417673..3479838 putative ICE predicted with ICEfinder tRNA 10.1016/j.jgar.2019.04.008 ICEKpnCRKP-I-1 the integration and excision module of ICE ICEKpnCRKP-I-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCRKP-I-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCRKP-I-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-1 IEM for excision the conjugation module of ICE ICEKpnCRKP-I-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-1 CM the regulation module of ICE ICEKpnCRKP-I-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-1 RM the accessory module of ICE ICEKpnCRKP-I-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-1 AM Meng LIU (Mia), Oliver He 1215 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1215 59114 bp NZ_CP037927 49.98[57.48] 4486964..4546077 putative ICE predicted with ICEfinder tRNA 10.1016/j.jgar.2019.04.008 ICEKpnCRKP-I-2 the integration and excision module of ICE ICEKpnCRKP-I-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCRKP-I-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCRKP-I-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-2 IEM for excision the conjugation module of ICE ICEKpnCRKP-I-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-2 CM the regulation module of ICE ICEKpnCRKP-I-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-2 RM the accessory module of ICE ICEKpnCRKP-I-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCRKP-I-2 AM Meng LIU (Mia), Oliver He 1302 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1302 57343 bp NZ_CP037928 50.27[57.39] 743014..800356 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP-8788-1 the integration and excision module of ICE ICEKpnKP-8788-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP-8788-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP-8788-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP-8788-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP-8788-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP-8788-1 IEM for excision the conjugation module of ICE ICEKpnKP-8788-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP-8788-1 CM the regulation module of ICE ICEKpnKP-8788-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP-8788-1 RM the accessory module of ICE ICEKpnKP-8788-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP-8788-1 AM Meng LIU (Mia), Oliver He 1194 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1194 57342 bp NZ_CP039808 50.27[57.37] 745714..803055 putative ICE predicted with ICEfinder tRNA 31911273 ICEKpnC2660-1 the integration and excision module of ICE ICEKpnC2660-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2660-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnC2660-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2660-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnC2660-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2660-1 IEM for excision the conjugation module of ICE ICEKpnC2660-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2660-1 CM the regulation module of ICE ICEKpnC2660-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2660-1 RM the accessory module of ICE ICEKpnC2660-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2660-1 AM Meng LIU (Mia), Oliver He 1193 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1193 56141 bp NZ_CP039819 50.2[57.2] 885731..941871 putative ICE predicted with ICEfinder tRNA 31911273 ICEKpnC2414-1 the integration and excision module of ICE ICEKpnC2414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2414-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnC2414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2414-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnC2414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2414-1 IEM for excision the conjugation module of ICE ICEKpnC2414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2414-1 CM the regulation module of ICE ICEKpnC2414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2414-1 RM the accessory module of ICE ICEKpnC2414-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnC2414-1 AM Meng LIU (Mia), Oliver He 1371 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1371 54943 bp NZ_CP039968 50.12[57.33] 741901..796843 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnR1701-1 the integration and excision module of ICE ICEKpnR1701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnR1701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnR1701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-1 IEM for excision the conjugation module of ICE ICEKpnR1701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-1 CM the regulation module of ICE ICEKpnR1701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-1 RM the accessory module of ICE ICEKpnR1701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-1 AM Meng LIU (Mia), Oliver He 1372 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1372 110540 bp NZ_CP039968 53.74[57.33] 1859451..1969990 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnR1701-2 the integration and excision module of ICE ICEKpnR1701-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnR1701-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnR1701-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-2 IEM for excision the conjugation module of ICE ICEKpnR1701-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-2 CM the regulation module of ICE ICEKpnR1701-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-2 RM the accessory module of ICE ICEKpnR1701-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1701-2 AM Meng LIU (Mia), Oliver He 1373 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1373 54943 bp NZ_CP039974 50.12[57.46] 741920..796862 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnR1761-1 the integration and excision module of ICE ICEKpnR1761-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1761-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnR1761-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1761-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnR1761-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1761-1 IEM for excision the conjugation module of ICE ICEKpnR1761-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1761-1 CM the regulation module of ICE ICEKpnR1761-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1761-1 RM the accessory module of ICE ICEKpnR1761-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnR1761-1 AM Meng LIU (Mia), Oliver He 1347 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1347 54942 bp NZ_CP040122 50.13[57.41] 744205..799146 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnLSH-KPN148-1 the integration and excision module of ICE ICEKpnLSH-KPN148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN148-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLSH-KPN148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN148-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLSH-KPN148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN148-1 IEM for excision the conjugation module of ICE ICEKpnLSH-KPN148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN148-1 CM the regulation module of ICE ICEKpnLSH-KPN148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN148-1 RM the accessory module of ICE ICEKpnLSH-KPN148-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN148-1 AM Meng LIU (Mia), Oliver He 1348 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1348 54943 bp NZ_CP040391 50.12[57.33] 789626..844568 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnLSH-KPN25-1 the integration and excision module of ICE ICEKpnLSH-KPN25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLSH-KPN25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLSH-KPN25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-1 IEM for excision the conjugation module of ICE ICEKpnLSH-KPN25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-1 CM the regulation module of ICE ICEKpnLSH-KPN25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-1 RM the accessory module of ICE ICEKpnLSH-KPN25-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-1 AM Meng LIU (Mia), Oliver He 1349 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1349 58190 bp NZ_CP040391 53.13[57.33] 1876308..1934497 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnLSH-KPN25-2 the integration and excision module of ICE ICEKpnLSH-KPN25-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnLSH-KPN25-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnLSH-KPN25-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-2 IEM for excision the conjugation module of ICE ICEKpnLSH-KPN25-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-2 CM the regulation module of ICE ICEKpnLSH-KPN25-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-2 RM the accessory module of ICE ICEKpnLSH-KPN25-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnLSH-KPN25-2 AM Meng LIU (Mia), Oliver He 1208 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1208 54942 bp NZ_CP040533 50.12[57.4] 717641..772582 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCR-HvKP1-1 the integration and excision module of ICE ICEKpnCR-HvKP1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCR-HvKP1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCR-HvKP1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP1-1 IEM for excision the conjugation module of ICE ICEKpnCR-HvKP1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP1-1 CM the regulation module of ICE ICEKpnCR-HvKP1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP1-1 RM the accessory module of ICE ICEKpnCR-HvKP1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP1-1 AM Meng LIU (Mia), Oliver He 1209 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1209 54942 bp NZ_CP040539 50.13[57.41] 2291829..2346770 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCR-HvKP4-1 the integration and excision module of ICE ICEKpnCR-HvKP4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP4-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCR-HvKP4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP4-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCR-HvKP4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP4-1 IEM for excision the conjugation module of ICE ICEKpnCR-HvKP4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP4-1 CM the regulation module of ICE ICEKpnCR-HvKP4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP4-1 RM the accessory module of ICE ICEKpnCR-HvKP4-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP4-1 AM Meng LIU (Mia), Oliver He 1210 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1210 54942 bp NZ_CP040545 50.13[57.41] 717397..772338 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnCR-HvKP5-1 the integration and excision module of ICE ICEKpnCR-HvKP5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP5-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnCR-HvKP5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP5-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnCR-HvKP5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP5-1 IEM for excision the conjugation module of ICE ICEKpnCR-HvKP5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP5-1 CM the regulation module of ICE ICEKpnCR-HvKP5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP5-1 RM the accessory module of ICE ICEKpnCR-HvKP5-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnCR-HvKP5-1 AM Meng LIU (Mia), Oliver He 1328 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1328 65703 bp NZ_CP040724 51.95[57.34] 943723..1009425 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKpvST147B_SE1_1_NDM-1 the integration and excision module of ICE ICEKpnKpvST147B_SE1_1_NDM-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST147B_SE1_1_NDM-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKpvST147B_SE1_1_NDM-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST147B_SE1_1_NDM-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKpvST147B_SE1_1_NDM-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST147B_SE1_1_NDM-1 IEM for excision the conjugation module of ICE ICEKpnKpvST147B_SE1_1_NDM-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST147B_SE1_1_NDM-1 CM the regulation module of ICE ICEKpnKpvST147B_SE1_1_NDM-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST147B_SE1_1_NDM-1 RM the accessory module of ICE ICEKpnKpvST147B_SE1_1_NDM-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKpvST147B_SE1_1_NDM-1 AM Meng LIU (Mia), Oliver He 1236 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1236 138326 bp NZ_CP040993 52.22[57.39] 4552091..4690416 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnFDAARGOS_775-1 the integration and excision module of ICE ICEKpnFDAARGOS_775-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_775-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_775-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_775-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_775-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_775-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_775-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_775-1 CM the regulation module of ICE ICEKpnFDAARGOS_775-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_775-1 RM the accessory module of ICE ICEKpnFDAARGOS_775-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_775-1 AM Meng LIU (Mia), Oliver He 1286 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1286 64547 bp NZ_CP041082 51.99[57.13] 1852482..1917028 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKp202-1 the integration and excision module of ICE ICEKpnKp202-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp202-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp202-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp202-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp202-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp202-1 IEM for excision the conjugation module of ICE ICEKpnKp202-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp202-1 CM the regulation module of ICE ICEKpnKp202-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp202-1 RM the accessory module of ICE ICEKpnKp202-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp202-1 AM Meng LIU (Mia), Oliver He 1293 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1293 56919 bp NZ_CP041373 50.23[57.34] 744262..801180 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP58-1 the integration and excision module of ICE ICEKpnKP58-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP58-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP58-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP58-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP58-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP58-1 IEM for excision the conjugation module of ICE ICEKpnKP58-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP58-1 CM the regulation module of ICE ICEKpnKP58-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP58-1 RM the accessory module of ICE ICEKpnKP58-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP58-1 AM Meng LIU (Mia), Oliver He 1359 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1359 58193 bp NZ_CP041644 53.13[57.46] 3348673..3406865 putative ICE predicted with ICEfinder tRNA 32582117 ICEKpnNKU_Kleb8A7-1 the integration and excision module of ICE ICEKpnNKU_Kleb8A7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNKU_Kleb8A7-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnNKU_Kleb8A7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNKU_Kleb8A7-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnNKU_Kleb8A7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNKU_Kleb8A7-1 IEM for excision the conjugation module of ICE ICEKpnNKU_Kleb8A7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNKU_Kleb8A7-1 CM the regulation module of ICE ICEKpnNKU_Kleb8A7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNKU_Kleb8A7-1 RM the accessory module of ICE ICEKpnNKU_Kleb8A7-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnNKU_Kleb8A7-1 AM Meng LIU (Mia), Oliver He 1110 1110 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1110 190855 bp NZ_CP042858 52.62[57] 4831525..5022379 putative ICE predicted with ICEfinder non Asn/Phe/Leu unpublished ICEKpnQD23-1 the integration and excision module of ICE ICEKpnQD23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQD23-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnQD23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQD23-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnQD23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQD23-1 IEM for excision the conjugation module of ICE ICEKpnQD23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQD23-1 CM the regulation module of ICE ICEKpnQD23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQD23-1 RM the accessory module of ICE ICEKpnQD23-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnQD23-1 AM Meng LIU (Mia), Oliver He 1264 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1264 133023 bp NZ_CP043047 52.07[57.21] 59825..192847 putative ICE predicted with ICEfinder tRNA 10.1128/mBio.01945-19 ICEKpnKLP268-1 the integration and excision module of ICE ICEKpnKLP268-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKLP268-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKLP268-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKLP268-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKLP268-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKLP268-1 IEM for excision the conjugation module of ICE ICEKpnKLP268-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKLP268-1 CM the regulation module of ICE ICEKpnKLP268-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKLP268-1 RM the accessory module of ICE ICEKpnKLP268-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKLP268-1 AM Meng LIU (Mia), Oliver He 1216 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1216 58048 bp NZ_CP043969 49.94[57.35] 1848470..1906517 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnD1-1 the integration and excision module of ICE ICEKpnD1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnD1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnD1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnD1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnD1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnD1-1 IEM for excision the conjugation module of ICE ICEKpnD1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnD1-1 CM the regulation module of ICE ICEKpnD1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnD1-1 RM the accessory module of ICE ICEKpnD1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnD1-1 AM Meng LIU (Mia), Oliver He 1235 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1235 104168 bp NZ_CP044047 50.91[57.24] 2916697..3020864 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnFDAARGOS_629-1 the integration and excision module of ICE ICEKpnFDAARGOS_629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_629-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnFDAARGOS_629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_629-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnFDAARGOS_629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_629-1 IEM for excision the conjugation module of ICE ICEKpnFDAARGOS_629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_629-1 CM the regulation module of ICE ICEKpnFDAARGOS_629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_629-1 RM the accessory module of ICE ICEKpnFDAARGOS_629-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnFDAARGOS_629-1 AM Meng LIU (Mia), Oliver He 1297 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1297 54942 bp NZ_CP044258 50.13[57.4] 748128..803069 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP65-1 the integration and excision module of ICE ICEKpnKP65-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP65-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP65-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP65-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP65-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP65-1 IEM for excision the conjugation module of ICE ICEKpnKP65-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP65-1 CM the regulation module of ICE ICEKpnKP65-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP65-1 RM the accessory module of ICE ICEKpnKP65-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP65-1 AM Meng LIU (Mia), Oliver He 1388 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1388 63443 bp NZ_CP045661 51.67[57.43] 1775474..1838916 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnSMU18037509-1 the integration and excision module of ICE ICEKpnSMU18037509-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSMU18037509-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnSMU18037509-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSMU18037509-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnSMU18037509-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSMU18037509-1 IEM for excision the conjugation module of ICE ICEKpnSMU18037509-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSMU18037509-1 CM the regulation module of ICE ICEKpnSMU18037509-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSMU18037509-1 RM the accessory module of ICE ICEKpnSMU18037509-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnSMU18037509-1 AM Meng LIU (Mia), Oliver He 1394 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1394 109478 bp NZ_CP045694 52.57[57.45] 750000..859477 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnTK421-1 the integration and excision module of ICE ICEKpnTK421-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnTK421-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnTK421-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-1 IEM for excision the conjugation module of ICE ICEKpnTK421-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-1 CM the regulation module of ICE ICEKpnTK421-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-1 RM the accessory module of ICE ICEKpnTK421-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-1 AM Meng LIU (Mia), Oliver He 1395 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1395 62178 bp NZ_CP045694 52.35[57.45] 1931936..1994113 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnTK421-2 the integration and excision module of ICE ICEKpnTK421-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnTK421-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnTK421-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-2 IEM for excision the conjugation module of ICE ICEKpnTK421-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-2 CM the regulation module of ICE ICEKpnTK421-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-2 RM the accessory module of ICE ICEKpnTK421-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnTK421-2 AM Meng LIU (Mia), Oliver He 1285 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1285 56142 bp NZ_CP047160 50.2[57.27] 1275102..1331243 putative ICE predicted with ICEfinder tRNA unpublished ICEKpnKP19-2029-1 the integration and excision module of ICE ICEKpnKP19-2029-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP19-2029-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP19-2029-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP19-2029-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP19-2029-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP19-2029-1 IEM for excision the conjugation module of ICE ICEKpnKP19-2029-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP19-2029-1 CM the regulation module of ICE ICEKpnKP19-2029-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP19-2029-1 RM the accessory module of ICE ICEKpnKP19-2029-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP19-2029-1 AM Meng LIU (Mia), Oliver He 1289 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1289 56142 bp NZ_CP047192 50.2[57.33] 778614..834755 putative ICE predicted with ICEfinder tRNA 32156053 ICEKpnKp36-1 the integration and excision module of ICE ICEKpnKp36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp36-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp36-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp36-1 IEM for excision the conjugation module of ICE ICEKpnKp36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp36-1 CM the regulation module of ICE ICEKpnKp36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp36-1 RM the accessory module of ICE ICEKpnKp36-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp36-1 AM Meng LIU (Mia), Oliver He 1123 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1123 59247 bp NZ_CP047336 50.01[57.35] 3836310..3895556 putative ICE predicted with ICEfinder tRNA 32606828 ICEKpn2019036D-1 the integration and excision module of ICE ICEKpn2019036D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2019036D-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn2019036D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2019036D-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn2019036D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2019036D-1 IEM for excision the conjugation module of ICE ICEKpn2019036D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2019036D-1 CM the regulation module of ICE ICEKpn2019036D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2019036D-1 RM the accessory module of ICE ICEKpn2019036D-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn2019036D-1 AM Meng LIU (Mia), Oliver He 1262 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1262 207779 bp NZ_CP047633 54.68[57.54] 1670024..1877802 putative ICE predicted with ICEfinder unpublished ICEKpnK2606-1 the integration and excision module of ICE ICEKpnK2606-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2606-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnK2606-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2606-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnK2606-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2606-1 IEM for excision the conjugation module of ICE ICEKpnK2606-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2606-1 CM the regulation module of ICE ICEKpnK2606-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2606-1 RM the accessory module of ICE ICEKpnK2606-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnK2606-1 AM Meng LIU (Mia), Oliver He 1115 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1115 54942 bp NZ_CP047648 50.13[57.4] 744979..799920 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn156070-1 the integration and excision module of ICE ICEKpn156070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn156070-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn156070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn156070-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn156070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn156070-1 IEM for excision the conjugation module of ICE ICEKpn156070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn156070-1 CM the regulation module of ICE ICEKpn156070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn156070-1 RM the accessory module of ICE ICEKpn156070-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn156070-1 AM Meng LIU (Mia), Oliver He 1116 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1116 54942 bp NZ_CP047649 50.13[57.37] 744979..799920 putative ICE predicted with ICEfinder tRNA unpublished ICEKpn158590-1 the integration and excision module of ICE ICEKpn158590-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn158590-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn158590-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn158590-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn158590-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn158590-1 IEM for excision the conjugation module of ICE ICEKpn158590-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn158590-1 CM the regulation module of ICE ICEKpn158590-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn158590-1 RM the accessory module of ICE ICEKpn158590-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn158590-1 AM Meng LIU (Mia), Oliver He 1334 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1334 79158 bp NZ_CP047675 51.41[57.54] 565947..645104 putative ICE predicted with ICEfinder tRNA submitted ICEKpnKUH-KPNHVL1-1 the integration and excision module of ICE ICEKpnKUH-KPNHVL1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKUH-KPNHVL1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKUH-KPNHVL1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-1 IEM for excision the conjugation module of ICE ICEKpnKUH-KPNHVL1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-1 CM the regulation module of ICE ICEKpnKUH-KPNHVL1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-1 RM the accessory module of ICE ICEKpnKUH-KPNHVL1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-1 AM Meng LIU (Mia), Oliver He 1335 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1335 137728 bp NZ_CP047675 52.26[57.54] 3462878..3600605 putative ICE predicted with ICEfinder submitted ICEKpnKUH-KPNHVL1-2 the integration and excision module of ICE ICEKpnKUH-KPNHVL1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKUH-KPNHVL1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKUH-KPNHVL1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-2 IEM for excision the conjugation module of ICE ICEKpnKUH-KPNHVL1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-2 CM the regulation module of ICE ICEKpnKUH-KPNHVL1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-2 RM the accessory module of ICE ICEKpnKUH-KPNHVL1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVL1-2 AM Meng LIU (Mia), Oliver He 1332 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1332 79158 bp NZ_CP047677 51.41[57.53] 565942..645099 putative ICE predicted with ICEfinder tRNA submitted ICEKpnKUH-KPNHVF1-1 the integration and excision module of ICE ICEKpnKUH-KPNHVF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKUH-KPNHVF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKUH-KPNHVF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-1 IEM for excision the conjugation module of ICE ICEKpnKUH-KPNHVF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-1 CM the regulation module of ICE ICEKpnKUH-KPNHVF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-1 RM the accessory module of ICE ICEKpnKUH-KPNHVF1-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-1 AM Meng LIU (Mia), Oliver He 1333 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1333 137728 bp NZ_CP047677 52.26[57.53] 3467254..3604981 putative ICE predicted with ICEfinder submitted ICEKpnKUH-KPNHVF1-2 the integration and excision module of ICE ICEKpnKUH-KPNHVF1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-2 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKUH-KPNHVF1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-2 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKUH-KPNHVF1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-2 IEM for excision the conjugation module of ICE ICEKpnKUH-KPNHVF1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-2 CM the regulation module of ICE ICEKpnKUH-KPNHVF1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-2 RM the accessory module of ICE ICEKpnKUH-KPNHVF1-2 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKUH-KPNHVF1-2 AM Meng LIU (Mia), Oliver He 1284 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1284 60024 bp NZ_CP048430 50.04[57.29] 4049956..4109979 putative ICE predicted with ICEfinder tRNA submitted ICEKpnKP18-3-8-1 the integration and excision module of ICE ICEKpnKP18-3-8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-3-8-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKP18-3-8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-3-8-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKP18-3-8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-3-8-1 IEM for excision the conjugation module of ICE ICEKpnKP18-3-8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-3-8-1 CM the regulation module of ICE ICEKpnKP18-3-8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-3-8-1 RM the accessory module of ICE ICEKpnKP18-3-8-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKP18-3-8-1 AM Meng LIU (Mia), Oliver He 1301 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1301 42771 bp NZ_CP049604 45.91[57.47] 4354746..4397516 putative ICE predicted with ICEfinder unpublished ICEKpnKp8701-1 the integration and excision module of ICE ICEKpnKp8701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp8701-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp8701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp8701-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp8701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp8701-1 IEM for excision the conjugation module of ICE ICEKpnKp8701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp8701-1 CM the regulation module of ICE ICEKpnKp8701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp8701-1 RM the accessory module of ICE ICEKpnKp8701-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp8701-1 AM Meng LIU (Mia), Oliver He 1292 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1292 134675 bp NZ_FO834906 52.06[57.4] 3678598..3813272 putative ICE predicted with ICEfinder tRNA 25341126 ICEKpnKp52.145-1 the integration and excision module of ICE ICEKpnKp52.145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp52.145-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKp52.145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp52.145-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKp52.145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp52.145-1 IEM for excision the conjugation module of ICE ICEKpnKp52.145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp52.145-1 CM the regulation module of ICE ICEKpnKp52.145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp52.145-1 RM the accessory module of ICE ICEKpnKp52.145-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKp52.145-1 AM Meng LIU (Mia), Oliver He 1309 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1309 54943 bp NZ_LR130548 50.12[57.4] 740471..795413 putative ICE predicted with ICEfinder tRNA submitted ICEKpnKPC2-1 the integration and excision module of ICE ICEKpnKPC2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC2-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnKPC2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC2-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnKPC2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC2-1 IEM for excision the conjugation module of ICE ICEKpnKPC2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC2-1 CM the regulation module of ICE ICEKpnKPC2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC2-1 RM the accessory module of ICE ICEKpnKPC2-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnKPC2-1 AM Meng LIU (Mia), Oliver He 1133 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1133 44753 bp NZ_LR607362 50.07[54.73] 780300..825052 putative ICE predicted with ICEfinder tRNA submitted ICEKpn4928STDY7387736-1 the integration and excision module of ICE ICEKpn4928STDY7387736-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387736-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn4928STDY7387736-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387736-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn4928STDY7387736-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387736-1 IEM for excision the conjugation module of ICE ICEKpn4928STDY7387736-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387736-1 CM the regulation module of ICE ICEKpn4928STDY7387736-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387736-1 RM the accessory module of ICE ICEKpn4928STDY7387736-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387736-1 AM Meng LIU (Mia), Oliver He 1134 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1134 64549 bp NZ_LR607368 51.99[54.1] 2908121..2972669 putative ICE predicted with ICEfinder tRNA submitted ICEKpn4928STDY7387808-1 the integration and excision module of ICE ICEKpn4928STDY7387808-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387808-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn4928STDY7387808-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387808-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn4928STDY7387808-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387808-1 IEM for excision the conjugation module of ICE ICEKpn4928STDY7387808-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387808-1 CM the regulation module of ICE ICEKpn4928STDY7387808-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387808-1 RM the accessory module of ICE ICEKpn4928STDY7387808-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn4928STDY7387808-1 AM Meng LIU (Mia), Oliver He 1312 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1312 62178 bp NZ_LR745042 52.34[57.53] 1803028..1865205 putative ICE predicted with ICEfinder tRNA submitted ICEKpnkpn154-1 the integration and excision module of ICE ICEKpnkpn154-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnkpn154-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpnkpn154-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnkpn154-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpnkpn154-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnkpn154-1 IEM for excision the conjugation module of ICE ICEKpnkpn154-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnkpn154-1 CM the regulation module of ICE ICEKpnkpn154-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnkpn154-1 RM the accessory module of ICE ICEKpnkpn154-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpnkpn154-1 AM Meng LIU (Mia), Oliver He 1124 http://bioinfo-mml.sjtu.edu.cn/ICEberg2/feature_page.php?ice_id=1124 54943 bp NZ_LT216436 50.13[57.29] 1016874..1071816 putative ICE predicted with ICEfinder tRNA submitted ICEKpn207M1D0-1 the integration and excision module of ICE ICEKpn207M1D0-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn207M1D0-1 IEM The set of gene and non-gene sequence responsible for the DNA integration process in the integration and excision module of ICE ICEKpn207M1D0-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn207M1D0-1 IEM for integration The set of gene and non-gene sequence responsible for the DNA excision process in the integration and excision module of ICE ICEKpn207M1D0-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn207M1D0-1 IEM for excision the conjugation module of ICE ICEKpn207M1D0-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn207M1D0-1 CM the regulation module of ICE ICEKpn207M1D0-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn207M1D0-1 RM the accessory module of ICE ICEKpn207M1D0-1 Meng LIU (Mia), Oliver He http://db-mml.sjtu.edu.cn/ICEberg/ ICEKpn207M1D0-1 AM DNA that consists of only one chain of nucleotides rather than the two base pairing strands found in DNA in the double helix form. ss DNA ss dna PSI-MI MI:0680 single stranded deoxyribonucleic acid DNA that consists of two base pairing strands. The 2 nucleotide chains are held together by hydrogen bonds between base pairs of nucleotides. ds DNA ds dna PSI-MI MI:0681 double stranded deoxyribonucleic acid GC_ID:1 ncbi_taxonomy all root Meng LIU (Mia), Oliver He 100226 GC_ID:11 PMID:12000953 PMID:8843436 ncbi_taxonomy Streptomyces coelicolor A3(2) GC_ID:11 ncbi_taxonomy unclassified tailed phages unclassified Caudovirales GC_ID:1 ncbi_taxonomy Vira Viridae viruses Viruses NCBITaxon:267457 GC_ID:11 PMID:15023939 PMID:15545472 ncbi_taxonomy Cupravidus Wautersia Cupriavidus Meng LIU (Mia), Oliver He 1068978 GC_ID:11 Amycolatopsis methanolica str. 239 Amycolatopsis methanolica strain 239 ncbi_taxonomy Amycolatopsis methanolica IFO 15065 Amycolatopsis methanolica IMSNU 20055 Amycolatopsis methanolica KCTC 9411 Amycolatopsis methanolica NCIB 11946 Amycolatopsis methanolica NRRL B-24139 Amycolatopsis methanolica 239 Meng LIU (Mia), Oliver He 1073387 GC_ID:11 Bacteroides fragilis str. HMW 615 Bacteroides fragilis strain HMW 615 ncbi_taxonomy Bacteroides fragilis HMW 615 Meng LIU (Mia), Oliver He 1075089 GC_ID:11 Pasteurella multocida str. 36950 Pasteurella multocida strain 36950 ncbi_taxonomy Pasteurella multocida 36950 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae KPNIH1 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae KPNIH10 NCBITaxon:1606016 NCBITaxon:1756147 GC_ID:11 PMID:21169462 PMID:23934253 PMID:25858248 PMID:27498788 PMID:28066339 ncbi_taxonomy Elizabethkingia endophytica Elizabethkingia genomosp. 1 Elizabethkingia genomospecies 1 Elizabethkingia anophelis GC_ID:11 PMID:22408243 Klebsiella pneumoniae subsp. pneumoniae str. HS11286 Klebsiella pneumoniae subsp. pneumoniae strain HS11286 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae HS11286 Meng LIU (Mia), Oliver He 1158627 GC_ID:11 ncbi_taxonomy Enterococcus faecalis CH19 Enterococcus faecalis EnGen0246 Meng LIU (Mia), Oliver He 1158660 GC_ID:11 ncbi_taxonomy Enterococcus faecalis CH116 Enterococcus faecalis EnGen0302 Meng LIU (Mia), Oliver He 1158677 GC_ID:11 ncbi_taxonomy Enterococcus faecalis DS16 Enterococcus faecalis EnGen0289 Meng LIU (Mia), Oliver He 1175266 GC_ID:11 ncbi_taxonomy Vibrio cholerae O1 str. VC504 Meng LIU (Mia), Oliver He 1175270 GC_ID:11 ncbi_taxonomy Vibrio cholerae O1 str. VC833 GC_ID:11 ncbi_taxonomy Vibrio cholerae non-O1/non-O139 str. VC998 GC_ID:11 PMID:11837318 ncbi_taxonomy Flavobacteria Flavobacteriia GC_ID:11 PMID:16280474 ncbi_taxonomy Legionellaceae group Legionellales NCBITaxon:119063 GC_ID:11 PMID:16403855 ncbi_taxonomy Burkholderia group Burkholderiaceae GC_ID:11 Klebsiella pneumoniae subsp. pneumoniae str. 1084 Klebsiella pneumoniae subsp. pneumoniae strain 1084 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae 1084 GC_ID:11 ncbi_taxonomy Streptococcus dysgalactiae group GC_ID:11 PMID:11155980 PMID:9779605 ncbi_taxonomy Pectobacterium GC_ID:11 PMID:11321122 PMID:11542017 PMID:11837318 PMID:16280474 PMID:26654112 purple bacteria purple bacteria and relatives purple non-sulfur bacteria purple photosynthetic bacteria purple photosynthetic bacteria and relatives ncbi_taxonomy Alphaproteobacteraeota proteobacteria Proteobacteria GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae KPNIH24 GC_ID:11 PMID:16280474 PMID:23334881 ncbi_taxonomy Proteobacteria gamma subdivision Purple bacteria, gamma subdivision g-proteobacteria gamma proteobacteria gamma subdivision gamma subgroup Gammaproteobacteria NCBITaxon:31968 GC_ID:11 PMID:10555317 PMID:11034484 PMID:11542017 PMID:15143038 PMID:25403554 PMID:26654112 low G+C Gram-positive bacteria low GC Gram+ ncbi_taxonomy Bacillaeota Bacillus/Clostridium group Clostridium group firmicutes Firmacutes Gram positive bacteria Low G+C firmicutes clostridial firmicutes firmicutes Firmicutes GC_ID:11 ncbi_taxonomy Bacillus inconstans Eberthella alcalifaciens Providencia alcalifaciens GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae ATCC BAA-2146 GC_ID:11 PMID:10319469 PMID:10319495 PMID:10425778 PMID:10758876 PMID:12656157 PMID:17220435 PMID:9734063 ncbi_taxonomy Aurococcus Staphylococcus Meng LIU (Mia), Oliver He 127906 GC_ID:11 ncbi_taxonomy Vibrio cholerae 01 Vibrio cholerae serogroup O1 Vibrio cholerae O1 NCBITaxon:325213 GC_ID:11 PMID:8573498 ncbi_taxonomy Micrococcus aureus Micrococcus pyogenes Staphilococcus aureus Staphlococcus pyogenes citreus Staphylococcus pyogenes aureus Staphylococus aureus Streptococcus aureus Staphylococcus aureus GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae DMC1097 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae UHKPC33 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae UHKPC07 GC_ID:11 PMID:1371056 PMID:2275854 Acidivorax ncbi_taxonomy Acidovorax GC_ID:11 ncbi_taxonomy Azoarcus GC_ID:11 PMID:11542160 PMID:26654112 PMID:27506333 ncbi_taxonomy 'Deinococcus-Thermus' Deinococcaeota Thermus/Deinococcus group Deinococcus-Thermus GC_ID:11 ncbi_taxonomy Streptococcaceae GC_ID:11 PMID:10555340 PMID:14657115 PMID:1720654 PMID:19620365 PMID:19880633 PMID:7537076 PMID:8995803 ncbi_taxonomy Streptococcus Meng LIU (Mia), Oliver He 1301098 NCBITaxon:399275 GC_ID:11 PMID:24803113 ncbi_taxonomy Pseudomonas knackmussii LMG 23759 Pseudomonas sp. (strain B13) Pseudomonas sp. B13 Pseudomonas sp. DSM 6978 Pseudomonas knackmussii B13 GC_ID:11 PMID:27534397 ncbi_taxonomy Streptococcus oralis NCBITaxon:1316413 NCBITaxon:391095 GC_ID:11 PMID:12449640 ncbi_taxonomy Streptococcus salivarius subsp. salivarius Streptococcus salivarus Streptococcus salivarius GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae 500_1420 NCBITaxon:1736023 GC_ID:11 PMID:11321121 PMID:18523205 ncbi_taxonomy Streptococcus sanguiinis Streptococcus sanguis Streptococcus sanguinis GC_ID:11 PMID:23245487 PMID:5220563 PMID:9731300 PMID:9734065 ncbi_taxonomy Streptococcus suis NCBITaxon:33971 GC_ID:11 PMID:6726177 Streptococcus salivarius thermophilus ncbi_taxonomy Streptococcus salivarius subsp. thermophilus Streptococcus thermophilus NCBITaxon:76757 GC_ID:11 PMID:15774692 PMID:8995807 ncbi_taxonomy Streptoccocus de la mammite Streptococcus agalactiae contagiosae Streptococcus difficile Streptococcus difficilis Streptococcus mastitidis Streptococcus agalactiae GC_ID:11 ncbi_taxonomy Diplococcus pneumoniae Micrococcus pneumoniae Streptococcus pneumoniae GC_ID:11 ncbi_taxonomy Micrococcus scarlatinae Streptococcus erysipelatos Streptococcus hemolyticus Streptococcus pyrogenes Streptococcus scarlatinae Streptococcus pyogenes Meng LIU (Mia), Oliver He 1316932 GC_ID:11 ncbi_taxonomy Mannheimia haemolytica M42548 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae KPR0928 GC_ID:11 ncbi_taxonomy Streptococcus pseudogalactiae Streptococcus dysgalactiae GC_ID:11 ncbi_taxonomy Streptococcus equi GC_ID:11 PMID:1995029 PMID:9542082 ncbi_taxonomy Streptococcus intermedius GC_ID:11 PMID:1695217 ncbi_taxonomy Streptococcus uberis type (genotype) II Streptococcus parauberis GC_ID:11 PMID:8427810 PMID:9103648 ncbi_taxonomy Enterococcus NCBITaxon:1219670 NCBITaxon:1796631 NCBITaxon:657310 GC_ID:11 ncbi_taxonomy Enterococcus feacalis Enterococcus proteiformis Enterocoque Micrococcus ovalis Micrococcus zymogenes Streptococcus faecalis Streptococcus glycerinaceus Streptococcus liquefaciens Enterococcus faecalis GC_ID:11 ncbi_taxonomy Streptococcus faecium Enterococcus faecium GC_ID:11 PMID:10425781 ncbi_taxonomy Bacillus subtilis subsp. subtilis GC_ID:11 ncbi_taxonomy Pseudomonadaceae GC_ID:11 PMID:16280474 ncbi_taxonomy Alteromonadaceae group Alteromonadales GC_ID:11 ncbi_taxonomy 'Vibrionales' Vibrionaceae group Vibrionales GC_ID:11 PMID:16280474 ncbi_taxonomy Pasteruellaceae group Pasteurellales GC_ID:11 lactic streptococci ncbi_taxonomy Lactococcus GC_ID:11 PMID:11594628 ncbi_taxonomy Bacterium lactis Streptococcus lactis Lactococcus lactis GC_ID:11 PMID:10028257 PMID:11594628 Lactococcus lactis lactis ncbi_taxonomy Lactobacillus xylosus Lactococcus lactis (SUBSP. LACTIS) Streptococcus diacetilactis Streptococcus lactis subsp. diacetilactis Streptococcus lactis subsp. lactis Lactococcus lactis subsp. lactis GC_ID:11 ncbi_taxonomy Pseudomonas aeruginosa group GC_ID:11 ncbi_taxonomy Pseudomonas putida group GC_ID:11 ncbi_taxonomy Pseudomonas syringae group GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae JM45 GC_ID:11 ncbi_taxonomy Bacillus/Staphylococcus group Bacillales GC_ID:11 PMID:10843090 PMID:11491334 PMID:1742196 PMID:2223602 PMID:23475340 PMID:7727277 PMID:8138135 PMID:8863420 Bacillus ncbi_taxonomy Bacillus rRNA group 1 Bacillus <bacterium> GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae 1158 Klebsiella pneumoniae subsp. pneumoniae 1158 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae HK787 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae 30660/NJST258_1 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae 30684/NJST258_2 NCBITaxon:1042380 NCBITaxon:1042381 NCBITaxon:1042382 NCBITaxon:1224247 NCBITaxon:1232470 NCBITaxon:1232819 NCBITaxon:1232822 NCBITaxon:1232824 NCBITaxon:1232825 NCBITaxon:1232828 NCBITaxon:1232830 NCBITaxon:1232840 NCBITaxon:1232841 NCBITaxon:1232844 NCBITaxon:1429427 NCBITaxon:1429428 NCBITaxon:1451270 NCBITaxon:1451272 NCBITaxon:1494536 NCBITaxon:1494586 NCBITaxon:1617262 NCBITaxon:1652099 NCBITaxon:1695905 NCBITaxon:1707495 NCBITaxon:1760969 NCBITaxon:1828507 NCBITaxon:387338 NCBITaxon:523730 NCBITaxon:941949 NCBITaxon:981081 GC_ID:11 PMID:11211269 ncbi_taxonomy Bacillus mesentericus Bacillus natto Bacillus subtilis/Bacillus globigii Bacillus subtilis8 Bacillus subtillis Bacillus subtilus Bacillus uniflagellatus Vibrio subtilis Bacillus subtilis Meng LIU (Mia), Oliver He 1450699 GC_ID:11 ncbi_taxonomy Pseudomonas aeruginosa C NCBITaxon:1233410 NCBITaxon:1866202 NCBITaxon:1866203 GC_ID:11 ncbi_taxonomy Streptomyces parvullus Streptomyces parvulus GC_ID:11 PMID:19515522 PMID:20068235 ncbi_taxonomy Streptomyces albidoflavus group GC_ID:11 PMID:19656940 ncbi_taxonomy Streptomyces griseus subgroup NCBITaxon:69207 GC_ID:11 PMID:26643615 PMID:27488356 ncbi_taxonomy Anaerobacter Clostridium GC_ID:11 ncbi_taxonomy Streptococcus equi subsp. equi NCBITaxon:1440055 NCBITaxon:1581190 GC_ID:11 PMID:23834245 PMID:27370902 PMID:27902176 [Clostridium] difficile ncbi_taxonomy Bacillus difficilis Clostridium difficile Clostridium difficle Peptoclostridium difficile Clostridioides difficile NCBITaxon:142595 GC_ID:11 PMID:10939646 PMID:12148636 PMID:12807180 ncbi_taxonomy 'Streptococcus luteciae' Streptococcus infantarius subsp. coli Streptococcus infantarius subsp.coli Streptococcus luteciae Streptococcus lutetiensis NCBITaxon:1683536 GC_ID:11 PMID:1374625 PMID:184898 ncbi_taxonomy 'Clostridium plagarum' Bacillus perfringens Bacterium welchii Clostridium plagarum Clostridium perfringens GC_ID:11 ncbi_taxonomy Vibrio cholerae non-O1/non-O139 Meng LIU (Mia), Oliver He 1582354 GC_ID:11 ncbi_taxonomy Streptococcus pyogenes 2812A conjugative prophage phi1207.3 Streptococcus phage phi1207.3 Meng LIU (Mia), Oliver He 158878 GC_ID:11 PMID:11418146 ncbi_taxonomy Staphylococcus aureus (strain Mu50 / ATCC 700699) Staphylococcus aureus subsp. aureus Mu50 GC_ID:11 PMID:10408878 PMID:15709360 PMID:1713054 PMID:1899799 PMID:8427807 PMID:8782674 PMID:9226919 PMID:9542083 ncbi_taxonomy Listerella Listeria NCBITaxon:1634566 GC_ID:11 PMID:17773427 PMID:1906732 PMID:8782698 ncbi_taxonomy Bacterium monocytogenes Bacterium monocytogenes hominis Corynebacterium infantisepticum Corynebacterium parvulum Erysipelothrix monocytogenes Listerella hepatolytica Listeria momocytogenes Lysteria monocytogenes Listeria monocytogenes GC_ID:11 ncbi_taxonomy Yersinia pseudotuberculosis complex GC_ID:11 ncbi_taxonomy Shewanella sp. Sh95 GC_ID:11 PMID:28905708 ncbi_taxonomy Bacteroidales NCBITaxon:85003 GC_ID:11 PMID:10028260 PMID:11155976 PMID:11321122 PMID:19244447 PMID:28840812 Actinobacteria high G+C Gram-positive bacteria ncbi_taxonomy Actinomycetes High GC gram-positive bacteria high GC Gram+ Actinobacteria <class> NCBITaxon:131550 GC_ID:11 ncbi_taxonomy Fibrobacter/Acidobacteria group Fibrobacteres-Chlorobi-Bacteroidetes superphylum Fibrobacteres/Acidobacteria group FCB group GC_ID:11 PMID:18988685 PMID:23851394 ncbi_taxonomy Terrabacteria group GC_ID:11 PMID:18803029 PMID:19502324 PMID:19666809 ncbi_taxonomy Amycolatopsis GC_ID:11 PMID:2223611 ncbi_taxonomy Amycolatopsis methanolica NCBITaxon:1845 GC_ID:11 PMID:10028256 PMID:1097584 ncbi_taxonomy Saccharopolyspora GC_ID:11 ncbi_taxonomy Actinomyces erythreus Streptomyces erythraeus Saccharopolyspora erythraea GC_ID:11 PMID:20212322 PMID:26410691 ncbi_taxonomy Clostridia GC_ID:11 PMID:16558750 PMID:24480908 ncbi_taxonomy Eubacteriales Clostridiales GC_ID:11 PMID:20212322 ncbi_taxonomy Lachnospiraceae GC_ID:11 PMID:20212322 ncbi_taxonomy Clostridium cluster XI Peptostreptococcaceae GC_ID:11 ncbi_taxonomy Bacillaceae GC_ID:11 PMID:20212322 ncbi_taxonomy Listeriaceae GC_ID:11 PMID:20212322 ncbi_taxonomy Lactobacillales GC_ID:11 PMID:27370902 PMID:27902176 ncbi_taxonomy Clostridioides GC_ID:11 PMID:10826795 PMID:24257967 ncbi_taxonomy Micromosospora Micromonospora GC_ID:11 PMID:12508862 PMID:19329591 PMID:26514588 ncbi_taxonomy Enterovibrio NCBITaxon:1973 NCBITaxon:31945 NCBITaxon:65506 GC_ID:11 PMID:10843062 PMID:11411701 PMID:1371059 PMID:15023980 PMID:15950131 PMID:16560709 PMID:4886644 PMID:8590678 PMID:8934906 PMID:9336904 PMID:9731302 ncbi_taxonomy Chainia Streptomyces GC_ID:11 PMID:12054225 ncbi_taxonomy Thermaceae GC_ID:11 PMID:11837318 PMID:12054225 ncbi_taxonomy Hadobacteria Deinococci GC_ID:11 ncbi_taxonomy Streptomyces ambofaciens NCBITaxon:1344 NCBITaxon:1617650 NCBITaxon:1866229 NCBITaxon:1866233 NCBITaxon:1866235 NCBITaxon:1866240 NCBITaxon:1866241 NCBITaxon:1866253 NCBITaxon:1866254 NCBITaxon:1866257 NCBITaxon:44287 NCBITaxon:985670 GC_ID:11 PMID:14412998 PMID:19515522 PMID:20068235 ncbi_taxonomy Actinomyces coelicolor Cladothrix coelicolor Nocardia coelicolor Streptococcus coelicolor Streptomyces calicolor Streptomyces coelicolor subspecies coelicolor Streptothrix coelicolor Streptomyces coelicolor GC_ID:11 PMID:27620848 ncbi_taxonomy Pectobacteriaceae GC_ID:11 PMID:27620848 ncbi_taxonomy Yersiniaceae GC_ID:11 PMID:27620848 ncbi_taxonomy Morganellaceae Adeolu et al. 2016 Morganellaceae GC_ID:11 ncbi_taxonomy Actinomyces cyaneus Streptomyces cyaneus GC_ID:11 PMID:13509657 ncbi_taxonomy Actinomyces glaucescens Streptomyces glaucescens NCBITaxon:214472 NCBITaxon:218285 NCBITaxon:38315 NCBITaxon:432623 NCBITaxon:715200 GC_ID:11 PMID:16014489 PMID:18175701 PMID:19060058 PMID:19656940 PMID:22286909 PMID:5640225 ncbi_taxonomy Actinomyces griseus Actinomyces setonii Streptomyces cavourensis subsp. washingtonensis Streptomyces setonii Streptomyces griseus GC_ID:11 ncbi_taxonomy Azoarcus sp. CIB GC_ID:11 PMID:10425795 PMID:10425796 PMID:10425797 PMID:10490293 PMID:10843050 PMID:10939651 PMID:10939673 PMID:10939677 PMID:11211268 PMID:11321083 PMID:11321113 PMID:11411719 PMID:11540071 PMID:11542017 PMID:11542087 PMID:11760965 PMID:12054223 PMID:2112744 PMID:270744 PMID:8123559 PMID:8590690 PMID:9103655 PMID:9336922 eubacteria ncbi_taxonomy Monera Procaryotae Prokaryota Prokaryotae bacteria prokaryote prokaryotes Bacteria GC_ID:11 ncbi_taxonomy Bacteroidetes Bacteroidia GC_ID:11 ncbi_taxonomy Flavobacteriales GC_ID:11 PMID:28581923 ncbi_taxonomy Zoogloeaceae GC_ID:11 PMID:11837318 PMID:16280504 PMID:26654112 Actinobacteria ncbi_taxonomy Actinobacteraeota actinobacteria Actinobacteria <phylum> GC_ID:11 PMID:12785304 PMID:13129998 PMID:16560709 PMID:19244447 PMID:27902296 ncbi_taxonomy Actinoplanaceae Streptomycetaceae GC_ID:11 PMID:16403855 ncbi_taxonomy Rhodocyclales GC_ID:11 PMID:27565417 ncbi_taxonomy Mesorhizobium japonicum NCBITaxon:103957 GC_ID:11 PMID:10826820 PMID:19244447 PMID:20601483 PMID:7857791 PMID:8186093 ncbi_taxonomy Actinosynnemataceae Pseudonocardiaceae Meng LIU (Mia), Oliver He 208435 GC_ID:11 PMID:12200547 Streptococcus agalactiae str. 2603V/R ncbi_taxonomy Streptococcus agalactiae 2603VR Streptococcus agalactiae 2603V/R NCBITaxon:2091 GC_ID:4 PMID:16350067 ncbi_taxonomy Borrelomycetales Mollicutales Mycoplasmas Paramycetales Pleuropneumoniales The Mycoplasmas Mycoplasmatales Meng LIU (Mia), Oliver He 208963 GC_ID:11 ncbi_taxonomy Pseudomonas aeruginosa str. UCBPP-PA14 Pseudomonas aeruginosa UCBPP-PA14 NCBITaxon:28203 GC_ID:11 PMID:11156001 PMID:15143020 PMID:1704793 PMID:17329766 PMID:29034857 ncbi_taxonomy Helicobacter GC_ID:4 PMID:13403276 PMID:16350067 ncbi_taxonomy Borrelomycetaceae Parasitaceae Pleuropneumoniaceae Mycoplasmataceae Meng LIU (Mia), Oliver He 209261 GC_ID:11 PMID:12644504 Salmonella enterica subsp. enterica serovar Typhi strain Ty2 ncbi_taxonomy Salmonella enterica subsp. enterica serovar Typhi Ty2 Salmonella enterica subsp. enterica serovar Typhi str. Ty2 NCBITaxon:29500 NCBITaxon:57371 GC_ID:4 PMID:10826816 PMID:11321109 PMID:11411711 PMID:11931184 PMID:13403276 PMID:15176735 PMID:16350067 PMID:16403858 PMID:25288662 PMID:8863441 PMID:8995799 ncbi_taxonomy Asterococcus Asteromyces Borrelomyces Bovimyces Eperythrozoon Haemobartonella Pleuropneumonia Mycoplasma NCBITaxon:219 GC_ID:11 PMID:11931154 PMID:1995031 PMID:8186097 PMID:8494747 ncbi_taxonomy Campylobacter pylori Campylobacter pylori subsp. pylori Campylobacter pyloridis Helicobacter nemestrinae Helicobacter pylori GC_ID:4 PMID:13403276 PMID:16350067 ncbi_taxonomy Anulomyces agalaxiae Asterococcus agalactiae Borrelomyces agalactiae Capromyces agalactiae Microbe de l'agalaxie contagieuse Pleuropneumonia agalactiae Mycoplasma agalactiae Meng LIU (Mia), Oliver He 211110 GC_ID:11 PMID:12354221 ncbi_taxonomy Streptococcus agalactiae str. NEM316 Streptococcus agalactiae NEM316 GC_ID:4 PMID:13138211 PMID:5449489 ncbi_taxonomy Asterococcus fermentans Micromyces hominis group II Schizoplasma fermentans Mycoplasma fermentans GC_ID:11 PMID:16403855 ncbi_taxonomy Campylobacterales GC_ID:11 ncbi_taxonomy Streptococcus agalactiae (serotype V) Streptococcus agalactiae serogroup V GC_ID:11 ncbi_taxonomy Streptococcus agalactiae (serotype III) Streptococcus agalactiae serogroup III GC_ID:11 ncbi_taxonomy Shewanella GC_ID:11 ncbi_taxonomy Ralstonia sp. JS705 Meng LIU (Mia), Oliver He 224308 NCBITaxon:535027 GC_ID:11 PMID:9384377 ncbi_taxonomy Bacillus subtilis 168 Bacillus subtilis subsp. subtilis 168 Bacillus subtilis subsp. subtilis str. BGSC 1A700 Bacillus subtilis subsp. subtilis str. 168 Meng LIU (Mia), Oliver He 235279 GC_ID:11 PMID:12810954 ncbi_taxonomy Helicobacter hepaticus str. ATCC 51449 Helicobacter hepaticus ATCC 51449 NCBITaxon:230 GC_ID:11 PMID:10028262 PMID:10319494 ncbi_taxonomy Alteromonas putrefaciens Alteromonas putrifaciens Pseudomonas putrefaciens Shewanella putrifaciens Shewanella putrefaciens NCBITaxon:251708 GC_ID:11 PMID:10319466 ncbi_taxonomy Pseudomonas syringae group genomosp. 2 Meng LIU (Mia), Oliver He 262724 GC_ID:11 PMID:15064768 Thermus thermophilus str. HB27 Thermus thermophilus strain HB27 ncbi_taxonomy Thermus thermophilus HB27 GC_ID:11 PMID:15388743 ncbi_taxonomy Pseudoalteromonadaceae GC_ID:11 PMID:15388743 ncbi_taxonomy Shewanellaceae GC_ID:11 PMID:5781580 PMID:8240955 ncbi_taxonomy Thermus Meng LIU (Mia), Oliver He 272559 GC_ID:11 Bacteroides fragilis str. NCTC 9343 Bacteroides fragilis strain NCTC 9343 ncbi_taxonomy Bacteroides fragilis ATCC 25285 Bacteroides fragilis NCTC9343 Bacteroides fragilis NCTC 9343 Meng LIU (Mia), Oliver He 272563 GC_ID:11 Clostridium difficile 630 (epidemic type X) Clostridium difficile str. 630 Clostridium difficile strain 630 ncbi_taxonomy Clostridium difficile 630 Peptoclostridium difficile 630 Clostridioides difficile 630 Meng LIU (Mia), Oliver He 272624 GC_ID:11 PMID:15448271 Legionella pneumophila subsp. pneumophila 'Philadelphia 1' Legionella pneumophila subsp. pneumophila strain Philadelphia 1 ncbi_taxonomy Legionella pneumophila subsp. pneumophila str. Philadelphia-1 Legionella pneumophila subsp. pneumophila str. Philadelphia 1 NCBITaxon:273 GC_ID:11 PMID:11594628 PMID:4334342 PMID:8590676 ncbi_taxonomy Thermua flavus Thermus aquaticus (SUBSP. FLAVUS) Thermus aquaticus (SUBSP. THERMOPHILUS) Thermus aquaticus flavus Thermus aquaticus subsp. thermophilus Thermus aquaticus thermophilus Thermus flavus Thermus themophilus Thermus thermophilus NCBITaxon:410873 GC_ID:11 PMID:17473255 Mesorhizobium ciceri bv. biserrulae ncbi_taxonomy Mesorhizobium ciceri subsp. biserrulae Mesorhizobium ciceri biovar biserrulae NCBITaxon:1864 GC_ID:11 PMID:19244447 PMID:8782687 ncbi_taxonomy Actinoplanaceae Actinoplanaceae Couch 1955 Micromonosporaceae NCBITaxon:1145375 NCBITaxon:1145612 NCBITaxon:1145781 NCBITaxon:1145856 NCBITaxon:1201624 NCBITaxon:1201685 NCBITaxon:1268672 NCBITaxon:1268673 GC_ID:11 PMID:16559622 PMID:28066339 ncbi_taxonomy Bacteroides fragilis subsp. ovatus Pasteurella ovata Pseudobacterium ovatum Bacteroides ovatus GC_ID:11 PMID:11541974 PMID:11837318 PMID:16166687 PMID:16403855 PMID:19060069 ncbi_taxonomy Alphabacteria Proteobacteria alpha subdivision Purple bacteria, alpha subdivision a-proteobacteria alpha proteobacteria alpha subdivision alpha subgroup Alphaproteobacteria GC_ID:11 PMID:16403855 PMID:28581923 ncbi_taxonomy Proteobacteria beta subdivision Purple bacteria, beta subdivision b-proteobacteria beta proteobacteria beta subdivision beta subgroup Betaproteobacteria GC_ID:11 ncbi_taxonomy other sequences other sequences NCBITaxon:212745 GC_ID:11 PMID:10758879 PMID:10939664 PMID:15950132 PMID:18048745 PMID:23918787 PMID:7727274 PMID:9103607 ncbi_taxonomy Liquidomonas Loefflerella Peudomonas RNA similarity group I Pseudomonas NCBITaxon:1224290 NCBITaxon:1437768 NCBITaxon:1437769 NCBITaxon:1437770 NCBITaxon:1508364 NCBITaxon:1683559 NCBITaxon:1683561 NCBITaxon:1851858 NCBITaxon:1851865 NCBITaxon:1860124 NCBITaxon:665948 NCBITaxon:931955 NCBITaxon:931956 NCBITaxon:931957 NCBITaxon:931958 NCBITaxon:932477 GC_ID:11 ncbi_taxonomy Bacillus aeruginosus Bacillus pyocyaneus Bacterium aeruginosum Bacterium pyocyaneum Micrococcus pyocyaneus Peudomonas aeruginosa Pseudomonas polycolor Pseudomonas pyocyanea Pseudomonas sp. 2_1_26 Pseudomonas aeruginosa GC_ID:11 ncbi_taxonomy Tailed phages bacterial virus prokaryotic virus Caudovirales NCBITaxon:591 GC_ID:11 PMID:10319519 PMID:10939679 PMID:15653929 PMID:15653930 ncbi_taxonomy Bacillus cholerae-suis Salmonella cholerae-suis Salmonella choleraesuis Salmonella enterica ser. choleraesuis Salmonella enterica GC_ID:11 ncbi_taxonomy vectors GC_ID:11 PMID:10319466 ncbi_taxonomy Pseudomonas syringae (PV. SAVASTANOI) Pseudomonas syringae pv. savastanoi Pseudomonas syringae savastanoi Pseudomonas syringae subsp. savastanoi Pseudomonas savastanoi NCBITaxon:1220705 GC_ID:11 PMID:1015934 PMID:23625262 PMID:28150577 ncbi_taxonomy Beneckea splendida Photobacter splendidum Vibrio hemicentroti Vibrio splendidus GC_ID:11 PMID:11837318 PMID:16403855 ncbi_taxonomy Proteobacteria epsilon subdivision Purple bacteria, epsilon subdivision e-proteobacteria epsilon proteobacteria epsilon subdivision epsilon subgroup not Epsilobacteria Epsilonproteobacteria NCBITaxon:105847 NCBITaxon:126995 NCBITaxon:1416793 NCBITaxon:1851854 NCBITaxon:1851855 NCBITaxon:1851856 NCBITaxon:1851857 NCBITaxon:1851861 NCBITaxon:1851863 NCBITaxon:1851864 NCBITaxon:1905567 NCBITaxon:1916993 NCBITaxon:216978 NCBITaxon:29437 NCBITaxon:668614 NCBITaxon:691260 NCBITaxon:760256 NCBITaxon:79218 NCBITaxon:931954 NCBITaxon:931964 GC_ID:11 PMID:11211254 PMID:1177780 PMID:17978216 PMID:9734035 ncbi_taxonomy Arthrobacter siderocapsulatus Bacillus fluorescens putidus Bacillus putidus Pseudomanas putida Pseudomonas arvilla Pseudomonas convexa Pseudomonas eisenbergii Pseudomonas incognita Pseudomonas ovalis Pseudomonas rugosa Pseudomonas striata Pseudomonas putida GC_ID:11 PMID:15879269 ncbi_taxonomy Elizabethkingia NCBITaxon:251732 GC_ID:11 ncbi_taxonomy Pseudomonas syringae (PV. PHASEOLICOLA) Pseudomonas syringae (pv. phaseolicola), and Pseudomonas syringae phaseolicola Pseudomonas syringae pv. phaseolicola Pseudomonas savastanoi pv. phaseolicola GC_ID:11 PMID:11321122 PMID:15143038 PMID:17978244 PMID:23606477 PMID:2592342 PMID:8123554 PMID:8863413 PMID:8863414 ncbi_taxonomy Mycoplasmas and walled relatives Paramycetes mycoplasmas Mollicutes GC_ID:11 ncbi_taxonomy Clostridiaceae NCBITaxon:39649 NCBITaxon:79063 GC_ID:11 PMID:8040890 PMID:8051250 ncbi_taxonomy Helicobacter ulmiensis Heliobacterium hepaticus Helicobacter hepaticus GC_ID:11 PMID:16166687 ncbi_taxonomy Xanthobacteraceae NCBITaxon:1820 GC_ID:11 PMID:15280283 PMID:5386179 PMID:8897428 ncbi_taxonomy Amycolatopsis mediterranea Nocardia mediterranei Streptomyces mediterranei Amycolatopsis mediterranei Meng LIU (Mia), Oliver He 340100 GC_ID:11 Bordetella petrii str. DSM 12804 Bordetella petrii strain DSM 12804 ncbi_taxonomy Bordetella petrii DSM 12804 Meng LIU (Mia), Oliver He 342614 GC_ID:11 Streptococcus agalactiae str. 515 Streptococcus agalactiae strain 515 ncbi_taxonomy Streptococcus agalactiae 515 Meng LIU (Mia), Oliver He 345072 GC_ID:11 Vibrio cholerae str. MO10 Vibrio cholerae strain MO10 ncbi_taxonomy Vibrio cholerae MO10 Meng LIU (Mia), Oliver He 347258 GC_ID:4 Mycoplasma agalactiae str. 5632 Mycoplasma agalactiae strain 5632 ncbi_taxonomy Mycoplasma agalactiae 5632 GC_ID:1 ncbi_taxonomy dsDNA viruses dsDNA viruses, no RNA stage GC_ID:11 PMID:16403855 PMID:1854635 rhizobacteria ncbi_taxonomy Rhizobiaceae group alpha-2 proteobacteria Rhizobiales GC_ID:11 ncbi_taxonomy Acidovorax sp. KKS102 NCBITaxon:37735 GC_ID:11 PMID:1503970 PMID:16449449 PMID:17082416 PMID:25386007 PMID:5669887 PMID:9103648 ncbi_taxonomy Enterococcus flavescens Streptococcus casseliflavus Streptococcus faecium subsp. casseliflavus Streptococcus faecium var. casseliflavus Streptococcus flavescens Enterococcus casseliflavus NCBITaxon:2127049 GC_ID:11 PMID:25566955 PMID:25736411 ncbi_taxonomy Rhizobium loti Mesorhizobium loti GC_ID:11 PMID:1742198 PMID:17755898 ncbi_taxonomy Photobacterium damsela Photobacterium damselae NCBITaxon:2201354 NCBITaxon:418642 GC_ID:11 PMID:1390113 PMID:18048751 PMID:2275851 PMID:29504926 ncbi_taxonomy Shewanella abalonesis Shewanella alga Shewanella haliotis Shewanella algae GC_ID:11 ncbi_taxonomy Pseudoalteromonas sp. BSi20311 Meng LIU (Mia), Oliver He 391295 GC_ID:11 Streptococcus suis str. 05ZYH33 Streptococcus suis strain 05ZYH33 ncbi_taxonomy Streptococcus suis 05ZYH33 GC_ID:11 PMID:7520739 ncbi_taxonomy Rhizobium ciceri Mesorhizobium ciceri Meng LIU (Mia), Oliver He 400673 GC_ID:11 Legionella pneumophila 'Corby' Legionella pneumophila strain Corby ncbi_taxonomy Legionella pneumophila str. Corby Meng LIU (Mia), Oliver He 405948 GC_ID:11 PMID:17369815 Saccharopolyspora erythraea str. NRRL 2338 Saccharopolyspora erythraea strain NRRL 2338 ncbi_taxonomy Saccharopolyspora erythraea ATCC 11635 Saccharopolyspora erythraea DSM 40517 Saccharopolyspora erythraea JCM 4748 Saccharopolyspora erythraea NRRL2338 Saccharopolyspora erythraea NRRL 2338 Meng LIU (Mia), Oliver He 438753 GC_ID:11 PMID:18522759 Azorhizobium caulinodans str. ORS 571 Azorhizobium caulinodans strain ORS 571 ncbi_taxonomy Azorhizobium caulinodans ORS571 Rhizobium ORS571 Rhizobium sp. (strain ORS571) Rhizobium sp. ORS 571 Rhizobium sp. ORS571 Azorhizobium caulinodans ORS 571 GC_ID:11 PMID:434652 ncbi_taxonomy Legionellaceae NCBITaxon:29550 GC_ID:11 PMID:16166707 PMID:434652 PMID:8573522 PMID:9734026 ncbi_taxonomy Legionella GC_ID:11 PMID:434652 ncbi_taxonomy Legionella pneumophila NCBITaxon:195041 GC_ID:11 PMID:12892133 PMID:1742199 PMID:27534397 ncbi_taxonomy Streptococcus crista Streptococcus oligefermentans Streptococcus oligofermentans Streptococcus cristatus GC_ID:11 PMID:8995802 ncbi_taxonomy Vibrio scophthalmi Meng LIU (Mia), Oliver He 45888 GC_ID:11 ncbi_taxonomy Vibrio cholerae O139 strain Vibrio cholerae serogroup O139 Vibrio cholerae O139 GC_ID:11 Staphylococcus aureus aureus ncbi_taxonomy Staphylococcus aureus subsp. aureus Meng LIU (Mia), Oliver He 46449 GC_ID:11 ncbi_taxonomy Cloning vector pAM120 GC_ID:11 PMID:4647834 ncbi_taxonomy Micromonospora rosaria Meng LIU (Mia), Oliver He 484021 GC_ID:11 PMID:19447910 Klebsiella pneumoniae subsp. pneumoniae str. NTUH-K2044 Klebsiella pneumoniae subsp. pneumoniae strain NTUH-K2044 ncbi_taxonomy Klebsiella pneumoniae NTUH-K2044 Klebsiella pneumoniae subsp. pneumoniae NTUH-K2044 GC_ID:11 PMID:8657018 ncbi_taxonomy Ralstonia NCBITaxon:117746 GC_ID:11 PMID:12054224 ncbi_taxonomy Flavobacteriaceae Meng LIU (Mia), Oliver He 496833 GC_ID:4 Mycoplasma fermentans str. PG18 Mycoplasma fermentans strain PG18 ncbi_taxonomy Mycoplasma fermentans PG18 GC_ID:11 PMID:19329591 ncbi_taxonomy Enterovibrio nigricans GC_ID:11 ncbi_taxonomy Alcaligenaceae GC_ID:11 PMID:11491321 ncbi_taxonomy Bordetella Meng LIU (Mia), Oliver He 522262 GC_ID:11 PMID:19819995 ncbi_taxonomy Staphylococcus porcinaris Staphylococcus rostri GC_ID:11 ncbi_taxonomy Staphylococcus aureus subsp. aureus 'sequence type 398' Staphylococcus aureus subsp. aureus ST398 Meng LIU (Mia), Oliver He 529507 GC_ID:11 PMID:18375554 Proteus mirabilis str. HI4320 Proteus mirabilis strain HI4320 ncbi_taxonomy Proteus mirabilis HI4320 GC_ID:11 PMID:12361284 PMID:27260339 PMID:28792373 PMID:7547295 ncbi_taxonomy Pseudoalteromonas GC_ID:11 PMID:10555323 PMID:10555334 PMID:16166704 PMID:27620848 ncbi_taxonomy Enterobacteraceae gamma-3 proteobacteria Enterobacteriaceae GC_ID:11 PMID:18929936 ncbi_taxonomy Saccharopolyspora endophyticus Saccharopolyspora endophytica GC_ID:11 PMID:26654112 ncbi_taxonomy Mollicutaeota Tenericutes NCBITaxon:59206 GC_ID:11 PMID:15653929 PMID:15653930 PMID:2915026 PMID:4011990 PMID:7149525 ncbi_taxonomy Salmonella cholerae-suis subsp. bongori Salmonella choleraesuis subsp. bongori Salmonella enterica V Salmonella enterica subsp. V Salmonella enterica subsp. bongori Salmonella bongori Meng LIU (Mia), Oliver He 553482 GC_ID:11 Streptococcus equi subsp. equi str. 4047 Streptococcus equi subsp. equi strain 4047 ncbi_taxonomy Streptococcus equi subsp. equi 4047 GC_ID:11 PMID:12710602 PMID:9779605 ncbi_taxonomy Bacillus carotovorus Bacterium carotovorum Erwinia caratovora Erwinia carotovora Pectobacterium cartovorum Pectobacterium carotovorum GC_ID:11 PMID:19700542 ncbi_taxonomy Escherchia Escherichia NCBITaxon:1637691 NCBITaxon:469598 NCBITaxon:662101 NCBITaxon:662104 GC_ID:11 PMID:10319482 E. coli Escherichia/Shigella coli ncbi_taxonomy Bacillus coli Bacterium coli Bacterium coli commune Enterococcus coli Escherchia coli Eschericia coli Escherichia coli Meng LIU (Mia), Oliver He 563774 GC_ID:11 Vibrio fluvialis str. Ind1 Vibrio fluvialis strain Ind1 ncbi_taxonomy Vibrio fluvialis ICEVflInd1 Vibrio fluvialis Ind1 Meng LIU (Mia), Oliver He 565664 GC_ID:11 PMID:27151808 Enterococcus faecium str. C68 Enterococcus faecium strain C68 ncbi_taxonomy Enterococcus faecium C68 NCBITaxon:39823 GC_ID:11 PMID:10555350 PMID:11411716 PMID:12635932 ncbi_taxonomy Calymmatobacterium Donovania Hyalococcus Klebsiella Meng LIU (Mia), Oliver He 570508 GC_ID:11 Helicobacter pylori str. P12 Helicobacter pylori strain P12 ncbi_taxonomy Helicobacter pylori P12 NCBITaxon:1096019 NCBITaxon:1673140 NCBITaxon:1795825 NCBITaxon:585494 NCBITaxon:692338 NCBITaxon:875801 GC_ID:11 PMID:11411715 PMID:1581186 ncbi_taxonomy 'Klebsiella aerogenes' (Kruse) Taylor et al. 1956 Bacillus pneumoniae Bacterium pneumoniae crouposae Hyalococcus pneumoniae Klebsiella pneumonia Klebsiella pneumoniae aerogenes Klebsiella pneumoniae GC_ID:11 PMID:26944634 Proteus ncbi_taxonomy Liquidobacterium Proteus <enterobacteria> GC_ID:11 ncbi_taxonomy Proteus mirabilis GC_ID:11 PMID:11034498 PMID:7547312 ncbi_taxonomy Proteus vulgaris GC_ID:11 ncbi_taxonomy Providencia NCBITaxon:1867082 GC_ID:11 ncbi_taxonomy Bacterium rettgeri Proteus rettgeri Providencia rettigeri Shigella rettgeri Providencia rettgeri GC_ID:11 PMID:10319519 PMID:10939679 PMID:12072558 PMID:15653929 PMID:15653930 PMID:3231714 PMID:9731304 ncbi_taxonomy Samonella Salmonella NCBITaxon:149049 GC_ID:11 PMID:15653929 PMID:15653930 PMID:7149525 ncbi_taxonomy Salmonella cholerae-suis subsp. cholerae-suis Salmonella choleraesuis subsp. choleraesuis Salmonella enterica I Salmonella enterica subsp. I Salmonella enterica subsp. enterica Meng LIU (Mia), Oliver He 593588 GC_ID:11 PMID:20348258 Vibrio cholerae str. MJ-1236 Vibrio cholerae strain MJ-1236 ncbi_taxonomy Vibrio cholerae MJ-1236 GC_ID:11 PMID:11760945 PMID:22888185 PMID:8494742 ncbi_taxonomy Azotirhizobium Azorhizobium GC_ID:11 Yersinia ncbi_taxonomy Yersinia <bacteria> GC_ID:11 PMID:19656940 ncbi_taxonomy Streptomyces griseus clade Streptomyces griseus group NCBITaxon:1161941 GC_ID:11 PMID:2223608 PMID:23919959 ncbi_taxonomy Bacillus pseudotuberkulosis Bacterium pseudotuberculosis Pasteurella lymphangitidis Pasteurella pseudotuberculosis Shigella pseudotuberculosis [Pasteurella] lymphangitidis Yersinia pseudotuberculosis GC_ID:11 PMID:15143042 PMID:4954820 PMID:8427811 ncbi_taxonomy gamma-3 proteobacteria Vibrionaceae GC_ID:11 PMID:17684269 PMID:19622642 PMID:23475340 ncbi_taxonomy Bacillus subtilis group NCBITaxon:710 GC_ID:11 PMID:7520733 ncbi_taxonomy Photobacter Photomonas Photobacterium GC_ID:11 PMID:17329787 PMID:4852581 ncbi_taxonomy Pseudomonas knackmussii NCBITaxon:705 GC_ID:11 PMID:1371064 PMID:17978204 PMID:21057054 PMID:21296930 PMID:24409173 PMID:4935323 PMID:7520733 PMID:8590667 ncbi_taxonomy Beneckea Listonella Microspira Pacinia Vibrio NCBITaxon:1006582 GC_ID:11 PMID:4180095 PMID:4935323 ncbi_taxonomy Beneckea alginolytica Oceanomonas alginolytica Pseudomonas creosotensis Vibrio alginolyticus Meng LIU (Mia), Oliver He 663913 GC_ID:11 Vibrio cholerae str. Mex1 Vibrio cholerae strain Mex1 ncbi_taxonomy Vibrio cholerae Mex1 Meng LIU (Mia), Oliver He 663914 GC_ID:11 Vibrio cholerae str. Ind5 Vibrio cholerae strain Ind5 ncbi_taxonomy Vibrio cholerae Ind5 Meng LIU (Mia), Oliver He 663915 GC_ID:11 Vibrio cholerae str. Ban5 Vibrio cholerae strain Ban5 ncbi_taxonomy Vibrio cholerae Ban5 Meng LIU (Mia), Oliver He 663916 GC_ID:11 Providencia alcalifaciens str. Ban1 Providencia alcalifaciens strain Ban1 ncbi_taxonomy Providencia alcalifaciens Ban1 Meng LIU (Mia), Oliver He 663958 GC_ID:11 Vibrio cholerae str. Ind4 Vibrio cholerae strain Ind4 ncbi_taxonomy Vibrio cholerae Ind4 GC_ID:11 PMID:9272984 ncbi_taxonomy Bacillo virgola del Koch Bacillus cholerae Bacillus cholerae-asiaticae Kommabacillus Liquidivibrio cholerae Microspira comma Pacinia cholerae-asiaticae Spirillum cholerae Spirillum cholerae-asiaticae Vibrio choleae Vibrio cholera Vibrio cholerae-asiaticae Vibrio comma Vibrio cholerae GC_ID:11 PMID:14071901 PMID:4935323 ncbi_taxonomy Beneckea parahaemolytica Oceanomonas parahaemolytica Pasteurella parahaemolytica Vibrio parahemolyticus Vibrio parahaemolyticus GC_ID:11 ncbi_taxonomy Streptococcus anginosus group GC_ID:11 ncbi_taxonomy Vibrio fluvialis GC_ID:11 PMID:10758890 PMID:11760945 ncbi_taxonomy Mesorhizobium GC_ID:11 ncbi_taxonomy CFB/Chlorobi group CFB/Green sulfur bacteria group Cytophagales/Green sulfur bacteria group Bacteroidetes/Chlorobi group Meng LIU (Mia), Oliver He 684738 GC_ID:11 PMID:20348266 Lactococcus lactis subsp. lactis str. KF147 Lactococcus lactis subsp. lactis strain KF147 ncbi_taxonomy Lactococcus lactis subsp. lactis KF147 GC_ID:11 PMID:11837318 ncbi_taxonomy not Thiobacteria delta/epsilon subdivisions GC_ID:11 PMID:12054225 Thermus group ncbi_taxonomy Thermales GC_ID:11 PMID:16403855 ncbi_taxonomy Mesorhizobium/Phyllobacterium group Phylobacteriaceae Phyllobacteriaceae Meng LIU (Mia), Oliver He 699033 GC_ID:11 Clostridium difficile str. 2007855 Clostridium difficile strain 2007855 ncbi_taxonomy Clostridium difficile 2007855 Peptoclostridium difficile 2007855 Clostridioides difficile 2007855 NCBITaxon:395 GC_ID:11 Azotirhizobium caulinodans ncbi_taxonomy Azorhizobium caulinodans GC_ID:11 PMID:10843050 PMID:15280320 PMID:15388716 PMID:17220461 PMID:2223605 PMID:29923825 ncbi_taxonomy Pasteurellaceae GC_ID:11 PMID:15143001 PMID:1736960 ncbi_taxonomy Actinobacillus Meng LIU (Mia), Oliver He 714962 GC_ID:11 Escherichia coli str. IHE3034 Escherichia coli strain IHE3034 ncbi_taxonomy Escherichia coli IHE3034 GC_ID:11 PMID:1847295 ncbi_taxonomy Actinobacillus pleuropneumonia Haemophilus pleuropneumoniae Actinobacillus pleuropneumoniae GC_ID:11 PMID:17704223 ncbi_taxonomy Vibrio harveyi clade Vibrio harveyi group GC_ID:11 ncbi_taxonomy Pseudomonaceae/Moraxellaceae group gamma-3 proteobacteria Pseudomonadales GC_ID:11 PMID:16403855 ncbi_taxonomy Helicobacter group Helicobacteraceae GC_ID:11 PMID:1736960 ncbi_taxonomy Haemophilus NCBITaxon:1572664 NCBITaxon:2044482 NCBITaxon:2044485 GC_ID:11 ncbi_taxonomy Klebsiella pneumoniae subsp. pneumoniae GC_ID:11 ncbi_taxonomy Bacterium influenzae Coccobacillus pfeifferi Haemophilus meningitidis Influenza-bacillus Mycobacterium influenzae Haemophilus influenzae GC_ID:11 ncbi_taxonomy Delftia sp. Cs1-4 GC_ID:11 PMID:1736960 ncbi_taxonomy Pasteurella GC_ID:11 PMID:15184562 ncbi_taxonomy Bacterium multocidum Micrococcus gallicidus Pasteurella cholerae-gallinarum Pasteurella gallicida Pateurella multocida Pasteurella multocida Meng LIU (Mia), Oliver He 754345 GC_ID:11 ncbi_taxonomy Actinobacillus pleuropneumoniae serovar 8 GC_ID:11 PMID:10028248 ncbi_taxonomy Mannheimia NCBITaxon:746 GC_ID:11 PMID:10028248 PMID:8782683 ncbi_taxonomy Pasteurella haemolytica Mannheimia haemolytica Meng LIU (Mia), Oliver He 765698 GC_ID:11 Mesorhizobium ciceri biovar biserrulae str. WSM1271 Mesorhizobium ciceri biovar biserrulae strain WSM1271 Mesorhizobium ciceri bv. biserrulae WSM1271 ncbi_taxonomy Mesorhizobium ciceri biovar biserrulae WSM1271 GC_ID:11 PMID:16403855 ncbi_taxonomy Burkholderia/Oxalobacter/Ralstonia group Burkholderiales GC_ID:11 ncbi_taxonomy beta-1 subgroup Comamonadaceae GC_ID:11 PMID:10319477 ncbi_taxonomy Delftia GC_ID:11 ncbi_taxonomy artificial sequences GC_ID:11 PMID:8300528 ncbi_taxonomy Bacteroidaceae GC_ID:11 ncbi_taxonomy Capsularis Ristella Bacteroides NCBITaxon:33929 NCBITaxon:469587 NCBITaxon:665938 GC_ID:11 PMID:16559622 PMID:28066339 ncbi_taxonomy Bacillus fragilis Bacteroides fragili Bacteroides inaequalis Bacteroides incommunis Bacteroides uncatus Fusiformis fragilis Pseudobacterium fragilis Pseudobacterium inaequalis Pseudobacterium incommunis Pseudobacterium uncatum Ristella fragilis Ristella incommunis Ristella uncata Sphaerophorus inaequalis Sphaerophorus intermedius Bacteroides fragilis NCBITaxon:1145805 NCBITaxon:1145866 NCBITaxon:1146176 NCBITaxon:1146582 NCBITaxon:1189829 NCBITaxon:1201516 NCBITaxon:1201798 NCBITaxon:1201827 NCBITaxon:469586 GC_ID:11 PMID:28066339 ncbi_taxonomy Bacillus thetaiotaomicron Bacteroides fragilis subsp. thetaiotaomicron Pseudobacterium thetaiotaomicron Sphaerocillus thetaiotaomicron Bacteroides thetaiotaomicron GC_ID:11 PMID:20212322 ncbi_taxonomy Enterococcaceae GC_ID:11 PMID:16559622 PMID:28066339 ncbi_taxonomy Bacteroides uniformis GC_ID:11 PMID:8573495 ncbi_taxonomy Butyrivibrio GC_ID:11 ncbi_taxonomy Butyrivibrio fibrisolvens GC_ID:11 PMID:19244447 ncbi_taxonomy Micromonosporineae Micromonosporales GC_ID:11 PMID:19244447 PMID:20601483 ncbi_taxonomy Pseudonocardineae Pseudonocardiales NCBITaxon:1882 GC_ID:11 PMID:19244447 Streptomycetineae ncbi_taxonomy Streptomycetes Streptomycineae Streptomycetales Meng LIU (Mia), Oliver He 876138 NCBITaxon:747490 NCBITaxon:875877 GC_ID:11 Streptococcus agalactiae str. FSL S3-026 Streptococcus agalactiae strain FSL S3-026 ncbi_taxonomy Streptococcus agalactiae FSL SAG3-026 Streptococcus agalactiae S3-026 Streptococcus agalactiae FSL S3-026 NCBITaxon:41530 NCBITaxon:601 NCBITaxon:72667 GC_ID:11 PMID:10319519 PMID:10758910 PMID:15653930 PMID:16558776 PMID:9336938 ncbi_taxonomy Bacillus typhi Bacterium (subgen. Eberthella) typhi Salmonella choleraesuis serovar Typhi Salmonella choleraesuis typhi Salmonella enterica ser. typhi Salmonella enterica serotype Typhi Salmonella enterica serovar Typhi Salmonella typhi Salmonella enterica subsp. enterica serovar Typhi GC_ID:11 PMID:20212322 ncbi_taxonomy Staphylococcus group Staphylococcaceae GC_ID:11 PMID:20212322 ncbi_taxonomy Bacillus/Lactobacillus/Streptococcus group Firmibacteria Bacilli GC_ID:11 PMID:27620848 ncbi_taxonomy Enterobacteriaceae and related endosymbionts Enterobacteriaceae group Enterobacteriales enterobacteria gamma-3 proteobacteria Enterobacterales GC_ID:11 PMID:3053773 PMID:434652 ncbi_taxonomy Legionella pneumophila subsp. pneumophila Meng LIU (Mia), Oliver He 935546 GC_ID:11 Mesorhizobium loti str. NZP2037 Mesorhizobium loti strain NZP2037 ncbi_taxonomy Mesorhizobium loti NZP2037 Meng LIU (Mia), Oliver He 935547 GC_ID:11 PMID:27565417 ncbi_taxonomy Mesorhizobium loti R7A Mesorhizobium japonicum R7A NCBITaxon:104956 GC_ID:11 PMID:11491321 ncbi_taxonomy Bordetella petri Bordetella petrii GC_ID:11 PMID:10930072 PMID:11594628 PMID:13108847 PMID:15023939 PMID:15545472 ncbi_taxonomy Pseudomonas oxalaticus Ralstonia oxalatica Ralstonia oxalaticus Wautersia oxalatica Cupriavidus oxalaticus NCBITaxon:171554 GC_ID:11 PMID:11541229 PMID:11542017 PMID:26654112 PMID:28066339 ncbi_taxonomy BCF group Bacteroidaeota Bacteroides-Cytophaga-Flexibacter group CFB group CFB group bacteria Cytophaga-Flexibacter-Bacteroides phylum Bacteroidetes class family genus order phylum species subphylum subspecies superkingdom organism animal fungus plant virus A material entity that is an individual living system, such as animal, plant, bacteria or virus, that is capable of replicating or reproducing, growth and maintenance in the right environment. An organism may be unicellular or made up, like humans, of many billions of cells divided into specialized tissues and organs. 10/21/09: This is a placeholder term, that should ideally be imported from the NCBI taxonomy, but the high level hierarchy there does not suit our needs (includes plasmids and 'other organisms') GROUP: OBI Biomaterial Branch WEB: http://en.wikipedia.org/wiki/Organism organism genome A gene is a material entity that represents the entire DNA sequence required for synthesis of a functional protein or RNA molecule. Oliver He WEB: http://www.ncbi.nlm.nih.gov/books/NBK21640/ In addition to the coding regions (exons), a gene includes transcription-control regions and sometimes introns. Although the majority of genes encode proteins, some encode tRNAs, rRNAs, and other types of RNA. gene a disposition that a gene can be used as a blueprint for generating a new form of product such as protein. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn YH: According to NCBI Gene project, there are two gene types: unknown (0) , tRNA (1) , rRNA (2) , snRNA (3) , scRNA (4) , snoRNA (5) , protein-coding (6) , pseudo (7) , transposon (8) , miscRNA (9) , ncRNA (10) , other (255). Therefore, we have generated corresponding gene dispositions. Note that we don't use the term "gene type" here to differentiate the meanings of "type" and "disposition". gene disposition a gene disposition that a gene can be used as a blueprint for generating a protein (i.e., a gene encodes for a protein). Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn protein-coding gene disposition a gene disposition that is the disposition of a gene that encodes for a tRNA. Yongqun He, Bin Zhao WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn RNA gene disposition a RNA gene disposition that is for a gene that encodes for a rRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn rRNA gene disposition a RNA gene disposition that is for a gene that encodes for a snRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn snRNA gene disposition a RNA gene disposition that is for a gene that encodes for a tRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn tRNA gene disposition a RNA gene disposition that is for a gene that encodes for a scRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn scRNA gene disposition a RNA gene disposition that is for a gene that encodes for a snoRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn snoRNA gene disposition a RNA gene disposition that is for a gene that encodes for a miscRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn miscRNA gene disposition a RNA gene disposition that is for a gene that encodes for a ncRNA. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn ncRNA gene disposition a gene disposition that represents the disposition of gene being "pseudo", i.e., the gene is a pseudogene. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn pseudo gene disposition a gene disposition that represents the disposition of a gene that encodes for a transposon. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn transposon gene disposition a gene disposition that is "other", i.e., the gene is for a gene product that is not listed for another other gene type. Note: The other gene disposition originates from automated generation using terms imported from the NCBI Gene resource (http://www.ncbi.nlm.nih.gov/books/NBK3841/ ). However the use of such an information-related term is not fully compliant with the Foundry Principles. Before we can find a better solution, we will for now keep them in the OGG. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn other gene disposition a gene disposition that represents the disposition of gene where the gene product is unknown. Note: The unknown gene disposition originates from automated generation using terms imported from the NCBI Gene resource (http://www.ncbi.nlm.nih.gov/books/NBK3841/ ). However the use of such an information-related term is not fully compliant with the Foundry Principles. Before we can find a better solution, we will for now keep them in the OGG. Yongqun He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn unknown gene disposition a gene that encodes for a RNA Oliver He RNA gene a RNA gene that encodes for a tRNA Oliver He tRNA gene a gene that encodes for a protein Oliver He protein-coding gene a gene that has lost its protein-coding ability or is otherwise no longer expressed in the cell. Oliver He WEB: http://en.wikipedia.org/wiki/Pseudogene pseudo gene a gene that has an unknown gene disposition Note: The unknown gene disposition originates from automated generation using terms imported from the NCBI Gene resource (http://www.ncbi.nlm.nih.gov/books/NBK3841/ ). However the use of such an information-related term is not fully compliant with the Foundry Principles. Before we can find a better solution, we will for now keep them in the OGG. Oliver He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn WEB: http://www.ncbi.nlm.nih.gov/books/NBK3841/ gene with unknown gene disposition a gene that has an other gene disposition Note: The other gene disposition originates from automated generation using terms imported from the NCBI Gene resource (http://www.ncbi.nlm.nih.gov/books/NBK3841/ ). However the use of such an information-related term is not fully compliant with the Foundry Principles. Before we can find a better solution, we will for now keep them in the OGG. Oliver He WEB: http://www.ncbi.nlm.nih.gov/IEB/ToolBox/CPP_DOC/lxr/source/src/objects/entrezgene/entrezgene.asn WEB: http://www.ncbi.nlm.nih.gov/books/NBK3841/ gene with other gene disposition A gene of an organism of Bacteria Yue Liu, Bin Zhao, Oliver He 2 gene of Bacteria A gene of Pseudomonas aeruginosa FFUP_PS_690 that has a tRNA gene disposition Meng LIU (Mia), Oliver He - tRNA gene of Pseudomonas aeruginosa FFUP_PS_690 A gene of Klebsiella pneumoniae L201 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae L201 A gene of Klebsiella pneumoniae 6 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 6 A gene of Klebsiella pneumoniae KPC160132 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPC160132 A gene of Klebsiella pneumoniae KPC160121 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPC160121 A gene of Klebsiella pneumoniae KPC160117 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPC160117 A gene of Klebsiella pneumoniae KPC160125 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPC160125 A gene of Klebsiella pneumoniae KP18-2079 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP18-2079 A gene of Klebsiella pneumoniae GSU10-3 DNA that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae GSU10-3 DNA A gene of Klebsiella pneumoniae JUNP254 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae JUNP254 A gene of Klebsiella pneumoniae PMK1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae PMK1 A gene of Klebsiella pneumoniae carbapenem-resistant blaNDM-1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae carbapenem-resistant blaNDM-1 A gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH33 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH33 A gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH32 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH32 A gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH30 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH30 A gene of Klebsiella pneumoniae 32192 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 32192 A gene of Klebsiella pneumoniae 34618 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 34618 A gene of Klebsiella pneumoniae CAV1392 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1392 A gene of Klebsiella pneumoniae CAV1596 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1596 A gene of Klebsiella pneumoniae U25 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae U25 A gene of Klebsiella pneumoniae subsp. pneumoniae TGH8 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae TGH8 A gene of Klebsiella pneumoniae subsp. pneumoniae RJF293 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae RJF293 A gene of Klebsiella pneumoniae subsp. pneumoniae RJF999 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae RJF999 A gene of Klebsiella pneumoniae KP38731 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP38731 A gene of Klebsiella pneumoniae KPNIH36 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPNIH36 A gene of Klebsiella pneumoniae AATZP that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AATZP A gene of Klebsiella pneumoniae NY9 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae NY9 A gene of Klebsiella pneumoniae CR14 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CR14 A gene of Klebsiella pneumoniae SKGH01 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae SKGH01 A gene of Klebsiella pneumoniae isolate blood sample 2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae isolate blood sample 2 A gene of Klebsiella pneumoniae BR that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BR A gene of Klebsiella pneumoniae ED2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae ED2 A gene of Klebsiella pneumoniae ED23 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae ED23 A gene of Klebsiella pneumoniae isolate 11 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae isolate 11 A gene of Klebsiella pneumoniae KP36 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP36 A gene of Klebsiella pneumoniae CAV1016 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1016 A gene of Klebsiella pneumoniae P1428 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae P1428 A gene of Klebsiella pneumoniae Kp_Goe_822579 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_822579 A gene of Klebsiella pneumoniae 459 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 459 A gene of Klebsiella pneumoniae isolate Kp_Goe_154414 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae isolate Kp_Goe_154414 A gene of Klebsiella pneumoniae CAV1417 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1417 A gene of Klebsiella pneumoniae CAV1453 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1453 A gene of Klebsiella pneumoniae Kp_Goe_62629 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_62629 A gene of Klebsiella pneumoniae MNCRE69 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae MNCRE69 A gene of Klebsiella pneumoniae MNCRE78 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae MNCRE78 A gene of Klebsiella pneumoniae MNCRE53 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae MNCRE53 A gene of Klebsiella pneumoniae Kp_Goe_822917 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_822917 A gene of Klebsiella pneumoniae Kp_Goe_33208 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_33208 A gene of Klebsiella pneumoniae Kp_Goe_71070 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_71070 A gene of Klebsiella pneumoniae SWU01 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae SWU01 A gene of Klebsiella pneumoniae CAV1042 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1042 A gene of Klebsiella pneumoniae CAV1217 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CAV1217 A gene of Klebsiella pneumoniae Kp_Goe_821588 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_821588 A gene of Klebsiella pneumoniae Kp_Goe_121641 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp_Goe_121641 A gene of Klebsiella pneumoniae AR_0049 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0049 A gene of Klebsiella pneumoniae subsp. pneumoniae BR7 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae BR7 A gene of Klebsiella pneumoniae subsp. pneumoniae BR21 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae BR21 A gene of Klebsiella pneumoniae subsp. pneumoniae RJA166 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae RJA166 A gene of Klebsiella pneumoniae subsp. pneumoniae KPN_KPC_HUG_07 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KPN_KPC_HUG_07 A gene of Klebsiella pneumoniae AR_0115 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0115 A gene of Klebsiella pneumoniae AR_0098 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0098 A gene of Klebsiella pneumoniae BWHC1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BWHC1 A gene of Klebsiella pneumoniae BK13043 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BK13043 A gene of Klebsiella pneumoniae KPN528 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPN528 A gene of Klebsiella pneumoniae K66-45 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae K66-45 A gene of Klebsiella pneumoniae AR_0047 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0047 A gene of Klebsiella pneumoniae AR_0112 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0112 A gene of Klebsiella pneumoniae AR_0146 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0146 A gene of Klebsiella pneumoniae AR_0129 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0129 A gene of Klebsiella pneumoniae AR_0126 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0126 A gene of Klebsiella pneumoniae AR_0113 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0113 A gene of Klebsiella pneumoniae AR_0138 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0138 A gene of Klebsiella pneumoniae AR_0120 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0120 A gene of Klebsiella pneumoniae AR_0125 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0125 A gene of Klebsiella pneumoniae AR_0145 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0145 A gene of Klebsiella pneumoniae AR_0152 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0152 A gene of Klebsiella pneumoniae AR_0148 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0148 A gene of Klebsiella pneumoniae AR_0139 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0139 A gene of Klebsiella pneumoniae 704SK6 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 704SK6 A gene of Klebsiella pneumoniae BIC-1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BIC-1 A gene of Klebsiella pneumoniae subsp. pneumoniae AUSMDU00008079 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae AUSMDU00008079 A gene of Klebsiella pneumoniae 911021 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 911021 A gene of Klebsiella pneumoniae 721005 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 721005 A gene of Klebsiella pneumoniae CCUG 70747 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CCUG 70747 A gene of Klebsiella pneumoniae subsp. pneumoniae ST101:960186733 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae ST101:960186733 A gene of Klebsiella pneumoniae subsp. pneumoniae ST2017:950142398 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae ST2017:950142398 A gene of Klebsiella pneumoniae TVGHCRE225 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae TVGHCRE225 A gene of Klebsiella pneumoniae FDAARGOS_443 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_443 A gene of Klebsiella pneumoniae FDAARGOS_444 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_444 A gene of Klebsiella pneumoniae FDAARGOS_446 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_446 A gene of Klebsiella pneumoniae FDAARGOS_447 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_447 A gene of Klebsiella pneumoniae isolate KSB1_5D that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae isolate KSB1_5D A gene of Klebsiella pneumoniae DA48896 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae DA48896 A gene of Klebsiella pneumoniae QS17-0161 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae QS17-0161 A gene of Klebsiella pneumoniae INF322 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF322 A gene of Klebsiella pneumoniae INF249 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF249 A gene of Klebsiella pneumoniae INF158 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF158 A gene of Klebsiella pneumoniae INF157 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF157 A gene of Klebsiella pneumoniae INF042 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF042 A gene of Klebsiella pneumoniae INF059 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF059 A gene of Klebsiella pneumoniae KSB1_7J that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KSB1_7J A gene of Klebsiella pneumoniae INF163 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF163 A gene of Klebsiella pneumoniae INF164 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF164 A gene of Klebsiella pneumoniae INF278 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF278 A gene of Klebsiella pneumoniae INF274 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF274 A gene of Klebsiella pneumoniae CRKP-2297 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CRKP-2297 A gene of Klebsiella pneumoniae CRKP-1215 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CRKP-1215 A gene of Klebsiella pneumoniae NH54 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae NH54 A gene of Klebsiella pneumoniae AUSMDU00003562 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AUSMDU00003562 A gene of Klebsiella pneumoniae AUSMDU00008119 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AUSMDU00008119 A gene of Klebsiella pneumoniae NU-CRE047 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae NU-CRE047 A gene of Klebsiella pneumoniae SGH10 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae SGH10 A gene of Klebsiella pneumoniae KP6 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP6 A gene of Klebsiella pneumoniae KP7 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP7 A gene of Klebsiella pneumoniae KP9 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP9 A gene of Klebsiella pneumoniae KP11 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP11 A gene of Klebsiella pneumoniae KP14 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP14 A gene of Klebsiella pneumoniae KP69 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP69 A gene of Klebsiella pneumoniae F44 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F44 A gene of Klebsiella pneumoniae JS187 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae JS187 A gene of Klebsiella pneumoniae 2N3 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 2N3 A gene of Klebsiella pneumoniae LS359 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae LS359 A gene of Klebsiella pneumoniae HS102438 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae HS102438 A gene of Klebsiella pneumoniae LS357 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae LS357 A gene of Klebsiella pneumoniae LS355 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae LS355 A gene of Klebsiella pneumoniae subsp. pneumoniae GD4 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae GD4 A gene of Klebsiella pneumoniae K2044 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae K2044 A gene of Klebsiella pneumoniae F1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F1 A gene of Klebsiella pneumoniae F5 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F5 A gene of Klebsiella pneumoniae F77 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F77 A gene of Klebsiella pneumoniae F127 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F127 A gene of Klebsiella pneumoniae F132 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F132 A gene of Klebsiella pneumoniae F138 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae F138 A gene of Klebsiella pneumoniae B12(AN) that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae B12(AN) A gene of Klebsiella pneumoniae KPNIH50 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPNIH50 A gene of Klebsiella pneumoniae KPNIH48 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPNIH48 A gene of Klebsiella pneumoniae WCHKP649 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP649 A gene of Klebsiella pneumoniae 16_GR_13 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 16_GR_13 A gene of Klebsiella pneumoniae 20_GR_12 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 20_GR_12 A gene of Klebsiella pneumoniae 2_GR_12 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 2_GR_12 A gene of Klebsiella pneumoniae WCHKP8F4 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP8F4 A gene of Klebsiella pneumoniae AR_0363 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0363 A gene of Klebsiella pneumoniae AR_0361 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0361 A gene of Klebsiella pneumoniae KPHS1249 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPHS1249 A gene of Klebsiella pneumoniae KP30835 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP30835 A gene of Klebsiella pneumoniae CFSAN054110 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CFSAN054110 A gene of Klebsiella pneumoniae WCHKP13F2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP13F2 A gene of Klebsiella pneumoniae WCHKP2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP2 A gene of Klebsiella pneumoniae subsp. pneumoniae SCKP020143 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae SCKP020143 A gene of Klebsiella pneumoniae WCHKP36 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP36 A gene of Klebsiella pneumoniae SCM96 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae SCM96 A gene of Klebsiella pneumoniae subsp. pneumoniae SCKP020046 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae SCKP020046 A gene of Klebsiella pneumoniae WCHKP020030 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP020030 A gene of Klebsiella pneumoniae WCHKP040035 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP040035 A gene of Klebsiella pneumoniae WCHKP7E2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP7E2 A gene of Klebsiella pneumoniae Kp589 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp589 A gene of Klebsiella pneumoniae AR_0153 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0153 A gene of Klebsiella pneumoniae AR_0079 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0079 A gene of Klebsiella pneumoniae AR438 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR438 A gene of Klebsiella pneumoniae L388 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae L388 A gene of Klebsiella pneumoniae L491 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae L491 A gene of Klebsiella pneumoniae subsp. pneumoniae SCKP020079 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae SCKP020079 A gene of Klebsiella pneumoniae subsp. pneumoniae SCKP040074 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae SCKP040074 A gene of Klebsiella pneumoniae DA33140 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae DA33140 A gene of Klebsiella pneumoniae 160111 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 160111 A gene of Klebsiella pneumoniae AR_0087 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0087 A gene of Klebsiella pneumoniae subsp. pneumoniae 12208 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae 12208 A gene of Klebsiella pneumoniae subsp. pneumoniae SC-7 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae SC-7 A gene of Klebsiella pneumoniae AR_362 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_362 A gene of Klebsiella pneumoniae KpvST101_OXA-48 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KpvST101_OXA-48 A gene of Klebsiella pneumoniae 2-1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 2-1 A gene of Klebsiella pneumoniae WCHKP3 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP3 A gene of Klebsiella pneumoniae INF125-sc-2279943 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF125-sc-2279943 A gene of Klebsiella pneumoniae XJ-K1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae XJ-K1 A gene of Klebsiella pneumoniae AR_0076 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0076 A gene of Klebsiella pneumoniae AR_0160 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0160 A gene of Klebsiella pneumoniae AR_0135 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0135 A gene of Klebsiella pneumoniae AR_0075 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AR_0075 A gene of Klebsiella pneumoniae XJ-K2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae XJ-K2 A gene of Klebsiella pneumoniae INF237 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae INF237 A gene of Klebsiella pneumoniae 675920 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 675920 A gene of Klebsiella pneumoniae WCHKP015625 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP015625 A gene of Klebsiella pneumoniae WCHKP115069 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP115069 A gene of Klebsiella pneumoniae 4743 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 4743 A gene of Klebsiella pneumoniae FDAARGOS_566 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_566 A gene of Klebsiella pneumoniae FDAARGOS_531 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_531 A gene of Klebsiella pneumoniae L39_2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae L39_2 A gene of Klebsiella pneumoniae L482 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae L482 A gene of Klebsiella pneumoniae subsp. pneumoniae CRK0298 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae CRK0298 A gene of Klebsiella pneumoniae KP_NORM_BLD_2014_104014 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP_NORM_BLD_2014_104014 A gene of Klebsiella pneumoniae KP_NORM_BLD_2015_112126 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP_NORM_BLD_2015_112126 A gene of Klebsiella pneumoniae KP17-15 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP17-15 A gene of Klebsiella pneumoniae KP17-16 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP17-16 A gene of Klebsiella pneumoniae subsp. pneumoniae R210-2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae R210-2 A gene of Klebsiella pneumoniae BJCFK909 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BJCFK909 A gene of Klebsiella pneumoniae KP18-29 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP18-29 A gene of Klebsiella pneumoniae isolate KSH203 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae isolate KSH203 A gene of Klebsiella pneumoniae NH34 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae NH34 A gene of Klebsiella pneumoniae C789 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae C789 A gene of Klebsiella pneumoniae C1398 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae C1398 A gene of Klebsiella pneumoniae NB5306 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae NB5306 A gene of Klebsiella pneumoniae 18CPO060 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 18CPO060 A gene of Klebsiella pneumoniae BA33875 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BA33875 A gene of Klebsiella pneumoniae AP8555 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae AP8555 A gene of Klebsiella pneumoniae subsp. pneumoniae CCRI-22199 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae CCRI-22199 A gene of Klebsiella pneumoniae BA1559 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BA1559 A gene of Klebsiella pneumoniae subsp. pneumoniae WCHKP015093 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae WCHKP015093 A gene of Klebsiella pneumoniae WCHKP020098 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP020098 A gene of Klebsiella pneumoniae VBA2172 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae VBA2172 A gene of Klebsiella pneumoniae BA28434 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BA28434 A gene of Klebsiella pneumoniae BP327 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae BP327 A gene of Klebsiella pneumoniae WCHKP2080 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP2080 A gene of Klebsiella pneumoniae WCHKP115068 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP115068 A gene of Klebsiella pneumoniae WCHKP020037 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae WCHKP020037 A gene of Klebsiella pneumoniae ABFPV that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae ABFPV A gene of Klebsiella pneumoniae KPNIH45 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPNIH45 A gene of Klebsiella pneumoniae ST23 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae ST23 A gene of Klebsiella pneumoniae CRKP I that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CRKP I A gene of Klebsiella pneumoniae subsp. pneumoniae KP-8788 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KP-8788 A gene of Klebsiella pneumoniae C2660 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae C2660 A gene of Klebsiella pneumoniae C2414 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae C2414 A gene of Klebsiella pneumoniae R1701 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae R1701 A gene of Klebsiella pneumoniae R1761 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae R1761 A gene of Klebsiella pneumoniae LSH-KPN148 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae LSH-KPN148 A gene of Klebsiella pneumoniae LSH-KPN25 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae LSH-KPN25 A gene of Klebsiella pneumoniae CR-HvKP1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CR-HvKP1 A gene of Klebsiella pneumoniae CR-HvKP4 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CR-HvKP4 A gene of Klebsiella pneumoniae CR-HvKP5 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae CR-HvKP5 A gene of Klebsiella pneumoniae KpvST147B_SE1_1_NDM that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KpvST147B_SE1_1_NDM A gene of Klebsiella pneumoniae FDAARGOS_775 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_775 A gene of Klebsiella pneumoniae Kp202 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp202 A gene of Klebsiella pneumoniae KP58 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP58 A gene of Klebsiella pneumoniae NKU_Kleb8A7 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae NKU_Kleb8A7 A gene of Klebsiella pneumoniae QD23 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae QD23 A gene of Klebsiella pneumoniae KLP268 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KLP268 A gene of Klebsiella pneumoniae D1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae D1 A gene of Klebsiella pneumoniae FDAARGOS_629 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae FDAARGOS_629 A gene of Klebsiella pneumoniae KP65 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP65 A gene of Klebsiella pneumoniae SMU18037509 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae SMU18037509 A gene of Klebsiella pneumoniae TK421 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae TK421 A gene of Klebsiella pneumoniae KP19-2029 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP19-2029 A gene of Klebsiella pneumoniae Kp36 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp36 A gene of Klebsiella pneumoniae 2019036D that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 2019036D A gene of Klebsiella pneumoniae K2606 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae K2606 A gene of Klebsiella pneumoniae 156070 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 156070 A gene of Klebsiella pneumoniae 158590 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 158590 A gene of Klebsiella pneumoniae subsp. pneumoniae KUH-KPNHVL1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KUH-KPNHVL1 A gene of Klebsiella pneumoniae subsp. pneumoniae KUH-KPNHVF1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KUH-KPNHVF1 A gene of Klebsiella pneumoniae KP18-3-8 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KP18-3-8 A gene of Klebsiella pneumoniae Kp8701 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae Kp8701 A gene of Klebsiella pneumoniae str. Kp52.145 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae str. Kp52.145 A gene of Klebsiella pneumoniae KPC2 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae KPC2 A gene of Klebsiella pneumoniae 4928STDY7387736 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 4928STDY7387736 A gene of Klebsiella pneumoniae 4928STDY7387808 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae 4928STDY7387808 A gene of Klebsiella pneumoniae kpn154 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae kpn154 A gene of Klebsiella pneumoniae isolate 207M1D0-sc-2013-04-03T11:21:06Z-1606409 that has a tRNA gene disposition Meng LIU (Mia), Oliver He Not available tRNA gene of Klebsiella pneumoniae isolate 207M1D0-sc-2013-04-03T11:21:06Z-1606409 A gene of Streptomyces coelicolor A3(2) that has a tRNA gene disposition Meng LIU (Mia), Oliver He 100226 tRNA gene of Streptomyces coelicolor A3(2) A gene of Amycolatopsis methanolica NCIB11946 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1068978 tRNA gene of Amycolatopsis methanolica NCIB11946 A gene of Bacteroides fragilis BF-HMW615 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1073387 tRNA gene of Bacteroides fragilis BF-HMW615 A gene of Pasteurella multocida 36950 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1075089 tRNA gene of Pasteurella multocida 36950 A gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH1 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1087440 tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH1 A gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH10 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1094170 tRNA gene of Klebsiella pneumoniae subsp. pneumoniae KPNIH10 A gene of Klebsiella pneumoniae subsp. pneumoniae HS11286 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1125630 tRNA gene of Klebsiella pneumoniae subsp. pneumoniae HS11286 A gene of Enterococcus faecalis EnGen0246 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1158627 tRNA gene of Enterococcus faecalis EnGen0246 A gene of Enterococcus faecalis EnGen0302 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1158660 tRNA gene of Enterococcus faecalis EnGen0302 A gene of Enterococcus faecalis DS16 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1158677 tRNA gene of Enterococcus faecalis DS16 A gene of Vibrio cholerae O1 strain VC504 that has a tRNA gene disposition Meng LIU (Mia), Oliver He 1175266 tRNA gene of Vibrio cholerae O1 strain VC504