{
 "metadata": {
  "name": "using-screed"
 },
 "nbformat": 3,
 "nbformat_minor": 0,
 "worksheets": [
  {
   "cells": [
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "filename = '/Users/t/dev/2012-scripps/python/25k.fq.gz'"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [],
     "prompt_number": 7
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "import screed\n",
      "for record in screed.open('/Users/t/dev/2012-scripps/python/25k.fq.gz'):\n",
      "   print record.name\n",
      "   print record.sequence\n",
      "   print record.accuracy\n",
      "   break"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "895:1:1:1246:14654/1\n",
        "CAGGCGCCCACCACCGTGCCCTCCAACCTGATGGT\n",
        "][aaX__aa[`ZUZ[NONNFNNNNNO_____^RQ_\n"
       ]
      }
     ],
     "prompt_number": 2
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "for record in screed.open(filename):\n",
      "   if record.name == '@895:1:4:1596:8538/2':\n",
      "      break\n",
      "        \n",
      "        \n",
      "print record"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "{'annotations': '', 'sequence': 'TACGGTCTTTTGAACTCATTGATGGCCCTGCGAAACGCCGCCTCAAGCTGTGCTCCGTAA', 'name': '895:1:4:1596:6003/2', 'accuracy': '_____aMUV]VQFJZZVZ]VZZMPZP[Q\\\\X]]S]S````X__X_WUZZMU________P_'}\n"
       ]
      }
     ],
     "prompt_number": 10
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "list_of_names = ['895:1:4:1596:8538/2', '895:1:4:1596:6003/2']\n",
      "list_of_records = []\n",
      "\n",
      "for record in screed.open(filename):\n",
      "    if record.name in list_of_names:\n",
      "        list_of_records.append(record)\n",
      "\n",
      "list_of_records"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "pyout",
       "prompt_number": 19,
       "text": [
        "[{'annotations': '', 'sequence': 'TCGCTCAGTTTCTTCGGCATATTGATCTGAACTTCGACGTAAAGATCGCCACGCTTTCCTGAGACTCCC', 'name': '895:1:4:1596:8538/2', 'accuracy': '_________X```]ZZZX]]KXXXY____X________________________X___X______``P`'},\n",
        " {'annotations': '', 'sequence': 'TACGGTCTTTTGAACTCATTGATGGCCCTGCGAAACGCCGCCTCAAGCTGTGCTCCGTAA', 'name': '895:1:4:1596:6003/2', 'accuracy': '_____aMUV]VQFJZZVZ]VZZMPZP[Q\\\\X]]S]S````X__X_WUZZMU________P_'}]"
       ]
      }
     ],
     "prompt_number": 19
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "%%file list-of-seqs.txt\n",
      "895:1:4:1596:8538/2\n",
      "895:1:4:1596:6003/2"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "Writing list-of-seqs.txt\n"
       ]
      }
     ],
     "prompt_number": 20
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "x = []\n",
      "for line in open('list-of-seqs.txt'):\n",
      "    line = line.strip()\n",
      "    x.append(line)\n",
      "x"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "pyout",
       "prompt_number": 21,
       "text": [
        "['895:1:4:1596:8538/2', '895:1:4:1596:6003/2']"
       ]
      }
     ],
     "prompt_number": 21
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "list_of_names = x\n",
      "list_of_records = []\n",
      "\n",
      "for record in screed.open(filename):\n",
      "    if record.name in list_of_names:\n",
      "        list_of_records.append(record)\n",
      "\n",
      "list_of_records"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "pyout",
       "prompt_number": 22,
       "text": [
        "[{'annotations': '', 'sequence': 'TCGCTCAGTTTCTTCGGCATATTGATCTGAACTTCGACGTAAAGATCGCCACGCTTTCCTGAGACTCCC', 'name': '895:1:4:1596:8538/2', 'accuracy': '_________X```]ZZZX]]KXXXY____X________________________X___X______``P`'},\n",
        " {'annotations': '', 'sequence': 'TACGGTCTTTTGAACTCATTGATGGCCCTGCGAAACGCCGCCTCAAGCTGTGCTCCGTAA', 'name': '895:1:4:1596:6003/2', 'accuracy': '_____aMUV]VQFJZZVZ]VZZMPZP[Q\\\\X]]S]S````X__X_WUZZMU________P_'}]"
       ]
      }
     ],
     "prompt_number": 22
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "n = 0.0\n",
      "m = 0.0\n",
      "for record in screed.open(filename):\n",
      "   n += len(record.sequence) - record.sequence.count('N')\n",
      "   m += record.sequence.count('G') + record.sequence.count('C')\n",
      "\n",
      "print '%g G/C content from %d and %d' % (m / n, m, n)  # string interpolation in Python\n",
      "print '%g G/C content' % (m / n,)  # string interpolation in Python\n",
      "\n",
      "print m/n, 'G/C content'"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "stream",
       "stream": "stdout",
       "text": [
        "0.597727 G/C content from 1030420 and 1723896\n",
        "0.597727 G/C content\n",
        "0.597727473119 G/C content\n"
       ]
      }
     ],
     "prompt_number": 33
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "outfp = open('/tmp/out.fa', 'w')\n",
      "for record in screed.open(filename):\n",
      "   outfp.write('>%s\\n%s\\n' % (record.name, record.sequence))"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [],
     "prompt_number": 36
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [
      "pwd"
     ],
     "language": "python",
     "metadata": {},
     "outputs": [
      {
       "output_type": "pyout",
       "prompt_number": 35,
       "text": [
        "u'/Users/t/dev/2012-scripps/python'"
       ]
      }
     ],
     "prompt_number": 35
    },
    {
     "cell_type": "code",
     "collapsed": false,
     "input": [],
     "language": "python",
     "metadata": {},
     "outputs": []
    }
   ],
   "metadata": {}
  }
 ]
}