Thursday, 10 May 1984 The PRESIDENT (Senator the Hon. Douglas McClelland) took the chair at 10 a.m., and read prayers. The Clerk-Petitions have been lodged for presentation as follows: Retirement Income Policy To the Honourable the President and members of the Senate in Parliament assembled: The petition of the undersigned citizens respectfully showeth that: 1. the Hawke Labor Government's retirement income policies are piecemeal, inconsistent and make no provision to encourage people to save towards their retirements; and, 2. the Government's proposed assets test legislation is iniquitous and, if enacted, its effects would be discriminatory. Your petitioners humbly pray that the Senate, in Parliament assembled, urge the Government to: 1. scrap its proposed assets test legislation; 2. either institute a broad enquiry into Australia's retirement income and taxation systems or await the outcome of the Senate Standing Committee on Social Welfare's work on this matter; and, 3. following the report of such a wide enquiry institute a retirement income policy which is fair and equitable, that encourages self-provision and which will be non-discriminatory. And your petitioners as in duty bound will ever pray. by Senator Messner (from 23 citizens). To the Honourable the President and members of the Senate in Parliament assembled. The humble petition of the undersigned citizens respectfully showeth: That Regulations and an Ordinance before the Parliament amend the Customs ( Prohibited Imports) Regulation and the Customs (Cinematograph and Films) Regulations and supersedes the ACT Objectionable Publications Ordinance in such a manner as to be harmful to society by removing from existing Commonwealth Law- The power to prevent the importation and sale of hard core pornography (e.g. X- rated videos) and publications which consistently incite the use of hard drugs; The power to prevent the importation and sale of grossly obscene publications including those associated with blasphemy; The power to require videos for non-commercial use to be registered by the Films Censorship Board before release from Customs. Your petitioners humbly pray that the Senate in Parliament assembled should disallow the new Regulations and Ordinance and ensure: That the Attorney-General enforce existing laws; That the Censors more appropriately reflect reasonable and responsible community attitudes; That further measures be taken in association with the States to protect Australians, particularly women and children, from exploitation; That, because of the importance of this issue to the whole community a conscience vote be permitted to all Members of Parliament. And your petitioners as in duty bound will ever pray. by Senators Scott (from nine citizens), Walters (from 114 citizens) and Watson ( from 54 citizens). To the Honourable the President and members of the Senate in Parliament assembled. The petition of the undersigned teachers and students working and studying in TAFE colleges throughout Australia respectfully showeth that: 1. We assert that TAFE, with over 1 million students, requires greatly improved resources if it is to continue to train Australia's skilled workforce effectively. 2. We call upon the Commonwealth Government to provide greatly increased funds to ensure that TAFE is accessible to all Australians, unlike the present time when thousands of people are turned away from TAFE colleges each year. 3. We urge the Commonwealth Government to equip TAFE workshops with the advanced technology used in modern Australian industries, and to expand TAFE's capital works program so that sufficient quality accommodation is available for TAFE teachers and students. 4. We ask that the Commonwealth Government greatly increase TAFE's recurrent expenditure, so that TAFE can respond quickly and flexibly to industry, Government and community demands. And your petitioners as in duty bound will ever pray. by Senator Zakharov (from 1,166 citizens). To the Honourable the President and members of the Senate in Parliament assembled: This petition of the undersigned citizens of Australia respectfully showeth that the reduction in the subsidy to tertiary student residential colleges of twenty-five per cent announced in the Federal Budget will: 1. Increase the financial hardship already being experienced by Australian students. The cut in subsidies to colleges will undoubtedly increase fees for that accommodation in 1984. Many students will be forced out of tertiary education as they will not be able to meet these increased costs particularly as the Tertiary Education Assistance Scheme only gained a maximum increase of $2.80 per week in the Federal Budget. 2. Decrease access to education for country students. Many country students live in college accommodation either to attend tertiary institutions in the metropolitan area or in regional centres. The cut in the subsidy to residential colleges will even further disadvantage this group of students who already have comparatively low participation rates in tertiary education. Your petitioners therefore call upon the Senate to ensure: (1) That the full subsidy to student college accommodation is immediately restored. (2) That the Federal Government assume financial responsibility for all student college accommodation to prevent the planned closures of colleges in Victoria. (3) That two student representatives are appointed to the committee of the Commonwealth Tertiary Education Commission reviewing student housing. (4) That new forms of college accommodation are investigated which would be more appropriate to the needs of the current student population, i.e. accommodation appropriate for students with dependent children. And your petitioners as in duty bound will ever pray. by Senator Ryan (from 46 citizens). Senator HAINES —by leave-I present the following petition: We the undersigned are aware that a letter in support of permanent part-time work (job sharing) is being sent to you in conjunction with this petition. We wish to acknowledge full support for a concrete scheme of permanent part- time work and job sharing, and hope such a scheme will be put into practice by your government as soon as possible. The petition is from 24 petitioners on behalf of 2,000 citizens. Petitions received. Notice of Motion Senator GARETH EVANS(Victoria-Attorney-General) —I give notice that, on the next day of sitting, I shall move: That leave be given to introduce a Bill for an Act to amend the law relating to copyright. Notice of Motion Senator GIETZELT(New South Wales-Minister for Veterans' Affairs) —I give notice that, on the next day of sitting, I shall move: That leave be given to introduce a Bill for an Act relating to repatriation and related matters. Senator MACKLIN(Queensland) —I give notice that, on the next day of sitting, I shall move: That leave be given to introduce a Bill for an Act to amend the Sales Tax ( Exemptions and Classifications) Act 1935. The PRESIDENT —Are there any ministerial statements? Senator GARETH EVANS(Victoria-Attorney-General) —In respect of ministerial statements, I am recorded on the Notice Paper as making at least one ministerial statement. In fact, today I will be making two ministerial statements: Firstly, on behalf of the Minister for Defence (Mr Scholes) on the strategic basis matter . I hope that will be done later this morning, The document is not yet completed , but notice will be given to the Opposition of it in ample time. Secondly, I will be making a statement later in the day, probably around the dinner hour, on the National Crime Authority. I am just giving notice to the Opposition as to what the proposal is in dealing with ministerial statements. Motion (by Senator Haines)-agreed to: That leave be given to introduce a Bill for an Act to protect private property from unjust acquisition under certain laws. Bill presented, and read a first time. Senator HAINES(South Australia)(10.05) — by leave-I move: That the Bill be now read a second time. I seek leave to incorporate my second reading speech in Hansard. Leave granted. The speech read as follows- In a democracy people have a right to expect that their property will not be compulsorily acquired without adequate compensation. The emergence of the modern , parliamentary democratic system was closely aligned with the development of a legal code that protected an individual's property. Arbitrary confiscation of property was a characteristic of despotic regimes which parliamentary democracy ought not to countenance. The purpose of this Bill is to protect private property from such unjust acquisition. The Westminster system of democracy, the British legal system and the social philosophy of liberalism all recognise the connection between the liberty of the individual and the individual's right to property. The first modern democrats concerned with the protection of the rights of a person against the tyranny of an individual or a group of individuals, recognised that the inherent capacity of a tyrant to deprive an individual of property also represented the ability of the State to deprive the individual of liberty. Of course times have changed. Modern democracies recognise that property ownership confers social responsibilities and therefore that the State has a reasonable right to direct the way in which property is used and disposed of. The individual's right to property therefore may need to be tempered by government action that enforces this social responsibility if such action is for the good of society. I believe a government has the right to make demands with regard to the use and disposal of property. Each case must be judged individually, but governments ought not to be precluded from taking action on behalf of the community. However when a government seeks to conflict with an individual's right to use and dispose of property, the proper course in a democracy is not to confiscate but to compensate. History abounds with examples of non-democratically elected leaders confiscating property from particular groups, e.g. ethnic or religious, without just compensation. They confiscated property in the name of the State, and for the ''good'' of the community, but were not interested in giving their victims just compensation. In so doing, they attacked the liberty of individuals , depriving them of their property and ultimately their livelihood. In fact, the modern form of despotism is even more vicious than its 17th, 18th and 19th century predecessors, and like them it has no regard for property rights and therefore individual rights. In this historical context, the choice for Australia is clear: in dealing with property rights we can continue to follow in the liberal democratic model which has a high regard for an individual's property or we can follow the totalitarian model which deprives the individual of all rights and therefore does not respect the right of an individual to own property. Recent events in New South Wales, following the enactment of the Wran Government's Coal Acquisition Act of 1981 are a case in point. In a simple and savage move, that Government declared that the historical rights of thousands of New South Wales freehold landowners to whatever coal might be found on or under their property, no longer existed. In a manner somewhat reminiscent of Stalin, Mr Wran claimed the coal was now the 'people's coal'. I am not going to dwell on Mr Wran's motives for taking such action. I am more concerned with the fact that to date, no compensation has been paid, and that the New South Wales Government shows no inclination to make just compensation to those who were deprived of their property as a result of the legislation that Government enacted. Mr Wran has clearly chosen the path of the tyrant in deciding on what terms to acquire property. Until recently this action had aroused little public interest or outcry. The reason for this may have been that coal owners are believed to be a comparatively small group of people, most of whom are thought to be wealthy. In fact, this is not the case and the Freehold Rights Association has estimated that of the 10,000 or so people involved, about a quarter are pensioners. In any case, the wealth of the people involved is not really at issue. I would hope that in a democratic society the property rights of all individuals would be respected, irrespective of whether the Government deems them to be well-off or not. The Constitution of the Commonwealth of Australia (section 51, paragraph xxxi) ensures that no law of the Commonwealth can cause the property of a person to be acquired otherwise than on just terms. However, the Constitutions of the Australian States do not necessarily make such a provision. I believe it is rather ironic that, while the Commonwealth Government would be restrained by the Constitution from acting in the despotic manner of the Wran Government, New South Wales and other State governments can apparently do so with impunity. The Universal Declaration of Human Rights adopted by the General Assembly of the United Nations in 1948, provides in Article 17 that everyone has the right to own property and no-one shall be arbitrarily deprived of property. Futhermore , the International Covenant on Civil and Political Rights, to which Australia is a party and which entered into force for Australia on November 13, 1980, provides in Article 26, that all persons are equal before the law and are entitled without discrimination to the equal protection of the law. That law prohibits any discrimination and guarantees to all persons equal and effective protection against discrimination on any grounds including property. Australia, as a party to that Covenant, under Article 2, undertakes to ensure that any person whose rights or freedoms as recognised by the Convention are violated shall have effective remedy. Acquisitions directly under Commonwealth Acts are not covered by the Bill because as mentioned in the preamble, the Constitution already requires such acquisitions to be on just terms (except in the Territories). Futhermore, the Parliament could not bind itself as to its own future Acts. The High Court held, in the case of Teori Tau v. the Commonwealth (1969) 119CLR 564, that the just terms requirement of the Constitution does not apply to acquisitions in a Territory. The Bill, therefore, extends to acquisitions by subordinate legislatures for the Territories (including the Governor-General in Council). As to the definition of 'prescribed day' in clause 5, the Covenant was ratified by Australia in 1980, with the date of deposit of the instrument of ratification being 13 August 1980. Under Article 49 of the Covenant, the Covenant entered into force for Australia three months later, on 13 November 1980. The effect of clause 6 would be that any future purported unjust acquisition by State law would be to no effect. The property would not be divested from its owner and no compensation would therefore be necessary. However, clause 7 deals with acquisitions that may have taken place between the prescribed date and the commencement of the Act, such as acquisitions under the Coal Acquisition Act, 1981 of New South Wales. Those acquisitions have been legally effective. The Bill does not propose to re-vest the property in the former owners but proposes to give an enforceable right to just compensation. Sub-clause (2) makes it quite explicit that the clause applies in relation to the Coal Acquisition Act, 1981 of New South Wales. This Bill will give people whose property rights have been infringed by a State government the right to an effective remedy. It simply requires that acquisition be on just terms or else the purported acquisition will have no effect. It will, therefore, protect the individual from an excessive and tyrannical abuse of the power of a State government. It will ensure that people are not left to the mercy of a greedy State government which chooses to acquire property in the manner of a totalitarian regime, rather than in the tradition of a parliamentary democratic system which respects the rights of individuals in particular their right to adequate compensation following compulsory property acquisition. Debate (on motion by Senator Robertson) adjourned. Bills received from the House of Representatives. Motion (by Senator Grimes) agreed to: That so much of the Standing Orders be suspended as would prevent the questions with regard to the several stages for the passage through the Senate of the Bills being put in one motion at each stage and the consideration of such Bills together in the Committee of the Whole. Ordered that the Bills may be taken through all their stages without delay. Bills (on motion by Senator Grimes) read a first time. Second Readings Senator GRIMES(Tasmania-Minister for Social Security)(10.06) —I move: That the Bills be now read a second time. I seek leave to incorporate the second reading speeches in Hansard. Leave granted. The speeches read as follows- LOAN (INCOME EQUALIZATION DEPOSITS) AMENDMENT BILL 1984 The purpose of this Bill is to give legislative effect to changes to the income equalization deposits scheme, first announced in the Treasurer's economic statement to the Parliament of 19 May, 1983. Further ministerial announcements on 16 June, 1983 and on 23 August, 1983 expanded upon the proposed nature of those changes. The Income Equalization Deposits Scheme, as amended, will have no taxation consequences other than the taxation of interest as income. The Government decided to remove the scheme from the tax system to prevent the possibility of its use for tax avoidance and so as to make the benefits accruing from the scheme more evenly available to all primary producers. The old arrangements had a degree of inequity, in that producers on the highest marginal tax rate, that is, on the highest incomes, benefitted most. As the provisions of the new scheme have been well publicized already, and as the details of the Loan (Income Equalization Deposits) Amendment Bill 1984 are explained in detail in a memorandum which I have arranged to be circulated, I shall confine my comments to outlining the broad features of the amended scheme. The aim of the scheme is to encourage primary producers to deposit moneys, in years when their incomes are high, so as to provide funds which can be drawn when incomes are lower. The incentive to make such deposits is an attractive interest rate, set quarterly at two percentage points above the short term Commonwealth Treasury Bond rate. The eligibility criteria which determine whether this high rate is received on deposits will be broadly the same as under former arrangements. All primary producers, but only primary producers, are eligible for the higher rate. Deposits can be made up to a limit of a $250,000 deposit stock. Above that, they will not be eligible for the higher rate. In respect of any income year a primary producer may make new deposits which receive the higher rate of interest, up to an amount equivalent to the lesser of : sixty per cent of gross receipts from primary production in respect of that year; and taxable income, other than income derived from property, in respect of that year. A deposit made at the higher rate will continue to receive that rate subject to the Taxation Commissioner's confirmation of eligibility estimates and as long as the depositor continues in the business of primary production. The determination of eligibility will be a two step procedure. The first step will be taken by the primary producer, self estimating the eligible deposit level for his or her current income year. This allows primary producers to take advantage of a current high income year to make deposits at the attractive interest rates. Interest payments in respect of new deposits will be based essentially on this self-estimation process. Provision is also being made, however, for the Commissioner of Taxation to provide an accurate assessment of the income of depositors and to provide that assessment to the Administrator of the scheme, who is to be known as the authorized person. The authorized person will only need to make an adjustment to the interest entitlement of the depositor if the commissioner's assessment effectively lowers the depositors' eligibility for interest payments at the high interest rate below the level which would otherwise be payable in respect of deposits actually made. Provision is being included to recoup any overpayments of interest which arise from overestimation by the depositor. Unwitting overestimation of income and deposit amounts will not be penalized, other than by recoupment. Furthermore, deposits made as a result of overestimates by primary producers will be able to be withdrawn without penalty immediately the Commissioner of Taxation's Determination is known. However, overestimation and deposit with intent to defraud is an offence under the Bill. The Bill provides for primary producer depositors to retain their ongoing entitlement to the high interest rate if they move in and out of primary production, or change primary production endeavours so long as they are not absent from primary production for a period exceeding 120 days. Of course new deposits may be made after resumption of primary production beyond that period and they would receive the higher interest rate if the eligibility criteria were then satisfied. The Amendment Bill provides that a depositor is required to notify the authorized person of the cessation of primary production business. Withdrawals from the scheme will be possible on a similar basis as in the past. That is, deposits may be withdrawn at any time after 12 months, or within that time on grounds of financial hardship. Hardship will initially be judged by the authorised person. If the depositor who is claiming hardship is dissatisfied with the initial judgement, he or she may approach the Administrative Appeals Tribunal for a ruling. The impact of the new arrangements on the future levels of deposits and withdrawals is very difficult to project with any degree of accuracy. Deposits have been continuing to ease since 1982. There may have been some natural pause in deposit intake toward the end of, and immediately following, the drought and also during the period of transition between the new scheme coming into effect on 1 September, 1983 and the application of this amending legislation. It will be necessary to observe the deposit performance over some period before accurate projections can be made about the longer term trend of deposits. The level of interest payments will depend on the level of deposits and so they are also very difficult to project accurately. The interest rates applying to the new scheme have been higher than those offered under former arrangements. However unrecouped income tax deductions will be brought to account at the time of conversions and this will offset the cost of the Budget of the higher interest rate. Furthermore, the new scheme has none of the characteristics which enabled depositors to avoid tax under former arrangements. The difference in administrative cost caused by the changed arrangements is expected to be small. The new IED scheme has been designed to allow primary producers to deposit funds with the Commonwealth at interest rates higher, and conditions more favourable, than those on Commonwealth Securities offered to the general public. This subsidy is intended to motivate primary producers to prepare for lean years but does not enable the wealthy to benefit more per dollar deposited, as did the former scheme. As such, this scheme should be particularly welcomed by smaller primary producers and those concerned with equity in our community. I commend the Bill to the Senate. INCOME TAX ASSESSMENT AMENDMENT (INCOME EQUALISATION DEPOSITS) BILL 1984 This Bill is complementary to the Loan (Income Equalization Deposits) Amendment Bill 1984 which I have just introduced. In introducing that Bill I outlined the features of the new Income Equalization Deposits Scheme which has been developed by the Government and which will operate with effect from 1 September 1983. The new arrangements are far more equitable than the ones they replace and will better serve to encourage primary producers to make due provision for adverse seasons. The provisions of this Bill are consequential upon amendments of the Loan ( Income Equalization Deposits) Act 1976 proposed by the earlier Bill. Their main purpose is to amend the income tax law to make changes to the taxation treatment of income equalization deposits in harmony with the decision to replace the former tax incentive basis of the scheme with one based on the payment of attractive interest rates on deposits. Accordingly, deposits made after 1 September 1983 will carry no special tax consequences. In particular, the income tax deduction previously allowable for eligible deposits made within specified limits is to be terminated. In outlining the provisions of the earlier Bill, I made it clear that, under the new arrangements, drought bonds and deposits made before 1 September 1983 may be transferred to the new scheme to enable depositors to take advantage of the special rate of interest payable under that scheme. Consistently with the basis on which income tax deductions were allowed under the former arrangements, where drought bonds or pre-1 September 1983 deposits are converted to the new scheme the amount so converted will be included in the depositor's assessable income of the year of income in which the conversion takes place. Depositors who apply to convert to the new arrangements within 60 days after the Bill receives Royal Assent will, for these purposes, be taken to have done so on 1 September 1983. Of course, no amount will be required to be included in assessable income in respect of drought bonds or income equalization deposits that did not qualify for deduction. The Bill will also permit the Commissioner of Taxation and his officers to furnish relevant information contained in tax returns to authorized persons involved in the administration of the new IED scheme. This is necessary because eligibility criteria applying to depositors under the new scheme will continue to be based on tax-related factors. A technical explanation of the Bill is contained in the explanatory memorandum that is being made available to honourable senators. I commend this Bill to the Senate. Debate (on motion by Senator Chaney) adjourned. Bill received from the House of Representatives. Ordered that the Bill may be taken through all its stages without delay. Bill (on motion by Senator Grimes) read a first time. Senator GRIMES(Tasmania-Minister for Social Security)(10.08) —I move: That the Bill be now read a second time. I seek leave to have the second reading speech incorporated in Hansard. Leave granted. The speech read as follows- The Patents Amendment Bill 1984 does not make any dramatic policy changes. It does however reflect dramatic changes in technology which are taking place in the world. Those changes will continue whether or not Australian industy meets the challenges to take part in them. The role of Government in meeting the challenge includes assisting industry to identify areas in which Australians can participate effectively and fruitfully. The crisis confronting Australian industry is that we are falling behind the rest of the world. To keep up we must concentrate on areas in which Australia can generate new technologies and take a fair share of tomorrow's prosperity. One such area already identified is biotechnology. The purpose of the Patents Amendment Bill is to encourage commercial realisation of biotechnology research in Australia. The Bill also makes possible Australia's accession to the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for the purposes of Patent Procedure. These measures complement a program of Government support for biotechnology including a Budget allocation for 1983/84 of $12.2 million. Good research, but where is the development Australia was once content to ride on the sheep's back, but the time came when the sheep was no longer moving fast enough to keep up with the rest of the world . The wool market was not enough to ensure national prosperity, so we eventually took an interest in manufacturing and mining. Now some of us are clinging to a new sheep's back in the form of out-dated technology. With its 15 million people, Australia has 0.3% of the world's population. We perform 2.0% of the world's scientific research, but originate 0.7% of patents and undertake only 0.1% of high technology production. Australia is in the middle rank of OECD nations in terms of government expenditure on research and development. But because of the very small contribution by industry we fall near the bottom of the list in terms of gross expenditure on research and development . Of the total of $1,054 million spent on GERD in Australia during 1978-79, government sources funded 4/5. Business enterprise sources were responsible for only 1/5 of the funds. The poor performance of the Australian private sector in R&D finds its reflection in Australia's comparative standing as a technologically-advanced country. The Australian Bureau of Statistics collects information relating to receipts and payments, by business, for technical know-how. Figures for 1981-82 show that , uncorrected for inflation, both payments and receipts decreased in the period from 1978-79 to 1981-82, payments by 8% and receipts by 7%. By comparison with other OECD countries, Australia's level of both import and export is very low. It may come as no surprise that the Netherlands had receipts for technical know- how of the order of twenty times as great as ours, in 1978; but payments also, were much higher-three times our level. On an expenditure basis, Australia performs about 0.9% of the world's applied research and experimental development other than that performed by the US, and over the period 1963-1979 obtained 0.9% of the foreign patents awarded in the US . Nevertheless, on a per capita basis Australia was strongly outperformed in US patents by the small developed European nations, specially Switzerland, Sweden, Netherlands. Belgium, Austria and Denmark. The Science and Technology Statement for 1982-83 presents the results of a collation of statistics relating to the import and export of goods with a high research component. This collation shows that in 1980 Australia exported US$681 per capita of such goods, which makes for a startling comparison with Switzerland, for which the figure is $2,584, Netherlands (1,378), Belgium (1,352 ), Sweden (1,087), Denmark (882), Austria (720), Ireland (589), Finland (509) and Norway (507). The figure taken over all OECD countries is US$468 per capita, with Portugal, Greece and Turkey having lower figures than Australia. In 1980-81 Australia ran a trade deficit of some $A6 billion in goods with a high research component. The deficit for all manufacturers was about $10 billion ; overall there was a trade balance, with imports and exports each totalling about $19 billion. A deficit in goods having a significant research component has been a normal part of Australia's trade pattern, but in the last decade it has increased rapidly. Thus we find ourselves in Australia doing a great deal of pure research but not making much commercial or economic gain from it. Government funded pure research largely passes into the public domain and Australian industry clings to the technological sheep's back of the 1950's and 60's. Biotechnology Radical change is needed to correct this imbalance. Australia must make a transition towards newly developing high-technology ''sunrise'' industries as wealth generators for our future, in addition to restructuring and revitalising our existing industrial base. Of these sunrise industries, biotechnology holds the greatest promise. It is sparing and efficient in its use of resources, and has almost unbounded applications in many areas of technology. There is nothing new or frightening in basing economic activities on the useful properties of living things. Agriculture has always been so based. Micro- organisms have been used for millennia to make cheese, wine, beer and bread. Industrial fermentations to produce antibiotics, citric acid and ethanol have been used for decades. This is not to mention that amazingly adaptable bacterium , E. coli, now famous in biotechnology, which has been serving the alimentary needs of the human species through the entire peristaltic course of history. Modern biotechnology expands and refines the use of living organisms into new and marvellously exciting areas of activity. Human insulin produced by genetically modified micro-organisms is now on the market. Most important for Australia, we have biotechnology researchers who are world leaders in agriculture, plant and animal genetics, microbiology, biochemistry and medical research. We must take advantage of the leads we have. A symposium and a workshop arranged through my Department have identified the following priority areas: plant agriculture, including genetic engineering to modify microbes, and tissue culture to improve plant species veterinary research, particularly on diagnostic probes and vaccines animal husbandry, including advanced breeding techniques and work on animal hormones human pharmaceutical and medical research, particularly on hormones, immunoproteins, and diagnostic probes biotechnology support, including equipment, instrumentation, and resources and processes food processing, in cheesemaking and other dairy production, and baking and brewing chemical industry, particularly water treatment. This list is only indicative and there will be worthwhile programs in other areas. Government support for biotechnology development These priority areas have been incorporated into the criteria for the National Biotechnology Program established by the Government in 1983. We aim in the national interest to broaden and strengthen the slender and rickety bridge between academic researchers and industry. Closer co-operation will help to make our best research findings available to commercially oriented and competitive industry. Research grants totalling $4.51 million which were announced in December last year are the first given under the Program. They span the years 1984 to 1986, and include $1.5 million in 1983-84. Most of the seven projects involve special collaboration between researchers and industry. Research institutions include the Walter and Eliza Hall Institute, Queensland Institute of Medical Research, Flinders Medical Centre, various University departments and CSIRO divisions, and the Commonwealth Serum Laboratories. Firms and other organisations include Biotechnology Australia Pty Ltd, Biotechnology Research Enterprises SA Pty Ltd, F H Faulding & Co. Ltd, Gradient Laboratories, Disposable Products Pty Ltd, and the Sydney Blood Bank. The projects relate to veterinary and anti-malarial vaccines, plant virus detection, insecticides, laboratory equipment and diagnostic techniques based on monoclonal antibodies. Funds allocated under the Program in 1983-84 also include $2.5 million to extend the Australian Industrial Research and Development Incentives Scheme to encompass biotechnology projects. Apart from the Program, $7.8 million went to CSIRO for biotechnology research, and $400,000 to the Howard Florey Institute at Melbourne University. Other important Government actions include steps to improve the flow of venture capital to growth industries from the Australian Industrial Development Corporation, and taxation incentives to encourage investment in specially established venture capital companies called Managment Investment Companies. Commercial and economic usefulness of patents Against this background of support, the role which patents might play as a stimulus to development may not be a major one. But the role is essential. Commercial exploitation is not possible without some form of protection in an area where huge amounts of money are needed. Patent protection is particularly important in assisting penetration by Australians into foreign markets. It would be tragic if Australia had to buy back products from overseas which were developed here or if we could only manufacture them here under licence. In 1980 the United States Supreme Court in the Chakrabarty case ruled for the first time that living micro-organisms were patentable. That was regarded as a landmark decision for American industry. In Australia, however, the Patent Office has long regarded biological processes and micro-organisms themselves as patentable, provided they satisfy the usual pre-conditions for obtaining a patent. That is, they must be novel and non- obvious, industrially useful, and fully described in the patent specification. This information has been widely disseminated-see, for example, a paper given in November 1981 by Philip Thomas of the Patent Office at a Sydney symposium on ' Genetic Engineering-Commercial Opportunities in Australia'. In October 1983 the Patent Office published a survey entitled 'Genetic Engineering-Patent Trends and Developments'. Based on that survey and later figures provided by the Office, the number of genetic engineering inventions for which patents were sought world-wide increased from 74 in 1981 to 109 in 1982 and 212 in 1983. They are currently running at about 7 new inventions per week. Corresponding figures for patent applications lodged in Australia were 44 in 1981, 49 in 1982 and 67 in 1983. In 1979 there were only 5. Biotechnology is, of course, broader than genetic engineering. But those figures give an indication of the rate of growth, not of basic research, but of potential commercial applications of biotechnology. Yet, of 187 applications lodged in Australia in the years 1979-1983, only 1 was of Australian origin. Australians do perform research, but what do they do with it? We used to be satisfied with the high-flown notion that research findings do the greatest public good if they are given to the world. The difficulty is that the rest of the world is more entrepreneurial and less altruistic than that, with the result that Australia is falling behind. The patent system recognises both the desirability of publication and the commercial realities for the innovator. There is a common misconception that patents require secrecy. In fact , provided a patent application is lodged first, a researcher can publish the invention without jeopardising the application (although if it is too early, this may give away some of the lead held over industry competitors). The patent application will be published in any event, usually 18 months after lodgement. The purpose of patents is to promote economic development. The mechanism is by way of proprietary rights in the form of a limited term monopoly for new inventions. Their economic operation stems first from protection which gives an incentive to invent and innovate, and second from the disclosure of information which is required from the patentee in exchange for patent rights. For an Australian company, proprietary rights protect its local and foreign interests in research and development, and improve its competitive position in other countries. the availability of protection provides incentive for investment. Disclosure enables Australians to have access to information about the leading edge of technology owned by foreign patentees. Over 90% of patents granted in Australia are of foreign origin. I am aware that the patent system has not been without its critics. I hope the current review by the Australian Property Advisory Committee will yield constructive suggestions on how it can be made to operate more effectively in advancing Australia's technological development. Patents Amendment Bill In the area of biotechnology, however, it is already apparent that patent law is failing to meet the needs of patentees, industry and the public. It is not uncommon for the law to lag behind social and technological change (if the two can indeed be separated). It is up to Government to make sure it catches up. In the case of biotechnology patents the lag has arisen from the virtual impossibility of carrying out an invention without access to a sample of the micro-organism used. Existing law requires a full written description of the invention. But where the invention involves the use of a micro-organism strain which is not available to researchers, a written description may well be next to useless. An antibiotic producing strain might have been isolated by unrepeatable fluke from the bottom of a lake in Scandinavia or from the soil in someone's backyard. The most thorough characterisation of the strain will not help anyone (apart from the patentee) to test the truthfulness of the patent specifications or to make further developments on the basis of the invention. The information is only good if you can obtain the actual materials needed as a starting point for further work. What is needed is a sample of the organism. Ultimately a micro-organism could be defined genetically in terms of the nucleotide base sequence of its DNA. In standard code the four bases are represented by the letters C, G, A and T. The first chromosome completely mapped out for any organism reads: CCGTC- AGGATTGACACCCTCCCAATTGTATGTTTTCA- TGCCTCCAAATCTTGGAGGAGGCTTTTTTAT- GGTTCGTTCTTACCTCTCTGAATGTCAC . . . and so on for a total of 5,375 bases. That was for a bacteriophage (a type of virus which destroys bacteria) known as OX174. The full sequence may be perused by anyone who is interested but not keen to consult scientific literature in Douglas R. Hofstadter's book, 'Godel, Escher, Bach: an Eternal Golden Braid'. Far more fascinating reading could be had for E. coli DNA, which contains 4.5 million bases. The sequence would occupy about 1,000 pages of Hansard, if Standing Orders would permit me to read it. Even then the information contained in the base sequence would need to be interpreted into useful form, and the most skilled biochemist would be unable or certainly unwillng to attempt to re-create the organism. For practical commercial purposes all this information would be less useful than a single cell of the bacterium. In a standard culture medium, one cell would divide into two identical offspring in about 30 minutes. Commercial quantities of the organism would take only days to produce. The essence of this Bill is to complement the existing requirement of a full description by also requiring deposit, with a prescribed depositary institution, of patent strains of micro-organisms which are not reasonably available. That new principle is to be fond in sub-sections 40 (3) and (5) of the Patents Act which are added by the Bill. As a result of the amendments, Australian industry will be guaranteed access to strains of all micro-organisms used in patented processes, just as access to information in written descriptions of inventions is guaranteed under the current law. In practice, depositary institutions hold a number of samples of each deposited strain. Most bacteria and fungi can be stored in freeze-dried form in small vials or frozen in liquid nitrogen in plastic ampoules or straws. Priceless samples can be readily reconstituted and turned to commercial purposes, provided that no patent is infringed. There are some cases where the specification itself describes how to make or obtain the new strain. If a person skilled in the art could reasonably be expected to be able to perform the invention without first having a sample of the micro-organism, then the requirement to make a deposit will not apply. A corollary to the deposit requirement is that if a deposit is required, then compliance with sub-section 40 (5) will satisfy the requirement of a full description of the micro-organism. That will also apply where the invention is itself a new micro-organism, relieving the applicant of the need to provide an excessively detailed description when a deposit, supplemented by relevant information on the organism's characteristics, is a realistic alternative. Mere deposit without some guarantee of access would not be enough. The applicant therefore must also give authority for the furnishing of samples of the micro-organism in accordance with the regulations and the Budapest Treaty. The terms of the authority to be required by the regulations will be discussed with industry to ensure that a fair balance of interest is struck. It is fundamental to the notion of patents that the patentee should be left with an enforceable monopoly. An unauthorised user of a strain can still be sued for infringement. The second aspect of the Bill is to implement the Budapest Treaty. That will ensure that the benefits provided by the deposit requirements will be available to Australians who patent abroad and to Australians seeking access to strains deposited by foreign patentees. The main idea of the Treaty is to enable a single deposit in any International Depositary Authority recognised by the Treaty to suffice for the puposes of the patent law of all member countries. To date 12 countries are members, including the US, the UK and other major European countries, and Japan. Australia intends to accede to the Treaty when the Bill comes into force. The Bill recognises all International Depositary Authorities for the purpose of satisfying Australian deposit requirements. There are currenty 9 Authorities. The Minister for Science and Technology has visited one of them-the Fermentation Research Institute in Tsukuba, Japan-a very impressive institution offering a range of services to industry and research. The remainder of the Bill supports these essential features. For example, provisions are made to remedy an inability of a depositary institution to supply samples, and to require a late deposit where a micro-organism ceases to be reasonably available. To gain the full benefits of participation of the new provisions, we intend to establish an Australian International Depositary Authority which will be recognised under the Budapest Treaty. Australians wishing to patent abroad in order to protect exports will then be able to satisfy the deposit requirements of foreign laws in many instances with a single deposit made locally. Financial impact The direct financial implications of the Bill are minimal. No additional resources would be required by the Patent Office in dealing with patent applications where a deposit had been made, and no direct contributions would be involved in acceding to the Treaty. Establishment of an International Depositary Authority within an existing Government institution is not expected to exceed $10,000. Ongoing costs of an Authority should be recovered from fees levied on depositors. Fees charged by overseas Authorities range from $300 to $1,000 for storage of deposits for the 30 year period required by the Treaty. The indirect implications for industry are very substantial. While the fees charged for lodging deposits are sizeable, there will be a reduced need for expensive drafting of patent specifications. But far more important are the advantages from having access to deposited strains. Although the value of access will vary from case to case, it is potentially enormous. Conclusion Developments projects based on Australian research are now causing great interest internationally. This was brought home to the Minister for Science and Technology recently when he visited two US companies which are world leaders in biotechnology-Genentech in San Francisco and Agrigenetics in Boulder, Colorado. We must stay in the race and keep ahead in areas where we have the lead. This needs a vigorous approach from industry, research bodies and Government. The Patents Amendment Bill demonstrates the Government's awareness of the need for commercial realisation of Australia's research and development efforts in biotechnology. Industry and researchers must continue to convert opportunities into advantages in this competitive field. The Bill offers improved ways in which that can be achieved. I commend the Bill to the Senate. Debate (on motion by Senator Peter Rae) adjourned. Senator CHANEY(Western Australia-Leader of the Opposition) —Pursuant to contingent notice of motion given by me I move: That so much of the Standing Orders be suspended as would prevent the Leader of the Opposition in the Senate moving a motion relating to the order of business on the Notice Paper. I speak to the motion so that the Senate is aware of what I am seeking. I will be seeking leave to move a motion in these terms: That intervening General Business be postponed until after the consideration of General Business Notice of Motion No. 78 for the reference of a matter to the Regulations and Ordinances Committee. The Senate will be aware of, because it has before it on the Notice Paper, a notice of motion by Senator Durack which he gave yesterday and which is No. 78 on the Notice Paper for today as shown on page 3812. That notice of motion is to refer certain regulations to the Standing Committee on Regulations and Ordinances. I will not in the course of these remarks specify them but they relate to the disallowance motion which was moved, I think by Senator Mason, and which has had extensive debate in this place. In the broad, the regulations relate to the classification of publications and the very vexed question of, I suppose, censorship, to put it shortly. What the motion, notice of which has been given by Senator Durack, seeks is to have the various regulations which have been the subject of so much debate-I point out that the debate has yet to be concluded but it will have to be concluded when we return after the couple of weeks up-put to the Committee to examine whether the regulations and ordinance referred to: (a) restrict unduly the Commonwealth's existing powers to prevent the importation of publications, including videotapes- (i) promoting or encouraging violence, (ii) promoting or encouraging the use of hard drugs, and (iii) depicting hard-core pornography, sexual violence or other gross obscenities; The proposal also asks the Committee to examine whether those regulations and ordinance restrict unduly the Commonwealth's existing powers to require videos not imported for public exhibition to be registered by the Film Censorship Board before release by Customs. The third point the Committee is asked to examine is whether those regulations and ordinance restrict unduly the power of the Commonwealth to protect children from exposure to publications previously referred to. I do not think there is any doubt from the level of interest that there has been in the debate on this disallowance that this is a matter of very broad public interest. Over the last 24 hours I have had the chance to read some of the material which has recently come from an inquiry sponsored by the House of Lords on this subject and I can say only that I think there are genuine difficulties facing us in this area. I can see that the Attorney-General ( Senator Gareth Evans) is getting very impatient. I am trying to restrict myself to explaining why I am seeking the suspension of Standing Orders and why I would like this matter to be dealt with today. The PRESIDENT —The Leader of the Opposition will understand that we do not want a duplication of the debate. Senator CHANEY —I understand that and I will try to be succinct. The simple point I am trying to make is that this is a matter of wide public interest and proper public and Senate concern. What we are seeking is that this motion, of which notice was given yesterday, should have an opportunity of being considered by the Senate-- Senator Chipp —Last night. Senator CHANEY —Notice was given last night. We should have an opportunity of having it considered by the Senate today. The reason for that is that we will be returning to this debate when the sittings resume in a couple of weeks time and it is the desire of the Opposition to have an opportunity for that Committee consideration during the two weeks while the Parliament is not sitting. We believe that the Senate would be aided in its consideration of this important matter if it had a report from the Committee. If this matter is dealt with by simply postponing it to the next fortnight's sittings we will lose that possible advantage. The question must be decided today whether we are to have the opportunity of a relevant Committee examination. I have had a preliminary indication from the Australian Democrats that they are not inclined to support this motion. Having had that indication, I simply direct some comments to that point. The PRESIDENT —Are you speaking about the motion to suspend the Standing Orders? Senator CHANEY —Yes, Mr President. I hope that this will not need lengthy consideration. All that the Opposition is seeking is a committee examination of the questions I have mentioned. It does not seek a determination of this vexed and difficult issue. It does not seek to reopen the issues which have had extensive debate. It seeks the advantage of some committee consideration. I stress that that advantage can be obtained today. It cannot be obtained in a fortnight or three weeks' time. I specifically ask the Democrats to consider the general principle that the Senate's detailed consideration of this matter will be assisted by some committee consideration. I ask them to put aside any other concerns they might have and to give their support for the motion to suspend Standing Orders. Senator MASON(New South Wales)(10.16) —This is probably a well meaning attempt by the Opposition to bring its point of view, or perhaps a public point of view, to a matter which, as the Leader of the Opposition, Senator Chaney, has said, has had a great deal of debate already. It is still in the transitional stage in the sense that I have moved a motion for disallowance of ordinances, which has been adjourned, and there have been various other motions, including one from Senator Harradine, to resolve this very complex matter. It is a complex matter. It is one of great difficulty which requires a good deal of thought and input from the community. We are getting that kind of input now. We would oppose immediately the suspension of Standing Orders, although we might be inclined, perhaps, to look at this later in the day. There may be an opportunity then to look at the motion, if it could be adjourned for that amount of time. I have not had time yet to consult the Standing Committee on Regulations and Ordinances, and the Committee's Chairman, Senator Coates, is not in the chamber. I do not know what his view is. It would be a grave lack of courtesy on the part of the Senate to visit a busy committee with a reference such as this, which must be an urgent one. As Senator Chaney has said, it will have to be looked at during the next two weeks. The other point is that it is not an easy matter. There is no way the Australian Democrats could agree with Senator Chaney that what is required of the Committee is something that it could knock off in an afternoon. What is required is a matter which could result in weeks of work. The Committee could receive responses from the public-as we know, many members of the public have strong views on this subject-which might occupy it for months. I am speaking to the question of suspension of Standing Orders because I think whether or not we have been able to consult the Committee bears directly, I suggest, on the question of suspension. Senator Chipp —Has the Committee been consulted? Senator Gareth Evans —Yes. The Chairman has rejected it. Senator MASON —That is the point. The Attorney-General says that the Chairman of the Committee, Senator Coates, has been consulted and that he has rejected the idea. Honourable senators interjecting- The PRESIDENT —Order! It is becoming difficult from the Chair's point of view, to hear Senator Mason. I ask Senator Mason and those senators who are interjecting to restrict their remarks to the reason for the suspension. Senator MASON —I suggest to you, Mr President, with regard to the suspension, that it is to the point that the Attorney-General has interjected that the Chairman of the Committee has been consulted and that he has rejected the idea. Senator Messner —What right has he to reject it? Senator Harradine —What right has he to say that? Senator MASON —Senator Harradine and members of the Opposition say: 'What right has he to say that'. I think it is a good idea for those remarks to be placed on the record. If honourable senators do not have sufficient respect for the Chairman of the Committee to place a reasonable workload on the Committee, we will create a precedent in this place. Senator Chaney —Mr President, I take a point of order. Under the Standing Orders of the Senate the references taken by committees is a matter for decision by the Senate. I remind the Senate that Senator Tate voted against the reference to the Standing Committee on Constitutional and Legal Affairs of the National Crimes Authority Bill. There are ample precedents for Caucus members of the Australian Labor Party to do their party's bidding on these matters. It is not a matter which under the Standing Orders lies within the province of the Chairman of a committee. It is a matter which lies within the province of the Senate. The PRESIDENT —The matter that is before the Chair now is the simple question of the suspension of Standing Orders to enable Senator Chaney to move a motion. The Senate now has to determine whether there will be a suspension of Standing Orders in the first instance. If it so agrees, Senator Chaney will be allowed to move a motion. That motion can then be debated. At this stage, I ask all honourable senators simply to keep to the question of the suspension of Standing Orders. Senator MASON —Thank you for that ruling, Mr President. The points you have made bear directly on the comments I will now make. Of course, they relate to the comments that Senator Chaney has made. Certainly, it is the Senate's authority and right to refer matters to committees. But surely there is an obligation on all honourable senators in this place to accommodate those committees as reasonably as we can and not to make unreasonable demands on them. I suggest to you, Mr President, that that bears directly on whether or not we agree to the suspension of Standing Orders at this stage and allow this matter to come on at this point. I make the point again that this matter has been dropped on the Senate at short notice. I cannot see why it could not have been done earlier yesterday-- Senator Archer —Would it have made any difference? Senator MASON —That is a matter I do not think we have to debate. Senator Archer can study his own conscience on that one. It does not matter whether it would have made any difference or not. The facts are that that did not happen. That is what we have to examine. If we get to the stage here where we study airy-fairy suggestions such as Senator Archer has made, we will never get any work done. I wonder whether the Leader of the Opposition, if he feels strongly on this matter , might agree to adjourn this matter until later in the day. That would at least give everybody time to look at the motion to suspend Standing Orders. Then we could perhaps decide what we were going to do. If we cannot do that, I do not see how the Democrats can in conscience support it. Senator GRIMES(Tasmania-Acting Leader of the Government in the Senate)(10.22) — At the moment the Government is not inclined to support this motion. However, we are willing to consider the proposition. In light of the sort of indignation we have heard here this morning from the Leader of the Opposition, Senator Chaney, I would like to point out the simple facts of this matter. Very late yesterday afternoon, Senator Durack came to me, as the Minister on duty, and said that he wanted to seek leave to move a notice of motion, something that he could have done yesterday morning, the morning before that or the morning before that. The notice of motion was obviously hurriedly drawn up some time yesterday. I had no objection-as I do not think I ever have any objection-to people doing that. I have done it in the past. Of course, no indication was given to me that we were going to add to the large number of items on the Notice Paper-for example, Senator Mason's notice of motion, which has been debated, and Senator Harradine' s notice of motion, which has been debated and will be debated again today-and that what the Leader of the Opposition was going to do, apparently without the agreement of the other Opposition parties, was to interfere with General Business. I notice that the first two General Business items on the agenda this afternoon-if I am right-are, in fact, matters that the Australian Democrats have raised. I do not think this is a satisfactory way to go on. As for the highly indignant statements to the effect that it is up to the Standing Committee on Regulations and Ordinances to take any reference that the Senate gives to it, of course that is true. Any reference that this Senate decides to pass to a committee should be passed to a committee. But as long as I have been in this place, it has been common courtesy to consult the chairman of that committee, first of all, to see whether the committee has the time to do the work and secondly, to see what sort of timetable it has. Quite frankly, considering the references on the agenda for that committee, that committee would be very hard pressed to complete that reference in three, four or five weeks, let alone two weeks. Senator Coates —There was no such approach. Senator GRIMES —No such approach was made. Let us not get indignant about the rights of honourable senators and the rights of the Senate. I agree with all of those rights. But let us remember that there is a bit of common courtesy in this place and that, in circumstances such as these, the chairmen of committees have always been approached. We received this notice of motion late yesterday afternoon. We received it because members of the Australian Democrats and members of the Government did not object to Senator Durack's seeking leave. So we got it at very short notice and very late. This morning we find, after going through the normal procedures, that what the Opposition wants to do is to suspend Standing Orders in order to bring this matter on under General Business, when General Business consists of items that the Australian Democrats have under General Business by arrangement with the Liberal Party of Australia. We are doing this in a situation in which we already have two items on the Notice Paper dealing with this matter. I do not know whether the Opposition is just indulging in political tactics-I have no objection to that-to keep debates going, to extend debates and to extend the number of debates. I do not know whether the Opposition is confused and has not been able to work out what its tactics should be. But it is not a very satisfactory circumstance. The Government is certainly not willing, without fair consideration, to go along with the suspension of Standing Orders to alter the General Business paper this afternoon without some concern that the people who already have that General Business time are in some agreement with it. If it is desired to adjourn the suspension of Standing Orders debate until later, if that is what the Democrats are requesting, to consider the matter-- Senator Chipp —We will agree to the suspension now and to debate it later. Senator GRIMES —All right; we will go along with that. But I think that all honourable senators on the other side must make up their minds as to what they want to do. The PRESIDENT —I should like to point out that the motion moved by the Leader of the Opposition is merely a suspension motion to enable the Leader of the Opposition to move a rearrangement motion. Senator CHANEY(Western Australia-Leader of the Opposition) —I seek leave to make a very brief statement, Mr President, so that what I am going to do will be made quite clear to the Senate and there is no misunderstanding. Leave granted. Senator CHANEY —I understand now that on the basis that if I move my motion and then adjourn debate on it to a later hour this day, there is a preparedness on the part of the Government and the Australian Democrats to agree to Standing Orders being suspended to allow the moving-- The PRESIDENT —Do you mean that you would adjourn the rearrangement motion? Senator CHANEY —Yes. So I shall seek the carriage of the motion to suspend Standing Orders, move the motion that I indicated I would move, and then seek to adjourn debate on it until a later hour this day. Senator GRIMES(Tasmania-Acting Leader of the Government in the Senate) —by leave -I would assume from both the Australian Democrats and the Liberals that the resumption of that debate will be in General Business time. Senator Chaney —Yes, and we shall have to talk about that. Senator GRIMES —The Opposition will be using up its own time, not ours. Senator CHIPP(Victoria-Leader of the Australian Democrats) —by leave-It is a reasonable and sensible course of action that the Senate has taken. I learnt about this matter this morning. The notice was given, apparently, at about 6 o' clock last night. We shall certainly agree to Senator Chaney's first motion now with a view to debating the other issue later in the day. But we would hope, if we could reach a gentleperson's agreement, that the Liberal Party of Australia will not eat into the time of General Business, because we have been waiting patiently for weeks, in agreement with the Liberals, to have two important issues of our own debated during that time. We hope that the Liberals will do the right thing and not encroach into our time during the General Business debate. Question resolved in the affirmative. Senator CHANEY(Western Australia-Leader of the Opposition)(10.28) —I move: That intervening General Business be postponed until after the consideration of General Business Notice of Motion No. 78 for the reference of a matter to the Standing Committee on Regulations and Ordinances. I seek leave to continue my remarks later. Leave granted; debate adjourned. Senator HARRADINE(Tasmania) —I seek leave, Mr President, to make a statement, because I am not too sure where we have reached at present. Leave granted. Senator HARRADINE —Am I correct in the understanding that Senator Chaney's motion will be the subject of debate this afternoon? Senator Grimes —Yes. Senator HARRADINE —If that is so, then the matters about which I am moving disallowance will be matters either to be referred or not to be referred to a committee, as the case may be. Senator Grimes —That is correct. Senator HARRADINE —In that event I move: That Business of the Senate, Notices of Motion Nos 1 and 2, standing in the name of Senator Harradine and relating to the disallowance of regulations be postponed until the next day of sitting. Question resolved in the affirmative. (Quorum formed) Consideration resumed from 4 May 1984. AUSTRALIAN BICENTENNIAL ROAD DEVELOPMENT TRUST FUND AMENDMENT BILL 1984 Senator GRIMES(Tasmania-Minister for Social Security)(10.31) —When the Committee last considered the Bill it was considering clause 2 (2), having deleted clause 5. We need to resolve the position in relation to clause 5, I move: That further consideration of clause 2 (2) be postponed until after the reconsideration of clause 5. Question resolved in the affirmative. Motion (by Senator Gietzelt)-by leave-proposed: That clause 5 be reinserted in the Bill as printed and reconsidered. Senator PETER RAE(Tasmania)(10.32) —The Opposition will oppose the motion moved by the Minister for Veterans' Affairs (Senator Gietzelt) but will support an amendment in the name of Senator Jack Evans, the details of which have been circulated, I understand. That amendment is in relation to clause 5 and seeks to leave out paragraphs (e) and (f) of proposed new section 23 (2). In summary, the Opposition will support the amendment which will be moved, the effect of which will be to change the definition of exempt work for the purposes of the Australian Bicentennial Road Development Trust Fund so that it will be possible for the Minister, if satisfied, to declare the following as circumstances in which it will not be necessary to tender: If the whole of the works concerned are urgently required by reason of an emergency; are of such a minor nature that the invitation of tender for those works would involve undue additional cost; are of a kind for which it is not practical to prepare adequate tender specifications; or are of a kind for which competitive tenders are unlikely to be received. However, during the previous debate in relation to this matter, the provisions in (e) and (f) were criticised from honourable senators on this side of the chamber as being unreasonable, unnecessary and removing the benefits of competitive tender and the check that that provides on the reasonableness or otherwise of the tenders which are being received and the value which the Australian taxpayer, in particular the Australian motorist, is obtaining for the funds provided through this special bicentennial road development levy of 2c per litre. The record is that since the introduction of competitive tendering there has been a 30 per cent improvement in the value of work done as against the estimates of the cost of the value. That tells its own story as to the benefit which is being derived as a result of the introduction of competitive tendering. I point out to those who have expressed some concern that the Minister still has the capacity to determine that the Department of Main Roads, a local government authority or whoever it may be should receive the work if there are special reasons, but at least there is the cross-check of competitive tendering to be considered. Experience indicates that the levy fund will ensure that the greatest possible amount of road construction, road improvement and road development works will be carried out. I have spoken first because of particular circumstances, but I indicate that the Opposition will support Senator Jack Evans's amendment, which I have read. We will then return to clause 2 (2) and I will speak in relation to that. Senator GIETZELT(New South Wales-Minister for Veterans' Affairs)(10.37) —The Government, in seeking to reinsert clause 5 in the Australian Bicentennial Road Development Trust Fund Amendment Bill, indicated, both in the second reading speech and in previous Committee debates, how much it believes this provision is integral to the success of the legislation. The Government announced in February this year that these would be the operative processes when the legislation was determined by the Parliament. The Government has undertaken a great deal of discussion with the smaller States in particular with a view to reaching a common position in respect of the main characteristics of clause 5. It is somewhat surprising therefore to find that Tasmania and Queensland have taken an attitude that negates the patient consultation and agreement that was reached with those two States. For example, the Minister for Transport, Mr Morris, has provided me with a telegram from the Minister for Main Roads in Tasmania which states: I wish to advise that Tasmania-- that is the Tasmanian Liberal Government- supports the relaxation of tendering procedures provided for in the Bills, and the following is the content of a telegram I forwarded to all Tasmanian senators , urging their support for the amendments: I will read that telegram: In the interests of the Tasmanian civil construction industry and the Tasmanian government's efforts to encourage development of that industry, you are urged to support the Commonwealth Government's relaxation of tendering procedures as proposed in the Australian Bicentennial Road Development Trust Fund Bill 1984 and the Roads Grants Amendment Bill 1984. The telegram is signed by the Hon. I. M. Braid, MHA, Minister for Main Roads in Tasmania. I therefore find it rather difficult to understand and appreciate the obstinacy of the Opposition. Of course, I understand that when the Opposition determined its attitude in respect of this Bill it was probably not sufficiently aware of the desire of the Commonwealth Government to recognise and legitimise the views of those States where a tendering process would enable some flexibility, particularly as it relates to local government. In particular, it failed to take into account the importance of the local government authority and the local constructing authority. Of course, that was based on the experience of the 1982 legislation. When it was proposed to amend the legislation detailed discussions were held with the States that had expressed some concern about the inflexibility of the previous legislation. It is interesting to note that while Queensland and Tasmania have conservative governments, those governments are supporting the initiatives of the Commonwealth in respect of this legislation. It was indicated to me by some National Party senators that they believe that a sensible approach is being adopted by the Commonwealth in this matter but that they are bound by a party decision. As I understand the processes of the Senate, when facts are brought to public examination the Government and the Opposition should seek a means of re-examining the legislation. If we are to be a House of review one would think that the Opposition would reconsider its dogmatic position taken earlier, in the absence of the knowledge of the views of those two respective governments, to which I have referred. I have sat in the Senate long enough to know that Opposition senators are constantly stating that they are representative of the State view and that they are here as the State's representatives. It is rather incongruous then that we should find ourselves in a situation where, notwithstanding the expressed views of the States and the misgivings of National Party senators from Queensland, the Opposition still persists in endeavouring to delete the important provisions of clause 5. They are obviously ignoring what the Minister in the other place has said and the assurances he has given and what I said last week in respect of the debate in the Committee stage when it was contemplated that clause 5 would be deleted from the Bill. It is clear that we are confronted with a dogmatic and obstinate position. I reiterate what was said: Those States that want this flexibility and want to exercise that flexibility on the basis of a direct representation to the Federal Minister will be expected to justify why their own or the local government constructing authority would not be successful in securing the contracts. We are not opening the door to unrestricted denial of private sector activity. We are opening the door only as it applies in respect of representations by the States themselves. The Minister will expect the State to make that representation in detail, stating how many employees may be affected by the inflexibility processes and how many employees may be retrenched or made idle if a particular tender is not won. This will enable the Minister to make an assessment of the number of employees affected and the effects upon the local economy. Senator Bjelke-Petersen stated in her contribution that it is important to recognise the very basic influence that the local government authorities in very many parts of Australia have over the economic viability of small regions. A State government will have to give reasons why those employees cannot be employed on other State or local government projects. So the States will have a rather tortuous job to place that before the Minister. Importantly, the Minister will have to look at the cost factor, which the Government appreciates is a part of the motivation of the Opposition. It is not solely the prerogative of members of the Opposition to adopt a cost competitive position. At a time of economic restraint it is essential for us to get the maximum out of every dollar that is spent, whether it is spent in the private or public sector. In this case, where public funds are involved, we want to get the most economic use out of every dollar too. The Minister will be looking at the expected cost of the project if performed by day labour. The Minister will not automatically, perforce of the fact that a State has made representations, give a certificate of exemption. He will look at it to see whether some comparison can be made with a tender price in a comparable area. In every way we seem to be confronted with bloody-mindedness. It is not the Government's philosophy that is being applied to this legislation. It is the Opposition's philosophy that the Government has been prepared to accept; that is , the right of the States to have an opportunity to make their representations to the Commonwealth. In the light of that very generous concession, which I believe the Minister has accepted, we have the support of the States to which I have referred. They have taken what I would regard as a very interesting step- not an unprecedented step-of circulating their views by telegram to the Tasmanian senators and suggesting that the Government's legislation, not the Opposition's approach, should enjoy the support of the Senate. Senator PETER RAE(Tasmania)(10.47) —I would like to reply to what I regard is one of the most mischievous, misleading and misrepresentative speeches I have heard in this chamber. Firstly, I indicated that the Opposition would agree to two-thirds of the proposals-that is, four of the six-going back into the Bill. The Minister for Veterans' Affairs (Senator Gietzelt) spoke as if bloody- mindedness, as he called it, had meant that there was an absolute refusal to consider any change whatsoever. Change has been made. The Minister should acknowledge that and not carry on as if the Opposition was just adopting an obstinate, bloody-minded attitude. Secondly, the Minister, if he was going to quote a telegram that was sent to him, might at least have considered, either in the first place or after my interjection, reading the reply because the reply indicated that all industry representatives refuted the suggestion made in the telegram and were strongly opposed to the destruction of our attempts to preserve the chance for private enterprise to participate and were keen to ensure that value for the dollars spent was obtained. I believe that the Minister has totally misrepresented and misunderstood the position adopted by members of the Opposition generally in relation to the Senate; that is, that we are representatives of the States but not of State governments. I object to the Government of Tasmania being called a conservative government by the Minister; it is a Liberal Government. If the socialist Minister wants to start throwing names around, I will call him a socialist Minister all the time instead of a Labor Minister. I do not suppose he will mind. But let us have the proper names referred to in this chamber when we are talking formally about what sorts of governments exist or what sorts of parties are in power or not in power in any particular place. Finally, let me reiterate that as a result of the reconsideration and discussion which has taken place, four of the six proposals for the new definition of exempt works are to remain in the Australian Bicentennial Road Development Trust Fund Amendment Bill as far as the Opposition is concerned. Senator Jack Evans will be moving an amendment. I wish the Minister would acknowledge that if he speaks and not misrepresent the position in the ways to which I have already referred. Question resolved in the affirmative. Clause 5 (Additional conditions with respect to approved projects). Senator JACK EVANS(Western Australia)(10.44) —I move: Proposed clause 5, paragraph (d), proposed paragraphs 23 (2) (e) and (f), lines 20 to 30 leave out the paragraphs. I would like to just make it quite clear that the amendment omits from the proposals and the requirements of the Minister for Veterans' Affairs (Senator Gietzelt) two of the four exempt classifications. I have had prolonged discussions with a number of people, including the Minister, the shadow Minister and the private contractors which, I notice, comprise the forgotten group in the debate from the Government side. The Minister keeps referring to the consensus that has been achieved by the parties which are involved in this legislation and its flow-on effects. The Minister needs to be reminded that a major party which has not agreed to this proposal is the representative group of the private contractors. It is all very well for the Federal and State governments to come together in a cosy arrangement which will exclude private contractors from certain categories of work and then for the Minister to claim that he has consensus simply because two arms of Government, or two levels of government, have reached agreement. That is not consensus; that is one group benefiting at the expense of another group. I think it needs to be quite clearly understood that we are not endeavouring to give an advantage to private contractors. We are endeavouring to redress an advantage that was going to be given to State and local governments at the expense of private contractors. All this amendment will achieve will be to ensure that all parties are in there with an opportunity to do this work. That means that they will each have to tender. I wish now to make two other points. The exemption would apply to works, the whole of which are: . . . of a kind that are usually carried out by a Department of State of the Commonwealth or of a State or by a particular person by virtue of a law of the Commonwealth or of a State, not being a Department or a person responsible for the construction of roads-- That sounds nice and simple. It may indicate that we are talking about only relatively small amounts of work which are done. Odd departments might do a few hundred dollars worth of work to clear up an electricity problem, a water problem or a railroad problem that, strictly speaking, is not the responsibility of a main roads department or a roads department. But it goes much further than that. I think the Minister needs to be aware of this when he is reading and taking cognisance of telegrams from Tasmania. That cosy little group of departments includes the Hydro-Electric Commission of Tasmania, a body which is not known for its backwardness in using influence of a variety of kinds on the Government of Tasmania, which Government would then transfer that pressure on to the Federal Minister. I believe that my amendment literally lets the Federal Minister off the hook. He certainly has not said this but I have a feeling that he will be quite relieved when this amendment is passed. It removes, by deleting both paragraph ( e) and paragraph (f) of clause 5, the possibility of having the gun pointed at his head by State Ministers and State governments, either on their own behalf or on behalf of local government bodies, to refrain from calling for tenders simply by the means which would be allowed under the Government's Bill of saying: 'We are about to lose jobs. Please do not call for tenders. Give us the work without going through that process. Do not put us into a competitive situation'. Of course, the Minister has missed one other vital aspect in this part of the Bill. Under this clause not only would tenders not be called but also there would be no requirement for the work to be budgeted. Therefore, it is quite possible under this clause for a State government to come forward and say: 'We want to do the work on a cost-plus basis and for it to proceed along those lines with no limit set because no tenders have been called. Therefore, there is no requirement, under the legislation as proposed, for a Budget to be agreed by the Federal Minister'. We are not willing to accept that that sort of blank cheque could be written under pressure from State governments, particularly in the sensitive area of contracting when there is a potential loss of jobs in both the private area and the public area. We believe that cognisance needs to be taken of all the considerations, including the price for this work to be done. Senator MacGIBBON(Queensland)(10.57) —I wish to speak in support of the amendment which is before the Committee. As I said in my speech in the second reading debate, the cost of building roads is an enormous impost on the Australian community. It is absolutely vital that we get value for every dollar spent; not only for every dollar we spend building the roads but also every dollar we spend in maintaining them. There is absolutely no substitute for the place of private enterprise in road building in Australia; that is an established fact. I regret that these amendments do not go as far as I would wish them to go to open up completely to competitive tender road building in this country. But at least they go some way towards it and that will be of very great benefit to the Australian community. Senator GIETZELT(New South Wales-Minister for Veterans' Affairs)(10.58) —What has emerged during the debate clearly shows that a different philosophical position is being introduced into the debate, one which I suppose can generally be described as the bent that the Opposition has overall of privatisation. However, leaving that aside, clearly what is not understood by either the Opposition or the Australian Democrats is that the Government sees clause 5 as an important ingredient in the processes of road construction but not the major characteristic of the process. We do not see it as the general rule; we see it as the one-off case that will be made to the Minister for Transport (Mr Peter Morris) given a particular circumstance. The Minister in no way will be involved in encouraging the Victorian, Tasmanian, and Queensland governments, or any other government, to bypass the private road construction authorities. That is not what is intended in paragraphs (e) and (f) of clause 5. That was not what was intended either in the Minister's debate in the House of Representatives or in my contribution in the Senate. Of course, we believe in consultation and, to some extent, consensus, but that does not mean at the disadvantage of the particular circumstances that will arise in paragraphs (e) and (f). I am sure that Senator Peter Rae will agree with me, even if he does not like the description of the Tasmanian Government as being conservative, that it is not a government committed to an extension of the day labour processes. It believes in providing opportunity for private sector construction. Similarly, I am sure that Queensland senators would say that that would be the overwhelming theory and practice of the Queensland Government. It was Mr Hinze who criticised the legislation that was introduced by the Fraser Government. He wanted the right and the opportunity on occasions to exercise the flexible approach to which I have referred. That is why we have the submissions to us. I concede that some ground has been made in respect of maintaining portions of clause 5 but, after all, it was the Senate, at the initiation of Senator Peter Rae with the support of Senator Jack Evans, that voted to delete clause 5 completely. I accept that there has been some movement, but that has occurred on the basis of representations made to the Minister whom I represent in this place by the very governments we are seeking to help, not with the view of driving a bulldozer through the legislation; rather, of letting a fly escape on the odd occasions when the Minister will be so requested on the initiative of the State. Can honourable senators imagine the Queensland or Tasmanian Minister taking advantage of paragraphs (e) and (f) with a view to ignoring completely the private construction authorities? I think that is manna from heaven. That is out of the realms of possibility. Rather they will be giving emphasis to the points that Senator Jack Evans and Senator Peter Rae have made. The last thing they would do would be to deny the right of private sector involvement in road construction. But they want the right, where circumstances exist, to come to the Federal Minister and say: 'In these circumstances it cannot happen. We cannot get the best deal and we therefore have to have an opportunity to let the local authority be the construction authority without the tortures of the tendering system.' I am advised that the cost of the project would have to be approved, based upon the project itself. That is inherent in the whole of clause 5. If the costs were to be excessive because of the day labour component, the Minister would have to negotiate, even under the basic principles of the clause itself. The Government accepts the fact that the majority view in this place obviously prevails. But I just want to try to allay the suspicions and concern that have been expressed that somehow or other this is a backhanded method of denying the private construction industry opportunities that advantage them in any of the tendering processes. It is the Minister's anticipation that these will not represent more than a handful of cases in the thousands of road construction projects under the bicentennial project. Having said that, the Government accepts the inevitability of the view that the construction authorities could be accused of having a vested interest in this matter. One does not carry consultation or consensus of view where a minority view becomes the majority view. We have a majority view that is made up of a State like Tasmania-I will not use adjectives which might upset senators-that does not normally agree with the Federal Government and a State like Queensland that I do not think even agreed with the previous Liberal Government on many issues. They have been prepared to say that the legislation has value. I would have thought that would be sufficient to allay the suspicions of even the most difficult Liberal Party, National Party or Australian Democrat senator. We will be persisting with the view, as I have endeavoured to do in my contribution, that the legislation should stand. The legislation has been worked out in consultation with the appropriate authorities. It is an expression of the co-operative federalism which I believe was a cornerstone of Liberal philosophy. The Minister has gone out of his way to accommodate that view and to that extent we will persist with our attempts to have clause 5 stand as printed. Question put: That the words proposed to be left out (Senator Jack Evans's amendment) be left out The Committee divided. (The Chairman-Senator D. J. Hamer) Ayes . . . . . . . . . . . 31 Noes . . . . . . . . . . . 29 —— Majority . . . . . . . . . 2 —— Archer, B. R. Lajovic, M. E. Baume, Peter Lewis, A. W. R. Boswell, R. L. D. MacGibbon, D. J. Carrick, Sir John Macklin, M. J. Chaney, F. M. Martin, K. J. Chipp, D. L. Mason, C. V. J. Collard, S. J. (Teller) Messner, A. J. Crichton-Browne, N. A. Missen, A. J. Durack, P. D. Rae, PeterEvans, Jack Reid, M. E. Guilfoyle, Dame Margaret Teague, B. C. Haines, J. Townley, M. Hamer, D. J. Walters, M. S. Hill, R. Watson, J. O. W. Jessop, D. S. Withers, R. G. Kilgariff, B. F. Bolkus, N. Jones, G. N. Childs, B. K. McClelland DouglasCoates, J. McIntosh, G. D. Coleman, R. N. Maguire, G. R. Colston, M. A. Primmer, C. G. Cook, P. F. S. Ray, RobertCrowley, R. A. Reynolds, M. Elstob, R. C. Richardson, G. F. Evans, Gareth Robertson, G. F. Georges, G. Ryan, S. M. Giezelt, A. T. Sibraa, K. W. Giles, P. J. Tate, M. C. Grimes, D. J. Walsh, P. A. Harradine, B. Zakharov, A. O. Hearn, J. M. Bjelke-Petersen, F. I. Button, J. M. Scott, D. B. Foreman, D. J. Question so resolved in the affirmative. Clause, as amended, agreed to. Postponed clause 2 (2). Senator JACK EVANS(Western Australia)(11.11) —Mr Chairman, I seek your direction as to whether, by deleting clause 2 as it stands, which includes deleting the sub-clause relating to the date of proclamation, we would effectively destroy the Bill. I do not wish to do that. I want to know whether it is necessary for me to move an amendment to clause 2 (2). The CHAIRMAN —Clause 2 deals, of course, with the date of commencement of the Act. Sub-clause (1) is not under consideration. No motion has been moved for us to reconsider that sub-clause. The only sub-clause that is being reconsidered is sub-clause (2) of clause 2, which deals with the date of operation of clause 5. Now that clause 5 has been reinserted, presumably some clause such as clause 2 ( 2) would be necessary, either in the present form or a variation of it. Senator PETER RAE(Tasmania)(11.12) — The position is this: Clause 5, which has been reinserted, contains the first four of the new definitions of exempt works. It does not contain what were originally the last two definitions, (e) and (f). The consequential matter which arises is in relation to the commencement date of the amendments made to the definition of exempt works by clause 5 as amended. Clause 2 (2) of the Bill attempts to include an element of retrospectivity for which there has been no justification and for which there could not conceivably be justification, unless the Government is adopting an attitude of taking the Parliament to be nothing more than a rubber stamp. The deletion of clause 2 (2) will mean that clause 2 (1) will remain. Clause 2 (1) provides for the Act to come into operation on the day on which it receives royal assent. There is no problem with that. That is the normal thing which would happen to legislation which is not made retrospective, or not made prospective to a particular date. In other words, it comes into operation on the day on which, in the normal course of events, it receives royal assent. We oppose retrospectivity being applied in a case where there is absolutely no justification for retrospectivity . As I understand it, that is what Senator Jack Evans was concerned about. I hope that what I have said clarifies the matter. Senator GIETZELT(New South Wales-Minister for Veterans' Affairs)(11.13) —I should respond on behalf of the Government because I have been advised that there are a small number of cases waiting for approval as a result of the Government's decision to agree to introduce the legislation. Senator Peter Rae asked why that provision was contained in the Bill. Representations were made to the Commonwealth by some of the States which wanted that authority because in the previous legislation there was no such authority. We have been arguing about the application of the Minister's prerogative in all the circumstances that we have canvasssed many times. The fact is that we sought to make the provision retrospective to that date because it is since that date that the representations have been made to us. Having regard to the fact that the legislation would come into effect, say, as from tomorrow, it would not have been able to be applied to those cases in the respective States which have made representations to us. Now that the Committee has seen fit to amend clause 5 by deleting two paragraphs which were unacceptable to the majority of honourable senators, this provision in clause 2 (2) does not really make a great deal of difference. The Bill will come into effect based only upon what is now contained in clause 5, and the Minister will apply the provisions in accordance with the decision of the Committee. Senator JACK EVANS(Western Australia)(11.16) —I believe that a fundamental principle is involved. I am willing to take the odium and for this Government to bear the expense of having resubmissions if it already has items in the pipeline that come under clause 5, paragraphs (a), (b), (c) and (d). I am willing to do that because there is a salutary lesson to be learnt by this Government and all governments that the Senate cannot be taken for granted. The decision of the Senate is potentially a decision to amend, to reject, to change the whole nature of legislation which comes forward from a Minister in the House of Representatives. I make no apology for supporting the Opposition in a rejection of this clause because, in doing so, we will make it very clear to all Ministers that they cannot take for granted the passage of legislation in the Senate, that the Senate is fulfilling its function, and that it will amend, review and behave in a way that the Minister for Veterans' Affairs (Senator Gietzelt), who is at the table, said it should behave 20 minutes ago; that is, as a House of review. We have already changed clause 5 substantially. It would be silly for us now to say that part of the deal that the Minister did with State governments can be made retrospective, but in regard to the other part they will have to start all over again through the tender calling process. So we have no alternative. If this House is ever to be seen by Ministers in the other House as a House capable of standing on its own two feet, capable of reviewing, we have no alternative but to reject this retrospective clause. Senator MacGIBBON(Queensland)(11.18) —As I understand what the Minister for Veterans' Affairs (Senator Gietzelt) has said, no decisions have been taken with respect to the letting of tenders in a prospective way with respect to this legislation. He used the phrase 'representations from various States'. Whether that is true is irrelevant. The crux of the issue, as Senator Peter Rae and Senator Jack Evans have said, is that a government cannot act before a Bill is passed into law. It is as simple as that. Whatever difficulties the Government was in, whatever embarrassments it might have suffered by presuming the Bill would be rubber stamped by both Houses, are just too bad. The fact is that we make the laws, not the Ministry. Senator GIETZELT(New South Wales-Minister for Veterans' Affairs)(11.19) —It appears that honourable senators opposite completely misunderstand the purpose of this clause. It has never been the Government's intention that the Senate be regarded as a rubber stamp, a point made by Senator Jack Evans and gladly picked up by Senator MacGibbon. What I have been endevouring to say-and it has obviously been falling on deaf ears-is that clause 5 was inserted in the Bill at the direct request of the Tasmanian and Queensland governments. As a result of those negotiations and consultations, agreement was reached about the Bill. Consequently, a starting date was put into the Bill so that the half a dozen cases which are currently before the Minister (Mr Peter Morris) from the States in question would be able to be approved, because they could not be approved under the old legislation. I think that when any Minister of the Crown gets representations from two State governments which are-to satisfy Senator Peter Rae-non-Labor governments and which say 'We want this clause in the legislation and we wanted these processes applied in it', the circumstances of politics being what they are, the Minister is entitled to say that the legislation enjoys the overwhelming support of senators from those States and should not have the position misrepresented to the effect that it is somehow taking away the right and the obligation of the Senate to review the legislation. It should be understood, rather, that the Federal Government is putting forward a piece of legislation that coincides with the views of those governments. The State governments in this case were entitled , therefore, to believe that, as their views are accommodated in the Senate, with the exception of Senator Jack Evans and his Party, there would be a fair chance of the legislation being passed-recognising that the Government does not have a majority in its own right. Therefore, a date upon which the agreement was reached with the respective States was naturally put in the legislation so that the Minister would have the opportunity to deal with those applications at the time the Bill was approved by the Parliament. The Senate has seen fit to change that, and we do not quarrel with the fact that now that it has changed obviously the date, 12 February 1984, is superfluous to the Bill. What I have to answer, however, is the suggestion that somehow the Government, which lacks a majority, expects the Senate automatically to approve its legislation. It was naturally expected that senators from Queensland and Tasmania at least would depart from their traditional position of opposition and adopt their constitutional function of representing the States and the State view that exists on these matters, and that the Bill would be regarded as a Bill that perhaps enjoyed the bipartisan support of the Parliament . That support has not been forthcoming. We accept that. The Minister will now have to go back to the States and say: 'The Senate has amended clause 5'. Obviously, what the States will do now will be to make fresh application based on the decision of the Senate. The reason we inserted the date in the Bill is that it was the date on which agreement was reached between two States who normally do not agree with the views of the Commonwealth in respect of legislation. Senator JACK EVANS(Western Australia)(11.22) —I want to clear up something because I am a relatively new person to this place. An explanation has just been given by a Minister of how we should behave in this place if the States and the Commonwealth reach an agreement. The implication seemed to be that, if my State Government reaches an agreement with the Commonwealth, I should go along with that agreement because I represent my State Government. Let me make it very clear that I certainly do not represent my State Government. I receive representations from it to which I listen attentively and, where possible, I endeavour to take into account its wishes. But I am the representative of over a million people in Western Australia, not just of the couple of hundred who sit in the State Parliament. I believe that that applies to all honourable senators in this place. We are States' senators representing the 15 million Australians in those States, and not representing the six State governments and the Territories. If the Minister has that misconception, I suggest that he needs to look again, certainly as far as the Australian Democrats are concerned. It may be that this is the way things function in other parties. I have been witness to telegrams being read out in this chamber as questions without notice, telegrams that have very obviously come from State governments and State Premiers. I suspect that there may be a degree of compliance by some senators with their State governments. But for goodness sake, let us not work under the misconception that any of us here are the tools of State governments. When a Minister reaches agreement with his State government counterparts, he must make it perfectly clear that that agreement is subject to the passage of the legislation in both Houses of this Parliament. He can take neither of the Houses for granted. He certainly cannot take the Australian Democrats' position for granted. In this case, the Democrats were unaware of the agreement until the legislation came before us. We had no preconceptions. We had had no representations from State governments of which I am aware on the legislation. So the suggestion that that date should apply for clause 5, paragraphs (a), (b), (c) and (d), is still not acceptable to the Australian Democrats. We will be voting against clause 2 (2). Senator PETER RAE(Tasmania)(11.28) —I certainly concur with what Senator Jack Evans has just said. I find quite offensive what the Minister has been suggesting as the justification for the Government's action. It just cannot be true. There is no reason why, the moment this Bill has been passed and receives royal assent, the new law should not apply and the existing applications be dealt with on that day by the Minister. Not a day need be lost. On the Minister' s explanation, retrospectivity is not needed. For the reasons that have been outlined, I find retrospectivity to be offensive. Senator Gietzelt —You asked for an explanation; I gave it to you. Senator PETER RAE —It was not a good explanation; it was an inaccurate one. The point is that the Bill will become law from the day on which it receives royal assent. From that moment it will be possible for applications in regard to exempt works which come under clause 5, paragraphs (a), (b), (c), and (d), which amends section 23 of the principal Act to be considered and approved by the Minister if he sees fit to do so. There is no need for retrospectivity, on the Minister's own explanation. Senator MacGIBBON(Queensland)(11.29) —I listened with amazement and incredulity to what the Minister said, because what he said was that because a Labor Minister in a Federal Parliament had reached agreement with two non-Labor governments, the will of the Senate was therefore compromised and neutralised and that a literally illegal act could therefore be made legal by a retrospective clause. A further part of the argument was that I am in some way a representative tied and bound by the Government of my State. I thought that even Senator Gietzelt, who has been here a lot longer than I have, would know that he was elected, as are all of us, by the people of our States and that State governments really have nothing to do with it. I am here as a representative of my State and not of my State government. I think it is perfectly proper that as a representative I take cognisance of and, where possible, aid and abet that State government, whether it is of my political persuasion or whether it is of the opposite persuasion. I have made that position publicly clear in the six years I have been a member of the Senate. I have publicly invited the Government of my own State to contact me and put a point of view that it wished promoted in this Parliament. I think it is a perfectly proper and perfectly ethical position to have. I might say in passing for the record that I have never had an approach from the Premier of my State to help him in any way at all, and I leave that as a matter of public judgment, because I think that senators do have a place in arguing the case for the Government. But that is separate and distinct from their primary purpose here, which is to represent the people of their State, and their interests, in a corporate way, as representatives of that State. The final point I make about this clause is that is it a retrospective clause, and I have opposed on every occasion that I have been in this Senate any legislation that had a taint of retrospectivity about it. Therefore, on those grounds alone I would be opposing this sub-clause of the Bill. Clause 2 (2) negatived. Title agreed to. ROADS GRANTS AMENDMENT BILL 1984 The Bill. Senator PETER RAE(Tasmania)(11.31) —I suggest to the Committee that the same procedure be adopted as was adopted in relation to the Bill which has just been dealt with, and that to save time the same points be made. They apply in exactly the same way. That is, that in relation to the definition of exempt works, the first four criteria be left in the Bill and the last two criteria be deleted, and that the provision for retrospectivity to 12 February be deleted. As I understand it, Senator Jack Evans has drafted amendments to that effect. I have such amendments, too, but I am happy for him to move his amendments, and the Opposition will support that course of action. Judging from the attitude adopted by the Minister for Veterans' Affairs (Senator Gietzelt) in relation to the last matter of difference, I hope that it will not be necessary to divide. The points have been made, and we may be able to get through the matter quickly without further speeches. I think that all the speeches that have been made apply equally to this Bill. Amendments (by Senator Jack Evans)-by leave-agreed to: (1) Page 1, clause 2, sub-clause (2), lines 10 and 11, leave out the sub-clause . (2) Page 2, clause 3, paragraph (b), proposed definition of 'exempt works', paragraphs (e) and (f), lines 11 to 22, leave out the paragraphs. Remainder of Bill-by leave-agreed to. Bills, as amended, agreed to. Bills reported with amendments; report adopted. Bills (on motion by Senator Gietzelt) read a third time. [COGNATE BILLS: APPROPRIATION BILL (No. 4) 1983-84 APPROPRIATION (PARLIAMENTARY DEPARTMENTS) BILL (No. 2) 1983-84] Consideration resumed from 4 May, on motion by Senator Grimes: That the Bill be now read a first time. Question resolved in the affirmative. Bill read a first time. Senator GIETZELT(New South Wales-Minister for Veterans' Affairs)(11.34) —I move : That the Bill be now read a second time. I seek leave, Mr Deputy President, to have the second reading speech incorporated in Hansard. Leave granted. The speech read as follows- I present Appropriation Bill (No. 3) 1983-84 which, together with Appropriation Bill (No. 4) 1983-84 and the Appropriation (Parliamentary Departments) Bill (No. 2) 1983-84 which I shall introduce shortly, comprises the Additional Estimates for 1983-84. In these Bills, Parliament is asked to appropriate moneys to meet essential and unavoidable expenditures additional to the Appropriations made under Appropriation Acts (Nos. 1 and 2) 1983-84 and the Appropriation ( Parliamentary Departments) Act 1983-84. These additional appropriations are required to meet commitments that have been approved by the Government since the Budget and additional requirements of an ongoing nature. The principal factors underlying the requirements are cost and price increases since the Budget was prepared. Although the Budget figuring contained allowances for prospective wage and salary increases, those amounts were not then appropriated, and funds are now required to meet the costs of awards and determinations made since that time. The national wage case decision in October 1983, in particular, provided for increases of 4.3 per cent. Expenditures relating to staffing increases have, for the most part, been met from the provision under Division 312 of Appropriation Act (No. 1) 1983-84 which provided 'Special funds' for the salaries and related administrative costs of government initiatives approved late in the Budget context but in respect of which it was not then practicable to allocate amounts to specific departments' appropriations. Particulars of amounts issued under Division 312 were provided to the Senate on 29 March. The additional appropriations in the three Additional Estimates Bills total $ 632.1 million. Of this, $508.5 million is sought in Appropriation Bill No. 3, $ 121.9 million in Appropriation Bill No. 4 and $1.7 million in Appropriation ( Parliamentary Departments) Bill No. 2. These amounts are offset in part by savings in the appropriations made by Appropriation Acts (Nos. 1 and 2) 1983-84 and Appropriation (Parliamentary Departments) Act 1983-84, reflecting the Government's determined efforts to achieve savings in expenditure for ongoing programs wherever possible. These savings, amounting to $295.7 million, are detailed under the relevant appropriation headings in the document, 'Statement of Savings Expected in Annual Appropriations', which has been distributed to honourable senators. After allowing for prospective savings, the appropriations now sought represent a net increase of $336.4 million in expenditures financed from annual appropriations. As a proportion of total outlays-encompassing both annual and standing appropriations-this increase amounts to 0.59 per cent. I note here that it is testimony to the Government's more thorough and rational management of the budgetary process that this proportion has fallen markedly from 2.3 per cent in 1982-83 and 1.1 per cent in 1981-82. Details of the total outlays picture were published on 8 March following the Government's mid-year review of the Budget estimates. I now outline some of the main areas in respect of which the Government has found it necessary to seek additional provisions in Appropriation Bill (No. 3) 1983-84 to meet expenditure for the ordinary annual services of the Government. An estimated $157 million is for wages and salaries, $78.2 million being for non-defence and $78.7 million for defence purposes, to meet increases in award rates and other wage and salary costs. The amounts include the wage and salary components of additional funds being provided to statutory authorities funded under one line appropriations. As I mentioned earlier, costs in respect of approved increases in staff numbers have been met from Division 312 of Appropriation Act (No. 1) 1983-84. $16.3 million is included under the Department of Defence for additional payments on aircraft projects, mainly the FA-18 fighter program. The increase has resulted from a rescheduling of payments. Total increases have been substantially offset by exchange rate savings. $14.7 million is sought for the Department of Education and Youth Affairs for assistance for tertiary students and for Aboriginal study grants. The increase is due to a higher number of eligible students than estimated and, on average, higher payments per student. The increased requirement for Aboriginal study grants reflects the trend by Aboriginal students towards longer courses than previously. An amount of $59.1 million is sought under the Department of Employment and Industrial Relations for labour force and training programs. The major part of the increase relates to the following areas: assistance for work experience training for Aboriginals the adult wage subsidy scheme The increase is mainly attributable to continued high levels of approvals under the range of wage subsidy programs, increases in the provision made for special groups and, to a lesser extent, policy decisions taken to increase activity in particular areas, for example, with respect to trade apprentices and retrenched workers. $12.1 million is sought under the Department of Health for expenditure under the Health Insurance Commission Act 1973 for administration of Medicare benefits payments. The increase reflects a reallocation of costs between the planning and establishment and the ongoing administrative phases of the Medicare benefits payments arrangements and cost and other unforeseen increases in expenditure. Once the reallocation of funds is taken into account the net increase in outlays is $5.54 million. An additional $8 million has been provided to the Department of Transport for the Tasmanian freight equalisation scheme reflecting a higher incidence of freight subsidy payments to shippers of eligible goods between Tasmania and the mainland. I commend the Bill to the Senate. Senator GILES(Western Australia)(11.35) —On a previous occasion in the Senate, on 4 May, I was taking the occasion of these Appropriation Bills to speak about a recent conference held in Tokyo to discuss with other countries of the region the end of the United Nations Decade for Women. I have made reference to the fact that there was considerable value in the fact that the conference was being held in Tokyo, where Japanese women had a considerable amount of input to the conference, and were also able to derive a great deal of comfort, information and support from other countries in the region. The conference was chaired by Her Excellency Mrs Nobuko Takahashi who led a strong official delegation from Japan. In addition observers were admitted as representatives of a wide range of non-governmental organisations, many of which are familiar to Australians. These included the International Alliance of Women, the International Council of Women, the International Organization of Business and Professional Women, the International Planned Parenthood Federation, the Women's Christian Temperance Union, the Young Women's Christian Association, and Zonta International. In almost every case these organisations were represented by Japanese women. Amongst the issues which concerned them greatly was the ratification by their own Government of the United Nations Convention on the Elimination of All Forms of Discrimination Against Women. Prior to the ratification of that Convention, the Japanese Government is very anxious to introduce into its own Parliament a Bill which will provide for equal employment opportunity. But there are very difficult problems between labour and management and not a high level, one could conclude, of serious commitment to the principles of non-discrimination. The Japanese Government sees the enactment of this Bill as a prerequisite to ratification of the Convention but at the same time those women representing non -governmental organisations, unions and political parties in Japan are seriously disturbed about some of the implications. It is clear that there is a strong body of opinion which believes that Japanese trading advantages over the years have been largely gained at the expense of very poorly paid women. Currently the official estimate is that the average female wage is only 52 per cent of the average male wage. At the Conference a whole range of obstacles was identified, obstacles which are preventing women in the region from reaching the equality which we seek and which the United Nations instruments and conventions advocate. Many of these obstacles are extremely difficult to overcome. They go to the traditions of centuries in many of the countries in the region. They go to the poverty and to the deprivation which is still widespread in the region in countries of enormous populations. They go also to issues of whether religions, in themselves, in some cases tend to oppress women particularly. There were some very interesting debates concerning whether Islam, for example, in its purest forms, provides for true equality between males and females and whether it simply reinforces the notions of biological determinism that are very familiar to many of us. Priorities in the region perhaps tend to take a different line from those with which we in Australia and New Zealand are familiar. Heading up the list are such issues as adequate food supplies, proper nutrition and family planning. Other issues of considerable concern throughout the region are the health and education of women and domestic violence. Another issue which engendered a considerable amount of very interesting and quite alarming debate was prostitution within the region. It is evident that some governments are allowing entrepreneurs to boost the tourist industry by organised prostitution and the sexual exploitation of women. The Conference was distressed to hear of particular instances of exploitation, extreme cruelty and in some cases barbarity. For example, we were told of a recent incident in Thailand where a brothel burnt to the ground and five prostitutes died. The reason they were not able to escape from the fire was that they were chained to beds by their feet to stop them from running away. Much of the exacerbation of prostitution in the area is the result of heavy migration from rural areas to the cities and the lack of proper and rewarding employment for women. The report provided to the Conference after its five days of deliberation was adopted by all the delegations except that of Iran. We were given to understand that this is not an unusual occurrence and that Iran frequently reserves its position. Nonetheless, it was extremely valuable for the Conference to have the delegation from Iran taking part in discussions such as the one I have referred to on prostitution and also on the subject of religion. Though unable to come to agreement on those two issues, we all came away with a much better understanding of the position of women in Islam, specifically the Shi-ite women from Iran. Amongst the resolutions that came out of the Conference were a number that went to particularly practical resolutions of some of the problems I have mentioned. High on the list was an exhortation that due attention be paid to economically deprived women in urban areas and in urban development to improve their living conditions and that, in relation to rural women, special attention be given to broad guidelines and models, including democratic agrarian reforms to improve their conditions. Special development measures must be taken by the United Nations to meet the needs of women in the least developed countries in health, including family planning, in education and in employment. It was very clear that many smaller and less well developed countries completely lacked any data base. This was a matter of concern in Australia not very long ago. We have got to the point now where we have much better statistics in relation to women's place in Australian society in every sense, not just as part of our economic structure but also in relation to levels of education and health. In many countres these statistics are inadequate, if not unavailable. It was recommended that in order to provde a firm base for the integration of women 's concerns into the overall development process a greater effort is needed to provide a sound conceptual base for women's issues and for the development of realistic models for action in differing socio-cultural, economic and political contexts. Work in this area can be undertaken in national and regional research institutions as well as in international and United Nations agencies. In this context attention should also be given to increasing the planning capabilities of women. It was obvious that the more sophisticated nations like Australia should undertake this extra responsibility, which I believe we are very well equipped to do, especially in relation to the smaller nations of the Pacific. We were very concerned that in the development of the region women should be given every opportunity. That point was made by the Australian delegation particularly and taken up in the eighteenth resolution, which reads: Special efforts should be made at both national and regional levels to ensure that women have equal access to all aspects of modern science and technology, particularly through education systems. The use of science and technology can be a powerful instrument in women's development. Special research to evolve appropriate technology for rural women and housewives should be carried out and existing and new technologies should be disseminated as widely as possible. The co-ordination of such activities should be the responsibility of ESCAP-- the Economic and Social Commission for Asia and the Pacific- in co-operation with other intergovernmental bodies and agencies dealing with the status of women or technology. In relation to prostitution the resolution adopted by the Conference, with the sole reservation of Iran, said: With respect to the specific impact of tourism promotion on women and the effects of very rapid migration of young women from rural areas, the meeting called on Governments to undertake concrete action against the increasing incidence of prostitution and sex-trafficking. In particular, Governments which had not already done so, are urged to: (a) Impose stricter penalties through legislation on those responsible at all levels for the organised prostitution trade; (b) Raise the problem of prostitution at the regional level so as to exert pressure on those countries involved in the trade to do their share in halting organised prostitution. It may appear that Australia has very little to do with this question but there was anecdotal evidence to the effect that plane loads of Australian males are going on organised tours to such countries as the Philippines, which really does not help anything very much except perhaps the Philippines tourist trade. It certainly is of no assistance to the general question-the raising of the status and opportunities of women generally in the area. The position of Iran on prostitution was once again very interesting and tended to be rather punitive as far as the victims, the prostitutes, are concerned. The Islamic Government of Iran believes and advocates that social measures should be taken to improve the education opportunities of women generally and to make certain that problems of rural and urban living are approached in a positive fashion. But we were quite intrigued by one of their recommendations in relation to the avoidance of prostitution, that young women should be encouraged to marry very early in which case their 'sexual instincts', as they described them, would be controlled by their husbands. If all else fails, prostitutes in Iran, I believe, are gaoled. Every delegation which gave its country paper to the Conference-I think 30 papers were delivered-emphasised the enormous significance of peace for development and equality in the region. I think most honourable senators would be aware that those three issues-peace, equality and development-are the main themes of the decade. There was a considerable amount of discussion about just what priority the issue of peace should take amongst the recommendations that came from the Conference. After a fair amount of negotiation between the delegations a formulation was finally arrived at. In fact it was the Mongolian delegation that provided the words to which all delegations were able to agree. It read thus: The achievement of peace is a main prerequisite for the implementation of strategies for the advancement of women. . . . . To this end, it is recommended that measures be undertaken aimed at strengthening the role of women in politics at all levels on a par with men, and expanding the active participation of women in the decision-making process concerning peace, international co-operation and disarmament. One of the papers that was provided as pre-reading for the Conference-these papers are available through our Office of the Status of Women-went very specifically to the participation of women in politics in the region. It very clearly makes the point that women are caught in a vicious circle. Their limited resources in terms of education, employment, wealth and poverty limit their access to public decision-making bodies which in turn adversely affects their access to resources. Mobilisation of women as a political force to demand their due share of resources and to increase their participation in decision-making structures is one way to break out of the vicious circle. Some countries have taken measures such as establishing goals and strategies and timetables for increasing within the decade the number of women in elective and appointed public offices and public functions at all levels. Some countries have gone further and established within their representative organisations quotas which must be set aside for women. This is a matter that has been considered and rejected by other countries, but the position throughout the region is still much less than impressive. In the vast majority of cases women have achieved less than even 5 per cent of the higher political and decision- making positions. The exceptions include the socialist countries, where women participate at a much higher rate. I am happy to report that in Australia the score has crept up to over the 5 per cent level nationally and has reached 10 per cent so far as our national Parliament is concerned. Socio-cultural attitudes prevailing in the Asian-Pacific region in many cases still assign women to an inferior social and political position. Those attitudes will remain until and unless women of the region are able to mobilise themselves and challenge these attitudes. A certain amount of assistance can be given by international organisations. A certain amount of assistance can be given by other countries in the region. However, much of the work, we have found, must be done by the women themselves who, as has been clearly explained over and over again, are not in a position to mobilise without the prerequisites of education, decent health, mobility, and certainly encouragement. At the elite level there are scattered movements in various countries of the region that are beginning to challenge the traditional attitudes which have kept women oppressed for so long. At the mass level in the region, women do not bother-they probably simply do not have the time or energy-to consciously challenge men's attitudes. Their priorities are quite different. Mere survival needs prevent them from charting new courses that defy the established social norms. So instead of changing the agenda, which tends to be the way in which we operate in Australia, women in the region are finding that they have to take a totally different approach. Rather than tinkering with the list of priorities, they are beginning to establish their own agenda, perhaps even writing their own book, as it were. In the last decade many countries of the region have seen endogenous women's movements develop and these have to be strengthened. Linkages amongst the grass roots organisations should be established so that these movements can grow bigger and recruit wider support. Again I see a role for countries such as Australia, which have superior resources in many respects. We have the opportunity, as the end of the decade nears, to look to the conference which will be held in Nairobi in July next year to make certain, firstly, that the Government of Kenya is given whatever support can be gained from the Australian Government-support perhaps in resources, finance, or seconding officials. Secondly, we can look to the less well developed countries with very poor resources and make certain that they are represented at the end of the decade conference. We can in this way help the women of those countries to link up with those of other countries in the region, to exchange information in the way that was possible in Tokyo, and to gain encouragement and confidence as a result of their association with women from countries with similar problems. A resolution of the Conference went to the question of political will. It reads: The capacity of the United Nations system to implement these recommendations depends on the political will and support of member governments. Women should therefore ensure that their Governments support and participate in the implementation of these recommendations by the United Nations. Since the resources of the United Nations system are restricted, women should look also to increasing local and national resources that can be brought to bear for women's issues in a strategy of self-reliance at the local level. At the International Women's Year conference in 1975 delegates were presented with a Plan of Action which had been developed by the United Nations and which was then opened up to all the countries which were members of the United Nations for their consideration and implementation. Again in 1980 a similar exercise was undertaken, but on that occasion Australian women had a great deal more opportunity to contribute. In 1979 we set up a series of conferences at regional and State levels, culminating in a national conference held here in Canberra early in 1980. A document was finalised at that conference under the title 'An Australian Plan of Action for the Second Half of the Decade'. Many of the items included in that plan were those that had been with us since 1975. As we come to 1985, the end of the decade, we still find that only marginal progress has been made in many parts of the world. Those plans of action are still valid; they are still contemporary, and in many cases we are looking, I believe, at another 10 to 15 years before significant progress can be made, at least as far as the great majority of women in the world are concerned. We hope to have a strong presence in Nairobi for the end of the decade conference. We hope also that non-governmental organisations, such as those to which I referred earlier, will be represented in Nairobi. We hope that once again Australia, as only a small nation but an important part of this region, will be able to make an important contribution. The success of the Tokyo Conference was largely due to contribute the skills and talents of Dr Nancy Viviani, an Australian, who is the Division Head at the United Nations Educational, Scientific and Cultural Organisation headquarters in Bangkok and whose task it was to plan the Conference and supervise its conduct. It was a matter of great satisfaction to those of us on the Australian delegation to see the competence with which Dr Viviani conducted the Conference. I feel that it would be fitting in concluding my contribution to this debate by adding the congratulations of the delegation to Dr Viviani on her performance and by making quite clear to the Senate the fact that we have women of considerable competence in international fields making an enormous contribution and bringing a great deal of credit to Australia in the process. The DEPUTY PRESIDENT —Before I call the next speaker, I draw the attention of the Senate to the fact that we are debating the second reading of Appropriation Bill (No. 3) and cognate Bills and in such a second reading debate the ordinary laws of relevance apply. I allowed Senator Giles to range very widely because in the peculiar circumstances of her speech she started in the first reading and completed her speech on the second reading. Subsequent speakers must direct their remarks to some aspects of the Appropriation Bills to be relevant and in order. If honourable senators wish to speak on the first reading on wider matters there will be a first reading debate at 12.45 p.m. when such contributions would be relevant. Senator HILL(South Australia)(12.02) —In my contribution to the debate on Appropriation Bill (No. 3) and cognate Bills I intend to argue that the economic prospects for this country are not as bright as Government spokesmen have indicated, that in fact real difficulties are apparent for the next financal year and that whether the economic recovery can be sustained will depend on government policy. Therein lies the concern because in fact it might be argued that the recovery has in part proceeded despite some of the Government's policies. There is no doubt that there has been something of an economic recovery in this country. We have witnessed a return to positive growth rates. There has been a small decline in unemployment. There has been some employment growth and we are experiencing lower inflation rates. These are all signs of an economy emerging from low levels of economic activity. I readily concede each of these. However, it is important to look at the reasons for the turnaround over the last six months from the low level of economic activity. I believe that such a turnaround can be attributed to four factors. First, Australia has benefited from the dramatic upturn in world economic activity in 1983, particularly in the United States of America. The latest available International Monetary Fund projections for 1984 put world economic growth at 3.7 per cent in real terms. For the first time in 15 years the average world rate of inflation is below 5.1. Australia's longer term economic prospects will continue to depend on the growth and durability of the world economic upturn in general, and the United States economy in particular. Secondly, the ending of the drought has had a dramatic one-off effect on Australia's growth projections for this financial year. In the first half of 1983-84 gross farm product rose at an annual rate of 85.2 per cent . The significant proportion of the 11.3 per cent increase in gross domestic product in the first half of 1983-84 can be attributed to the dramatic farm recovery. Thirdly, the continuing effects of the previous Government's wage pause program through to September 1983 provided a vital brake to the massive real wage increases of late 1981 and 1982. The pause in wages growth gave business valuable breathing space to restore profit levels, a necessary requisite for increased investment activity. Finally, the tentative recovery can be attributed in part to the Government's stimulatory spending on such things as housing and job creation projects. The cost of such discretionary budgetary action has, however, been an addition of some $2 billion to the structural component of the Budget deficit. Therefore, three of the four major infuences on Australia's economic recovery were outside the control of the present Government, which is probably why we have got as far as we have. However, this is not a recovery of even economic growth. Clearly it is patchy and many indices show how precariously balanced it is. It is a recovery capable of turning sour in a very short time. I give the Senate some examples. Firstly, I ask them to look at the metals and engineering sectors-two sectors that have been particularly savaged by the recession. A combined Metal Trades Industries Association Inc.-Commonwealth Banking Corporation survey, published only last month, predicted manufacturing and metal sales to rise by 9 per cent during 1984 . I remind the Senate that in 1983 they declined by 4 per cent. The survey identified agricultural implements, housing, consumer goods and light industrial equipment as healthy sectors during 1984. Nevertheless, the same survey has predicted slack activity in foundries, heavy engineering, general engineering, heavy electrical engineering, pumps and compressors. In addition, the MTIA survey concludes that investment in new buildings and structures will remain depressed. That leads me to the second of the indices, that of private fixed investment. Private fixed investment has not risen in the last year. In fact it fell by 4 per cent in the December 1983 quarter and is predicted to fall by a further 10 per cent in 1984 and 1985, in current price terms. In particular, in seasonally adjusted terms investment in manufacturing has declined continuously since the March quarter 1982, falling from $1,023m to $730m in December 1983. There is no reason for joy in those figures. Again, in employment there has been pleasing expansion of job opportunities, but unemployment rates have fallen only marginally-from 10.4 per cent in December 1983 to 9.3 per cent in March 1984, on a seasonally adjusted basis. One therefore suspects that this has been accounted for by an increase in participation rates as the economy has improved. That subject was debated in some depth yesterday. Therefore, the economy continues to be burdened by the costs of intolerable unemployment, particularly of 15 to 19-year-olds, that unemployment rate having declined only marginally. Yet this sector, I remind the Senate, has occupied a principal priority in government relief initiatives. In the manufacturing sector we must remember that employment has declined by 17,000 or 1.5 per cent in the three months to February. Therefore, when we examine the so-called recovery in employment, we in fact see it to be a narrow employment- based growth with jobs being provided mainly in finance, public administration, community services and construction. We are therefore in a shaky position. What the Australian people deserve is a government that will pursue policies that will build on the fortuitous events of last year. What that means is government leadership in the vital areas of wage control, budgetary restraint and the adoption of policies which will create an economic climate conducive to increased private sector investment. In these areas the Government does not have the policies to achieve such goals. Let us look first at wage control. I think all honourable senators will accept that it is of paramount importance. Put simply, wage restraint is necessary if profit levels are to be allowed back and profits are to be maintained at levels conducive to increased private investment and employment growth, particularly bearing in mind the historically low levels that have existed over the last two years. The prices and incomes accord, about which we hear so much, has not and will not achieve the objective of wage restraint. The most visible manifestation of the accord to date has been the reintroduction of full wage indexation over the past two quarters of 1983-84. In the six months since wage indexation, wage increases of 8.6 per cent have been granted by the Conciliation and Arbitration Commission. While Australia has, therefore, been in the process of emerging from a recession, the private sector has had to meet an additional $6 billion wage bill irrespective of its capacity to pay such an increase. As an instrument, therefore, of broadening the base and strength of recovery the accord has failed to deliver. It has been shown to be an instrument purely for the purpose of wage maintenance, which incidentally means the maintenance of wage cost pressure on employers and the consequent impacts on domestic prices. On that subject, our need to contain and, ideally, reduce domestic cost pressures in order to achieve greater international competitiveness for our export industries remains. The accord is a major impediment to meeting this challenge. Australia's costs and prices presently remain out of kilter with those of countries with which we trade. The latest available comparative figures for consumer price changes published by the Organisation for Economic Co-operation and Development show only France with consumer prices increasing at a greater rate than Australia. Australia's current underlying inflation rate is in the vicinity of 7.6 per cent , compared with current rates of inflation in Japan of 1.8 per cent; Canada, 4.2 per cent; the United States of America, 3.2 per cent; West Germany, 2.6 per cent ; and the United Kingdom, 4.9 per cent. The accord with wage indexation in operation at a time of tentative economic recovery has created a major hindrance in achieving improved international competitiveness. In its analysis of the international competitiveness dilemma the Business Council of Australia pointed out last December that in 1982-83 nominal wage costs in the OECD area rose by a mere 5 per cent. Yet even with the wage pause instituted in the latter part of 1982, total average weekly earnings in this country rose by more than 11 per cent, double the OECD figure. This year with the accord in operation little change is expected in the discrepancy between overseas and domestic wage rates. The Business Council of Australia saw the inevitable consequence of wage rises at this stage of economic recovery in the following terms: . . . the restoration of 'full indexation plus some drift' at the current inflation rate of 7-8 per cent through 1983-84, will limit the relief from what is quantitatively the most important source of pressure on our price competitiveness. There will, no doubt, be considerable drift. With what might be called the Medicare distortion, the consumer price index was artifically reduced for the March quarter to minus 0.4 per cent which should, theoretically, result in no wage rise. But now, pursuant to the terms of the previous accord, the unions are demanding catch-up awards. The concept of catch-up awards is envisaged as part of the agreement. Beyond the immediate dangers to international competitiveness posed by wage indexation we have yet to see any concerned government initiatives which address the excessive pressures on Australia's wage structure of on-costs and the multitudinous Federal and State government charges which add significant amounts to the nation's wage bill. Too often that area tends to be overlooked. The Australian Industries Development Association bulletin of April 1983 showed , for example, that labour on-costs grew at a rate 60 per cent faster than direct wage costs in the period from 1974 to 1982. In 1982 alone AIDA estimated the rate of on-cost growth to be 77 per cent higher than direct wage costs. Such figures bring home one vital point: The critical issue for Australia's future international competitiveness is not only direct labour costs through wages, but also an ability to maintain shifts in unit labour costs-wages plus on-costs-in line with unit labour cost changes occurring overseas. In this endeavour the Government, and the accord, has conspicuously failed to meet its responsibilities. The past two indexation awards and resulting on-costs will lead to the private sector employers facing a mammoth $12m bill this year. The question is: Can Australia and particularly the unemployed in this country afford such a situation? The whole issue of wages is indicative of this Government's inconsistent approach to economic management. It is ironical to note the support the Prime Minister (Mr Hawke) and the Treasurer (Mr Keating) have given to the efficiencies of financial market deregulation. We saw the floating of the dollar in November of last year together with the Government's announced intention to allow the entry of foreign banks-decisions which have the laudable objective of widening and freeing up Australia's financial markets. They are decisions which the Opposition supports and welcomes as far as they go. Yet the Government has adopted a totally contradictory approach to the labour market through its commitment to the accord and to wage indexation. As far as the Government is concerned, the rationale behind its decisions to seek a more efficient and sensitive financial and banking sector through the freeing of the markets is not applicable to wages. If the market is seen to provide an efficient allocation mechanism in one, why not the other? Another area which requires some comment relates to the Government's expected or anticipated budgetary policy. The Government's commitments to the Australian Council of Trade Unions under the prices and incomes accord and its discretionary decision for an $8.6 billion deficit in last year's Budget leave it little room to manoeuvre in formulating the 1984-85 Budget. In order to maintain the accord and set the groundwork for an election-most probably in December of this year-a tax cut in this year's Budget has now become mandatory, which leads to concern as to the future deficit and its effect upon economic recovery. The Victorian Chamber of Manufactures estimates that next year's Budget deficit will be $7.6 billion. Furthermore, it predicts that this deficit will blow out to $9.2 billion the following year. In conjunction with this, the VCM, together with the Government's own forecasts, predicts inflation to rise from 7.3 per cent this financial year to 9 per cent the following year. The Government, clearly, has not heeded warnings of business leaders that a deficit over $5 billion will put undue pressure on the economy. Instead, the Prime Minister and the Treasurer have sought to present a deficit at least the same size as last year's as an exercise of economic sobriety. The danger of such a policy is clear to see. As the Australian commented a couple of days ago, on 8 May, in the last paragraph of its editorial: With an already overly high level of national debt, another relatively large budget deficit later this year can only drive up interest rates and raise the spectre of higher taxation further down the track. What this amounts to is that the Hawke Government has had a dream run economically with a series of fortuitous events giving it a great opportunity. But instead of seizing the opportunity to build upon that base it is going to seize the opportunity for an early election. Its policies cannot and will not lead to sustained economic growth. Its policies will not lead to an Australia that is internationally competitive, confident of reducing unemployment and able to meet the reasonable aspirations of its potential work force. I suggest to the Senate that those policies are found in the Opposition's economic policy and its wages and incomes policy, both of which have been recently announced-policies that are directed towards economic growth, that look to less reliance on income tax, a less distorted economy with less unnecessary regulation. Coalition objectives aimed at lowering the deficit will be achieved by reduced government spending with consequent less pressure on inflation and interest rates. Lower government spending will permit the arrest of continuously rising government taxes and charges and the return of productive incentive. Coalition policies will reintroduce reality back into wage fixation, permit a flexibility to reward growth and achievement and respond to economic downturns. The comparison is clear. Labor's policies, as I have indicated, are artificial and contrived. They are not a framework for a strong and efficient economy. When the Government, rather than face reality, takes us to an early election the Australian public must not be fooled. Australians should ask: How much of any recovery has been contributed to by the fortuitous circumstances to which I referred earlier? Australians will see that coalition policies are based on reality. They recognise the hard facts of life, that in a competitive world there is not an easy way. To face reality is never easy. But when reality is faced we will have taken the first step in this country back on a road to recovery, not dependent upon fortuitous events but on policies that face the facts of real economic life . Australians will then be better off for having made that decision. Senator MAGUIRE(South Australia)(12.24) —I wish to speak on Appropriation Bill (No. 3) 1984-85, Appropriation Bill (No. 4) 1983-84 and the Appropriation ( Parliamentary Departments) Bill (No. 2) 1983-84. These Bills provide appropriations for the running of the government to June, to the end of the financial year. They cover the unexpected items which occur in Budgets, those items for which provision was not originally made in the August 1983 Budget. The total amount of funds to be appropriated by these Bills is in excess of $630m. However, as a result of various savings effected by the Government during the course of the year, the net increase in total outlays as a result of these measures is some $336m. It must be said that much of the increase in the outlays is due to extra wages and salaries costs and higher award wages, in particular, those handed down in October last year. I refer to the 4.3 per cent increase in wages awarded by the Conciliation and Arbitration Commission. One of the major appropriations in these Bills is that for natural disasters relief. An extra $46m has been appropriated by these Bills to provide for disaster relief, bringing the national total for the financial year to $157m. That money is paid through the Department of Finance. An extra $16m is to be paid to Queensland for drought and flood relief, $16m to Western Australia for a drought which is now emerging in that State and, in respect of my own State of South Australia, $1.2m has been provided. That takes the total amount paid from the Commonwealth Budget for disaster relief in that State to $11.5m. During the meeting of Estimates Committee C, a breakdown of the funds expended by the South Australian Government on disaster relief was provided to me. These now total $6m this financial year in respect of the Ash Wednesday bushfires, $1m in respect of floods in the Barossa Valley area and $4.5m for drought relief. Those amounts are broadly but not exactly paralleled by the amounts provided in the Commonwealth Budget. One significant item which appears in the estimates for the Department of Primary Industry is the southern bluefin tuna management program. That is a new program which did not appear in the original appropriations. It began in October 1983. The funds are paid through the Budget to reimburse the State governments in respect of their management of this very important national resource around the southern coasts of Australia. Certainly, the southern bluefin tuna management program, which was introduced by the present Government, is of vital importance to a number of centres in my own State, notably, Port Lincoln and Streaky Bay on Eyre Peninsula, where the tuna industry is a major source of livelihood. The amount of money to be paid to South Australia this financial year under the program is $51,000 with $108,000 being paid to Western Australia. One of the very large elements of the Appropriation Bills is the $59m extra to be appropriated for labour force and training programs. From a total of $59m there are allocations for assistance for work experience, training for Aboriginals and moneys for the adult wage subsidy scheme. Of course, labour force retraining is a key area. That $59m extra allocation needs to be seen in a wider context. For example, yesterday we had before the Senate the national technology strategy discussion draft in which it was proposed that Australia in the future should adopt a target of retraining one per cent of its labour force annually. According to the discussion draft that should be a national priority. On my calculation that suggests some 60,000 Australians would need to be retrained every year to effect that one per cent priority. As I indicated yesterday, on my calculations that suggests that more than the entire work force of Geelong in Victoria would need to be retrained each year to achieve that target. But I believe it is achievable. A one per cent retraining level has been the practice in countries such as Sweden for a number of years. I am sure it is something that can be managed in Australia. I believe that one of the interesting items in the Budget is the variation by a number of departments of the allocation for fares for travel and travelling allowances. For example, the cost of fares alone in respect of the Department of Finance increased by some $34,000 to a figure of over $300,000. Fares in the Department of Primary Industry increased by $56,000 to well over a quarter of a million dollars. In the Bureau of Statistics over $600,000 was spent on fares. In a tally of just four departments I discovered that over $1.4m was expended in respect of fares alone. I must say that, with such large payments involved, I wonder whether any thought has really been given by the Commonwealth Government and the Commonwealth Public Service to the question of whether there is any scope to utilise advance purchase air fares in some circumstances. I emphasise 'in some circumstances'. I acknowledge that there are restrictions, certainly faced by the ordinary consumer, in using advance purchase air fares. But I imagine that, with so many people in the Commonwealth Public Service travelling each year, many of these people must have knowledge of their travel arrangements, travel dates and times well in advance-for example, people attending conferences and seminars. It seems to me that it could be very cost-effective for a study to be conducted on the feasibility of using advance purchase air fares in some circumstances. I believe certainly an inquiry into that subject at a departmental level in the Department of Finance could be very beneficial. In these Appropriation Bills large amounts are also provided for travelling allowance. For example, the aggregate amount for the Department of Primary Industry, the Australian Bureau of Statistics, the Department of Resources and Energy and the Department of Finance for travelling allowance alone came to $1. 1m. It is not clear from the information supplied how much of that travelling allowance is in respect of travel to and from Canberra but it certainly raises some interesting questions. For example, it seems to me that with somewhat better air schedules to and from the national capital there might be some scope for reducing travelling allowance payments. I would have thought that the Commonwealth Government, being a major consumer of air travel, would have some abililty to talk to the airlines about their schedules to the national capital. For example, the schedules as they have operated until recently meant that many working days in Canberra were artificially shortened. As a result of these schedules people arrive relatively late to the capital and depart early from the capital on the airlines. Some improvement in the airline schedules to and from Canberra could assist the Budget in cutting down travelling allowance. Officers from capital cities other than Canberra have very short working days when they get to Canberra and are often forced into staying overnight resulting in the payment of travelling allowance. The estimates for the Bureau of Statistics provide $600,000 for extra positions to boost work on the Bureau's register of business. That will enable the Bureau to carry out a wider range of surveys of business activity in Australia and I think all senators will welcome the availability of much more reliable information on business activity. One very interesting item in the Appropriation Bills was overtime in respect of the Department of the Treasury which has increased by $14,000 above the Budget allocation. It was revealed to Estimates Committee C that this financial year the Department of the Treasury has had a 60 per cent lift in the number of ministerial letters over the previous financial year. In the Estimates Committee I was able to discover that before 1983-84 the Treasury dealt with 14,000 to 16, 000 ministerial letters a year. Since the change of Government in May and June last year, for example, 2,000 letters were dealt with in each month-a very interesting phenomenon. Perhaps many constituents who raised matters in the past but had made no progress decided to dust off their old proposals and bring them out last year with the change of government. It is not clear what the reasons were but it has certainly resulted in an increase in overtime in the Department of the Treasury. Now that the signs of upturn in the economy are consolidating there seems to be less pressure on Treasury officers and, I imagine, less pressure through the Department for extra funds in the Budget. It is very illuminating to look at some of the economic indicators that are now available to us as a sign of improving economic conditions in the country. For example, a few minutes ago the Bureau of Statistics released the latest labour force information for the month of April. I am pleased to say that that shows that in the 12 months since April last year 224,000 extra jobs were created in Australia. I stress that they are extra jobs and that 224,000 extra people are now working than were working in April 1983. Of course, honourable senators will be aware that that figure of 224 ,000 is well above the estimate made in the August Budget last year for employment growth in the national economy. In the 12 months to March-I do not have the growth rate to April-there was a 3 per cent increase in the number of people employed in Australia. That figure is the highest that has been achieved in Australia for many months. On other indicators available to us the economy is improving and the recovery is strengthening. Senator Grimes recently indicated to this House that the number of persons now receiving unemployment benefit was down on the corresponding period last year. That is the first time for many months that there has actually been a decline in the number of persons receiving unemployment benefit nationally. That, of course, will have very advantageous effects on the Budget outcome for 1983-84. I think it is entirely likely-- Senator Messner —You still cannot keep the deficit down though. Senator MAGUIRE —I will come to that in a minute. It is entirely likely that the recent estimate of an average of 620,000 persons receiving unemployment benefit in Australia will be on the high side and the average figure will be lower than that. That will mean further savings for the Budget. There have been dramatic increases in the housing sector in the last 12 months, both in approvals for new dwellings and, more importantly, commencements of dwellings. They have increased significantly in most States. This is reflected in a very large national increase in housing approvals and commencements. A very significant element of the upturn is the result of one of the key measures in the Budget brought down last year-the first home owners scheme, which has enabled many young couples in Australia to enter the housing market much earlier than they would have been able to otherwise. This has resulted in a higher level of home ownership and a very big boost to the housing industry in this country. That scheme is having a major effect on boosting economic activity in Australia. I will be very interested to see the final allocations for that scheme when the final Budget figures become available. It has certainly been an outstanding success. It shows what impact a government policy measure can have on the level of economic activity. The previous speaker in this debate, Senator Hill, referred to the level of inflation and talked about the impact of medical and health costs on the consumer price index. I put on the record that even by measuring inflation on the old basis-I must say that I prefer to do that but to get a guide of trends it is certainly useful to have both-before changes were made to the treatment of health and medical costs it is still very clear that there has been a significant reduction in inflation during the life of this Government. On the old basis of compilation of statistics the consumer price index increase in the March quarter 1984 would have been only 1.2 per cent. That is the lowest quarterly increase for a long time. In the 12 months to the end of March this year, on the old basis with medical and health costs treated in the former way, the inflation rate measured by the consumer price index was only 7.6 per cent. Senator Messner —That was not due to your policies; it was due to the wages pause. Senator MAGUIRE —There is a very large reduction in the inflation rate, a further reduction in the 12 months to the end of December when the inflation rate was 8.3 per cent. With medical and health costs included in the former way there has been a 0.7 per cent reduction in the annual inflation rate in one quarter. That is a significant reduction. Senator Peter Rae —And the direct result of the former Government's policies. Senator MAGUIRE —Honourable senators on the other side are, I presume, mouthing off about the wages pause, which was not sustainable. Such an inequitable policy which constrained the wage claims of one group in the community surely could not have worked or been sustainable for more than about six months. I think most honourable senators opposite know that the reductions in inflation that are now occurring are very much the result of the policies of this Government. The accord is a much more sustained policy measure than the wages pause could have ever been, because it was so inequitable and so unfair and just would not have lasted. As I have indicated, the inflation rate as measured on the former basis is now running at 7.6 per cent annually, a very sustained reduction in the rate which applied earlier last year. It augurs well for the trend in interest rates and, in turn, it gives us a further cause for optimism in the housing sector. One of the things in which I am particularly interested, as I am sure, are officers of the Treasury, is the varying trends in unemployment rates in the various States in Australia. I am certainly looking very carefully at the moment at the relative improvement in unemployment in South Australia, where the difference between the national average and the unemployment rate has narrowed dramatically in recent months. I hope that very soon average unemployment in South Australia, which in recent years has been a relatively depressed State, will go below the national average. Senator Messner —How much of that is due to the CEP, do you think? Senator MAGUIRE —When it does go below the national average, it will be the first time that that has happened, according to my research, since 1976 or 1977. So that will be a major improvement in that State. I stress to Senator Messner that I am talking about the relative improvement in South Australia compared with the national average. I am sure he is aware, as are most honourable senators, that the community employment program is operating not only in South Australia but in all States. So there is no real validity in his arguments, unless he can demonstrate that the CEP in South Australia is well ahead of other States. He might be prepared to issue a statement on that matter. If he does, I will be pleased to read it. I stress that I am talking about relativities. I am hopeful that in the near future the unemployment rate in South Australia will go below the national average for the first time in seven or eight years. In conclusion, I indicate that I am hopeful that the deficit figure in the Budget this year will be less than the most recent estimate. I understand that the estimate of the deficit outcome made by Minister for Finance (Mr Dawkins) is the product of these appropriation Bills and also revenues. I think the deficit estimate, as was recently estimated, will be reduced to below $8.7 billion in the final figures for the 1983-84 year. I believe that the figure will be a little lower than that. I look forward to tax cuts in the next Budget in August. I believe that the Budget to be brought down in August will contain significant reductions in income tax. Senator Peter Rae —They will be a bit like the 1975 tax cuts, I bet. Senator MAGUIRE —I bet they will be better than the 1977 and 1978 tax cuts introduced by the previous Government. I believe that significant tax cuts will be introduced in the 1984-85 Budget in August. I believe they will be focused on lower and middle income earners. These tax cuts will give a significant boost to economic activity and in that way will assist in the further creation of employment in the community. Most importantly, the tax cuts will ensure continued existence and further robust health for the accord between the Government and the Australian Council of Trade Unions. Debate (on motion by Senator Ryan) adjourned. [COGNATE BILLS: SUPPLY BILL (No. 2) 1984-85 SUPPLY (PARLIAMENTARY DEPARTMENTS) BILL 1984-85 AUDIT AMENDMENT BILL 1984] Debate resumed from 8 May, on motion by Senator Grimes: That the Bill be now read a first time. Senator COLEMAN(Western Australia)(12.45) —I use the first reading of these Bills to bring to the attention of the Senate once again the plight of people in other countries where human rights and civil liberties are not recognised. Honourable senators will recall that only a few short weeks ago we had a debate in this Parliament on a matter which was brought forward by Senator Missen, when the senators who participated in the debate represented not only all those political parties that are represented here but, I would suggest, all factions within those political parties. On that occasion Amnesty International had just released its report 'Torture in the Eighties' and I took the opportunity to express my concern for the women in the countries that were listed. I simply remind the Senate that listed was a total of 98 countries where atrocities not only were being perpetrated by the ruling authorities but were accepted by them as a permissible means of punishment. I put on record then and I put on record now that it is not acceptable; it is not acceptable and can never be acceptable to any humane society or to a society where there is even a smattering of democracy. I want to concentrate today on the situation as it relates to Chile, because a few days ago I was given a letter which had been received by our Ambassador in that country, Mr Kevin Flanagan. It is a letter which was originally written in Spanish and has been translated-which is just as well because my Spanish is extremely limited. Unfortunately, the list of organisations that support that letter has not been translated and it is difficult for me to describe them except to say that those organisations appear to be what we in Australia might call domestic-type organisations, going through the whole range to what might be expressed as being militant, if anything could be considered as being militant in a country such as Chile in the present circumstances. The letter is dated 22 March and reads: Dear Sir, Through your means we want to bring to the attention of women of Australia and your country's public opinion in general, the plight of women and of the people of Chile. We deem it necessary to do so as part of our struggle for life in our country. Who are we? We are Chilean women from many different sectors, professional and blue-collar workers, students and peasants, artists and homemakers; women of all ages who have survived more than a decade of a deadly government system whose clearest signs have been assassinations, exile, disappearances, secret jails, torture, banishment, repression of dissidents and all kinds of power abuse and arbitrary actions which hit the poorest sectors of the population. We accuse the military regime of plunging our country into the most serious crisis in history, an overall crisis which goes beyond the political, economic and social crisis. In this crisis, the future and the life of our nation are at stake. We live in a generalized atmosphere of violence, of growing poverty and unemployment; there are hundreds of thousands of youths without any hope whatsoever in the future. This hopelessness turns many youths to drugs and prostitution, often at a very early age. All this explains our feeling of urgency when we fear for our fate as a people. We seek a future where life might have a chance. We women have therefore declared a permanent state of mobilization, in order to confront what we consider is an inhumane government. We are not just women in pain, complaining about our country's tragedy. Last December, twelve thousand women met here in Santiago and made a pledge to struggle for life in Chile and to keep up this struggle until we put an end to this deadly regime. The month of March was declared ''Women's Month'' and we made several peaceful demonstrations to publicize our purpose. On 8 March we suffered the Government's repression: 33 women were arrested; nine union leaders were held without charge for 5 days at the order of the Ministry of the Interior and one of them suffered an abortion as a result of this ordeal. Gross mistreatment by the police force was denounced in several cases. The brutality of government repression has made it impossible to carry out other activities destined to denounce the violation of human rights, in general, and women's rights, in particular. Thus we decided to culminate this ''Women's Month'', addressing the women and the people of the world. Because what happens to the people of one country also affects the people of all other countries. It is to the conscience of Humanity-and to each man and woman-that we turn to denounce these crimes. Silence and indifference only condone these criminal deeds. In a few days-on 27 March-there will be another Day of National Protest in which women will participate actively. We remind world public opinion of the recent massacre which took place in Chile on August 11, 1983, when 18 000 soldiers occupied the city of Santiago and there were 82 dead and hundreds of injured. Justice has not yet been done. We know that those of us in Chile who want to put an end to this rule of death are a majority. We feel strengthened by both reason and morality in our struggle against the force of weapons, of greed and petty interests. We know that difficult and painful times are ahead in our struggle for life and democracy. We are, however, willing to run risks because that is what our conscience dictates. We know also that the women of the world will understand us and that they would be willing do the same: to struggle to regain freedom and leave the legacy of a decent country to our children and grandchildren. We therefore request, Mr Ambassador, that you make the content of this letter known by sending it through your Ministry of Foreign Affairs to the President of the Committee on Foreign Relations in your country's Parliament, in order that it may be included as a document in the congressional record. Some 21 organisations are listed at the back of that letter in support of it. I have no idea how many people that would represent, but it is certainly my intention to communicate with those organisations through our Embassy in Chile to provide them with the support that they have requested from us. I could, I suppose, have got the Parliamentary Library to go back much further than I have to get information on Chile for me, but one of the reasons for not doing so was that I felt that over the last 10 years it could only be considered repetitious because nothing has changed since the Allende Government was overthrown in 1973. But I did get the Library to go back far enough to get an indication of what the media themselves were saying about the situation. Perhaps the article that most completely covers the whole sorry mess is that of the Bulletin of 27 September last year. It is written by Robert Low, who had spent two years in Chile under the Allende Government and went back after 10 years of rule by General Augusto Pinochet. I want to quote substantially from this because I believe it demonstrates the absolute despair of and for the people of Chile, particularly of the women in Chile. It is under the title 'Why Chile Has Grown Weary of Pinochet' and says: In 1973 Allende was overthrown and killed in a bloody coup. He was replaced by a four-man junta led by General Augusto Pinochet, which has just celebrated its 10th anniversary. In those 10 years the Pinochet Government has acquired a reputation for repression which is almost without equal. Particularly in the aftermath of the coup, thousands were killed, or arrested and tortured. Tens of thousands more were sent into exile abroad or dispatched to remote corners of Chile as eternal exiles. About 2500 people simply vanished, introducing the sad word desaparecido into the world's consciousness even before the same thing started happening in neighbouring Argentina. Political parties were banned and the Press was muzzled. . . . . In the capital, Santiago, everybody was talking about the economic crisis, the sharp rise in unemployment (said by the Government to be less than 20 per cent but reckoned by most to be more than 30) and the resulting monthly ''protest days'' which started in May. . . . . When, last year, the government finally admitted what the critics had been saying all along, that the country was bleeding to death, it was too late. With the peso revalued, salaries frozen, unemployment and the cost of living suddenly soaring, the protests from a hitherto cowed population began: demonstrations, stoppages, an unsuccessful attempt at a general strike and a haunting echo of the last year of the UP: the people of Santiago banging empty saucepans in protest at food prices. The government has reacted in its usual fashion, breaking up demonstrations, leaving a total of about 35 dead (including several children), sacking strikers and jailing strike leaders and politicians who support them. But these jackboot tactics are only fuelling the growing demands for a return to democracy. I might add that Pinochet has said there will be a gradual return to some form of controlled democracy. He intends to have an election, but not until 1989. Suddenly, for the people of Chile, it is beginning to appear that that is too slow. The article by Robert Low goes on: But the most obvious sign of the state of Chile was the children. Begging food or money, selling little items for a few pesos, they were everywhere. Outside the new post office they rushed up to parking motorists to open the car door or offer to clean it with a rag. At every house where I was entertained, the meal or conversation was interrupted by a boy or a girl knocking on the door to beg for food. They were never turned away empty handed, even by people themselves with money problems. . . . ''There has always been some poverty in Chile,'' said a Belgian priest, 28 years in La Serena, ''but never anything like this.'' Later in the article, Robert Low quoted a poet in Chile: ''We are exiles in our own country.'' He went on: All over Chile you can see gangs of men tidying verges or engaged in some such public works project. They are on the PEM, the Minimal Employment Plan. It might be better renamed the Minimal Payment Plan. It is the Government's response to the unemployment crisis. Out-of-work bachelors get 2000 pesos a month ($27) and heads of household 4000 pesos ($54). ''It just about pays for electricity and water,'' said one of the two unemployed brothers . . . They preferred taking their chance digging up potatoes illegally or selling olives or shellfish. The next quotation is from the January-February 1984 edition of the publication Freedom at Issue, which has a table showing the state of each country on a scale from one to seven in relation to both political rights and civil liberties. Seven is the worst. It is interesting that Chile rates a six for political rights and a five for civil liberties. In that edition Freedom House has this to say under the heading 'No Comfort to Oppressors': We note that Chile, Poland, South Africa and Yugoslavia have been placed in the partly free category in the latest revision of the Survey. It goes on to say: We emphasise, however, that all four countries-Chile, Poland, South Africa and Yugoslavia-now appear on the bottom rung of the new listing of partly free countries. . . . . It is not Freedom House's intention to give comfort to the four regimes that continue to limit severely the liberties of their people. Rather, we feel obliged to acknowledge that in each of these countries the limits of liberty are currently being stretched by irrepressible forces within the societies. Mr Acting Deputy President, you and other members of this chamber would be well aware of my long association with the parliamentary group of Amnesty International. I joined that association shortly after I arrived in this place in 1974. I have served as secretary and I am at present an executive member. I believe that my credentials in that and other human rights and civil liberties associations are without question. My purpose in raising that matter in this speech is that I do intend that copies of what I am saying today will go to those organisations listed at the back of this letter through our Embassy in that country. I believe it is important for them to understand my concern for them, as I have a concern for others in similar situations. But the 1983 report of the Amnesty International organisation had this to say about Chile: 'Amnesty International's major concerns were: persistent allegations of torture of detainees by the security forces-ninety-five known complaints were submitted in 1982. . . It goes on to talk about the 650 documented cases of disappearances since 1973. There are many more than that, of course. I wanted particularly to quote from a couple of the newspaper articles that I mentioned earlier, but there is just not time. Suffice to say that a fact finding mission from this Parliament is going to Central America later this year . I had hoped that I would be a part of that fact finding mission but that was not to be. My colleague, Senator Maquire, however, has been appointed to it. I have his assurance, because of his concern in the area of human rights and civil liberties, that if it is at all possible to have that mission extended to Chile- I understand at the moment the intention is to go to Mexico and from there possibly into El Salvador-he will make contact with those organisations which supported the letter that was received by the Ambassador in Chile. I hope that he will take to them the concern not only of myself, as expressed in this first reading debate, but also of this Senate, of this Parliament, of the Australian people, for the repressed attitude that is being demonstrated to the people of Chile. I hope also that he will have the opportunity to meet with some of the representatives of those organisations so that in actual fact when he returns to this place we can have a comprehensive report on an outsider's determination on what the situation is and not constantly be reliant upon only information that is leaked through to us in a form similar to this letter. It is most important that we who live in a democracy do everything that we can to enhance the prospects for democracy in other countries. The Minister for Foreign Affairs, Mr Hayden, has made two very stern statements on the situation in Chile, but I believe that as members of this Parliament we have a great responsibility on our shoulders to ensure that we raise the matter each and every time we can and advise the authorities from those other countries that we are not prepared to put up with that oppression. Senator PETER RAE(Tasmania)(1.00) —I rise to support in general terms what Senator Coleman has said and to acknowledge her long-standing interest in human rights and her credentials in relation to the matters about which she spoke. The Opposition supports the expression of abhorrence to all forms of repression of human rights which takes place in a regrettably large number of countries throughout the world. I am particularly motivated to rise to speak by a conversation which I had several years ago with an Indian member of parliament who told me how much it meant to them when they were imprisoned to receive by various means a copy of the Hansard record of what had been said in this chamber in relation to their plight and the fact that they were supported in their time of trouble, in their time of great personal concern, when they were being subjected to totally unjustified political repression. Therefore, I believe it is important that this chamber should from time to time express its concern. When Senator Coleman indicated that she wanted to send back to Chile a copy of the remarks that have been made, I felt that it was as well if there were a wider expression of support of the general abhorrence of Australia as a democracy, as a parliamentary democracy, to all attacks on human rights. I would like to mention just a couple of other countries and indicate our abhorrence of torture, which has become part of the system of government in so many countries. One would have hoped that by the twentieth century, by this stage when we are able to put people on the moon, man's thoughts-mankind's, personkind's thoughts-might have got to the stage of being able to exclude as a conceivable, permissable approach to government the use of torture; but not so, regrettably. We have reports of the bloodbath in Matabeleland. We have had a debate about Zimbabwe and what might happen, and how regrettable it is to find that there are repeated reports of political repression, of slaughter, of imprisonment, of torture and of actual physical defilement of people-I use that term in the broad sense-taking place in Zimbabwe. As I have mentioned previously, according to a Scandinavian team which visited Vietnam and studied the situation there, and produced a film in relation to it, no fewer than 15,000-its estimate is that it is up to 200,000-political prisoners are still held without trial nearly 10 years after the completion of the war in Vietnam. I am sure that no one, whatever view he or she may have had as to the rights or wrongs of the Vietnam war itself, could conceivably support the continued detention without trial after this time of people who were on the losing side in that battle. We have the extraordinary, and I regard as lamentable, behaviour of the Ayotollah and his Government in Iran in relation to the Baha'ists. As I have said in this chamber before, one would have great difficulty in finding a religion which was more based upon peace and upon non- interference in government, non-interference with the processes of government, than the Baha'i religion. Yet its supporters are persecuted by that Government because they preach something which is more to do with love than hate and it does not suit the hate-inducing Government of Iran to have people in the community who might stir up any thought other than hatred as a basis for operation. One could go on to talk about Argentina; one could talk about a variety of countries. Regrettably, almost certainly, the list of 98 countries to which Senator Coleman referred, which is set out in a report, is by no means complete. But it gives some indication of the enormity of the problem which we face in the world-that of trying to civilise government, to civilise the people of the world , and to improve standards of behaviour. If by any reference that can be made in this chamber people are heartened in their time of travail, if people are encouraged to stand up against this sort of behaviour and to stand for human rights, I think we ought to be saying what has been said this afternoon. I support Senator Coleman in what she said and compliment her on it. Senator JONES(Queensland)(1.07) —I take the opportunity at this first reading to congratulate the Hawke Government on its initiative in investigating the feasibility of a kibbutz-style co-operative for young unemployed. It is a topic that is certain to encounter some initial resistance from some of the more entrenched conservatives with knee-jerk reactions to such terms as 'commune' or 'kibbutz', overlooking the extent of the social tragedy that unemployment has created in this country. Several government departments are already looking at the feasibility of this innovative and imaginative concept. I understand that within the Department of Employment and Industrial Relations the Bureau of Labour Market Research has commissioned the Australian National University to examine existing communal living arrangements in Australia and that that research is under way. Many of these communities have, through sheer determination and hard-won experience, achieved a significant measure of self-sufficiency and productivity which could be of immediate value to the Government in its effort to find viable relief for the chronic unemployed. Not long ago the Australian Institute for Applied Social Research, based at the Griffith University in Brisbane, conducted a survey on the single question of what people thought of the notion of these communal projects. The volume of public response so surprised the Institute that it approached the Department of Education and Youth Affairs for funding to expand the survey. The Department agreed to fund further research. As a result the Institute is now engaged in a more detailed analysis of public interest in the issue of communal or kibbutz-style co-operatives in Australia. Both of these research programs are continuing. The Attorney-General's Department will be examining the rather complex legal aspects of establishing a viable kibbutz; a term that I use loosely at this stage. The whole project is being co-ordinated by the Department of the Prime Minister and Cabinet. The Prime Minister (Mr Hawke) said in his Boyer Lecture in 1979: Alternative communities are more likely to contribute to social harmony than the burgeon of a disaffected body of unemployed to whom society pretends it has discharged its obligations by the signing of a dole cheque. He went on: There is a need for Australians to re-examine social attitudes to work patterns , education, training and the work ethic itself. The whole concept of an unemployment benefit should also be questioned. It is absolutely vital, we acknowledge, that unemployment, and probably high unemployment, is going to be a feature of developed, democratic societies in the immediate and distance future. Many factors make this inevitable, but principally it is due to the combination of increasing technological changes in the work place and an increasing labour market. If society is not prepared to countenance forced limitations to population growth and technological innovations, and if it cannot provide outlets for the physical and mental energies of its youth, it has a clear obligation to provide constructive alternatives to the financial, creative and emotional poverty of the dole. In March this year there were 701,300 people unemployed in Australia. More than half of these were under 25 years and one-third were under 19 years. That is a total of 369,500 young Australians under 25, in their prime years, overtaken by the rush of progress and left with little or nothing to do. In these we can include, or we can add to them, the estimated 50,000 homeless children that are currently roaming the streets of Australia. I believe that kibbutzes or whatever they might be called, can provide shelter, food and income and an opportunity for employment and self-sufficiency in industries such as agriculture, horticulture, cottage industries, light manufacturing and various trades. They can provide a tangible and fulfilling existence for tens of thousands of young Australians who are currently lost through inactivity and rejection by society. They would represent a more sensible, practical and responsible adjustment by our society to the harsh realities of technological change. Already in this country there is widespread interest in the much simpler alternative of working to live rather than living to work. Kibbutzes, sanctioned and assisted by government, would help to rekindle the self-respect, self-confidence and sense of purpose of thousands of long term unemployed. State governments also have a role to play and should be looking to establish free educational facilities teaching do it yourself techniques and other survival skills to unemployed people of all age groups who are prepared to opt for an alternative lifestyle instead of the dole. The Federal Government should examine the provision of adequate subsidies and the establishment of grants similar to the current rural subsidies and extended credit facilities and guarantees for co-operatives formed for either subsistance living or intensive farming and should ensure sufficient land is available to support alternative farms, hamlets and communities. This could be done with existing Crown land or land acquired under section 51 ( 31) of the Constitution, which deals with the Commonwealth acquisition of property on just terms from any State or person for any purpose in respect of which the Parliament has the power to make laws and any such acquisition must be for a specific public purpose. However, according to Mr Henry Nix, an eminent scientist from the Division of Land Use Research at the Commonwealth Scientific and Industrial Research Organisation, sufficient land is available in Australia to support rural alternative lifestyles without seriously affecting food and fibre production by conventional high technology methods. Mr Nix said that alternative lifestyles, subsistance farming and low-technology agriculture would add needed diversity in rural land use and would provide a solution for a significant proportion of the unemployed population. That concept needs closer attention from the Government. Co-operative communities must be given the power to become self-managing and to assume the responsibility for their local roads, primary education, welfare, buildings et cetera. Perhaps some existing alternative communities could be subsidised to provide tuition and learning experience for those generally prepared to adapt to the lifestyle and to help to smooth the transition period- an apprenticeship, if you like, in alternate living and an opportunity to work our relationships and formulate attitudes. Many, if not most, of our unemployed kids have little training in trade or other skills that are necessary for survival in a kibbutz environment. It will be necessary for governments at three levels to assist in the establishment of these communities and for the community generally to play a role, where possible. Service clubs have a commendable record in assisting community projects. I can think of nothing more worthwhile than providing some hope and dignity for many of our long term unemployed. We all have a role to play. At last count there were more than 1.3 million aged pensioners in this country, many of whom are enjoying a well-earned rest. About 65 per cent of the people over 65 years are under 75 years, which indicates that most pensioners are of an age when people are usually physically healthy and mentally alert. I believe the Federal Government should also investigate ways of offering pensioners with trade and other skills suitable inducement to engage in areas of youth education in kibbutzes. Pensioners have acquired a lifetime of invaluable experience that is usually ignored by the community when they retire. It is lost to the community. I believe an attempt should be made to gather back that information, that skill, that education that those older people within the community have; harness those skills and that education for the benefit of the youth who are playing a role within a kibbutz community within Australia. Many of these people would be delighted to remain active and useful to their community during the early years of their retirement. Instead they are being consigned to the social scrapheap in the depressing knowledge that they still have many years of worthwhile contribution to society left in them. The elderly must be harbouring volumes of knowledge that would be vital to any group of young people trying to establish a kibbutz-knowledge about things such as carpentry, furniture making, cooking, animal husbandry, stonemasonry, art, sewing, food preservation, leatherwork, basketry, butchering, farming, drainage, to name but a few. The value of their contribution should not be underestimated. Together these two groups of disadvantaged Australians, representing a huge pool of untapped energy, talent and experience-a pool of more than two million people with little or nothing to do-I believe could help to make the establishment of this type of community or alternative lifestyle a real, meaningful attempt by this Government and by the people of Australia to do something for the unemployed. I hope that the Federal Government can find sufficient funds in this year's Budget to begin a pilot kibbutz-style project in each State and Territory at least to make the attempt to give some of these two million people something useful to do. Senator KILGARIFF(Northern Territory)(1.17) —In the early morning-at daybreak- on Friday, 23 March, Cyclone Kathy came in on the Gulf of Carpentaria and hit Borroloola. There was quite a lot of comment in the Senate for a few days after that, as there was quite a lot of concern about what was happening there and whether the people were being properly looked after. There was, I think, a quite general awareness. It is interesting to note, looking back now, that the intensity of Cyclone Kathy was something like 250 kilometres per hour. This, I think, was at least equal to that of Cyclone Tracy-perhaps it was even a little stronger-when Cyclone Tracy destroyed a large portion of Darwin on Christmas Eve in 1974. Honourable senators might remember that at that time, after Cyclone Kathy hit Borroloola, I commended the action of the two police officers there- Van Heythuysen and Wanke-who, before daybreak, gathered the 250 people of the town of Borroloola, took them to the police station and tended them very well. I said at that time they should be recommended for some official recognition and I still believe that. Just briefly, as people have been interested in Borroloola, I make one or two remarks about the assistance that is being given to Borroloola by the Northern Territory Government in conjunction with the Federal Government. The Minister for Community Development, Mr Daryl Manzie, on 30 April this year indicated what relief payments for Borroloola residents would be despatched. The Northern Territory Department of Community Development has worked with the local community in anticipation of an influx of money into the town. The majority of people will receive 100 per cent compensation for assessed losses. Some will find the relief payment will not adequately cover the after insurance losses, hence the description 'relief payment' and not 'compensation'. The scheme is modelled on the Queensland arrangements, with the addition of a 25 per cent estimated cost differential for Borroloola-that is a loading on top of what it would have cost in Queensland. No significant difficulties are envisaged with rebuilding in the new town site. It is planned that general public housing will be available before the next wet season. The wet season commences anything from December onwards. I am talking about 1984, of course. New school arrangements are planned for the start of the school year in 1985-the kindergarten took quite a lot of damage. An interdepartmental task force involving the Commonwealth Government and the Northern Territory Government is in the final stages of preparing a report with recommendations for the Chief Minister. No doubt this will go to both governments. I am told that, while some $150,000 would be required to restore Aboriginal accommodation to pre-cyclone standard, the Department of Aboriginal Affairs and the Aboriginal Development Commission are talking in terms of $1.5m to $2m for new housing at Borroloola. As has been voiced before, one must question whether the site of the Aboriginal village should be moved to the high ground on the other side of the Macarthur River. Honourable senators would realise that Borroloola is on the Macarthur River and is some 60 Kilometres inland. But the village of Borroloola is very low lying and it is often flooded. So this matter has to be looked at very carefully. The Rumbaria Malandara Housing Association has applied for a lease for Aboriginal housing. The Aboriginal Development Cororation undertook to arrange the signing of the lease application last January but has not yet forwarded the application. I think it would be good if the Aboriginal Development Corporation were to have this lease fulfilled so that decisions could be made and construction of the new village commenced. In the meantime, the Northern Territory Government building authority will grant permits for rebuilding on that portion of the site which is not flood prone. So while this very remote town of Borroloola has suffered much through Cyclone Kathy, it does appear that all the authorities of both governments are very aware of that fact and plans are in being now for rebuilding and for settling the people in good housing again. Last night in the adjournment debate I spoke very briefly on a matter. Today I wish to refer to it again. It relates to the banning once again of television film unit at Ayers Rock. Last night, I compained about the situation. Today I would like to fill in with a few more details. The title to Yuluru National Park has not yet been handed over. The Federal Government still has control of the park through the National Parks and Wildlife Service. Despite continued assurances which have been given, month after month, by the Prime Minister (Mr Hawke) and other Ministers that there will be no restriction on public access to the park, time and time again we have seen professional film crews refused permission to film at Yuluru-that is, Ayers Rock. These include film teams with Paul Hogan, Val Doonican and a number of Italian producers, as well as the latest casualty-Simon Townsend's Wonderworld. As I indicated last night, considerable damage is being done to the tourist industry, not only within the region but to the Australian tourist industry. Last night I called on the Minister for Aboriginal Affairs, Mr Clyde Holding, to urgently review the guidelines for the Rock and to bring some commonsense and stability to the situation. I have here and I have shown it to the Minister for Education and Youth Affairs, Senator Sue Ryan, a telex from the Chief Minister for the Northern Territory to Mr Clyde Holding, indicating the extreme concern that the Northern Territory and the industry feel about the banning of people from the Rock. This is going far to far. I once again say that the Minister for Aboriginal Affairs has a responsibility to see that this matter is corrected and that it does not happen again. On the one hand the Minister for Aboriginal Affairs, in promoting Kakadu because there will be no uranium development by the Federal Government, says that tourism will be the answer to the Aboriginal people and that funds will be made available. On the other hand, he is allowing this to happen-he who is responsible for the lease of Ayres Rock, responsible for handing over Ayers Rock to other people. I say 'other people' because in handing it over to Aboriginal people, in reality, to quite a degree, it is a matter of handing it over to the white advisers. Unfortunately, it is the white advisers who make many of the decisions in the name of the Aboriginal people. I know-I have been told by the Aboriginal people on many occasions-that it is their wish to work in with the industry and to welcome visitors to Ayers Rock. But they are being misled. I say again that the decision is being made by these advisers. I will quote briefly from the telex from the Chief Minister and then seek leave to have it incorporated in Hansard. In this particular case a six-person television crew is collecting footage and stories in the Northern Territory for the Simon Townsend Wonderworld show for the Channel 10 network. I understand the Chief Minister said in his telex: Now despite having gone through the proper channels, an Australian children's TV programme has been barred from the Rock at the last moment to the detriment of their young audience and to the detriment of the Territory tourist industry and the jobs that go with it. Now I find it extremely strange that a children's program should be barred. The Chief Minister said: As I understand permission was applied for to film Ayers Rock about six weeks ago through the director of the Australian National Parks and Wildlife Service in Canberra. This unfortunately is the procedure-- unfortunately, because the procedure has broken down time and time again-- for people wanting to film in the major national parks in the Northern Territory . Despite repeated follow-ups to the application the TV producers received no word back until yesterday, Tuesday May 8-- When they were in the middle of filming stories in the top end-for the children- they were told they could not film in Ularu National Park. He went on to say: 'I understand a telex from the TV producer of the Pitjantjatjara Council asking for immediate reopening of negotiations was replied to in terms indicating that there was nothing personal in the ban, and no applications for filming in the park would be entertained until after the 22nd May, which is about a week after the Simon Townsend Wonderworld crew are scheduled to leave the Northern Territory. Apparently there is a meeting at Ayers Rock-- as I indicated last night-- on May 22nd to consider guidelines for future applications. Now, fair is fair. When are we going to have some stability and common sense? Here the tourists industry is being damaged and at stake is a considerable amount of benefit for the Aboriginal people at Ayers Rock, who have indicated they wish to participate in the tourist industry. Yet it is being absolutely fragmented-I would go even so far as to say destroyed-by this ridiculous saga that has gone on, month after month. Professional crews, who quite obviously know what they are doing, who are ethical in what they do, who know that in the films that they take they have to be aware of Aboriginal culture and such, are refused permission to film time and time again, even though a lot of these filming teams have come from overseas specifically to film Ayers Rock. It is a most unfortunate situation. I now seek leave to have incorporated in Hansard the telex from the Chief Minister of the Northern Territory to Mr Clyde Holding, the Minister for Aboriginal Affairs, Mr Acting Deputy President. Leave granted. The document read as follows- Dear Minister, Once again the Territory tourist industry is in danger of losing untold valuable publicity and promotion because of the ban on a TV crew from Ayers Rock and the Uluru National Park. The 6 person TV crew is collecting footage and stories in the Northern Territory for the Simon Townsend Wonderworld show for the 0 10 network. As I understand it, permission was applied for to film at Ayers Rock about six weeks ago through the Directors of the Australian National Parks and Wildlife Service in Canberra. This unfortunately is the procedure for people wanting to film in the major national parks in the Northern Territory. Despite repeated follow-ups in the application, the TV producers received no word back until yesterday, Tuesday May 8, when they were in the middle of filming stories in the top end. They were told they could not film in Uluru National Park. I understand a telex from the TV producer to the Pitjantjatjara Council asking for immediate reopening of negotiations was replied to in terms indicating that there was nothing personal in the ban, as no applications for filming in the park would be entertained until after May 22, which is about a week after the Simon Townsend Wonderworld crew are scheduled to leave the Northern Territory. Apparently there is a meeting at Ayres Rock on May 22 to consider guidelines for future applications. In the past six months the victims of this intransigent attitude to Aboriginal groups and their white advisers at Ayers Rock include Paul Hogan, who is spearheading your current tourism drive, an Italian film crew, Val Doonigan and the British Broadcasting Corporation, and now Simon Townsend's Wonderworld, a highly rated children's programme. In the interests of stimulating tourism in the Territory and Australia generally, the Northern Territory taxpayers shelled out thousands of dollars in airfare and charter fees to make sure the Val Doonigan BBC production at Ayers Rock went ahead, and the N.T. Tourist Commission spent $16,000 retrieving our own television ads and dubbing them on to film so the Italian TV crew could screen Australia's best-known tourist attraction through northern Europe. Now, despite having gone through the proper channels, an Australian children's TV programme has been barred from the rock at the last moment to the detriment of their young audience and to the detriment of the Territory tourist industry and the jobs that go with it. Quite frankly, I am fed up to the back teeth with dealing with people who say one thing and do another. Your Government has talked up a storm on tourism over recent months, yet when it comes down to action on the ground, such as physically promoting tourist attractions like Ayers Rock, the Territory Government can get nothing done without being engaged in a public fight and paying out thousands of dollars in cash. The Leader of your Government talks about spending $70m on tourist development in Kakadu National Park during an election campaign, but efforts by the N.T. Government to put together a seminar on tourism in the Park involving the relevant parties, including the traditional owners, are torpedoed by a Federal Government Minister who tells us the Aboriginals aren't ready for such talks yet. The Australian Government has control of Uluru National Park and Ayers Rock through the Australian National Parks and Wildlife Service, and Federal Government Ministers up to and including the Prime Minister constantly tell Australians that there is no restriction on public access to the park because of Canberra's bilateral decision to give title to Uluru to an Aboriginal ownership group. Title has not yet been handed over, yet access is severely restricted or impossible already, as Paul Hogan, Val Doonican, Simon Townsend and several Italian TV producers can testify. The mind boggles at what will happen to Ayers Rock and Uluru National Park, not to mention the Territory taxpayers' $150m investment in Yulara outside the Park borders, when full title is granted. I don't want to use a children's television programme as a political football in the overall question of access to a Commonwealth National Park which happens to lie within the borders of the Northern Territory. I also don't want Territory taxpayers to miss out on a couple of million dollars worth of promotion for their major tourist attraction, which translates to protection of their investment in the Yulara village and jobs for their children. My simple request is that you speak with your Ministerial colleagues as a matter of urgency to sort out a practical way in which an Australian children's TV programme can film Australia's best-known tourist attraction in an Australian National Park without a major confrontation between Australia people, the Australian Government and Australia's Northern Territory. Yours Sincerely, Paul Everingham Senator KILGARIFF —Thank you, Mr Acting Deputy President. In closing I once again make the appeal that I made last night. The Minister for Aboriginal Affairs has a direct responsibility in the matter. He and his Government handed over the reserve of Ayers Rock, although the lease deeds have not yet been handed over. It is his responsibility. I look to him to respond to the letter from the Chief Minister of the Northern Territory and to use his good officers- if he has any, and I am beginning to doubt it from the way he is performing-to take some action to ensure that this does not occur again. Senator LAJOVIC(New South Wales)(1.31) —Earlier in this first reading debate we heard Senator Coleman speaking about Chile and the tribulations and plight of Chilean citizens of the lack of democracy and the lack of human rights in Chile. She mentioned a report by a journalist describing what is happening in Chile today and the demonstrations in Chile by unemployed, hungry people. She also mentioned that the Minister for Foreign Affairs of the present Government, Mr Hayden, has strongly protested twice to the Chilean Government regarding the lack of freedom in that country. She mentioned also that in the 1982 scale issued by Amnesty International Chile rated six out of eight. Unfortunately she did not mention which country was seven or eight, but I can assure honourable senators that if she had such a list and if the scale were to go beyond eight, one of the countries which would appear as sixteen, not six, would be Bulgaria. Nobody speaks or hears about the freedom of the Press, depression, unemployment, living standards, human relations or human rights in Bulgaria. Honourable senators might wonder why. I know the answer. Bulgaria is one of those countries where humane socialism reigns. It is not a fascist country. It is a socialist democracy. It is a one party state where human rights are totally ignored, where demonstrations are not allowed, where individuals are treated as no one. I have a case before me for this Senate. I am doing as Senator Coleman suggested. This chamber should bring to the attention of this nation and to other nations what is happening to the citizens of countries where democracy does not exist. In the gallery today we have Mr Jordan Manolov Georgiev, a Bulgarian who left Bulgaria four years ago, who came to Australia three years ago, who is a naturalised Australian now. He has been unfortunate that when he left Bulgaria he was not able to bring with him his wife and two children. Anyone who understands what is happening in those free democratic countries like Bulgaria knows that when a person gets a passport the family is never allowed to go with him. That is why Mr Georgiev's family is still in Bulgaria today. How can anyone understand why, after so many years of pleading, asking, begging , appealing to everyone, a government-a so-called humane, socialist democratic government-would not allow a man's wife and two young children to join him when he is living outside that paradise? Mr Georgiev has tried everything. He is not a millionaire; he is a poor man. It is strange that when he sends parcels to his family the parcels disappear, the family does not get them; they are returned with a note 'not present at this address'; or they are sent to a completely different place, even if the address is correct. They are returned from that place after many, many months-after he complains. In many cases the contents of those parcels have been tampered with. The fact is that his family has been living at the same address for the last four and a half years. They have not moved. He sent some money to his wife-a cheque for $350. It is missing. Nobody knows where it is. She did not get it. What kind of society is that? What kind of government is that? We do not hear the songs about it that we hear about Chile. There is constant reference in all the papers to the lack of human rights in Chile. Nobody talks about Bulgaria, Mr Georgiev and what is happening there. How can a man, or any person, stay healthy , sane and reasonable if he is separated from a wife and two young children? The fact is-I have seen the doctor's certificate-that Mr Georgiev's health has deteriorated. I am not surprised at that. For someone who has experienced that kind of separation, I am surprised that Mr Georgiev is still in the shape he is. He has a petition, signed by 6,000 Australians from all walks of life- politicians on both sides of the political spectrum, trade union leaders. Everybody signed that petition. We have done what Senator Coleman said. We have done one other thing which we in this chamber thought the proper thing to do. We wrote a letter to the Prime Minister of Bulgaria on 15 December 1983. Mr Acting Deputy President, I seek leave to have this letter incorporated in Hansard. Leave granted. The letter read as follows. AUSTRALIAN SENATE Canberra, A.C.T. December 15, 1983 Mr Todor Zivkov, Prime Minister of the People's Republic of Bulgaria, Sofia, Bulgaria Prime Minister, We, the undersigned, being Senators of the Australian Parliament elected by the Australian people, respectfully urge you and your Government to respond positively to the plea made by Jordan Georgiev now an Australian Citizen , to allow his wife, Stefka, and his young sons, Manoi and Georgi, to join him in Australia. As you will be aware, Jordan Georgiev left Bulgaria in October 1979, was admitted as a migrant to Australia and is now an Australian Citizen. For four years he has unremittedly sought reunion with his family in Australia, and the refusal to allow this course has been a source of considerable distress to all members of this family. We are informed that his wife urgently desires to come to Australia with their children. Successive Australian Governments have supported his plea and many leading Australians have joined in the humanitarian request that reunion be permitted, in accordance with those human rights to which most Governments are committed. We seek an early reply and a positive response to our request. Yours sincerely, Senator LAJOVIC —This was signed by 27 senators, among them Senator Susan Ryan, a Minister of the Crown, and Senator Gareth Evans, Attorney-General of this Government. There was no reply. Nobody contacted any of the signatories to this letter. So on 16 March 1984 I wrote a follow-up letter to the Prime Minister of Bulgaria, simply asking him for an answer to our original letter or an acknowledgment that he received the letter. By the way, both letters were registered. But there was no reply. I feel that this Government should do something like what it intends to do or is doing in the case of Chile. It should voice its strongest protest against a country treating an Australian citizen in such a way: Keeping his family in Bulgaria, incommunicado; intercepting the parcels; intercepting the moneys which he is sending to them; and totally ignoring his plea, made for a simple, humanitarian reason-that his wife and two children might join him in this country. Senator MISSEN(Victoria)(1.42) —I rise in this debate to support Senator Lajovic in the complaint he made. I salute too Mr Georgiev, who is here today and who has fought valiantly for many years to get his wife and children into this country. Of course, he has had a lot of support from individuals, but I regret that he could have had more support from government departments. I think we have something to answer for in this regard. I support everything that Senator Lajovic said. I am one of the signatories to the letter which we sent late last year and to which we have had no reply. But I want to refer in my speech to some of the massive correspondence which exists in Mr Georgiev's file. Georgiev has been fighting this battle not only through his protests and his vigil outside the Bulgarian representative's office, but also in his request to the Prime Minister (Mr Hawke), in his request to the Minister for Foreign Affairs (Mr Hayden), in his request to the Commonwealth Ombudsman, in his request to the Attorney-General (Senator Gareth Evans), who could do very little or nothing, and in his request to the Minister for Immigration and Ethnic Affairs (Mr West). In a number of instances I think there has been a lack of a really serious carrying out of duty in some of the departments of our Government . I turn primarily to the Foreign ministry. Of course, I advised the Foreign Minister we intended to speak on this matter. There have been years of denial of the use of influence which this Government could have been exercising. I go back further than the term of this Government to that of the previous Government and say that governments in Australia could, before this, have made a much more resolute stand. Since 1981 Australian governments have included his name in the list of names of Bulgarians for whom they have wanted something done by the Bulgarian Government. I do not believe that what they have done has been in any way sufficient. Indeed, despite the massive file that was developed in the Foreign Ministry on this matter last year the Foreign Ministry managed to lose the file entirely. When Mr Georgiev endeavoured through the Freedom of Information Act to get possession of the records on himself and his family he received a letter from the Private Secretary to the Minister for Foreign Affairs saying: I write to advise you that no such file is held in this office. The Private Secretary referred it on to the Department. After some leisurely period, on 7 September 1983, Mr Georgiev received a letter from the Freedom of Information section of the Department of Foreign Affairs, in which appears the following: A quick check of our records indicates the Department holds no file on you either in its Passport or Consular Sections. We do not have any idea of what other section of the Department might hold a file or documents relating to you or your family. It goes on to say that if he cannot be more specific they will refuse his request under section 15 (2) of the Freedom of Information Act. Very helpful indeed! Yet the file came to light after that, of course, and some documents were reluctantly made available. The file is indeed a very thick file, containing a lot of material and a lot of cables-many of these are in my possession today-relating to the efforts by Mr Georgiev to get his family out of Bulgaria and into this country. The file is, in fact, three centimetres thick, according to the Department, now. I think there has been a lack of dilgence on the part of the Department in dealing with these matters. Not only has there been a loss of his records, but he has had representations made on his behalf by many members of parliament, including representations which have been made quite assiduously by Mr Michael Maher, a New South Wales Labor member of this Parliament. I pay tribute to him for the completely unsuccessful efforts he has made to get this Government to take action. After he wrote correspondence to the Foreign Minister he received from the Foreign Minister a letter, which is undated but which appears from the contents to have been written late in June or early in July last year, which includes the following: I regret that my staff have not been able to find your letters nor is there any record that they were received in my office. Thus Mr Maher has found himself unable to get satisfaction. Mr Maher has also been endeavouring to get the Prime Minister to meet Mr Georgiev but that, after I think a year and a half or two of trial, has not been successful. One wonders at the complete refusal of the Prime Minister to see this man and to hear from him personally. Indeed, early this month Mr Georgiev sent the Prime Minister a letter of some 12 or 14 pages detailing his many complaints. I do not think he has had any acknowledgement yet. The letter bears marks and signs of the trauma through which Mr Georgiev has gone. He feels now that there is a conspiracy against him, and one does not wonder that he feels that way. I suggest that this is something which the Prime Minister and the Foreign Minister must take more closely in hand. In addition to that, and perhaps even more seriously, comes the matter of the cables that have gone forward between our representatives in Yugoslavia-we have no ambassador in Bulgaria and they handle these matters-and the Australian foreign ministry. They are very revealing indeed. They idicate the extent to which the Bulgarian authorities have managed to persuade our representatives when they visit that there may be something in the complaints and charges which are made against Mr Georgiev by the Bulgarian Government. One example of that is a cable which came to Canberra from our embassy in Belgrade, indicating that it had been in touch and a representative had been to Bulgaria. It states despite information received from Mr Gregoriev: Georgiev's refusal to pay as ''admission of guilt on false charge'' seems at least to admit knowledge of charge but to deny its validity. The Bulgarians are claiming that Mr Georgiev left the country and was guilty of some charge-I think it is called 'damage to social property'. He does not know what it is about and has no reason to know, but even our own authorities are suggesting that because he refuses to pay a huge bribe to get his family out of Bulgaria that is an acknowledgement of the charge. I very much regret that our representatives who have responsibility for this overseas should be accepting such things. One finds this in a reply from Belgrade to Canberra by cable of 3 March 1983: In relation to the particular family reunion case-said that Mr Georgiev had left Bulgaria illegally after being charged with some unspecified offence to do with ''damage to social property''. His two children had been placed in the legal custody of his father-- that is, Mr Georgiev's father-- and the grandfather was unwilling to allow the children to join their father in Australia. That will be demonstrated to be a lie. It continues: The whereabouts and views of Mrs Georgiev seem not to be known to this official . It might not be known to this official, but it is certain she has not changed her residence for four and a half years and it is a hypocrisy to say that sort of thing. It goes on: Mr Georgiev was free to return to Bulgaria under the amnesty referred to in the Bulgarian note. He has more sense than to do that. It continues: If however, Mr Georgiev wished his family to join him in Australia it was a matter for him to sort out the wishes of the members of his family still in Bulgaria. Should this be resolved in his favour he would also have to pay an amount of 20,000 lev in settlement of his offence. (This is about dlrs US 15,000 , depending how the exchange rate is calculated). So a huge payment has to be made. Has our Department of Foreign Affairs protested about that type of blood-money which is to be extorted from one of our Australian citizens? No, it has not. It just passes it on. The Foreign Ministry in Canberra when it replied on 18 March to our representatives in Belgrade at least put his case: Georgiev will not submit to demand from Bulgarian Government for $15,000 to secure release of wife and children. He sees payment as an admission of guilt on false charge of alleged 'damage to social property'. He is also concerned that, if payment is made, no specified time of release is indicated and that a further three years may elapse before his wife and children are allowed to leave Bulgaria. Georgiev is in possession of recent letters from his father indicating a willingness for the children to be re-united in Australia. Despite our advice to contrary Georgiev intends to continue with protest outside consular premises and further proposes to embarrass Bulgarian Government by publicising demand for $15,000. I say: 'Good on him. It is excellent that he should be fighting like this and doing it honourably'. I do not feel much pleasure in seeing the Department give him contrary advice to mute his complaints against this vicious Stalinist government and its actions. Now I want to say that, in addition to this, our foreign ministry-I must be very short with this-has also taken up something in a seven-page letter which he has written complaining about the actions of Bulgarians here bringing pressure on him and his family. He passes on a remark made to someone that our Prime Minister was a KGB agent. The foreign ministry then concludes, for no reason whatsoever, that he said it himself, that he was making this allegation. It had to be explained, again by Mr Michael Maher, in a reply of 24 October that he did not say so. The officer in charge of the East European Section of the foreign ministry here in Canberra made a complaint to Mr Milteniy, who was the ethnic affairs officer in the Labor Council of New South Wales, contending that Mr Georgiev was making this allegation against the Prime Minister. Of course it is denied and Mr Michael Maher denies it. Finally, I regret that our Foreign Ministry has not taken a whole-hearted attitude and, in fact, has not stood up strongly in this matter. I just mention two other departments. The Department of Social Security gave a family allowance to this man for some years, from which he endeavoured to pay moneys across to his family. The Department stopped the allowance this month. Apparently it has been decided not to allow it any longer. Perhaps it thinks there is no chance of his getting his wife and children into this country. I think that is a very retrograde act. It is revealed in a letter dated 1 November 1983 from Mr Maher to the Minister for Social Security (Senator Grimes) that people from the Department of Social Security were ringing his lodgings-somehow they got the phone number-complaining that he was overpaid. The Department of Immigration and Ethnic Affairs has also delayed the issue of visas. I think it has something to answer for there. Also the victimisation that he has been getting from the Bulgarian authorities is something that our Government ought to be complaining about. Indeed, Senator Lajovic has told us about what has been done to his communications, and this has not been resolved by the Department of Communications. That has been difficult. But when he protested in May 1983 outside the Sydney Town Hall, where a Bulgarian exhibition was being held, what happened? A complaint came from Bulgaria to our representatives in Yugoslavia about his doing that. We got cables from Yugoslavia telling us that the Bulgarian Ambassador, Mr Staykov, had called and had handed over a note complaining that the workings of their Consulate-General in Sydney were being hampered by the demonstration outside that office by Mr Georgiev seeking a reunion of his family from Bulgaria. We pass on complaints and apparently we accept complaints. We accept the police in New South Wales removing Mr Georgiev from outside the Town Hall, where he had permission to obtain signatures for his petition. I say also that this man has not received the sort of support in this country that he should. It is significant that one of the matters raised was that if he were only working for the KGB he would be all right, but unfortunately he was not willing to do that. We have been told of the public support and of the petitions and of the attempts to get him help. I put it to this Government that it should do more than that. The Prime Minister should see him. The issue should be raised in international forums like the Human Rights Commission. We should put on record our objection to the beastliness of Stalinist Bulgaria. We should not contribute here in this country to his difficulties, but rather we should take a much more full blooded attitude and try to ensure that this type of victimisation does not happen to him and does not happen to other people in this country who are Australian citizens. Senator GRIMES(Tasmania-Minister for Social Security)(1.56) —Mr President, I rise briefly to speak because of the two important speeches that have been made by Senator Lajovic and Senator Missen. There are three aspects that I will refer to briefly. First of all, Senator Missen and Senator Lajovic have made detailed and serious complaints about the treatment of Mr Georgiev by various departments in this country, and I take that seriously. I will certainly take that up with the relevant Ministers. I note that one complaint is about my own Department and I will certainly have that investigated. I am not in a position to give any detailed answers on any of the matters that have been raised, but I can assure honourable senators I will take up that matter. The second aspect is the matter of what the Australian Government, what the Prime Minister himself and, I suppose, generally what the Department of Foreign Affairs can do about someone who is in difficulty with a closed society such as Bulgaria. I can appreciate Senator Lajovic's feelings and I can appreciate that he feels very strongly about this, as I believe we all should. My name apparently was not on that letter, but if someone had asked me I would have put my name on it. The only thing I would like to say is that I recently attended Socialist International, which is an international organisation of democratic socialist parties, chaired by Willy Brandt. As everyone here knows, he is a great socialist and a great democrat. Because a society like Bulgaria uses the term socialist in its title, it does not mean that all of us who would call ourselves socialists should be cast in that same mould. I hope that Senator Lajovic's frequent use of the expression during his speech was not aimed at anyone on this side, as it sometimes is. I can assure honourable senators that I will take up this matter. I can assure them that I believe we should all keep pressure on Bulgaria, as we keep pressure through Amnesty International on Chile, on Rumania, and on other countries who are severely restricting the rights of their citizens in this way. I think that in very closed societies, that is about as much as we can do as individuals but that pressure does sometimes work, and I think we all should continue to apply it, both as individuals, as members of Amnesty International, and as members of governments and oppositions. I will take up those matters. I will make sure that we get some replies. Certainly, if we get replies of the standard that Senator Missen and Mr Maher seemed to have received, I can assure honourable senators I will join with them on another occasion in condemning that sort of behaviour. Senator TOWNLEY(Tasmania)(1.59) —As one of the signatories to that letter I am glad to hear what the Minister has just said. I am sure we will await what I hope will be a rapid reply, not a long drawn out matter, on what he finds from the Department. Debate interrupted. The PRESIDENT —Order! It being 2 p.m., in accordance with sessional orders, I now call on Questions without Notice. Senator GRIMES(Tasmania-Acting Leader of the Government in the Senate) —This afternoon Senator Walsh is meeting the Chinese Trade Minister at the airport. I have been informed that the Chinese Minister's plane has been delayed and that Senator Walsh is still at the airport. I ask that, initially, any questions which would normally be directed to Senator Walsh be directed to me. BUILDING INDUSTRY: WAGE CLAIMS Senator Dame MARGARET GUILFOYLE — I direct a question to the Minister representing the Minister for Industrial Relations. I ask: Do the articles in today's newspapers headed 'Canberra set to back building workers' rise' and ' Willis will back building unions' super scheme push' accurately reflect the Government's reported intervention in a full Australian Conciliation and Arbitration Commission hearing tomorrow? Does the Government support the payment of the 4.1 per cent national wage rise in addition to the superannuation scheme? Does the superannuation claim of the building unions breach the wage fixing guidelines of 'no extra claims commitment' given by the building unions to the Government earlier? Could the Senate be advised on these matters? Senator GRIMES —I will not be able to answer the honourable senator in the detailed manner that I should. Senator Withers —Have a go. Senator GRIMES —In view of what happens to people when they have a go in this place, as Senator Withers suggests, I am not going to go too far. All I do know- and I have been partly involved-is that the Government has been involved in long negotiations with the Australian Council of Trade Unions and the building industry unions. Part of the negotiations certainly has been concerned with the introduction of a superannuation scheme in that industry, an industry in which, as Senator Dame Margaret Guilfoyle knows, people move around a lot and have broken periods of employment and frequent changes of employer. As to the details of what the Government's attitude will be before the Arbitration Commission and whether the Press reports are accurate, I will endeavour to get an answer as quickly as possible. In fact, I hope to get it before the end of Question Time and let the honourable senator know. Senator COLSTON —I direct a question to the Minister representing the Minister for Health. Are certain aids available for disabled people in Queensland under a scheme which is funded by the Commonwealth Government and administered by the Queensland State Health Department? What aids are available under this scheme? Do those aids include surgical shoes? Has the provision of some aids recently been approved but not been made available because of a lack of funds? If so, what level of funding is required to allow the program to continue? Have those funds now been made available? Senator GRIMES —As Senator Colston says, certain aids are available to eligible persons under the program of aids for disabled people, the so-called PADP scheme . The scheme is funded by the Commonwealth Government but the States in each case are responsible for the day to day administration of the program. The program was designed to provide aids for daily living for disabled people who are not eligible under other government programs to assist in keeping them in the community rather than in institutional care. Categories of aids available include: Home modifications, wheelchairs, oxygen, prostheses, surgical footwear, wigs, electro-larynxes, aids for incontinence, walking aids and all sorts of equipment and appliances for personal use. Over the years since this program was initiated, I think in 1980, the amount of money allocated has been increased. In the last Budget $7.1m was allocated to the States and Territories under this program. That money has already been fully committed in Queensland and in all other States. In fact, the money was fully allocated, I believe, more than a month ago. That has led, of course, to the deferment of some applications for aids. In other words, the program is federally funded but administered by the States. The States are responsible for the expenditure of funds. Because of pressure on the program, those funds have, in fact, already been utilised. That, of course, has created problems of the type that Senator Colston has mentioned. The matter of additional funding for the program for the remainder of 1983-84 is under consideration by Dr Blewett. All State Ministers have been consulted and will be informed when a decision has been made. But it must be understood that that decision will have to be taken against the background of a need for restraint in Commonwealth expenditure. The State Ministers are well aware of that. They were notified of it at a recent conference. The result of those considerations, which I dare say will have to be brought to Cabinet, will be made known as soon as they are finalised by the Minister and his Department. Senator MESSNER —My question is addressed to the Minister representing the Minister for Communications. Did the Australian Broadcasting Corporation, in its Nationwide program, seen in Adelaide on Monday, 28 November 1983, present a report of a meeting in Melbourne of an auction of signs stolen from the Commonwealth defence facility at Pine Gap? Will the Minister provide either a transcript or a video copy of the report to members of parliament and the Australian Federal Police to ascertain whether breaches of Commonwealth law were involved? Senator RYAN —I have no information about the ABC program which was referred to in the honourable senator's question. I believe that he gave the date of the program as being sometime last November. I will refer the matter to the Minister for Communications. Senator CHILDS —When does the Minister representing the Minister for Foreign Affairs expect the report of the Jackson Committee to Review the Australian Overseas Aid Program to be presented to Parliament? Senator GARETH EVANS —I understand that the report is with the printer. It is anticipated that it will be tabled before Parliament rises for the winter recess . Senator WATSON —My question is directed to the Minister representing the Minister for Defence. I ask: Is it a fact that most Royal Australian Air Force Mirage aircraft have exceeded the airframe safety standard in terms of flying hours as specified by their manufacturers? When questioned on the high number of accidents affecting Mirage aircraft, the Minister for Defence, Mr Scholes, replied that other countries had Mirages in service. In so doing, he overlooked two factors-the flying hours are not necessarily comparable and the other countries have more modern Mirage aircraft. Senator GARETH EVANS —I suspect from Senator Watson's last comment that he is well aware of such information as I have from the Minister for Defence. But for the record, here it is. The hours flown by each Mirage pilot were: In 1981-82, 224; 1982-83, 194; and 1983-84, 209. Senator Watson —I said the airframes. Senator GARETH EVANS —The honourable senator was after the airframes? Senator Watson —Yes. Senator GARETH EVANS —The total number of Mirage hours flown by the aircraft, which probably only makes sense when one adds up the number of aircraft being flown, was 13,082 in 1982-83 and 13,280 in 1983-84. Willing as I always am to give honourable senators that sort of information, whether they want it or not, there it is. So far as crashes by Mirages are concerned, which is, I think, relevant to the question, there have been lots, but not an excessive number, I am told, by international standards. In 1975 there were zero; 1976, seven; 1977, two; 1978, one; 1979, one; 1980, two; 1981, two; 1982, zero; 1983, two; and in 1984, so far, there have been five. The Chief of Air Staff has, however, assured the Minister for Defence that aircraft are flown only if they meet strict airworthiness standards. Mirage losses have been 12.25 aircraft per 100,000 hours flown. I am told that this is comparable to or better than equivalent aircraft overseas. If in the middle of all that information Senator Watson has not had his request satisfied, as I suspect he has not, I shall do my best to ensure that he is so satisfied by the Minister as soon as I can. Senator WATSON —I ask a supplementary question, Mr President. If the Minister reads the Hansard he will note that I was not referring to the ability of the pilots but, rather, to the airframe of the aircraft. Perhaps the Minister will consider the question and give me a reply at a later date. Senator GARETH EVANS —I have acknowledged that there is a difference. Even I, with my inability to appreciate the finer points, can distinguish between an aircraft and a pilot. I am perfectly happy to find the information for Senator Watson and to advise him accordingly. Senator McINTOSH —Has the attention of the Minister representing the Minister for Resources and Energy been drawn to calls for some form of public inquiry into the British nuclear tests conducted in South Australia in the 1950s and 1960s, and into the effects of those tests? Can the Minister advise the Senate of the response to date of the Government to these requests? Senator GRIMES —The Minister for Resources and Energy and the Government are aware of the calls from a number of sources for a public inquiry into the atomic weapons tests at Maralinga. This morning the Minister for Resources and Energy, Senator Walsh, and the Minister for Aboriginal Affairs met representatives of the Pitjantjatjara Council Executive to hear that Council's case for such an inquiry. Senator Walsh informs me that the Government can well understand and appreciate the concerns expressed by Aboriginal people and by many other Australians about the weapons tests and about their possible effects on the health of many Australians. As Senator Walsh has already made clear here it would be generally agreed, with today's knowledge, that many of the things done by the British-with the full approval of the Australian Government of the day- were at best careless and at worst irresponsible. The Minister has also pointed out that last December the Government engaged a consultant, Dr John Symonds, to provide as full a report as possible on the British weapons tests program in Australia. Dr Symonds and officers of the Minister's Department have, with the co-operation of the British Government, assembled relevant documents both in this country and in the United Kingdom as a background to Dr Symonds's report, and in conjunction with the Government's response to a number of common law actions for compensation. Secondly, the South Australian Government has established a study into the effects on Aboriginal health of the weapons tests program-a study with which the Commonwealth is co- operating in providing relevant information from its own sources. Thirdly, the Minister for Resources and Energy will be taking a proposal to Cabinet on Monday for an expert scientific assessment of the data which is available on the fallout from British weapons tests conducted in Australia. These three investigations will document the information which is currently available. Just as importantly, they will reveal where there are deficiencies with data and information currently available, and what those deficiencies are. When the reports from these studies are available-all three are obviously matters on which the Government wants advice as soon as possible-the Government will be able to examine whether any further studies or inquiries could and should be made. As far as any further inquiries are concerned, the Minister has already indicated that he has an open mind on that question, and it would be premature to establish an inquiry at this stage, before a full assessment has been made of the information currently available to the Government, and of any deficiencies or gaps in that information. These are obviously matters of serious concern and they deserve to be treated as carefully as possible. This Government does not condone the test program conducted in Australia 20 or 30 years ago nor the way in which it was conducted. Our responsibility now is to see that the facts about these tests are established as far as we possibly can. The inquiries which have been set in train are designed to do that. I urge everyone who has an interest in this matter to be patient long enough for those inquiries to be conducted and assessed. Senator CHIPP —I direct my question to the Minister representing the Minister for Defence. Is it a fact that Australian researchers are co-operating with the United States in developing the so-called hyper-velocity and electro-magnetic guns defence systems for the United States? Is it a fact that this research will aid President Reagan's plan for a system of defences against nuclear missiles and the lunacy of putting nuclear missiles into space? How does this co- operative research effort square with the Government's repeated statements that it opposes the extension of the nuclear arms race to space implicit in the development of a space-based ballistic missile defence? How is it possible that, with one hand, this Government opposes a nuclear arms race in space, yet, with the other hand, is helping to develop those very same weapons? Senator GARETH EVANS —I suspect that Senator Chipp's question is based on an article in last Saturday's edition of the Melbourne Herald, under the headline ' Australia in ''star wars'' project', which article, in turn, seems to have been based on an answer given by the Minister for Defence to a question on notice-No. 1046-in the House of Representatives in which he said, among other things, that Australia and the United States are involved in a joint collaborative program on electro-magnetic launchers. This program is one of a number of programs carried out under the auspices of the Australia-United States Memorandum of Understanding on Co-operative Research and Development. He went on to say that the potential applications of electro-magnetic launchers cover any situation where an ultra-high velocity projectile is required, such as for the interception of anti-ship missiles. While not of interest to Australia in this respect, they have also been proposed for strategic systems such as defence against ballistic missiles. I am also able to give the honourable senator some information on this subject from the Minister for Foreign Affairs which relates more, I think, to the latter part of the question. It is to the effect that recent United States studies indicate that the successful deployment of a system of defence against ballistic missiles is likely to be extremely costly. They also indicate that the technical feasibility of such a system has yet to be conclusively demonstrated and that it would in any event be many years before deployment could be contemplated. The United States has not taken a decision to deploy a system of defence against ballistic missiles. The Australian Government has expressed concern on a number of occasions that outer space is the coming arena of super-power competition and has called for the prevention of an arms race in outer space. Military activity in outer space is already circumscribed through several existing arms control agreements. We support strengthening this arms control regime through further verifiable agreements. Australia is an active participant in the consideration of outer space questions in the conference on disarmament in Geneva. We urge all countries, especially those with space capabilities, to work in good faith to avoid an arms race in outer space. Senator MAGUIRE —I direct my question to the Minister representing the Minister for Health. I refer to statements made at a recent hearing of the Public Accounts Committee about the existence of kickbacks in the supply of pathology services. Is the Government concerned by the possible existence of kickbacks? What steps are being taken to bring the practice to an end? Does the Minister believe that such practices could contribute to the total cost of medical fraud and overservicing, which are now estimated at $130m annually? Senator GRIMES —Yes, from time to time Ministers for health and governments have heard allegations of the practice of kickbacks, primarily in relation to the practice of pathology. Section 129 of the Health Insurance Act contains provisions to the effect that any person involved in kickbacks is, upon conviction, liable to very severe penalties-including imprisonment, I think, for up to five years. To the extent that inducements may be offered to a medical practitioner to order pathology tests, kickbacks certainly could lead to overservicing in the form of requests for tests which are not reasonably required. One hears of allegations of such behaviour from time to time. Whenever the Department hears of such allegations, they are investigated to the limit of the information available; but to date there has been no prosecution of any person under that section of the Health Insurance Act. The Government is concerned that abuses such as kickbacks should be identified and dealt with according to the law. One of the characteristics of the kickback allegations has been the absence of detailed information sufficient to pursue investigations to the point of laying charges. If any honourable senators or any members of the community are able to provide such information and it is capable of being substantiated by investigation, I suggest that they are under an obligation to notify the Department of Health, which will vigorously and completely pursue such matters. However, it is a difficult area. It is an area in which, as in the case of the Public Accounts Committee, various governments have had allegations made, but those allegations have not up until now been substantiated sufficiently to press charges. Senator CHANEY —I refer the Attorney-General to the question I asked him on 3 May about his reported suspicions that his office telephones may have been bugged. I note the Attorney's non-committal answer on that occasion, but I draw his attention to the report in Tuesday's Australian newspaper which claims that the Australian Security Intelligence Organisation has reported to the Attorney that it could only conclude that a bug had been used on his office telephones. I also refer to yesterday's reports that the Attorney briefed Caucus on this matter. Will the Attorney-General inform honourable senators whether they should be concerned about the security of ministerial and other telephone services in this building? Senator GARETH EVANS —The reports of what I said to Caucus were quite garbled. However, I did not regard it as appropriate to correct those reports, any more than I regard it as appropriate now to canvass in any degree of detail what I understand to be the situation. All I perhaps should say, given that those reports have appeared, is that the ASIO report to me as to whether there had been an intercept of my telephone was inconclusive in its findings for reasons which are set out in detail in the report. Accordingly, I think the implication of my answer to this Parliament the other day remains the same, that people should exercise caution, regrettable though this may be, in having conversations on ministerial phones. Senator CROWLEY —My question is directed to the Attorney-General as the Minister representing the Special Minister of State. Has his attention been drawn to the Clancy column in the National Times of 6 May 1984 in which an item gives advice or instruction for the transfer of inscribed stock? It reads: Where the transferee is a female the words spinster, married woman, widow, whichever is applicable, to be used. Where the transferee is a male, occupation is to be stated. Can the Attorney-General comment about this item with his usual circumspection? Can he advise whether such advice or instructions on forms will be addressed by the Government's examination and review of all forms? Senator GARETH EVANS —I did see the Clancy item. I think it came from a Melbourne Port Authority instruction, which is no doubt a source of considerable embarrassment to my Victorian ministerial colleagues and a demonstration that, no matter how earnestly we may pursue, as a party and as governments in our respective jurisdictions, non-sexist results in these areas, it is very difficult indeed to ensure that quite grotesque travesties of respect for women do not continue to appear in official documents of this kind. There is something known, I am told, as an SF program, a simpler forms program-I hope it was not preceded by a simpler forms analysis-which is proceeding in the Department of the Special Minister of State and which I understand is likely to result in some productive non-sexism in future documentation as it is produced. Senator CHANEY —Mr President, my question is addressed to you and it follows the question which I directed to the Attorney-General a few minutes ago. In view of the Attorney-General's cautionary advice to honourable senators about the reliability of ministerial telephones, I ask you, Mr President, in the interests of senators and members, whether you can give us any assurance about the telephone services within this building and their security. The PRESIDENT —When Senator Evans's complaint about his phone was drawn to my attention I discussed the matter with the parliamentary security officers who in turn advised that the parliamentary electronics technician examined Senator Evans's phone. As I understand it, that was done with officers of the Australian Security Intelligence Organisation. The report given to me by the parliamentary security officers was that, as a result of that investigation, no evidence could be found of interference with the Parliament House exchange and that, if there were interference, it could have been in the Barton telephone exchange. Since that time the Minister for Veterans' Affairs called at my office last Monday evening, when unfortunately I was at Government House, to lodge a complaint that his telephone was being interfered with. I have referred that matter to the parliamentary security officer and I have not yet received a report on that incident. I assure honourable senators that if they have any suspicion of their phones being interfered with in any way it will be taken up by me immediately with the parliamentary security officer. Senator BOLKUS —I refer the Minister representing the Minister for Transport to a recent item on the Willessee program indicating that light commercial vehicles on the Australian market were not safe for use as passenger vehicles even though they had been advertised for such use. Is it a fact that there are no adequate standards covering these vehicles? Is it also a fact that progress towards such standards has been extremely slow? In view of the dangers to road safety, can the Minister say whether the Government is taking any action to enforce appropriate standards in this area? Senator GIETZELT —It is true that the standards in respect of passenger vans have been totally inadequate. The Government has been concerned for some time that all passenger vehicles for private use should provide the level of safety normally afforded by the Australian design rules. However, as the honourable senator suggested, the safety standards for light commercial vehicles, particularly vans, are different from those for cars; and, where passengers are carried, an anomaly has been in existence for quite a number of years. Accordingly, with the growing use of vans by citizens generally as passenger transport, the Minister for Transport has directed that the safety standards for these vehicles should be upgraded as a matter of priority to give van occupants the required protection afforded and provided for under legislation for passenger vehicles-in other words, cars. As a result of the Government's efforts over a period of only several months, the Australian Transport Advisory Council in February of this year agreed on a package of measures to improve van safety. Specifically, from 1 January 1985 vans used for passenger transport will no longer be classed as commercial vehicles and a number of normal passenger car design rules will apply. As well, seat belts will be required for all passengers. New design requirements to improve van safety further, such as emergency locking retractor seat belts, seat anchorages, child restraint anchorages, safety rims for wheels, improved tyres and head restraints, will be required from 1 January 1986. That time scale arises from the necessity for the industry to accommodate the Government's new requirements. Of course, priority attention is being given to improving van braking. Work is also under way on side and front impact protection requirements . In summary, the Government has pulled out all stops to improve safety. The arrangements to which I have referred will provide a significantly enhanced level of safety for those Australians who use these vehicles in ever increasing numbers for their personal and family transport. Senator LEWIS —My question, which is directed to the Minister representing the Prime Minister, is about the Commonwealth community employment program. Is it a fact that that program for this year allocated $64m to Victoria but that up to the beginning of this month only $35m had been spent, leaving $29m in Victoria's kitty? I remind the Minister that, when Mr Willis introduced this program, he said that only projects of real value to the community were to be funded and that they would not be for frivolous purposes like weeding lawns or painting goal posts. Is it a fact that in Victoria the Congress for International Co- operation and Disarmament has received funding for propaganda-three jobs-to the tune of $47,568; that Pax Christi, run by Dr Joe Camilleri, has received an allocation of $71,061 for five jobs; that Harry Van Moorst has been able to organise for the Coalition against Poverty and Unemployment six jobs at a cost of $155,975; and that the Young Women's Christian Association, as recommended in this week's Bulletin, has adopted a very good means of achieving funds by giving its project the title of the Migrant Women Developmental Research and Resource Centre Co-operative and managed to receive $689,423 for 41 jobs? What actions will this Government take to protect the $29m left in Victoria's kitty? Senator GRIMES —The community employment program was introduced to provide jobs which were useful, and particularly to provide the long term unemployed with work experience which would make them better able to get employment after they had received that initial training. I am not sure whether $29m is yet to be spent in Victoria but I will certainly obtain that information for Senator Lewis . I do not know whether the job-funding he has mentioned has been provided to CICD, Pax Christi, I think, the Coalition Against Poverty and Unemployment and the YWCA. It is certainly an interesting mixture of people. I do not know whether any of those organisations could provide jobs which were useful in the short term or provide long term training or long term experience for people who have been unemployed. As Senator Lewis knows, the approvals are recommended by committees of both Federal and State groups in each State. I will see that the facts, as they have been drawn to our attention by Senator Lewis, are drawn to the attention of the Prime Minister. I will obtain answers as to whether the jobs provided by CICD are propaganda jobs, as he described them. I doubt whether that is what is described in the applications or the approvals. I will obtain a more detailed answer. However, I can assure Senator Lewis that what was needed in this country before this Government was elected were programs which would provide people with jobs and with work experience so that they could overcome the very real difficulties they had suffered under the previous Government's policies. Senator ROBERTSON —Has the attention of the Attorney-General been drawn to the statement by the Queensland Government concerning disciplinary action to be taken against Queensland teachers who play Advance Australia Fair as Australia's national anthem at school ceremonies? What protection can the Attorney give to those who are threatened in this unusual way? Senator GARETH EVANS —I am not sure what protection I can give them. There are limitations on the scope of even the most adventurous Commonwealth Attorney- General when it comes to protecting people in the State systems. One of the limitations of our present legal system is that there is no systematic protection of human rights and there is a capacity to discriminate against people on the ground of political beliefs, which I assume would be the kind of thing that would be in issue here, in the absence of the national anthem requirement having any legal force, to the extent that sanctions could apply against someone who refused to play it. What we are reduced to is a situation in which, as Senator Robertson postulates, people are likely to be seriously prejudiced in their careers because of what most people would regard as a highly defensible, not even political, statement but simply a statement of nationalist sentiment in accordance with what is the accepted practice and indeed the proclaimed law elsewhere in Australia. It will not be until we do have some national protections of the exercise of political rights of this kind, of the kind that may prove to be contained in a Bill of Rights, that there will be any such protection available. Senator Chaney —Why don't you introduce the Bill? Where is the Bill? Hurry up. Senator GARETH EVANS —I am delighted to hear that one of the abominable snowmen opposite is yelling for the production of a Bill of Rights, demonstrating a willingness and a keenness to go down that particular policy path. In the absence of any other visible policy paths to go down, come the end of the year, in the words of Richard II, they will be wallowing naked in the December snow. However, in the absence of, yet, any such legislation being in force, it would not be possible for any complaint to be registered to the Human Rights Commission that would be able to be enforced, either there or through the courts . That must be a matter for the future. Whether there is any other possible legal avenue that could be pursued by people on the receiving end of this absurd exercise of overweening State parochial power by Mr Bjelke-Petersen is something to which I will give further attention. Senator TOWNLEY —Did the Minister for Education and Youth Affairs see the article in the Australian earlier this week headed 'Student allowance a national scandal', which referred to a speech by Mr Justice Kirby, Chancellor of the Macquarie University, when he was addressing the annual conference of the Australian College of Education in Canberra? Did the Minister note that Mr Justice Kirby said that the tertiary education assistance scheme should be raised to encourage students to stay in education rather than squandering their intellectual birthright? I ask the Minister whether she agrees with Mr Justice Kirby's statement: . . . the position we have arrived at is quite unacceptable. . . . . . If we want to maintain our place in the world, the key to that ambition is to be found in the schoolroom, in the colleges, in the university . . . Finally, will the Minister say what she and the Treasurer are attempting to do about this matter? Senator RYAN —I did see the article and I paid some attention to it because I am always interested in what Judge Kirby has to say on education matters. I think he is usually very sensible and very supportive of the view, which is the Government's view, that the proper education of our young people is one of the best ways in which we can expend public moneys. I certainly endorse his view about our low retention rates. In fact, I think Judge Kirby was quoting from some of my speeches when he used some of those statistics. I know that he was because he sent me a copy of his speech and I read it. I think Judge Kirby, along with many Australians who have taken an interest in this area, is aware that our participation rates are very low, and that this poses problems of equity and problems for a government desirous of bringing about a regeneration of our economy and a regeneration of industry. I was pleased to see that Judge Kirby was covering these issues and again drawing the public's attention to some very unsatisfactory situations we inherited from the previous Government. As to the particular comments he made about levels of TEAS, I think that there were some discrepancies between the figures reported in the article and those provided by my Department. However, I will make several points. It is true that the number of students on TEAS in universities and colleges of advanced education declined from 72,277 at 30 June 1978 to 62,768 at the same time in 1981, but the numbers are increasing again towards an expected 69,000 in 1984. The percentage of students on TEAS, of all full time enrolments in universities and CAEs, was 37.7 per cent in 1976 and 37.2 per cent in 1981, according to my Department's figures. Some 60 per cent of students on TEAS were getting the maximum allowance either at the home, away from home or independent rate in 1976 , 64 per cent in 1981, and 67 per cent in 1983. So there have been some improvements with regard to TEAS, although I would be the last person to suggest that the improvements we have seen are satisfactory. In conclusion, in general terms I endorse the remarks made by Judge Kirby about the undesirable effects, both for individuals and for our society in general, of low participation rates, and, I add, the need as budgetary circumstances permit to improve the level of support we are able to provide to students undertaking full time training. Senator COATES —I ask the Minister representing the Minister for Home Affairs and Environment: Does the Government have any information on whether the Maralinga nuclear weapons tests affected radiation levels over Tasmania at the time? Does the Government know whether the State Government has any other information from any monitoring it undertook at the time? Senator RYAN —I have been provided with some information on the subject of Senator Coates's question by the Minister for Home Affairs and Environment. The Australian Ionising Radiation Advisory Council, in its report, AIRAC No. 9, on British nuclear tests in Australia, referred to the results of monitoring for radioactive fallout in Hobart as part of a national monitoring network established for the later series of tests. There were two occasions on which recorded radiation was attributed to tests at Maralinga. For the other five tests at Maralinga no radiation attributable to the tests was recorded by the national monitoring network stationed in Hobart. On each of the two occasions when radiation was recorded the amount was equivalent to less than one- thousandth of the national background level of radiation. I am advised by the Minister for Home Affairs and Environment that he has no information on any monitoring programs which may have been carried out by Tasmanian Government authorities in the relevant period. However, the Minister has also advised that he will take the matter up with his State counterpart, the Honourable Mr Pearsall. Senator DURACK —My question is addressed to the Minister Assisting the Prime Minister on the Status of Women. I refer the Minister to widespread concern which has been expressed by women's organisations throughout Australia, organisations as diverse as the Catholic Women's League, Women Against Violence and Exploitation and many others, about the flood of hard core pornographic and violent video material available in Australia. I ask: Is the Minister concerned about this problem which has emerged? Is she in particular concerned about the degradation of women and the threat to women and children which this material poses; and if so, what action does she propose to take in this regard? Senator RYAN —I am aware of expressions of concern from a wide range of women's organisations about the increasing accessibility of Australians to hard core pornography in the form of videos. I share their concern. It is my view that there is a very serious dilemma in a democratic society between the principle of freedom of choice by adults to view whatever material they wish to view and the need for properly elected authorities to protect vulnerable members against violence or exploitation. My own view is that the recent flooding of the market here with this material provides the Government with such a dilemma. I have discussed this matter with some length with my colleague the Attorney-General. I understand that he has also had discussions with officers from the Office of the Status of Women arising out of the kinds of representations made. Some steps have been taken by the Government in respect of this matter. It is my view that we will need to monitor those steps to see whether they satisfy what I consider to be our requirements for protecting the community against material which can lead to or which can, in some way, be part of the cause for violence, particularly sexual violence, against women and children. Senator DURACK —Mr President, I ask a supplementary question. Does the Minister consider that the steps which the Government has taken are adequate in this matter? Senator RYAN —I cannot predict whether they will prove to be adequate. What I have just said is that I will ensure that these steps are monitored. If they prove not to be adequate I give an undertaking to Senator Durack that I will raise the matter again with the Government and with the Attorney-General so that adequate steps can be taken. Senator GILES —I refer the Minister representing the Minister for Territories and Local Government to a question to him on 3 May in which it was suggested that the Government was sitting on the report of the Task Force on the Implementation of Self-Government in the Australian Capital Territory. Has the Minister for Territories and Local Government tabled the report? Are arrangements in train to table the report in this place? Can the Minister guarantee the people of the Australian Capital Territory that they will have ample opportunity to discuss the report before any of its recommendations are implemented? Senator GIETZELT —It is true that Senator Reid asked me a question on the report of the Task Force dealing with self-government for the Australian Capital Territory. I understand that report will be tabled in the House of Representatives today and will be available to honourable senators shortly. The Minister in his tabling statement has advised that the Government is not necessarily committed to the particular arguments or recommendations of the Task Force and will take into account the community's response to the report and the development of the Government's position on the implementation of self- government. The Government also expects to receive soon the report of the Commonwealth Grants Commission on Australian Capital Territory finances. In the light of public comment on the Task Force and the Grants Commission's report, after consultations with members of the Task Force, the House of Assembly, the Trades and Labor Council of the Australian Capital Territory and relevant departments and authorities and other community organisations, the Government proposes to publish in the first half of 1985 a White Paper on the implementation of self-government. This will allow further public consideration of the Government's intentions. In addition, the consultative process to which this Government, of course, is very heavily committed, will include the establishment of a committee of relevant unions and government officials to give particular consideration to the question of an Australian Capital Territory administration separate from the Australian Public Service, depending upon the results of the Government's decision. Senator HAINES —My question, which is directed to the Minister for Education and Youth Affairs, refers to the telex reportedly sent to all Cabinet Ministers today in response to the belief of the Federation of College Academics that Cabinet may consider postponing the 1985-87 triennial funding. I understand a copy of the telex was sent to the Minister's office earlier today-in any event I have a copy with me. I ask: Can the Minister assure the Senate that Cabinet is not considering such a blatant reversal of the Australian Labor Party's re- election commitment to triennial funding? Can the Minister also assure the Senate that in fact the Australian Labor Party Government will remain true to its promise by extending triennial funding to equipment and capital programs? If the Minister cannot assure the Senate now about these matters, thereby running a real risk of fuelling speculation and adding further strain to the prices and incomes accord, can she give an indication as to when she will be able to announce Cabinet's decision on those matters? Senator RYAN —I can indicate when I will be able to announce the decisions. Those decisions will be announced when I issue the guidelines to the two education commissions. I expect that will be early in July. However, I can reassure Senator Haines and the people on whose behalf she is raising the matter today, that I will be tabling the report of the Commonwealth Tertiary Education Commission for 1985-87 in the Senate this afternoon. The time lag in tabling it from the time when I received it is due entirely to the time lag in the printing processes. The reports are hot off the press today; I hope they arrive in time for the tabling. They will be tabled. I am sure that will be a reassurance to all those people concerned with the future of higher education in this country. Individual decisions and recommendations will, of course, be taken up to the extent that budgetary circumstances permit. CTEC's recommendations will form a part of our budgetary considerations in the next few weeks. The decisions will be announced, as I said, at the time of the handing down of the guidelines to the two education commissions. Senator SIBRAA —My question is directed to the Minister representing the Minister for Immigration and Ethnic Affairs. I ask: Is it a fact that Asian immigration under the Fraser Government was substantially higher than under the first full year of the Hawke Government? If so, does the Minister agree with the editorial in today's Sydney Morning Herald in which it is stated that the Opposition's contribution to a full and honest immigration debate has so far been extremely dishonest and that claims by the Opposition that the Government's immigration policy is pro-Asian and anti-British are 'nonsense'? Senator GRIMES —I have noted the editorial in this morning's Sydney Morning Herald and the debates which have occurred in another place before this. About 3 .30 this afternoon in the House of Representatives the Prime Minister will be making a statement on immigration policy. I will be making that statement a little later in this place. I can merely say at the moment that Asian migration, including refugee arrivals, reached a peak of 26,528 in 1981-82. In 1982-83 the figure was 24,486. For the period July 1983 to December 1983 the figure was 11, 773. Senator Sibraa is clearly correct in his observations. However, it is worth while pointing out that in interpreting these figures for those who wish to make comparisons with similar figures for Europe and Britain one should be careful. With the exception of refugees, who are obviously in a special category arising from our humanitarian and international obligations, people are selected for migration to Australia from all over the world according to pre-determined and universally applied criteria. This point ought to be emphasised: People are selected for migration according to the same criteria irrespective of where they apply and irrespective of their racial or religious background. It would be a sad day for human values if this or any other government were allowed to select people for migration on the basis of their race, religion or, for that matter, sex. People who arrive in this country for permanent residence and, ultimately, citizenship do so because they satisfy the selection criteria, which are well known to honourable senators and the public. As to the second part of the question, as I said earlier, I did see the editorial in the Sydney Morning Herald. I certainly agree with the comments in that editorial, which states: The only flaw in Mr Peacock's argument is that the Opposition's contribution to the full and honest debate has so far been extremely dishonest. Its claim that the Government has departed from bipartisan immigration policy by running a 'pro -Asian and anti-British' policy is nonsense. It was the Fraser Government that effectively cut back British and European migration after the collapse of the resources investment boom. Two months before the Hawke Government was elected, the then Minister for Immigration, Mr Hodges, cut the skilled migrant intake by nearly one third. Nothing the Hawke Government has done has significantly altered the number of migrants-skilled or otherwise-coming from Britain and Europe. The most important change since Mr Hawke took office is a decline in the number of applications from prospective British migrants: from about 26,000 in 1982-83 to 6,550 in the first seven months of this financial year. The editorial continues: If Mr Peacock wants to play a constructive role in the debate he could start by pointing out that an immigration program that will result in 4 per cent of Australia's population being of Asian extraction by the end of the century is not a policy to create an Asian Australian. As I said, later this afternoon I will be making a statement which will give fuller details. Senator Archer —Boring. Senator GRIMES —Senator Archer is anxious to get into this debate in the usual racist and biased way. I suggest that he will have the opportunity to do that later. The PRESIDENT —Order! The Minister will withdraw that remark. Senator GRIMES —What must I withdraw? The PRESIDENT —The remark just made in relation to Senator Archer. Senator GRIMES —I withdraw. Senator Sir JOHN CARRICK —My question is directed to the Minister representing the Prime Minister. I draw the Minister's attention to the evidence by the Department of Primary Industry to Senate Estimates Committee C that total earnings from primary industry will fall by 23 per cent in 1984-85. I also draw his attention to recent authoritative forecasts that capital investment in the manufacturing and mining industries will fall by more than 30 per cent in each sector in the coming period. I ask: In view of these expert forecasts which cover virtually all the main activities of the private sector, what specific evidence can the Government produce to support its claim that unemployment will decline? In which specific sectors will that decline take place? Senator GRIMES —I do not know the details of the evidence which was referred to by Senator Sir John Carrick, but I take it that, as he said, there was a prediction by those expert groups that there will be a fall in farm income and investment in the manufacturing sector. I hope those experts are more expert than the people who advised Senator Sir John Carrick when he used to come into this place and tell us about the oil boom which was going to occur in the shale deposits in Queensland. I hope they are more expert than the experts who advised Senator Sir John Carrick and Mr Fraser of the resources boom in this country which never occurred. This Government has predicted that economic recovery will continue provided we can maintain the existing policies, provided we can maintain the prices and incomes accord in this country and provided we can turn what is obviously a considerable economic recovery this year into a persistent and lasting recovery. According to the job figures released by the Australian Bureau of Statistics today there have been 225,000 more jobs in this country in the last 12 months. That is considerably beyond even our estimates. What we wish to create in this country is an economy which grows and an economy which grows in all sectors-the manufacturing and primary sectors. Our policies are aimed at that. We will continue with the fiscal and economic policies which have resulted in such an improvement in the last 12 months. We do not pretend for one minute that we are going to wipe out unemployment in this country in one year or two years. I will look at the evidence given by the so-called experts which Senator Sir John Carrick has drawn to my attention. I will draw the Prime Minister's attention to that evidence and get a more detailed, more appropriate and, undoubtedly, more expert response for the honourable senator in the future. Senator Sir JOHN CARRICK —I ask a supplementary question. In response to the Minister's answer, is it not a fact that the unemployment figures today show a real increase in unemployment? Senator GRIMES —I hardly think it is a supplementary question, but I will certainly answer it. Rather than be accused of doing something selective, I will give everybody the full facts and the full details. The labour force statistics show that in the Government's first year in office employment increased by 225, 000, which is in fact 45 per cent of the target which we aimed at before we got into government. Senator Messner —Yes, but what is it in real terms? Senator GRIMES —I said I would not be selective. I will quote all the figures. In the last month there has been an increase of 15,500 jobs. That is way below the March increase, but March was the largest increase in that time. There was a rise in the participation rate and that should be expected and is expected during the early stages of economic recovery. These two influences have combined to produce a rise in the seasonally adjusted unemployment rate from 9.3 per cent to 9.5 per cent, despite the increases in employment. No one would attempt to hide that at all. I can point out that in the Department of Social Security the figures for the payment of unemployment benefit continue to decrease. At the moment it looks as though the expenditure by the Department of Social Security this year on unemployment benefit will be somewhere in the region of $330m to $ 360m below the estimate in our Budget. As I have said, and as Senator Sir John Carrick has said, there has been an increase in the seasonally adjusted unemployment rate from 9.3 per cent to 9.5 per cent. That demonstrates, amongst other things, that there will be no smooth decrease in unemployment, that unemployment figures will be affected by the participation rate. Perhaps it is better that we look not only at the monthly figures but also the three-monthly figures. No one in this Government says that unemployment has dropped to a satisfactory level. No one in this Government believes that the job is over and that all is going to be smooth sailing from now on. What we are encouraged by is the great increase in the number of people in employment. We are also encouraged by the number of people who are participating in the work force and willing to participate in the work force, because this indicates a general feeling of confidence and an improvement in the psychological attitude of the community as a whole. Senator ELSTOB —My question, which is directed to the Minister representing the Minister for Resources and Energy, refers to the atomic testing at Maralinga. Can the Minister say what the implications would be if the British Government did breach the test treaty in operation at the time of atomic testing? Was an agreement made by the British Government and the then Menzies Government that any Australian personnel affected by the testing would be the responsibility of the Australian Government? Has the Minister considered the possibility of private citizens also claiming compensation from the Federal Government for social negligence? Senator GRIMES —I believe that part of that question would involve me giving a legal opinion. As I have said before in this place, I am the very last person who would be willing to do so. I will certainly seek to obtain from my colleague , Senator Walsh, the nature of the legal agreement, if one existed, as referred to by Senator Elstob. One of the problems referred to by Senator Walsh in the information he provided to me to answer a question asked earlier today is that we need to find out the facts of exactly what happened at the time. We need to gather all the information available both here and overseas. First, we need to get the data, and, second, the exact details so that we can make a proper judgment of what has happened both as a government and as a parliament. It is my understanding that people have already made common law claims against the Commonwealth Government concerning illnesses that they have suffered for which they seek compensation. Whether the Australian Government or the British Government would be responsible in all those circumstances I am not sure; so the best thing I can do is seek exact details from my colleague for Senator Elstob. Senator MISSEN —My question, which is addressed to the Minister for Education and Youth Affairs, relates to the submission by the Outer Eastern Municipalities Association in Victoria presented to the Minister on 31 March 1984, concerning the provision of technical and further education facilities in the northern corridor of the outer eastern region. Does the Minister agree that the statistics, details and arguments contained in this submission prepared by the shires of Lillydale, Healesville, Sherbrooke and Upper Yarra and the cities of Croydon, Knox, Ringwood, Nunawading, Doncaster and Templestowe demonstrate the urgent need that exists for the development of a locally situated complex of TAFE services to cater for the ever-expanding number of current and future students? If so, I ask the Minister: First, what consideration has the Government given to the submission which recommends the establishment of a multicampus educational system, TAFE facilities distributed throughout the northern corridor, including central core facilities located in the shire of Lillydale, and off-campus facilities close to other student populations providing area-specific, community responsive training in areas demanded by growing local industry? Secondly, when can the Outer Eastern Municipalities Association expect a response from the Government to its submission? Senator RYAN —I have received a copy of the submission to the Victorian Minister for Education prepared by the Outer Eastern Municipalities Association of Victoria concerning the provision of TAFE facilities in the northern corridor of the outer eastern region of Melbourne. I am aware of continuing local concern about the provision in this region and I am sympathetic to it. But as honourable senators will know, the provision of TAFE is essentially a State responsibility with Commonwealth support being supplementary to State effort. Commonwealth funding for capital projects is provided only in response to proposals submitted by State governments. I have been advised by the Council of the Tertiary Education Commission that, to date, no proposal has been received from the Victorian authorities for Commonwealth assistance for TAFE buildings in the area to which Senator Missen's question refers. However, I understand that the matter is currently under consideration by Victorian TAFE authorities. When a proposal is forthcoming from the Victorian Government we will be able to give it formal and official consideration. Senator ELSTOB(South Australia) —I present the ninth report of the Publications Committee. Report-by leave-adopted. Senator ELSTOB —I seek leave to make a short statement relating to the Committee 's concern at the increasing number of corrections and alterations to annual reports. Leave granted. Senator ELSTOB —On behalf of the Joint Committee on Publications I would like to draw the attention of the Senate to the increased incidence of corrections and alterations being made to annual reports by departments and authorities after the reports have been tabled in the Parliament. The Publications Committee is concerned at this trend, as it delays the timely production of the parliamentary paper series and naturally limits the usefulness of the original annual reports. I understand that arrangements have been made to have all such notifications of amendment tabled in both Houses and distributed to all honourable senators and members. The Joint Committee on Publications will continue to monitor the situation and will draw the attention of the Senate to any substantial amendments which are made to annual reports. Debate resumed. Senator CHANEY(Western Australia-Leader of the Opposition)(3.07) —It is now my understanding that the Australian Democrats will support the motion which would bring this matter before the Senate. I make that statement to forestall any unnecessary and time-wasting debate on that aspect of it. That understanding, which I have from the Australian Democrats, relates to our preparedness to make some amendments to the legislation. Indeed, I would like to defer to the Deputy Leader of the Opposition in the Senate, Senator Durack, who has the conduct of this matter on behalf of the Opposition. But in discussions since the matter came on for debate this morning, the suggestion has been made that the word ' unduly' might be removed from the motion which Senator Durack will be seeking to move today. We wish the word 'unduly' to be deleted where it appears in paragraphs 2(a), (b) and (c) of the motion. In addition, the Australian Democrats have indicated to us that they do not wish to nominate an additional member to the Committee although Senator Harradine is anxious to join the Committee for that task. It would therefore be our intention to substitute the words 'Leader of the Government' for the words ' Leader of the Australian Democrats' where those words appear in paragraph 5. That would effectively enable the Committee to be enlarged and would permit Senator Harradine to join the Committee but would not require the Australian Democrats to join the Committee. The motion I moved earlier today will enable us to deal with Notice of Motion No. 78 which appears in Senator Durack's name during this session of General Business of the Senate. Senator GARETH EVANS(Victoria-Attorney-General)(3.09) —Even with the amendment foreshadowed by the Leader of the Opposition, Senator Chaney, this is simply not an acceptable proposition and not a sensible way of doing business in this place . Whichever way one twists and turns in the drafting of this proposal-I appreciate it is improved in this respect by removing the word 'unduly'-the reality is that we are still asking the Senate Standing Committee on Regulations and Ordinances to turn its mind squarely to what is absolutely redolent with policy overtones. As such, it is an inappropriate exercise for a committee which has been in existence since 1932, which has been elevated to world fame and stature as a committee of this Parliament and which is doing a thoroughly worthwhile job. That Committee is being put very much at risk by any such proposal. I appreciate that this is to foreshadow the substantive debate rather than the procedural one-perhaps, Mr Deputy President, you can clarify for me whether we are on the procedural one as to whether we should have the debate- The ACTING DEPUTY PRESIDENT(Senator Colston) —That is correct. Senator GARETH EVANS —But I make the point that the substantive debate would need to address its collective mind to this proposal and consideration of the enormity of what is here proposed should, I believe, lead people not to contemplate bringing on the matter. It is an inappropriate reference. It is not a matter of the Committee simply being asked to apply its existing criteria. It has already done that. It has already reported to the Senate on the application of those criteria. As to paragraph 3-whether the matter is more appropriate for parliamentary enactment or revised delegated legislation-on which the motion is hung, that is something which either can be resolved at the threshold in the way that the Committee already has in giving consideration to this in the past or it demands the detailed attention to policy matters which is necessarily implied in the language of paragraph 2 of the motion. If the Committee is being asked whether there is any restriction on the Commonwealth's powers to do these various things it can from one point be argued to be a very simple technical question, answerable, if we are talking about constitutional power, with a flat negative, answerable, with a little more detail, if we are talking about power in terms of the power available to Customs officials or the Attorney-General within the four corners of the regulation itself. Either way that is not a question that demands Committee consideration. If it is a technical question it can be quickly and readily resolved on legal advice which the Government is perfectly happy to supply to the Senate without prejudice. That is something which the Parliament can take into accout when it next debates this matter. If it is not a purely technical matter and not something that goes to the criteria that are supposed to be applied by the Committee in the way they have already been applied in the Committee deliberations, we are left with no other reading of this motion than that the Committee is being asked to have regard to, consider and report upon the policy implications of the regulations now before the Parliament. It is being asked to do so in an absurdly constrained time of two weeks. The whole thing is a nonsense, with respect, and it ought not to consume the time of the Senate any further, whether by way of debate on the procedural matters or debate on the tie substantive matters that are involved. As I have indicated on numerous occasions, there is no desire on the part of the Government to stifle a full debate on the question of what the regulations applicable in this area should be. There are still some days left to run so far as the existing disallowance motions before us are concerned. The Government is perfectly happy on the first day back to have a debate on Senator Mason's outstanding motions and Senator Harradine's disallowance motions but to have that debate against the canvas of draft regulations, redrawn regulations, which are in the process of being drafted right now by the Commonwealth in response to the previous debate. Had I had more time in the last few days I hoped to have been able to circulate the redrafted proposals this week. It has not been possible to do that but I hope to be able to do it certainly well before honourable senators come back to this place on 29 May. Then senators will be armed with a clear statement, in regulation form, of what the Government's intentions are to respond to the existing disallowance motions and the points made the other day by Senator Harradine. The debate that will occur then will be a much better informed one than it is at the moment. I indicate my willingness also to circulate to honourable senators a background paper prepared by the Department going to the technical questions to the extent they can be construed as technical questions in this reference should honourable senators feel they need any more background of that kind. Rather than burden an already over-burdened committee with a work load of this kind, rather than require it to tear up the conventions which have governed its operations very successfully since 1932, the Senate should recognise this motion for the nonsense that it is and pass on to the other business that, quite rightly, the Australian Democrats are anxious to get on to. Senator MASON(New South Wales)(3.14) —The debate seems too be at the stage where we might as well put our bit into it. It is true, as the Leader of the Opposition (Senator Chaney) has said, that with modifications to the motion we have agreed to support it. This is not necessarily because we feel that we have a strong commitment to do so; far from it. It is merely because, as usual, we will have to decide whether it passes and we realise that there are areas of concern in the Senate and the Community which this reference may or may not allay. But it is very important that the right of those people to be heard should not be unreasonably withheld from them. I cannot agree with the Attorney-General (Senator Gareth Evans) that this reference would place a lot of work on an over-burdened committee. As far as I can see, the Committee, from judging the references listed on the Notice Paper, is not over-burdened at the moment. The fact that it has looked at this matter once before is also beside the point. Fresh material and matters have been raised. I am not canvassing those matters. Mr Deputy President, you are aware that we have raised this matter, we have taken a certain point of view and sought certain things. That does not give the Australian Democrats the right to decide arbitrarily that the points of view of other people and honourable senators should be disregraded. It is on that basis only that we will support this reference. We understand that it will not be a complicated one. No public evidence will be called as a result. It is basically a matter of the kind of legal opinions the Attorney-General has spoken of. In fact, as I can see it and on my understanding, it is that kind of process except that the Committee, in an organised way, will be able to listen to them and report to the Senate reliably on the outcome. I suggest to the Attorney-General that this is not the great deal he makes it out to be. It will not damage the Committee. There is no precedent where the Committee is concerned. Senator Coates —Very much so. Senator MASON —I say to Senator Coates that in our view the mere fact that the Committee in the past has not dealt with policy matters of this kind does not necessarily limit it in the future. It is a regulations and ordinances committee designed on behalf of the Senate to look at what the Executive does in the way of regulations and ordinances. I do not concede that this matter has policy implications but, if that is the case, it is not a matter that we could not reasonably be asked to take on board. Question resolved in the affirmative. Senator DURACK(Western Australia)(3.18) —I seek leave to amend notice of motion No. 78 which has been circulated in my name, as foreshadowed by Senator Chaney. Leave granted. Senator DURACK —I move: (1) That the following Regulations and Ordinance be referred to the Standing Committee on Regulations and Ordinances: (a) Customs (Prohibited Imports) Regulations (Amendment), as contained in Statutory Rules 1983 No. 331 and made under the Customs Act 1901; (b) Customs (Cinematograph Films) Regulations (Amendment), as contained in Statutory Rules 1983 No. 332 and made under the Customs Act 1901; (c) Classification of Publications Ordinance 1983, as contained in Australian Capital Territory Ordinance No. 59 of 1983 and made under the Seat of Government (Administration) Act 1910; and (d) Classification of Publications Regulations, as contained in Australian Capital Territory Regulations 1984 No. 2 and made under the Classification of Publications Ordinance 1983. (2) That the Committee examine whether the aforementioned Regulations and Ordinance, individually or severally: (a) restrict the Commonwealth's existing powers to prevent the importation of publications, including videotapes- (i) promoting or encouraging violence, (ii) promoting or encouraging the use of hard drugs, and (iii) depicting hard core pornography, sexual violence or other gross obscenities; (b) restrict the Commonwealth's existing powers to require videos not imported for public exhibition to be registered by the Film Censorship Board before release by Customs; and (c) restrict the power of the Commonwealth to protect children from exposure to publications in (a) (i), (ii) and (iii). (3) That the Committee advise the Senate whether, in light of this examination, the Regulations or Ordinance contain matter more appropriate for Parliamentary enactment or revised delegated legislation. (4) That, notwithstanding anything contained in the Standing Orders, for the purpose of the inquiry, the membership of the Committee be increased to nine members. (5) That one of the two additional members be nominated by the Leader of the Government and the other be nominated by the Independent senator. (6) That the Committee report to the Senate on or before 29 May 1984. I do not propose to canvass the arguments to any extent in support of this motion. I think they have been dealt with on the procedural motion and Senator Chaney and Senator Mason have referred to them. However, I simply say that this reference to the Standing Committee on Regulations and Ordinances is not seeking a policy consideration by that Committee or policy recommendations from it. It is asking, in effect, for guidance from the Committee as to the effect of the ordinances in a legal sense on the Commonwealth's powers in relation to the importation of publications. The Attorney-General (Senator Gareth Evans) said that this could be literally interpreted to confine it to the question of the Commonwealth's constitutional powers. That would be a very slick and unworthy way for the Committee to operate . I am sure that it would not operate in that way. Perhaps the motion could be further amended to make perfectly clear what it is about, but to any reasonable layman looking at the matter, without trying to take smart legal nit-picking points, it is quite clear what the exercise is about. I am sure that Senator Mason and Senator Harradine know quite clearly what is required of the Committee . The Regulations and Ordinances Committee is very familiar with dealing with matters in a short time frame. It has a legal adviser, and it will not have to hold any extensive hearings on this reference. It is simply a matter of getting advice, having a meeting to discuss that advice, and making a short report to the Senate. The Committee is well adapted to and experienced in this type of exercise, and I do not have any doubt that it can achieve this purpose. Another possible argument is that the reference is outside the charter of the Regulations and Ordinances Committee. It is not outside the general charter of the Committee under the Standing Orders. It is true that over the years it has adopted a charter which limits its consideration of regulations and ordinances to certain questions. I do not maintain that this reference is specifically within those parameters, except in relation to paragraph 3, which asks the Committee to advise whether the regulations would be more appropriate for parliamentary enactment rather than by subordinate legislation. The main limitation on the Regulations and Ordinances Committee's role is that it does not deal with policy. This reference does not ask it for policy advice. It asks simply for legal advice as to the effect of the regulations. The Senate has debated the regulations. That debate was adjourned after there had been a great deal of debate, during which certain doubts were raised as to what was the effect and the meaning of certain provisions of the regulations and ordinances. I believe it will greatly assist the Senate when the debate is resumed to have a report of this kind from the Regulations and Ordinances Committee, which has a tradition of independence and competence. It is for those reasons that I have moved this motion, and I seek the support of the Senate for it. Senator WALTERS(Tasmania)(3.23) —The motion moved by the shadow Attorney- General, Senator Durack, states in part: 2. That the Committee examine whether the aforementioned Regulations and Ordinance, individually or severally . . . The motion-and I wholeheartedly concur with the amendment by the Australian Democrats-continues: (a) restrict . . . the Commonwealth's existing powers to prevent the importation of publications, including videotapes; I am particularly interested in paragraph (c); that is, that the Committee examine whether the aforementioned regulations and ordinance, individually or severally, and I quote: (c) restrict . . . the power of the Commonwealth to protect children from exposure to publications in (a) (i) (ii) and (iii). I do not know whether the Attorney-General (Senator Gareth Evans) is aware of the reports coming from both England and Wales. I would like an indication as to whether he is aware of them. Senator Gareth Evans —Yes, I am indeed. Senator WALTERS —Then it surprises me further that he should press ahead with this particular regulation, since he has been made aware of what is occurring and of the report that has been issued in England and Wales. I have asked the attendants to distribute to honourable senators a copy of that report, because I believe it is relevant to the matter we are discussing. Senator Gareth Evans —Mr Acting Deputy President, I take a point of order. It might be relevant to the general subject matter but it is hardly relevant to the timing of the debate which is now before us on the question of a reference of a matter to the Standing Committee on Regulations and Ordinances which, on the view of the Opposition, is not supposed to go to policy questions. The ACTING DEPUTY PRESIDENT(Senator Colston) —Senator Walters, perhaps you could explain the reason for wanting to pursue this line of debate. Senator WALTERS —I thought I had, Mr Acting Deputy President. I read to you and to the Senate the reason for this line of debate. It fits in entirely with the section of the motion that I read, which states: (c) restrict . . . the power of the Commonwealth to protect children from exposure to publications in (a) (i) (ii) and (iii). I believe that that fits in entirely with the debate. I do not doubt for one minute that Senator Evans does not want me to refer to it, but I am afraid it is very relevant. The ACTING DEPUTY PRESIDENT —Have you just circulated this report? Senator WALTERS —Yes, you will find a copy on your table. Senator Gareth Evans —Mr Acting Deputy President, is it in order for an individual senator to circulate something without leave, requiring the attendants to devote their time and energy to lumping these things around? Are we to bring armloads of pamphlets into the chamber and distribute them in the future? I do not make a great issue of it, but it seems to me to be a little extraordinary. The ACTING DEPUTY PRESIDENT —It is a little unusual, but the material has been distributed, so we will leave it at that. I ask Senator Walters to continue with her remarks. Senator WALTERS —I am quite sure that it was distributed at no great cost to the attendants. I draw the attention of honourable senators to the report that is before them. I note that Senator Evans refused a copy. Senator Gareth Evans —Because I already have it on the file. Senator WALTERS —I am not sure whether Senator Evans has a copy in front of him. We have before us two parts of a report which some British Lords have brought down as a result of wide concern in the community at the rise in violent crimes. They noted that there was a rise of 27.4 per cent- Senator Coates —Mr Acting Deputy President, I take a point of order. One is usually very tolerant when Senator Walters speaks outside the terms of a motion, but she has started to debate the issues which the Opposition wants the Standing Committee on Regulations and Ordinances to look at. She is now debating the contents of a report from another country. I think it is totally irrelevant to this reference and she ought to be brought back to the terms of the debate. The ACTING DEPUTY PRESIDENT —Senator Coates, I uphold your point of order. Senator Walters, the question before the chair is whether certain matters should be referred to the Standing Committee on Regulations and Ordinances. That is the matter which you should be debating. You should not be debating the matters that may be discussed by the Regulations and Ordinances Committee. I ask you to confine your remarks to the question that is before the chair, namely, whether these matters should be referred to the Regulations and Ordinances Committee. Senator WALTERS —Mr Acting Deputy President, my reason for debating this report is that it bears very heavily on whether this reference should go to a Senate committee, the Standing Committee on Regulations and Ordinances. Indeed, in my opinion, the report relates so succinctly to the recommendation put forward by Senator Durack that the words I have now read twice to honourable senators explain why fully. The Senate is debating whether certain regulations and an ordinance should be referred to the Regulations and Ordinances Committee in order that that Committee may examine whether they restrict the power of the Commonwealth to protect children from exposure to publications. If I cannot debate whether the regulations and the ordinance should be referred to the Committee for legal opinion, as I believe they should, and if I cannot cite evidence which says that evidence is available in the rest of the world that such restriction could be the case, and that therefore, the Senate should move that legal opinion be sought on the regulations and the ordinance-- Senator Grimes —Mr Deputy President, I take a point of order. The Acting Deputy President, who preceded you, made a ruling on this subject. I suggest that what Senator Walters is doing is canvassing that ruling. I know she wants to indulge in prurient nonsense, but if we are going to have sensible debate, we have to obey some rules of debate. The DEPUTY PRESIDENT —I uphold Senator Grimes's point of order. I support the ruling given earlier by Senator Colston. I support the ruling of Senator Colston on this matter, which is that this is a very narrow debate on the matter of the referral to a committee of particular terms of reference. The honourable senator must not pre-empt the debate, either in the Committee or when the Committee reports. The honourable senator must confine herself, if she speaks at all, merely to the terms of reference. That was the ruling given by Senator Colston and I support that ruling. Senator Chaney —Mr Deputy President, I rise not to canvass your ruling, but to seek the withdrawal of a comment made by the Acting Leader of the Government in the Senate. He used the word 'prurient' and some other word, I think, relating to the interest that was being shown by the honourable senator. I think that is offensive and should be withdrawn. The DEPUTY PRESIDENT —Senator Grimes will withdraw the remark. Senator Grimes —Mr Deputy President, I withdraw. We are rapidly running out of words in this place. The DEPUTY PRESIDENT —Senator Walters, within those limits you may continue. Senator WALTERS —Mr Deputy President, can you tell me whether there is any way I can refer to evidence that is available-- Senator Gareth Evans —You can in the debate when we resume. Senator WALTERS —I am asking the Deputy President. I am not asking the Attorney- General. Mr Deputy President, I would like the answer to come from you, rather than from the Attorney-General. The DEPUTY PRESIDENT —I am perfectly happy to give you the ultimate answer, Senator Walters. What you may do-and what would be perfectly appropriate for you to do if you wish to do so-would be to write to the Committee drawing its attention to this evidence. You have publicly drawn the Senate's attention to it . Any remarks arising out of it would be very relevant in the debate which will follow the Committee's report. However, they are not relevant at this moment. Senator WALTERS —Mr Deputy President, that clarifies the matter considerably because, as far as I was aware, it was indicated that public evidence to the Committee would not be permissible, that only legal evidence would be permitted. If that is the case, and I am entitled to approach the Committee, it throws a totally different light on the matter and I will take your advice. However, I do need clarification. The DEPUTY PRESIDENT —I think I must limit the advice I am giving you, Senator Walters. What evidence the Committee receives is in the hands of the Committee and its Chairman. I am merely saying that you are perfectly entitled to write to the Committee drawing its attention to the existence of this document. What action the Committee then takes will be up to the Committee. Senator WALTERS —Mr Deputy President, as I understand it, you have ruled me out of order for debating or even referring to the report that is available. The DEPUTY PRESIDENT —No, Senator Walters, I said that you were in order in referring to the existence of the report but not to its content. You have referred to the existence of the report. I think that is all that is appropriate at the moment. To discuss the content of the report would be pre-empting the discussions in the Committee and the debate we will have when the Committee has reported. Senator WALTERS —Thank you very much, Mr Deputy President. The Senate is now aware that a report exists-despite honourable senators opposite-and I think honourable senators would do well to read it. I think they would be surprised. To give Senator Tate his due, I believe that he would be appalled at what comes out of that report. As a member of the Standing Committee on Regulations and Ordinances, I suggest that he does read it. I will send a copy of the report to the Committee. But obviously, from what the Attorney-General, Senator Gareth Evans, has already indicated, he will not allow it to come before the Committee. Senator Tate —I am not going to be intimidated by the Attorney-General. Senator WALTERS —The Committee is master of its own destiny. Senator Tate assures this chamber that he will not be intimidated by the Attorney-General, and quite frankly, I believe that he is speaking the truth. I have seen Senator Tate in action on the Regulations and Ordinances Committee and he will not be intimidated by anyone on it. I note that the Government objects very strongly to this reference going to any committee at all. I wonder why. I wonder why it is so concerned about the information that may come out of a committee looking, no matter how narrowly, into this matter, looking into the legal side of whether the regulations and the ordinance brought down by the Attorney-General: restrict . . . the Commonwealth's existing powers to require videos not imported for public exhibition . . . or restrict unduly the power of the Commonwealth to protect children from exposure to publications . . . That is, publications of explicit pornography. Let us not forget that, in a departmental memorandum, the Attorney-General said that the barriers to pornography have been lifted. He then made his couple of exceptions. His departmental memorandum states: Barriers to the importation of hard-core pornography-other than child pornography, publications which incite terrorism and publications containing extreme violence and/or sexual violence-have been lifted. I have great pleasure in supporting the view that this reference should go to a committee. I am very disappointed that I am unable to go further in bringing the attention of the Senate to this very up-to-date report. Indeed, Part II of the report was made available only in March this year. Part III is yet to come and is due this month, May 1984. I hope that Part III will be available before the Regulations and Ordinances Committee comes down with any decision on this matter . While the reading of this report is not a legal interpretation, I ask members of that Committee to read the report in full because I believe that there is a lot in it about which they should give some sort of opinion. Senator GARETH EVANS(Victoria-Attorney-General)(3.38) —I have already explained in the previous procedural debate why the Government resists this motion. I will not repeat now anything I said. I will add only that Senator Walters's contribution to this debate has demonstrated the manifest absurdity of the position that is sought to be maintained by both the Leader of the Opposition ( Senator Chaney) and the Deputy Leader of the Opposition (Senator Durack), namely that the reference being conveyed to the Standing Committee on Regulations and Ordinances is wholly narrow, wholly technical in scope, and concerned purely with legal issues which can be resolved quickly and narrowly and by a short report. It is obvious from the nature of Senator Walters's contribution that she certainly does not take that view of the terms of reference given to the Committee. Indeed, even with the deletion of the word 'unduly' it is almost impossible to so read them. Certainly, the pressures upon the Committee will be such as to make its job very difficult indeed and will make its position really quite intolerable by reference to the traditional way in which that Committee has operated. I do not want to debate at this stage, obviously, the report to which Senator Walters has referred. But lest anyone should get too excited about this document , let me put on the record, in one sentence, the advice that people should be very careful indeed about it. Information available to me through my Department is that both the Roman Catholic and Methodist representatives on the sponsoring committee have withdrawn as a result of an accusation that has now been made by the Oxford Polytechnic's television research unit that the director of this inquiry, Dr Clifford Hill, has misused its data. The report is extremely controversial, not only as to its subject matter but also as to its methodology and its credibility. It was commissioned by a group of British members of parliament and peers. It has been the subject of a great deal of such controversy. I understand that the Catholic Church in the United Kingdom is now sponsoring a new survey by the Oxford group. Senator Walters would be very wise to get her act together and to find out just a little more about this document, on board which she has been so quick to leap, before ramming it down our long- suffering throats when we do get to the appropriate opportunity to debate these matters substantively, which will be when the debate on the disallowance motions is called on, that is, on 29 May or 30 May. Senator HARRADINE(Tasmania)(3.41) —I support the reference. I do so with a feeling that this is about the third fall-back position that I have. The Senate will appreciate that I have on the Notice Paper a notice of motion, which is now No. 53, referring certain regulations to the Senate Standing Committee on Constitutional and Legal Affairs for investigation as to whether the regulations remove from existing Commonwealth law the power to prevent the importantation of hard-core pornography and publications which consistently incite the use of hard drugs, et cetera. I do not want to delay the Senate long on this matter, so I shall be very brief. However, my desire was to ensure the fullest possible parliamentary and public debate on this issue, which is a most sensitive and important issue to the people of Australia. Unfortunately, because the Government does not want to see that full parliamentary and public contribution to this important matter, we shall not have such a public opportunity, in the shape of that Standing Committee, and so we fall back to this situation. I must admit that I was somewhat concerned about the fact that the long- standing traditions of the Senate Standing Committee on Regulations and Ordinances may in some way be compromised by a reference of this nature. I agree with the deletion of the word 'unduly' and I think that, with the inclusion of that word in the proposal, it may well have been construed that the Regulations and Ordinances Committee was being asked by the Senate to make a decision as to policy questions. But as it now stands, it is de-gutted of any such suggestions. That is not to say that the Regulations an Ordinances Committee, as expanded, cannot consider the issues and, having considered them, then go to the question of whether they offend in some way the principles which have governed the operation of that Committee over the many years, as the Attorney-General ( Senator Gareth Evans) has said, since 1932. Suffice it to say that those are clearly set out in publications of the Committee. They are set out in the seventy-first report, on the fiftieth anniversary of the Committee, in March 1982. They are as follows: The Committee scrutinises delegated legislation to ensure: (a) that it is in accordance with the statute; (b) that it does not trespass unduly on personal rights and liberties- that is a matter which the Committee would need to consider in the light of everything that has come forward- (c) that it does not unduly make the rights and liberties of citizens dependent upon administrative decisions which are not subject to review of their merits by judicial or other independent tribunal; and (d) that it does not contain matter more appropriate for Parliamentary enactment. The very first report of the Senate Standing Committee on Regulations and Ordinances, the very Committee to which we are sending this reference, was on a reference concerning the very issue about which we are now talking-the question of censorship of cinematograph films. Over 50 years ago it was the view of the Committee at that stage, and a resolution was thus recommended to the Senate, as follows: That in the opinion of this Senate the time has arrived when public policy in regard to the censorship of imported cinematograph films should be set out in substantive legislation. That was the Committee's decision at that stage. What the Deputy Leader of the Opposition, Senator Durack, is proposing now is nothing more nor less than to ensure that the principles that guide the consideration of the Regulations and Ordinances Committee are applied to the facts that will be before that Committee . It is important to make that point. I know that the Committee has already met and formally considered these matters. But that occurred before any of the debate took place in this chamber. I simply suggest that it is entirely correct for the Regulations and Ordinances Committee, having regard to the accumulated information that it will now have, to give consideration to the question whether the regulations and the ordinance restrict the Commonwealth's existing power to prevent the importation and publication of publications, including videotapes, promoting or encouraging violence, promoting or encouraging the use of hard drugs, and depicting hard-core pornography, sexual violence or other gross obscenities. It is entirely proper for the Regulations and Ordinances Committee to do that. I wish that it could have been done in a manner in which we could have had more public input, and that there were more time to do it. The time factor is a matter that no doubt will be addressed by Senator Coates. We are being put in a jam over the time because of the Government. There is no other reason. The Government can release the pressure on the Regulations and Ordinances Committee by two acts. One would be to repeal the existing ordinance and the existing regulations that have been put before us and to bring down a composite amendment , if the Government wants to do it in its own way, to the Customs (Prohibited Imports) Regulations, the Customs (Cinematograph Films) Regulations and the Australian Capital Territory (Classification of Publications) Ordinance. It could do that, and that would allow another 15 days to tick away, which would enable the Senate to give proper consideration to these issues. As we are now placed, we have only one sitting day left to deal with these regulations and the ordinance. Between now and then the Attorney-General-he has made this clear-is going to dribble in further amendments to these regulations and this Ordinance. I put it to the Senate: Is it fair to ask the Senate to consider these issues in that totally unsatisfactory manner? I suggest that that is not fair. If the Government had regard to the need for proper consideration of these matters, it could repeal those regulations now and come back with a complete, compact set so that we know where we are, instead of dribbling in amendments here and there and doing us out of our rights as to time. I do not wish to canvass the issues and it is not appropriate for me to do so here and now, but I believe, in short, that this reference is entirely consistent with the honourable traditions of the Regulations and Ordinances Committee. I believe also that that Committee, as expanded, will be able to address the most important issues involved and hopefully come up with some recommendation which will meet the approval of the Senate as a whole as to the procedures that we ought to follow so as to ensure a proper and full parliamentary and public debate of them. Senator COATES(Tasmania)(3.52) —These regulations and this Ordinance have already been examined by the Standing Committee on Regulations and Ordinances without any comment from the legal adviser or from any member of the Committee, including Senator Durack; that is, they were dealt with as in no way contravening the principles of the Committee and in no way needing the Committee to write to a Minister, to report to the Senate or to take any such action. So I do not see any point in referring back to the Committee matters which have already been dealt with. As has been mentioned already in this debate, the Committee's principles do not include examining policy questions involved in any regulations or ordinances. As was read out by Senator Harradine, the Committee determines whether matters are in accordance with the statute and deals with other such technical and legal matters, including principle (d) which sets out that the Committee shall examine delegated legislation to see whether it is more appropriate for parliamentary enactment. What is being put to us here as a reference to the Committee is a policy question disguised as a request for regulation and ordinance-type consideration. Senator Harradine wants this matter to be dealt with by the Standing Committee on Constitutional and Legal Affairs. He wants it to be dealt with as a substantive matter, as obviously does Senator Walters. Neither of them really wants this narrow legal examination which, as I said, has already been done anyway. Of course, it is said that the Constitutional and Legal Affairs Committee, because of its other references, has not the time to deal with it and that, therefore, it is inappropriate to proceed with a reference to that Committee. So what do they do? They try to refer it instead to the Regulations and Ordinances Committee in a completely innovative way which is without precedent. Far be it from me to take the conservative position of defending the traditions of a Senate committee, but it is strange that we on this side of the Senate are put in this position and that it is those from the conservative parties opposite who want to tear up the traditions of the Regulations and Ordinances Committee which have worked so well. Senator Tate —It was the same in 1975. Senator COATES —As in 1975, as Senator Tate interjects. It is not so much that they are traditions, but the procedures of the Committee have worked well until now. I do not mind there being a review of the activities of the Regulations and Ordinances Committee to see whether it ought to change its role-I would be happy to look at that-but that change of role ought to be done in a proper way and not by way of a political matter in respect of which division and heat are being generated by those opposite. I suggest that this motion to refer, if carried, will set an inappropriate precedent and would distort the whole role of the Regulations and Ordinances Committee. Paragraph (3) of the motion uses the words of one of the Committee's principles which, I might say, are not the principles of just the Committee. They have also been adopted by the Senate as the principles of its Committee. They are not something the Committee can suddenly change without referral back to the Senate. I point out that the suggestion in paragraph (3) as to whether or not the regulations or the Ordinance contain matter more appropriate for parliamentary enactment is really stretching principle (d) much further than anyone could really accept. I cannot believe that the Opposition members of the Committee really support this change in the activities of the Regulations and Ordinances Committee, especially Senator Durack who, as Attorney-General, himself advised the Committee of his opinion of its limited role in very much the same terms as Senator Gareth Evans, the present Attorney-General, has done. Senator Durack, because of pressure from the likes of Senator Walters in his party, is doing a complete turnaround in his attitude to the role of the Regulations and Ordinances Committee when he ought to be defending it. I turn briefly to paragraph (2) of the motion which talks in clauses (a), (b) and (c) about restricting the existing powers of the Commonwealth to protect children. How can regulations or ordinances restrict power, for heaven's sake? Either the mover of the motion did not mean to use these words or it was done in too much of a hurry, but I am not at all certain how the Committee will be able to deal with it. I certainly do not think that Senator Mason when he spoke earlier indicated that he understood the role of the Committee or how it should operate. He talked about how people should be heard. As I understand the Committee's Standing Orders, we will not be able to hear anybody. It is suggested to us that we have a narrow legal look at the question. If that is so, why are we adding Senator Harradine to the Committee? If the Committee is to operate in this normal and traditional way, why are we adding to the Committee a new member who is at the centre of the storm over the content of these regulations and this Ordinance and not looking at the technical and legal question of whether or not they were correctly drawn or correctly introduced? I think the wording of the motion and particularly the proposed addition of Senator Harradine to the Committee really show up the intent of those who, as Senator Harradine said, are taking a last resort to try to get a committee, any committee of the Senate, to look at this matter. Senator Walters has asked members of the Committee to read a report from the United Kingdom of a parliamentary inquiry into video violence and children. I will read that report, but I will not be reading it as a member of the Regulations and Ordinances Committee; I will be reading it as an interested member of the Senate, as far as the general question of video material is concerned. The timing of the matter is another worry I have. It is proposed in the motion that there will be two additional members, one to be nominated by the Leader of the Government in the Senate (Senator Button) and the other to be nominated by the Independent senator. The member of the Committee to be nominated by the Independent senator is, I presume, very easy. He has to consult only himself and if he does not appoint himself I would be very surprised. However, the appointment of an additional member by the Government will require a meeting of the Government Party to determine who our nominee should be. The next meeting of Caucus will not be until 29 May. We will then be in a situation where we will have about one hour, between the Caucus meeting and the resumption of the Senate, when the Regulations and Ordinances Committee can meet. Of course , we cannot meet while the Senate is sitting. I know Senator Harradine would not agree to that, even if there were such a proposal. Senator Harradine —Are you saying that you will thwart the Senate's decision? Senator COATES —I am pointing to some of the anomalies and problems with the motion as it is drafted. It is calling for additional members, one to be nominated by the Leader of the Government in the Senate. That nomination has to be determined by the Caucus. I am appalled that the Opposition is proposing this reference to the Regulations and Ordinances Committee, to change its role in such a dramatic way over this issue. The principles and activity of the Committee have been very constant over the 52 years of its existence. They exclude any consideration of policy matters. That practice has been adopted for most of the years of the Committee's existence and has been accepted by everyone concerned as one of the chief reasons for the Committee's extraordinary success. Apparently the Australian Democrats will support this motion. I wish that some of their number could have been here to hear my comments calling on them not to support it. Apparently their minds are made up about the matter. I think it will be very disappointing if this reference goes ahead, and I urge the Senate to oppose it. Senator DURACK(Western Australia)(4.03) —in reply-In closing the debate I will deal briefly with one or two matters raised by Senator Coates. He complained that this reference would give a new direction to the Senate Standing Committee on Regulations and Ordinances. I pointed out in my speech in support of this motion that it is only a very small extension and would not affect the principle under which the Regulations and Ordinances Committee operates, that is, that it does not provide policy advice or recommendations to the Senate but deals within the charter of advising the Senate as to the effect of certain regulations and ordinances. I do not see why we should freeze in concrete any committee of the Senate because it has acted in a certain way for 50 years. That seems to be the worst of all reasons for saying that it should continue to act in that way. All the comments we hear from the Attorney-General (Senator Gareth Evans) about the need for change, mostly for its own sake, sit very strangely with this highly conservative attitude to the role of a Senate committee. I certainly believe that the Regulations and Ordinances Committee is not appropriately structured, in either the way it operates or the way it meets, for major investigations and recommendations about policy matters. This recommendation has nothing of that sort in it. The other quite absurd argument that Senator Coates has advanced is that the Committee has already dealt with these regulations and ordinances, it has reported to the Senate, and there is nothing that breaches its charter. Nobody has suggested there is anything in them that needs further investigation within its existing charter. This is a new reference to the Committee asking it to do a different job within a very limited framework. It is a job which its own legal adviser can well and easily do and which the Committee can well and easily consider and make recommendations to the Senate. There is really no substance whatever in Senator Coates's objections. I hope that the Senate will give speedy support to this motion. Question put: That the motion (Senator Durack's) be agreed to. The Senate divided. (The President-Senator the Hon. Douglas McClelland) Ayes . . . . . . . . . . . 30 Noes . . . . . . . . . . . 26 —— Majority . . . . . . . . . 4 —— Archer, B. R. Jessop, D. S. Baume, Peter Kilgariff, B. F. (Teller)Boswell, R. L. D. Lajovic, M. E. Carrick, Sir John MacGibbon, D. J. Chaney, F. M. Mason, C. V. J. Chipp, D. L. Messner, A. J. Collard, S. J. Missen, A. J. Crichton-Browne, N. A. Rae, PeterDurack, P. D. Reid, M. E. Evans, Jack Scott, D. B. Guilfoyle, Dame Margaret Teague, B. C. Haines, J. Townley, M. Hamer, D. J. Walters, M. S. Harradine, B. Watson, J. O. W. Hill, R. Withers, R. G. Bolkus, N. Jones, G. N. Childs, B. K. McClelland, DouglasCoates, J. Maguire, G. R. Coleman, R. N. Primmer, C. G. Colston, M. A. Ray, RobertCook, P. F. S. Reynolds, M. Crowley, R. A. Richardson, G. F. Elstob, R. C. Robertson, E. A. (Teller)Evans, Gareth Ryan, S. M. Georges, G. Sibraa, K. W. Gietzelt, A. T. Tate, M. C. Giles, P. J. Walsh, P. A. Hearn, J. M. Zakharov, A. O. Bjelke-Petersen, F. I. Button, J. N. Martin, K. J. Foreman, D. J. Lewis, A. W. R. Grimes, D. J. Macklin, M. J. McIntosh, G. D. Question so resolved in the affirmative. Debate resumed from 5 April, on motion by Senator Peter Rae: That the Senate take note of the papers. Senator BOSWELL(Queensland)(4.12) —I rise to make a few remarks on the question of surveillance. There is no doubt in my mind that the Government has downgraded surveillance, particularly in the area of the Great Barrier Reef. Surveillance has been downgraded from 1,400 hours to 1,200 hours. The radar used for the surveillance has been downgraded. I have asked a number of questions of the Minister for Veterans' Affairs (Senator Gietzelt) as Minister representing the Minister for Transport and I have asked questions in Estimates Committee E on this matter. It appeared to me that no one in the Government knew why the downgrading had taken place. I must have asked 12 or 14 questions. Departmental officers replied that it was a matter for the Department of Transport because it was responsible for charter arrangements and had made the charter arrangements previously. It might have made the charter arrangements previously but this matter has been transferred to the Department of the Special Minister of State. A number of questions need to be answered in this area. Firstly, why was the contract taken away from AireSearch Pty Ltd and awarded to Skywest Airlines Pty Ltd-a Western Australian company-without any tenders being called and with no specifications being given? It is a disgrace that a contract can be summarily taken away from one company and given to another with no tenders being called. To my knowledge-and as far as I can ascertain from all other sources of knowledge-the radar that Skywest has installed is inferior to the 360 degree radar in the Nomad Searchmaster plane. The radar is ineffective for a number of reasons. The radar that the AireSearch plane is presently using has a 360 degree scan target, with a range of 140 miles. It can give the exact position of contact, range and bearing by digital readout. It can track multiple targets without heading variations. It has a 1,000 kilowatt power effect, roll stabilisation, tracking skills and possible angles of 45 degree bank. It is approved for night time search. An independent source estimates that the Skymaster search radar with 360 degree range costs $6,060 per 2,700 square miles whereas the side looking aerial radar costs $6425 per 2,700 square miles. The radar that has been lost through the contract being taken away from AireSearch was capable of searching at night. The plane was capable of flying at night. It had an arrest record of, I think, 14 Taiwanese clam boats. It had a wonderful record of search and rescue. I can obtain no reason from the Minister, from the Estimates Committee or even Senator Gietzelt why this contract was taken away. As I said before, I believe this Government has a lot to answer for on this subject. I notice that my time is running out. I hope that the Minister opposite , Senator Gietzelt, can lay some light on this subject. People in Queensland, such as those in the professional fishing industry, are terribly worried. I ask the Government to put the same effort into the Great Barrier Reef as it did into the South West Tasmanian wilderness. Question resolved in the affirmative. Debate resumed from 7 May, on motion by Senator Sibraa: That the Senate take note of the paper. Senator CROWLEY(South Australia)(4.18) —I spoke to the response by the Minister for Foreign Affairs (Mr Hayden) to the Joint Committee on Foreign Affairs and Defence report the other day. I am happy to take the opportunity to continue my remarks, both in response to his report and to continue my remarks about an organisation called APHEDA-Australian People for Health Education and Development Abroad. I wanted to raise the subject of this organisation for two reasons: Firstly, because at the moment it is addressing assistance to Eritrea and secondly, because its aims and objectives are in line with the outline of Government aims and objectives mentioned by Mr Hayden in his comment on the Commonwealth report. The APHEDA organisation has been established to provide the people of Australia, through the trade union movement, with an organisation to assist directly developing countries on a people to people basis. It is fully supported by the Australian Council of Trade Unions and it is the only trade union based non-government overseas aid organisation in Australia. It has been established particularly to represent the expression of concern that the Australian working people have for the health, welfare and development of people in the world community. One of the principal concerns of that organisation has been to look at the health of people in refugee situations in Third World countries. I do not need to draw the Senate's attention to the awful poverty, both physical poverty and psychological poverty, of the people in refugee places around the world and people in Third World countries. Not all of them are in the same position. There are very different degrees of poverty and sometimes countries are affected by such things as disasters, earthquakes and famine. In fact, we can see the effect of famine biting deeply into parts of Africa at the moment and the enormous suffering of people there. In most of those places the water supply and sanitation are poor. Some of the basic things that we have in this country, such as the ordinary, every-day immunisation of the majority of the people against diseases, are not available to the majority of people in those developing countries. Because this report refers to the Horn of Africa, I will comment on one of the factors that was causing great concern to this organisation, that is, the fact that infant deaths in Eritrea are as high as 300 for every 1,000 deaths and that , even more shockingly, one in every three women dies in childbirth. I do not know of a maternal mortality as high as that in any other place in the world. We are shocked in Australia at any death that can be prevented of any baby and maternal mortality in this country is very rare. In Eritrea one woman in three dies in childbirth. That largly is a consequence of poverty, malnutrition, disease and near starvation. All of these things are fairly preventable. I think the way some unevenness of distribution allows that to happen is a terrible indictment of our world. One of the earliest projects of APHEDA was to provide assistance to teacher training for health education workers in Eritrea so that in fact the people will be helping themselves. It is a health worker training project. That person will be working with the people of Eritrea to try to increase the basic requirements for health in that area. The focus of the APHEDA organisation is on leaving people self-reliant in health care. It is also, importantly, on giving people human skills, if I can put it like that; that is, instead of building large and expensive hospitals at this stage of the country's development we will be looking at the barefoot doctor concept far more. So the emphasis will be on giving people basic skills, basic teacher training and health education training so that they can maximise the health of people in that area for a minimal dollar cost. I am very pleased to be on the board of directors of the APHEDA organisation and working very closely witht the ACTU in this first trade union project with non-government organisations for assistance to people around the world-in particular at the moment through its project in Eritrea. Question resolved in the affirmative. Consideration resumed from 9 May, on motion by Senator Kilgariff: That the Senate take note of the papers. Question resolved in the affirmative. Senator PETER RAE(Tasmania) —I seek leave to make a very brief statement in relation to the first matter discussed this afternoon, the report on the review of Australia's coastal surveillance and protection. It will be a very brief statement. Leave granted. Senator PETER RAE —I thought of moving a supplementary motion to the motion that the Senate take note of the paper but then preferred to take the course that I now propose, which is simply to make the request that the Minister for Veterans' Affairs (Senator Gietzelt) arrange for the report of the debate on the report to be referred to the Minister for Transport (Mr Peter Morris) with a request that a reply be given to the Senate. Matters were raised which are of concern to a cross section of people in the chamber. I initially moved that the Senate take note of the paper, and I ask simply that the Minister consider giving an undertaking to make that arrangement. There being no other specific procedure under the Standing Orders for that arrangement to be undertaken, it seemed to be the simplest way was to seek leave and ask the Minister to do so. Senator GIETZELT(New South Wales-Minister for Veterans' Affairs) —by leave-I undertake to refer the matter to the Minister for Transport (Mr Peter Morris). Consideration resumed from 29 February, on motion by Senator Haines: That the Bill be now read a second time. Debate (on motion by Senator Kilgariff) adjourned. Consideration resumed from 9 May, on motion by Senator Jack Evans: That the Bill be now read a second time. Debate (on motion by Senator Robertson) adjourned. Senator KILGARIFF(Northern Territory)(4.27) —I move: (1) That a select committee, to be known as the Select Committee on Volatile Substance Fumes, be appointed to inquire into and report upon the voluntary inhalation of volatile substance fumes, with particular reference to the health and social consequences of the availability of such substances to the community, particularly, (a) to persons who have not attained the aged of 18 years; and (b) where the practice of petrol sniffing has become endemic. (2) That the Committee consist of six Senators, as follows- (a) three to be nominated by the Leader of the Government in the Senate; (b) two to be nominated by the Leader of the Opposition in the Senate; and (c) one to be nominated by the Leader of the Australian Democrats. (3) That the Committee proceed to the despatch of business notwithstanding that all members have not been duly nominated and appointed and notwithstanding any vacancy. (4) That the Chairman of the Committee be appointed by and from the members of the Committee. (5) That the Chairman of the Committee may, from time to time, appoint another member of the Committee to be the Deputy-Chairman of the Committee, and that the member so appointed act as Chairman of the Committee at any time when there is no Chairman or the Chairman is not present at a meeting of the Committee. (6) That, in the event of an equality of voting, the Chairman, or the Deputy- Chairman when acting as Chairman, have a casting vote. (7) That the quorum of the Committee shall be three members. (8) That the Committee and any sub-committee have power to send for and examine persons, papers and records, to move from place to place, to sit in public or in private, notwithstanding any prorogation of the Parliament or dissolution of the House of Representatives, and have leave to report from time to time its proceedings and the evidence taken and such interim recommendations it may deem fit. (9) That the Committee have power to appoint sub-committees consisting of three or more of its members, and to refer to any such sub-committee any of the matters which the Committee is empowered to consider, and that the quorum of a sub-committee be a majority of the Senators appointed to the sub-committee. (10) That the Committee be provided with all necessary staff, facilities and resources and be empowered to appoint persons with specialist knowledge for the purposes of the Committee with the approval of the President. (11) That the Committee be empowered to print from day to day such papers and evidence as may be ordered by it, and a daily Hansard be published of such proceedings as take place in public. (12) That the Committee report to the Senate by 5 June 1984. (13) That, if the Senate be not sitting when the Committee has completed its report, the Committee may send its report to the President of the Senate or, if the President is not available, to the Deputy-President, who is authorised to give directions for its printing and circulation and, in such event, the President or Deputy-President shall lay the report upon the Table at the next sitting of the Senate. (14) That the foregoing provisions of this Resolution, so far as they are inconsistent with the Standing Orders, have effect notwithstanding anything contained in the Standing Orders. Honourable senators will remember that on 6 October last year I spoke on this subject. Since then there have been quite a few speeches and questions on the same matter. In moving the motion in the Senate today I am looking for the support of the Senate because the subject of this inquiry is a most serious matter that affects many communities in Australia. The results of surveys carried out, for instance, in New South Wales show that 60 per cent of year 9 students have experimented with sniffing. Children as young as eight years old have been encouraged to sniff. It has also been shown that sniffing is carried out by children from all social classes, in all types of communities in cities and rural areas. There are two aspects to this problem. Perhaps they could be divided in this way: First, what is happening among the young people in the cities and schools in the Australian community; and, secondly, petrol sniffing which is more apparent in the Aboriginal communities particularly in the Northern Territory although it is quite likely to occur as much in southern Australia as well. Let me deal first with petrol sniffing in Aboriginal communities. This is not a new problem. In fact, I think this practice probably commenced during World War II when troops based along the northern coast used to sniff petrol just to get a kick out of it. This practice has continued and has been picked up particularly by the Aboriginal children. A study was undertaken by Dr Don Eastwell of the Royal Brisbane Hospital in 1979. He looked at two communities in east Arnhem Land. In both communities more than half of the boys aged between nine and 14 and a quarter of the girls in the same age group were regular sniffers. It has been suggested that, in the last five years, this figure has risen. The consequences of sniffing have become very grim. There have been a number of deaths in the last few years. I understand that there is a Press report indicating that another teenager died within the last week. This happened in Brisbane only last Friday. Some of the side-effects of sniffing are: Vocal chords and lungs frozen by gas in aerosols; paralysis after habitual sniffing; brain damage; suffocation after inhaling vomit while high; irreversible damage to kidneys, liver and heart; and sores in the throat and nose. When one looks at the young children aged between seven and 12 in some of the Aboriginal communities it is quite apparent that considerable brain damage has occurred. It is a most unfortunate and sad thing to see petrol sniffing in the settlements. There, because it is strange to the Aboriginal people, they are not able to counter it. They do not know what action to take. It is something that is outside their culture, perhaps like drinking. Petrol sniffing has spread through the Aboriginal community. Because parents cannot cope with the situation on many occasions one finds children living on the side of the village, perhaps in the bush in a group, without any cares whatsoever. The staff on some of these settlements are obviously endeavouring to do something about it. Many Europeans have put in years of effort to try to overcome the problem, but to no avail. Recently an ingredient was added to petrol. It was of such nature that if a person sniffed petrol it would make that person sick. In one settlement already they have found the means to take that ingredient out of the petrol. It is not my intention to say in the Senate how it was done. Dr Eastwell, in his study about which I have been talking, found that there were also social and educational drawbacks. The word 'sniffers' conjures up a rather humorous situation. Perhaps sniffing is not really the expression that should be used. But we should not look upon it as something that is humorous. Sniffing in the schools today is deadly. Dr Eastwell found that children are less competent in their verbal performance, less well organised, less able to follow directions and less able to concentrate. They are often hyperactive, subject to trembling, badly co-ordinated in walking, standing and speech, and have a lack of emotion and initiative. Some steps have to be taken to lower the incidence of petrol and glue sniffing. I have indicated that additives have been used in petrol and other commercial products. I wish now to go off on a tangent and talk about various commercial products. I have with me a cylinder of glue which I think comes from Taiwan. Honourable senators will be able to see that this is a very attractive cylinder for glue to be put in. It has a picture of ships and a picture of a little girl walking with her dog in the garden. But this is glue. When one takes off the cap of this glue and has a sniff of it one finds that it has a most attractive aroma, like a raspberry drink. It is most attractive. One could imagine that children would want always to carry this around if they could get their hands on it. But this is glue; it is not a raspberry or strawberry drink. This glue has been brought into Australia from, I think, Taiwan. It is accessible to children in Australia to the horror of those people who find it in the shops. This glue has been sent to me. I have with me another peculiar thing, although I wonder whether it is peculiar , called a puffy smelly sticker which comes from Japan. On it are the words: ' Just scratch and sniff'. I hold it up for honourable senators to see. It is a very attractive thing. It is made up of a lot of little stickers in a sealed square. When one tears the cover off and scratches and sniffs it, this one has a pineapple smell. These stickers are given as prizes within the community. This has taught children in schools and kindergartens what sniffing is all about. I can tell honourable senators that, without a word of a lie, this has been and is responsible for encouraging young people to sniff. They go from this to other things such as glue, aerosols and those other substances which I have indicated to honourable senators might be detrimental to their health and perhaps causing their death. A few months ago, I said that I was going to go ahead with this matter. I sought opinions on it. I was told then that it was only a matter of education. This situation is much more serious than one where we can just say: 'We will have education. We will tell the children that they must not sniff, that it is dangerous to sniff'. Sniffing is practised throughout the Australian community and throughout the schools in the same way as drugs are taken by the young people of Australia. This has not always been apparent. A few weeks ago it became more obvious despite the fact that there is legislation. Before I say a little about the legislation that has been enacted in Scotland and England I wish to take honourable senators back to events early this week. The Courier- Mail dated 7 May 1984 carried the headline: 'Parents mourn the girl who loved to dance'. The newspaper article stated: But last Friday, Leza, 13, was found dead in her bedroom after apparently inhaling toxic fumes . . . I am sure that all honourable senators saw the Sunday Telegraph dated 6 May which carried the headline: 'Shock Government school study. One in two try lethal sniffing'. I do not think I need to read the article. Honourable senators have probably read it. If they have not; I suggest that they do. In the Sunday Telegraph of 6 May the main theme was sniffing. One article was headed: 'The Facts. Laws and Restrictions.' Another was headed: 'Sniffing: Your kids could be next victims'. Several pages contained articles on this topic. The opinion column in that newspaper was headed: 'Time to rescue the sniffer kids'. It stated: It's known as 'sniffing'-an innocent enough description. But it represents one of the more disturbing problems facing the youth of our nation. The result of a study among 4,000 NSW school children to be released next week suggests that up to six out of 10 Year 9 students have dabbled with sniffing. Youngsters of only eight years have indulged in the dangerous practice. Several young people have died; others have suffered irreparable liver, kidney and heart damage. Only the most uncaring of parents will fail to be horrified by this revelation. Only the most uncaring of politicians could fail to react to it. What makes 'sniffing' more frightening than other forms of thrill-seeking, such as drug abuse, is its insidiousness, the ease of availability of the products, the almost total absence of laws to combat it. So the editorial goes on. Once again, I refer it to members of the Senate. No doubt honourable senators have heard of a very brave woman. We are hearing more of her these days. She is Jan Oswald. She has started an organisation known as SOS-Stamp Out Sniffers. She has been heard in so many places. She is a devoted young mother, a housewife. She spoke at the National Press Club in Canberra a few weeks ago. She has been on various wireless stations, television and elsewhere. She has devoted her life to endeavouring to get the Australian community to realise the significance of this problem. She is a dedicated person . She has her own story. She is doing this work in memory of her son who, to his family, was very dear. He died from sniffing. Since then Jan Oswald has devoted herself to bringing to the attention of Australians this dangerous habit that is invading the country. It is a pity, when one speaks on a topic such as this, that the debate is not televised so that I could show viewers the tube of glue. Perhaps viewers would like to have been able to see a photograph of what a petrol sniffer looks like. It is my hope that the photograph I have in my hand can be reproduced in the newspapers. People could look deep into the eyes of the young Aboriginal person, at his expression and at the beer can that is tied with a bit of wire around his neck. That is the manner in which such children live. They carry around their necks by wire a can out of which they continually sniff petrol. The photograph is horrifying when one looks into the eyes of that child. One hundred and one statements and articles have been published regarding this situation. Having shown honourable senators that photograph I now come back to Aboriginal children. An article in the Australian of 8 October 1981 was headed: 'Fuel sniffing takes grim toll among Aborigines'. An article in the Northern Territory News of 21 January 1982 was headed: 'Maningrida Petrol Shock. Horror report details sniffing habit'. It talks about emaciated children roaming the streets of Maningrida in large numbers-victims of the spreading petrol sniffing habit. I was pleased to see that on Monday Senator Robertson, the Government Whip in the Senate, asked a question of the Government about the habit of sniffing. The answer that Senator Grimes gave indicated that the Government is concerned about this situation. He indicated considerable concern. I will not talk at length on this matter because I could talk for hours. I could talk about schools and the practices of our teenagers. I could talk about the high percentage of children amongst whom this habit, which brings about paralysis and death, is growing. I think there is sufficient evidence to show the Senate for honourable senators not to brush off the matter. It is not an easy thing to be cured by education or legislation. There is legislation in Australia, Scotland and England endeavouring to stop this practice but it has not been particularly successful. An article in the Courier Mail was headed: 'Glue sniffing: children may be taken from parents'. That is another way in which the problem has been tackled. The article states: Queensland children caught sniffing glue will be liable to be taken from their parents under new laws proposed by the Bjelke-Petersen Government, despite advice to the contrary in a confidential children's services departmental report to the Cabinet. Another article, if anybody is interested in it, is headed: 'Getting stuck into sniffers'. Another article in Queensland is headed, 'Tougher line on ''sniffers' ' ' and an article headed, 'State gets tough with glue sniffers', refers to the Victorian Government. These reports were all published in 1981. The English legislation goes back to 1981. The point I am making is that while genuine attempts have been made by the States and in other countries to overcome this problem it has not been overcome. It is growing and getting more serious. The number of deaths has not been very high among hundreds of thousands of children. Only 30, 40, or 50 children have actually died through sniffing. But very many children are in the balance. The time has come for the Senate to take an interest. When I raised the question a little while ago it was said that the Senate has a very heavy work load, and so it has. I believe that the work load in the Senate is becoming heavier. Obviously, the Senate's committee work load is becoming heavier, and day by day references are sent to committees. The Senate has a responsibility to the community and to these children. Let us consider the present situation of the Senate select committees-not the standing and other committees but the select committees that have been formed for a particular purpose. At the moment they are the Select Committee on Animal Welfare, the Select Committee on the Conduct of a Judge, the Select Committee on Private Hospitals and Nursing Homes, and the Select Committee on Statutory Authority Financing. We know that the Animal Welfare Committee has just been formed and I would expect the life of that Committee to be quite long. My understanding with regard to the Conduct of a Judge Committee is that it is to complete its inquiry by 31 May 1984, that is, at the end of this month. The Select Committee on Private Hospitals and Nursing Homes was formed a year ago and I understand that its work is nearly finished. The Select Committee on Statutory Authority Financing was formed in April 1983, and I have been advised by the Clerk today that it has nearly finished its work. So the time is ripe to form a new Senate select committee because all the other committees, with one exception, have practically completed their inquiries. Now is the time to form such a committee and enable it to commence its work as quickly as possible. There have been many petitions, particularly those organised by Jan Oswald, of the Stamp Out Sniffers association. I ask the Senate this afternoon to support my motion, the motion that has been put forward in the name of Jan Oswald and, without being dramatic, I ask it to support the idea behind it. She wants to ensure that no other child dies in the way her son died. I commend the motion to the Senate. Senator ROBERTSON(Northern Territory)(4.53) —I support the proposition moved by Senator Kilgariff, my colleague from the Northern Territory. In doing so, I commend him for the amount of work he has put into the preparation of the motion and its supporting material. In the Northern Territory we have discussed this matter at great length because it is of particular concern to us. Petrol sniffing, glue sniffing and so on have been a problem for many years, and it is particularly bad in the Northern Territory. I have had personal experience of this, of seeing the effects on young people, over 20 years. Some honourable senators will know that I was associated with education before I entered this place. The effects of petrol sniffing, as it was in the early days, was one of the things which particularly worried us. Senator Kilgariff has graphically described the effect on young people of the habit of sniffing petrol or glue. It is now recognised, as was indicated earlier, that it is also a problem in the European communities. I will quote briefly from an article in the Canberra Times, drawing on the same material I used when I asked the Minister for Social Security (Senator Grimes), representing the Minister for Health, whether he could give us some assistance. The article in the Canberra Times of 7 May, referring to the report to the New South Wales Minister for Health, stated: The report examined the drug-taking habits of NSW school children. Use of alcohol, tobacco, analgesics, solvents and aerosols, marijuana, sedatives, hallucinogens, narcotics and stimulants was surveyed. Solvents and aerosols were included for the first time in a survey of NSW schoolchildren's drug-taking habits. The survey findings highlighted the need for more specific research into the use of solvents and aerosols by school students. Thirteen-year-old girls were most likely to be sniffing on a regular basis, with 13 per cent doing so. It was found that sniffers were most likely to be young, 13 to 14 years, that girls were more likely to sniff than boys, that levels of sniffing varied from school to school regardless to the social class area or system of the school. That article referred to the European community. In the Aboriginal community the problem, as I indicated earlier, has been recognised for many years. Aboriginal elders and councils have taken steps, and they have been supported in this by the Europeans whom they have invited to assist them. Parliamentary committees have identified the problem and have been of some help in giving advice about what might happen. The steps that have been taken to overcome petrol sniffing, particularly, have ranged from the physical locking away of the petrol drums and the physical locking of petrol tanks of cars, through to the more exotic use of skunk juice, as it was called, in the petrol so that the petrol smelt very bad. The long term effect of the skunk juice has yet to be identified. Certainly the physical matter of locking away the drums or locking the petrol caps did not work. The young people found ways of gaining access to the petrol. I have indicated that it is now a problem in the European communities. We would all agree-there would be no one in this chamber who would not agree-that it is a problem. But we must ask this question: Is a further study necessary? I have referred already to the fact that a report was conducted by a committee from the other place. It has been looked at over the years by a Senate committee as well. Is it really necessary for us to set up another committee to look at the problem? At the end of my contribution I will seek leave to continue my remarks because I hope there will be a wide debate on this matter. I hope that honourable senators on both sides of the chamber will look at whether we really need another study. I believe there are advantages in having another study. There are advantages in drawing together the experiences we have had to date, particularly in the Northern Territory, where most of the work has been done. There are advantages in looking at the later studies that have been done in this area. One part of the study that perhaps has not been looked at before, and one which justifies the setting up of another committee, is the reasons why children sniff and whether the reasons are the same in the Aboriginal community as they are in the European communities. I have a feeling that the use of sniffing is related to unemployment or, in the case of younger people, dissatisfaction with school, in the sense of the school not meeting the needs of the young people. There is no doubt, of course, that school acceptability, if I can use that word, whether the young people are happy with school, is related to a large degree to whether they think they will get a job at the end of their schooling; whether they are prepared to do the work necessary at school to obtain qualifications if at the end of their schooling they are not likely to get a job. We must also look at the relationship with the self-esteem of young people, and whether the young people who engage in petrol and glue sniffing have a low self-esteem. This must be related, of course, not only to their place in the community but also to their identity as individuals. It must be related also to the whole area of land tenure-what we have tended to call land rights-and the standard of living. The next question we must ask ourselves is this: If a committee is necessary, what sort of committee? Would we have a select committee or a standing committee ? Quite clearly, the motion which has been moved today by Senator Kilgariff refers to a select committee. When we have a further debate on this issue someone might be prepared to move an amendment that the number of committee members be limited to four rather than six, and that those four people should have a special interest in the field. I have a feeling that four people, working together with an adequate secretariat, could work as effectively as six people. I will certainly suggest to Government senators that this be put as an amendment . We know that the present Government has recognised the problems of alcoholism and sniffing-they are connected-because in the 1983-84 financial year $3,664,500 was allocated to 49 programs. I appreciate that those programs were mainly alcohol rehabilitation programs, but they were in the area of assisting Aboriginal people to help themselves. I have no doubt that if there were programs by which Aboriginal people could help themselves to overcome the problem of sniffing dangerous substances, some assistance would be found, either out of this vote or perhaps some other area. Let me also, of course, commend the Northern Territory Government which is also working in this area to try to assist. The problem is-and this is appreciated I am sure, by all of us sitting around this chamber-that there is so much in front of Senate committees at present. We have the additional problem that we have made a decision in this place to limit the number of select committees that can operate at any one time. As I indicated earlier, I hope that there will be more debate on this matter. I am sure that this motion will be agreed to. I am sure that the feeling will prevail around this chamber-on both sides, on the cross benches-that something ought to be done about this matter. I would like to see the committee established and would like to see it go into operation as soon as possible under the constraints that I have just mentioned. Senator CHIPP(Victoria-Leader of the Australian Democrats)(5.03) —I maintain the spirit of consensus and harmony that we have had since things looked like blowing up this morning. As I understand from the interesting speech that Senator Robertson has just made he favours the concept of referring this matter to a committee. It appeals to the Australian Democrats also, because it is a serious matter. While Senator Robertson was acknowledging the work load on senators and was therefore, I think, suggesting that a committee of four members be appointed, I was suggesting precisely the same thing, unofficially, to the Leader of the Opposition, Senator Chaney, and to Senator Kilgariff. If there is no great objection on behalf of the Government, I think that the Senate could well proceed to vote on this motion now although, perhaps with the amendment that four members be appointed to the Select Committee on Volatile Substance Fumes, two appointed by the Leader of the Government in the Senate and two appointed by the Leader of the Opposition. I so move: Paragraph 2, leave out all the words after 'Committee', insert 'consist of four senators, two nominated by the Leader of the Government in the Senate, and two nominated by the Leader of the Opposition in the Senate'. Senator ROBERTSON(Northern Territory)(5.04) —The Government has no objection to the amendment. Senator KILGARIFF(Northern Territory)(5.05) —I think the amendment moved by Senator Chipp is reasonable and the Opposition will go along with it. Amendment agreed to. Motion, as amended, agreed to. Senator GARETH EVANS(Victoria-Attorney-General)(5.06) —In response to the notice of motion standing in the name of the Leader of the Australian Democrats, Senator Chipp, which calls upon the Government to make a statement about the document, 'Strategic Basis of Australian Defence Policy' as regards its status, its content, decisions taken by the Government on the basis of it and the steps taken by the Government to keep the document secure, I seek leave to incorporate in Hansard a ministerial statement made by me representing the Minister for Defence (Mr Scholes) which addresses itself to those issues. Leave granted. The statement read as follows- STRATEGIC BASIS OF AUSTRALIAN DEFENCE POLICY Following the publication in the National Times of purported extracts from a Defence Department document titled ''The Strategic Basis of Australian Defence Policy 1983'' there has been much attention given to aspects of defence policy and to the assessment and analysis process on which it is founded. This statement clarifies these points and describes in broad terms the content of the 1983 Strategic Basis document and its principal conclusions. Purpose of the Strategic Basis Soon after World War II the practice was introduced of the government's senior defence advisers, the Defence Committee, periodically reviewing the implications for Australia's security of international developments that could lead to the use of military force against Australia or its interests. These reviews have generally been titled ''The Strategic Basis of Australian Defence Policy'' and are presented to the Government through the Minister for Defence. The reviews are designed to advise government on how threats to Australia might arise and their implications for our security. They address the kinds of policies Australia might adopt, in its force posture and in its defence relationship with other nations-both in our region and outside-when the latter could influence our security. Any decisions on particular policies are a matter for Government at appropriate times. The Process Responsibility for developing the intelligence assessments on which the Strategic Basis is founded rests with the Office of National Assessments. That Office, in association with the Joint Intelligence Organisation and Foreign Affairs, produces a comprehensive assessment of Australia's security outlook that serves to inform the Defence Committee. It is an independent analysis developed by those competent in the field of assessing possible and probable developments in the international security environment which might affect Australia. It does not suggest what actions Australia might take. The Defence Committee, which prepares the Strategic Basis, consists of the most senior and experienced of the Australian Government's advisers in the field of national security. It is chaired by the Secretary of the Department of Defence and comprises the Chief of Defence Force Staff, the Chiefs of the three Services and the Secretary of the Departments of the Prime Minister and Cabinet, Treasury and Foreign Affairs. The Committee subsequently presents to the Minister for Defence-and he, when he is satisfied, to Cabinet-advice on such matters as: the strategic issues of importance to us, and how we might influence them to advantage; what we should aim to do for ourselves; where we might look to others for assistance; and what we should contribute to others; the sorts of military contigencies which should most concern us-whether because of the hazard they present to our security or because of when they could occur; how, broadly, available resources should be divided, in establishing our defence posture, between readiness and sustainability of the force we have now, and our ability to develop strength in the longer term; the balance of resources to be applied to the force itself and to the defence and civil infrastructure, including industrial support, and the general level of defence effort necessary to provide adequately for Australia's security. The document is, as its name implies, advice on the basis for defence policy. It does not purport to provide a specific plan for future defence actions, but rather a framework within which decisions can be made. it does not supersede the responsibilities, for example, of the CDFS to command the Defence Force, for the CDFS and Secretary to co-administer the Defence Force, for the Minister to exercise control, and for the Government to make the key decisions and decide policy. The Government considers the judgments and recommendations put before it by the Defence Committee. To the extent that it is endorsed by Government, the material becomes what is known as ''strategic guidance''. As was stated by the Prime Minister in a letter of 10 October last year to the Minister for Defence Support , the Strategic Basis paper that was presented by the Minister for Defence to Cabinet ''is a guidance document prepared by officials to assist in defence planning and development of Australia's defence policies.'' It was specifically endorsed by Cabinet as ''guidance for review of defence planning and the development of Australian defence policies''. The Content of the Strategic Basis The 1983 Defence Committee document begins by examining the implications for Australia's security of the balance of power and the prospect of nuclear or conventional conflict between the Superpowers, the implications for Australia, in the field of defence, if war were to occur and how these matters should affect our defence posture. It examines the scope for Australia to contribute to deterrence of global conflict and to strategic arms control. The document then goes on to examine the strategic circumstances of regions other than that of Australia's primary strategic interest and the implications that flow for Australia's defence policy of developments there. Multi-lateral issues, including nuclear proliferation, developments in relation to Law of the Sea, Antarctica and possible Australian involvement in international peacekeeping activities are examined. An assessment is made of the factors that shape our defence policy in the regions of abiding concern to Australia-South East Asia and the South West Pacific. Consistent with the Government's policies, for the first time in the series, the 1983 paper includes a separate chapter on considerations relating to the independent defence of Australia against threats that might emerge from within the region. This chapter draws heavily on the Defence of Australia Studies initiated during the previous Labor Government in the early 1970's. The situations considered are not regarded as likely or probable, but it is a prudent element in defence planning to ensure that our defence capabilities are assessed against situations that illustrate threats that could occur if circumstances changed for the worse. The 1983 document particularly sets out to come to grips with the defence capability and appropriate response required against forms of pressure that could credibly be exerted on Australia in the shorter term and it examines the prospects for (and requirements to insure against) more substantial pressures that it judges could only arise in the longer term, and after massive changes in the political situation of the countries concerned. The Strategic Basis concludes by identifying, from its analysis, some general principles on which our future defence planning should be founded. This requires that the principal conclusions be drawn out concerning the implications of defence contingencies that could arise with the least warning; the importance of providing a basis for expansion if more substantial military pressures were to emerge later; the question of the trade-off between the allocation of resources to force readiness as against capital investment; the place of Reserve Forces in defence policy and planning; policy on Civil Defence; the factors that should determine our policies in relation to supply and industry support and defence science and technology. Principal Conclusions of the 1983 Strategic Basis One of the principal conclusions of the 1983 Strategic Basis is the judgement of the Defence Committee that the uncertainties and risks faced by Australia at that time appeared to be no greater than they were when the previous Strategic Basis paper was prepared in 1979. The Defence Committee also expressed the view that the prevailing level of planned Defence development was broadly appropriate to Australia's circumstances and needs. The Defence Committee's judgement that Australia's strategic circumstances remain favourable for the foreseeable future, but that there are inevitably uncertainties in the longer term, is the basis for favouring the direction of resources to capital investment in equipment and facilities of long term value whilst containing manpower and expenditure on administration and training to a minimum commensurate with a basic level of military competence rather than high readiness. At the same time, the Strategic Basis notes that the needs of shorter-term contingencies, including deterrence of such escalation as an enemy might be capable of, should command priority in equipment acquisition, training and infrastructure development. The more extensive examination of the 1983 paper of contingencies affecting the defence of Australia itself leads to the conclusions that, befitting Australia's status as an independent nation, provision for self-reliant national defence should command priority in our defence policy; it should guide the structure of the Defence Force and the development of supporting infrastructure. This can be contrasted with the historical view of the Australian Defence Force as merely an adjunct to the military forces of a ''great and powerful friend'' and designed for operations as part of a larger allied effort in areas remote from Australia. Underpinning this conclusion is the judgement drawn from earlier examination in the Strategic Basis, that Australian defence involvement beyond our area of primary interest is too unlikely, the circumstances too uncertain and our probable military role too minor to require special provision in our force structure. Moreover, as a middle ranking power with limited resources, Australia has no practical option but to concentrate its defence resources for use in the region of its primary interest. This is the area in which our defence interests are directly engaged and in which we can exercise the most influence. Because of recent public discussion about nuclear matters, the following paragraphs set out relevant conclusions of the Strategic Basis paper in this area, and re-state Government policy. Much of the material in the Strategic Basis on these matters has already been made public in Ministers' speeches. For example, in relation to the Superpower relationship, the principal conclusion is that nuclear or conventional conflict is improbable, but continuation of this situation depends on the maintenance of effective deterrence as well as strategic dialogue and understanding between the Superpowers. The assessment notes that we should continue to support deterrence through the defence relationship with the US, including the joint defence facilities. The paper also notes the potential of equitable and verifiable agreements for strategic arms control to promote stability in the strategic relationship between the US and the USSR. The conclusion is that such agreements support Australian security interests and should be supported. The Government's firm and unequivocal policy is to strengthen the constraints on acquisition of nuclear weapons by countries which presently do not have such weapons and to use our diplomatic and political influence to that end. The Government's commitment to support of the non-proliferation regime is absolute. This means that, as part of doing what it can to promote universal acceptance of the Non-Proliferation Treaty, the conclusion of a Comprehensive Test Ban and a South Pacific Nuclear Weapon Free Zone, and working for international agreement on a wide range of other measures in the arms control and disarmament arena, the Government has renounced any interest of its own in developing or otherwise acquiring nuclear weapons. It regards that renunciation as binding and permanent. As the Strategic Basis document itself says: 'Australia's interests continue to be served by adherence to, and support for, wider acceptance of the Treaty on Non-Proliferation of Nuclear Weapons and for strengthening nuclear safeguards measures generally'. (House of Representatives Hansard, p.1164) Steps taken to Keep the Strategic Basis document Secure The Cabinet Office Handbook contains detailed rules for the production and distribution of documents. The Strategic Basis 1983 was distributed in accordance with these normal Cabinet Office procedures. All the Cabinet copies of the document were returned to the Cabinet Office, and all other copies can be accounted for. I advised the Senate in my answer during Question Time on 4 April 1984 (Hansard, Senate p.1187), and on 5 April (Hansard, Senate p.1301), of the authority for distribution of the document. The Prime Minister directed that a joint investigation be undertaken into the leaking of the classified Defence document and associated Cabinet papers. This is being undertaken by the Australian Federal Police with the assistance and advice of ASIO. The investigation is continuing. It has been complex and wide- ranging, but I am advised the time being taken is no more than may have been expected, given that there were at least 60 to 70 copies and accordingly a large number of people who in the normal and proper course would have access to it. As to the prevention of future occurrences, the Government has done all it can to keep documents of this kind secure. The experience under previous Governments shows that absolute security is impossible. Short of banning photocopiers from all Departments and from Parliament House and other extraordinary steps, such as conducting searches of all public servants and other staff every time they leave their office, there is no real way to prevent such occurrences, however much we deplore the matter. Senator CHANEY(Western Australia-Leader of the Opposition)(5.07) —by leave-I move: That the Senate take note of the statement. I am sure the Attorney-General (Senator Gareth Evans) did not mean to be churlish when he said that he was making the statement in response to a notice of motion given by Senator Chipp. In fact, this Senate passed a motion on 30 March, I think, of this year, which called upon the Government to make a full statement as a matter of urgency on the content of and decisions taken by the Government on the document known as the 'Strategic Basis of Australian Defence Policy 1983' and the steps taken by the Government to keep the document secure. We have waited quite a time for a response from the Government following the passage of that motion. I acknowledge the notice of motion that was given by Senator Chipp during the last period of sittings in which he indicated that he would call upon the Government to make a statement by 1 May. The Opposition indicated that it was prepared to support Senator Chipp's motion but the Leader of the Opposition in the Senate, Senator Button, undertook early last week- Senator Gareth Evans —The Leader of the Government. Senator CHANEY —I am sorry, I meant the Leader of the Government. The Attorney has been calling us Ministers all day. It is a catching habit. Senator Button indicated to Senator Chipp and to me that he had a statement with which he was not satisfied and that he intended to put it down in a matter of days. Senator Chipp did not seek to pursue his motion, given the Government's undertaking to make a statement. I would like to say a number of things about this statement. The first is that the Opposition is less than delighted at the Government's approach to putting down important statements, starting at 5 o'clock on the afternoon of the Thursday of the second week of sitting. In the hour and 20 minutes which remain of the sitting we have before us the prospect of a couple of other major statements, including the Government's response to the report of the Senate Standing Committee on Constitutional and Legal Affairs on the National Crimes Authority Bill which we understand will be quite a detailed statement and which is a matter of great importance to the Senate because it is a response to a major report brought down by the Constitutional and Legal Affairs Committee. We have yet to have brought down in this place a statement which has been made in the other place on the very important subject of immigration. I think that all honourable senators would regret that in the space of less than an hour and a half we are faced with the prospect of dealing with three major statements which we will now not have an opportunity to debate any further for at least two weeks . The statement which has been put down today with respect to the 'Strategic Basis of Australian Defence Policy 1983' is a statement which, on the face of it , could have been put down weeks ago. It really tells us nothing new. It tells us nothing which could not have been said a month ago. With respect to the only matter that perhaps required some action on behalf of the Government, namely, the third leg of the information that was requested, that is, advice on the steps taken by the Government to keep the document secure, we simply have the advice that it followed the procedures laid down in the Cabinet office handbook. This statement adds very little to the knowledge that the Senate had before it was made. It is something of a Clayton's statement. Australian Defence Policy Australian Defence Policy Australian Defence Policy Australian Defence Policy Australian Defence Policy Australian Defence Policy Australian Defence Policy Australian Defence Policy Australian Defence Policy However, I want to make a number of comments on what has been put down. The extracts in the statement to which I wish to refer underline why there was concern on the part of some people about the document which was leaked to the National Times. The document confirms what was printed by the National Times in the first week of April; namely, that the document which fell into its hands had been endorsed by the Cabinet as the strategic basis of Australian defence policy and as a guidance for the forthcoming review of defence planning and for the development of Australian defence policies. This is an important document. It is not some theoretical essay, something which Senator Gareth Evans, with his practised hand and his speedy eye, would mark C-plus, B-plus or A-minus at the bottom when he was satisfied as to its academic value. This is a document which Senator Gareth Evans and his colleagues specifically endorsed to guide the review of defence planning and the development of Australian defence policies. We have raised the question-I notice that it is not tackled in the statement- whether the Government's mind was specifically addressed to this paper, given the euphoric condition of the Prime Minister (Mr Hawke) following Australia's great win in the America's Cup and his lengthy and enjoyable visit to the yacht club in Perth. But the Government seems to be telling us in this statement that it has seriously adopted this very important document. It has told us how it was prepared. It has told us that there is a Defence Committee which prepared the strategic basis. It consists of the most senior and experienced of the Australian government advisers in the field of national security. It is chaired by the Secretary to the Department of Defence. It comprises the Chief of the Defence Force Staff, the chiefs of the three Services, and the secretaries to the Department of Prime Minister and Cabinet, the Treasury, and the Department of Foreign Affairs. We have found out that the report is presented to the Minister for Defence and that when he is satisfied, it is presented to Cabinet. So we have a document which has gone through all of this, which has been presented to Cabinet, and which has been endorsed as a guidance for the review of defence planning and for the development of Australian defence policies. Therefore, it is this document, and not some subsequent gloss on it, which is meant to provide a guidance to the public servants who work for the people of Australia in this area and who are responsible for the development of policies. It is important to note some of the conclusions which are there, because they tend to draw out some important issues, and they tend to give some support to the concern which was expressed by the Australian Democrats and others about the possibility that the Government might have been considering an ultimate move into Australia having its own nuclear weapons. Senator Tate —Oh! Senator CHANEY —I will point to the specific passages in this statement which indicate the concern, which the Government has apparently adopted as its own, that provision for self-reliant national defence should command priority in our defence policy. Let me refer to just a couple of extracts from the statement which has just been incorporated in Hansard. It says: The Strategic Basis concludes by identifying, from its analysis, some general principles on which our future defence planning should be founded. This requires that the principal conclusions be drawn out concerning the implications of defence contingencies that could arise with the least warning; the importance of providing a basis for expansion if more substantial military pressures were to emerge later. That is one of the views put forward in the statement and in the document which was leaked which suggests that the Government has been alerted to the need to take action to provide some basis of expansion of our military forces if circumstances changed. We find a little later in this statement reference to the fact that provision for self-reliant national defence should command priority in our defence policy. I refer to those passages as showing an emphasis in the document of concern about the need for independence and the need for possible new developments in our defence approach should circumstances change. It is true that what we have in this statement now is the Government's commitment to the support of the nuclear non-proliferation regime as being absolute. We have the statement that the Government has renounced any interest of its own in developing or otherwise acquiring nuclear weapons. We have the statement that it regards that renunciation as binding and permanent. However, those statements are ex post facto statements. They are not statements which form part of the document or part of the Cabinet decision which adopted the document. These are the Government's subsequent statements. This is the Government's subsequent gloss upon the document that it adopted on that euphoric day in Perth. I welcome the fact that the Government has indicated its firm commitment to the Nuclear Non-Proliferation Treaty. I think that the gloss which has been put on it, the additional words which have been provided, are important in clarifying the position. I believe that that is consistent with other statements made by the Government when the furore about this document emerged. I think that it is in the interests of Australia that the statements should be as clear as they are here. The only other section of the statement to which I wish to refer at this stage is something that appears on page 6 of the typescript. I refer to it because it indicates a move by the Government towards acceptance of propositions with respect to the defence of Australia which have long been held by members of the Opposition, and held by us when we were in government, and matters which were put in issue by various members of the Australian Labor Party over the years, and I believe that it is in Australia's national interest that we see in this statement the Government adopting positions which are closer to those which have been traditionally adopted by the Liberal and National parties in this Parliament. I refer to the third paragraph on page 6, which says: For example, in relation to the Superpower relationship, the principal conclusion is that nuclear or conventional conflict is improbable, but continuation of this situation depends on the maintenance of effective deterrence as well as a strategic dialogue and understanding between the Superpowers. The assessment notes that we should continue to support deterrence through the defence relationship with the United States, including the joint defence facilities. The paper also notes the potential of equitable and verifiable agreements for strategic arms control to promote stability in the strategic relationship between the United States and USSR. I emphasise the following words: The conclusion is that such agreements support Australian security interests and should be supported. The Opposition would say 'Amen' to that. We agree that the agreements support Australian security interests and should be supported. We are pleased to see the Government embracing that proposition in such a wholehearted fashion. I stress that what we have here in this document is a repudiation by the Government of the absurd proposition which sometimes seems to gain currency in the Parliament and elsewhere that there is some salvation for the world in unilateral disarmament, in a unilateral approach to becoming a better and more peaceful world. I think it is correct to assert, as is asserted in this document , that the maintenance of peace in the present world requires the maintenance of effective deterrence as well as the dialogue and understanding which we would all wish to promote. I particularly welcome the Government's clear statement that there is a need to support the agreements which we have with our allies and that they are in Australia's interests and should be supported. Time is marching on. There are other major matters which the Government wishes to bring before the Parliament. Much as I might complain about the Government's failure to bring them before the Parliament at an earlier or a more suitable time, which would give us an opportunity to debate them more fully, I wish to see those statements introduced into the Senate so that the Senate will at least have the benefit of debating them on our return to this place and so that we have the chance to see the Government's response in particular to the report of the Senate Standing Committee on Constitutional and Legal Affairs on the National Crime Authority. Rather than seek leave to continue my remarks, which would prevent anyone else from speaking-I think that Senator Mason is seeking the call-I shall indicate that I may have other things to say about the statement; but if I do, I am sure that we can move an amendment to the motion to take note and I could enter the debate at a later time. I am pleased that this report has come to hand, even though it is late, and I look forward to the Senate having a chance to consider it further. Senator MASON(New South Wales)(5.20) —In view of the amount of effort that the Australian Democrats put into trying to get the Government to bring down this elucidating statement, I must say that we welcome it without very much enthusiasm because it is bland, superficial and late. The portions of the National Times report that originally gave concern to us and, I think, to very many people in Australia were these: The belief that Australia might develop nuclear weapons if our neighbours did so and that the lead time for the development of Australian bombs should be watched; in other words, we should be keeping an eye on our neighbours to see what they are doing and we ought to be keeping up with them. This is an imputation which I believe the Government has yet to put to rest. Certainly this statement does not put it to rest. If we want nuclear proliferation in this area we are going about it in the right way if we persist with this line of argument. I would have thought that probably most of our neighbours, who have plenty of problems of their own and who, as we know, at present have no nuclear capacity of this type, not even nuclear power capacity, might well have been prepared just to let matters drift on. But when the Australian Government comes up with a document of this consequence and importance which has been endorsed by Cabinet and which raises this dangerous lead time, this virtually competitive element, that is greatly to be regretted. In a world where I think all men and women of good intent want to see fewer nuclear weapons and some de-escalation of this absurd situation which places the world itself at threat, I think it is highly irresponsible of the Government even to bring this matter up, particularly in a document which it knew perfectly well must leak because there are hundreds of copies of it around. As a matter of fact, a day or two after this leak I was talking to somebody who shall be nameless but whose opinion I respect and who sees me from time to time. This man said that he had been to see a senior military man in Australia and had asked his friend in the military: 'Can you confirm or deny whether this stuff in the National Times is the document concerned?' His friend, who was a high ranking military officer, I understand, said: 'I can neither confirm nor deny it , but the first thing I did when I came into my office today was to look in my safe to see whether it was still there'. That was the degree of security in this matter. I think the Government has not taken into account the fact that this is material which presumably was going to leak. The Government must have wanted it to be leaked, because it would be incredibly naive if it saw it in any other light. The second point is the alleged Soviet superiority in nuclear weapons and the need to support a United States strategic nuclear build-up. This is a highly controversial area, and a pot which I suggest we have no right or reason to be stirring. Yet we have stirred it. In doing so, we would seem to support such views as those exhibited by President Reagan that whole new generations of nuclear weapons should come into being. After all, that is what the Australian Government's statement means. Of course, among other things, we are encouraging the United States in its deployment of advanced cruise missiles. What is the latest one sees about that in respectable scientific magazines this month? The Soviet Union is known to be already further ahead with its cruise missile technology than the United States suspected. This has now been revealed. I saw it in the magazine of the American Association for the Advancement of Science only last night. The consequence of this will be that the peril of the people of the United States will be increased enormously because of Soviet retaliation. The Soviet Union will escalate this by ringing the United States with a pattern of submarines carrying their version of sea cruise missiles. In other words, this bland assertion which our Government brings up that changing strategic relativities could give the Union of Soviet Socialist Republics significant political advantages unless the balance can be redressed by United States strategic programs was put in this statement, I believe, without any proper examination, without any justification and without the serious consideration it ought to have been given. It is leading us to support of that kind of situation rather than to a responsible attitude on the part of this Government in trying to be deterrent. That makes the following statement on page 6 of this report ring pretty hollow: The Government's commitment to support of the non-proliferation regime is absolute. I should think it would realise that this matter is a little more complicated than just standing on a pedestal and saying: 'We do not want nuclear weapons'. It is a lot more complicated than that. Senator Gareth Evans —Coming from your mouth, Democrats, that is a bit cheeky. Senator MASON —I see that I have made that point with the Attorney-General. That is good; I am delighted. The response of the Minister for Defence (Mr Scholes) mentions deterrence as a catch-all and positive policy. I think the Leader of the Opposition (Senator Chaney) mentioned that too. He saw this, I think properly and reasonably, as a movement of the Government towards the defence position of the Fraser Government. There is no doubt that that is the case. So I fear that in this situation, as in many others, in the words of Animal Farm, it is becoming very difficult to distinguish the pigs from the men. I refer to the following sentence on page 6: The assessment notes that we should continue to support deterrence through the defence relationship with the United States, including the joint defence facilities. I would like to have seen a little qualification of that. I would like to feel that our Government did not say that just as a bland and blunt statement, as something that we just accept. We are passive apparently. We are among the lemmings who move passively towards the brink. There is no indication here from our Government that deterrence might be scaled down or that we are a responsible , middle ranking power which wants to bring the number of nuclear weapons down. There is none of that at all. It is just the same uncritical statement that we will go along with exactly what the United States wants and that we do not apparently want any input into that. For instance, what about the Star Wars program? That will undermine deterrence totally. Has the Government thought about it? It does not say anything about that here. It has not given us a view on it. Here is the Government's opportunity in the second statement, we had hoped in calling for it, to put paid to accusations which we, among others, brought to bear as a result of the National Times articles. I would have hoped for a whole thoughtful section in this statement from our Minister for Defence on the implications of the star wars program. What does Australia think about it? Is this part of deterrence or not, because it is happening? It is very disappointing that the Government has not done that. By not saying anything, of course, we implicate ourselves in this destabilising technology. The Government of the United States is perfectly entitled, on the basis of this further statement, to assume that the Australian Labor Government is perfectly in favour of these continuing technologies and does not appear to take any cognisance of the highly responsible view being put forward by authorities all over the world-not just by left wingers or its own party but by eminent scientists all over the world; it goes beyond politics-that this technology goes beyond deterrence to a situation where, perhaps at a few minutes notice at some time, the risks to this planet are increased appallingly. Yet the Government cannot even make a statement on that, when so many of our citizens are concerned . I will not take up too much more of the time of the Senate. I could speak for a considerable time on this. Although the statement, I suppose, is to be welcomed to the extent that it is here, it certainly does not answer the bulk of our concerns and we will be questioning the Government further on the issues I have raised and on some others as well. Senator Sir JOHN CARRICK(New South Wales)(5.28) —This statement which has come to hand tonight brings into focus a very important matter. It is a statement which the Attorney-General (Senator Gareth Evans) would not admit existed in the first place. Then he said he would not admit to the accuracy of the substance of the publication. It is not competent for us to debate this important statement tonight. It needs to be debated in depth. Therefore, I seek leave to continue my remarks later. Leave granted; debate adjourned. Senator GARETH EVANS(Victoria-Attorney-General)(5.29) —by leave-On behalf of the Minister representing the Minister for Immigration and Ethnic Affairs (Mr West), I present a statement made by the Prime Minister (Mr Hawke) earlier this afternoon. I seek leave to have the text of the statement and the accompanying documents and table incorporated in Hansard. Leave granted. The speech and documents read as follows- STATEMENT TO PARLIAMENT-10 MAY 1984 Over the past few days, powerful emotions have been unleashed in this country and in this Parliament over the issue of immigration. We in this place have a particular responsibility to ensure that what we do and say on this matter is judicious, calm and constructive. There is a risk that if the debate on immigration loses touch with facts and departs from a civilised approach, racism and racial intolerance could be promoted to the detriment of our national unity and our basic values. I know I speak for this Government, for the Australian Labor Party and for the overwhelming majority of Australians in rejecting racial intolerance and in calling for a measured and humane discussion of these issues. One of Australia's greatest achievements has been our acceptance of people from widely diverse nationalities around the world. The enrichment of our national life by new settlers since World War II, predominantly of European stock, has been palpable. Over the past decade, we have buried the White Australia Policy for ever. We have shown our capacity to accept people from Asian cultures, many of whom have sought a new life in Australia following the tragedy of the wars in Indo-China in which Australia itself participated. Surely no Member of this Parliament would wish to allow that achievement to be called into question now by prejudice and intolerance. As The Australian stated in its Editorial of 9 May 1984 in discussing the need for informed debate on immigration: 'Unless it is carried on with moderation and respect for other points of view we shall come to no sensible conclusion and Australia will become an ugly place to live in.' It is therefore imperative that our debate be based on a clear understanding of the facts and the facts be presented honestly and without a view to political point scoring. Senator Chipp, whose views on this matter I respect, pointed yesterday to the dangers of ignoring and distorting the facts and their causes in a speech which I commend to all Members. My purpose here today is to place Government's Immigration Policy. On coming to Office, the Labor Government took the view that at a time of high unemployment, unprecedented in the post-war era, we should reduce the total migration intake. We decided in particular to curtail drastically recruiting for the Australian workforce. I believe that that decision was correct. As the same time, we acknowledged the aspirations of new settlers in our community to reunite with their families, by allowing an increased component for family reunion. We also accepted our responsibilities to the international community and our moral obligation as a participant in the Vietnam war to continue the bipartisan humanitarian policy of accepting refugees, particularly from Indo-China. It is worth pointing out, as i said in this place on 8 May, that the Australian Labor Party in opposition wholeheartedly supported the Fraser Government's efforts in offering Indo-Chinese refugees a new life in this country, notwithstanding our Party's strong opposition to the war itself. Inevitably, Australia's bipartisan acceptance of Asian refugees has carried with it bipartisan acceptance of their right to participate equitably in the Family Reunion Program. As Senator Chipp has said, it is inconceivable that we could accept refugees in the late 1970's and refuse their families in the 1980's. This Government is not going to designate any group of Australians as second class citizens. We are simply not going to tell people who are here legitimately in this country that they have second clss rights, that they are not allowed to exercise their rights under the Family Reunion Program. When the intake of Indo-Chinese refugees was at its highest under the previous Government in the period 1979 to 1981, we as an Opposition responsibly and constructively sought to make no political capital out of that fact. There is some irony in the fact that now, when the absolute number of Indo-Chinese refugees-and indeed the total number of Asians-coming into Australia is dropping , we find ourselves being subjected to criticism from some quarters for allegedly contributing to the ''Asianisation'' of Australia. The Leader of the Opposition has in this place and in statements to the media indicated that he is not opposed to the present number of Asians coming into Australia. Indeed he said on 'Nationwide' on 8 May that the 'right number' of Asians was now coming in. He has, however, expressed concern, about the 'mix' or the 'balance', as he put it, of the present migrant intake and has called for an increase in European migration. The fact is that the proportion of settlers (excluding refugees) coming to Australia from Europe, the UK and Ireland is still higher than from any other area. In the nine months to 31 March 1984, migration visas issued to the people from that area constituted some 45 per cent of the total number granted. This high proportion of visas issued has occurred despite a diminution of migrant applications from that region and repudiates claims of anti-British bias or anti-European bias in our Migration Program. In the same nine months, 39.5 per cent of total migrant applications came from Britain and Europe compared to 44.4 per cent for 1982/83, 63.1 per cent in 1981/82 and 66.6 per cent in 1980/81 . European migration posts have been recently asked by the Minister for Immigration and Ethnic Affairs to offer explanations for the diminution in interest in migration to Australia from Europe. In the case of Britain, for example, migration applications have declined dramatically-from over 130,000 in 1980/81 to some 13,000 in the first nine months of this financial year. The post in London attributes particular importance in this decline to publicity given in Britain to the recession in Australia, the unemployment situation in 1982 and, especially, unemployment among British migrants. It may well be that as the improving economic circumstances here become more widely known in Europe this situation will turn around. One can imagine, Mr Speaker, the impact in Britain of reports of steel workers, recruited for BHP under the former Government's Employer Nominations Program, being sacked within months of their arrival in this country. Nothing could be better calculated to have a long-term negative impact on migration from Britain. At the same time, while the absolute number of Asians now coming to Australian is declining because of the lower target which the Government has set for refugees, their percentage share of the intake is increasing. This partly reflects the decline in interest from Europe to which I have referred. More relevantly, since the Opposition has raised the issue of alleged distortions in the 'balance' or 'mix' of the migration program, the percentage increase of Asian migration also reflects the fact that the Opposition during its final year in Government reduced the total migration intake at a much faster rate than the refugee intake. In that year, it reduced its migration intake by 21 per cent from 118,000 to 93 ,000. Yet at the same time, it reduced the Asian refugee intake by only 12 per cent, from 14,557 to 12,758. We did not then, nor do we now, criticise them for that decision. By contrast under the Labor Government, the reduction in the overall migration program has been closely paralleled by that in the Asian refugee intake. The point that I wish to emphasise is that in Government the Opposition had no particular regard for the so-called 'balance' or 'mix' it is now promoting as a policy objective. Not only that, the number of Asian refugees included in the overall intake during the period that the Opposition was in Government is now being strongly reflected in the family reunion program. There are ample grounds therefore for suggesting that the Opposition's stand on this issue smacks of hypocrisy. For my own part, as I said on 'Nationwide' on 8 May, I do not believe that one can honestly say that there is an immutably right figure for any migrant group within the overall intake. Rather the approach of the Labor Government reflects the application of economic criteria in determining the total intake and of economic and humanitarian factors in breaking down this total among different categories of migrants. This Government does not consider that a 'balance' or 'mix' in our migration program determined on racial grounds can have any place in our society. It categorically rejects the discriminatory concept of quotas, which is implicit in what the Leader of the Opposition has said in recent days about increasing the number of European migrants. It also categorically rejects any proposal to introduce covert discrimination through differential standards in selection criteria. We of course acknowledge the need to ensure that our migration program does not threaten the stability and fabric of Australian society. But in working towards this end the Government considers that not only is the size and composition of our intake important, but also the programs within our community to promote the integration of migrants into our society from initial concentrations of ethnic groups, and the broader promotion of racial tolerance in our country. In the past few days, the Leader of the Opposition has supported his criticism of the Government's Immigration Policy by reference to statistics which he describes as official government. The basis for his claims has caused some puzzlement to the Government because my colleague, the Minister for Immigration and Ethnic Affairs, has received no request from the Opposition for up-to-date immigration statistics. Enquiries have now revealed that some figures were in fact obtained by the Hon. Member for Mitchell directly from a junior officer in the Department of Immigration and Ethnic Affairs. The Department has now had these figures re-checked because they do not square with other statistics available to the Government. Our figures-figures confirmed and released yesterday by the Minister-showed that overall migration applications from Europe are in decline. The Opposition's figures purported to show that family reunion applications from Europe were increasing against this trend. It emerges that the Opposition's figures are in fact wrong-and that even these figures have been used in a statistically unsound manner. My colleague, Mr West, has today written to the honourable member for Mitchell pointing out this error and giving him revised figures which confirm the Government's consistent advice that the trend of family reunion applications to migrate to Australia from traditional sources in Europe is in fact declining. The Secretary of the Department of Immigration and Ethnic Affairs, Mr McKinnon, has also provided the Minister with statistical and other material which clarifies the factual basis on family reunion and the trend in Australia's Immigration Program. Furthermore, it sets out in some detail the highly dubious fashion in which these incorrect statistics were used by the Opposition. Mr McKinnon said: 'MIGRANT APPLICATION STATISTICS You asked me to explain the apparent conflict in applications for family reunion in European posts as used by Mr Cadman in the Adjournment Debate on 7 May 1984 with the advice given to you related to the decline in interest from traditional countries of migration. Mr Cadman's office approached the Department direct by telephone. The figures supplied are derived from the Migration Program Management System. They comprise recorded applications for family migration by class, by country of last residence for 1982/83 and the first half of financial year 1983/84. Mr Cadman then doubled the half-year figures to produce an annual rate which he compared with the 1982/83 figures. On the basis of this comparison, he concluded that there was an increase in family migration applications in the United Kingdom and Europe. A number of qualifications need to be made: 1. The figures are wrong. The data included in MPMS, which is still being developed, are notoriously unreliable. They depend upon input from a number of posts using a number of classification methods. When supplying such figures, a caveat is normally included which draws attention to their limitations, but on this occasion the caveat was not included. A complete re-run of the figures, including recourse to the basic data, has been undertaken. The revised results are attached. You will note that they considerably alter the picture portrayed by Mr Cadman. 2. The figures are seasonal and should not be treated by doubling a half-year figure. Applications in European posts are seasonal. An example using U.K. figures for total number of persons covered by applications shows: July-December 1980 46,504 January-June 1981 77,854 July-December 1981 43, 883 January-June 1982 60,317 July-December 1982 29,357 January-June 1983 22,766 Thus a doubling of the figures for July-December in any category runs the risk of grossly under or over-estimating the annual rate. 3. The series is not consistent. A higher proportion of persons applying in European posts have been applying under family reunion as the opportunities for skilled migration, which does not depend upon sponsorship, have declined. As the occupational Demand Schedule has narrowed, persons who would normally have applied otherwise are now applying under family reunion. Furthermore, the increase in the scope of family reunion to include Category C only commenced in the first half of 1982 and the influence of this widened eligibility would have been felt increasingly through the period used by Mr Cadman. 4. The data are not complete. One of the other indications of declining interest in migration is the number of persons put into processing who do not respond to an invitation to interview. For example, the current response rate in the Athens post is as low as 50%, which indicates that about half of the people being sponsored by relatives in Australia are not interested in migration. Although the non-response rates for other European posts are not as high, they are still significant and well above the equivalent rates for Asian posts. I should point out that the figures for applications relate to actual arrivals approximately one year later. Thus, even if family reunion interest were to be regenerating in traditional migration countries (which is contrary to the advice from virtually all our posts), this would not be reflected in current arrivals figures. The current figures on the balance of source countries for arrivals would reflect the applications in 1982/83 at the latest, before any changes in immigration policy of the current government became operative. In any case, I should point out that the only changes made since the change of Government affect the family reunion Category C. This represented less than one quarter of all family reunion arrivals in 1982/83. Thus the changes introduced in the Points Assessment System will change marginally the proportion from different sources in future arrivals. I would like to give you my unqualified assurance that no policy or operational instructions have been promulgated which would inhibit migration from traditional source countries. You would be aware that special efforts have been made to lift the number of Category C family reunion migrants once the shortfall became evident. Furthermore, with the declining overall level of applications in these countries, we have been able to improve significantly our processing times for family reunion migrants particularly from those countries. For example, for the United Kingdom the average time between receipt of the application (M47) to the approval letter is now approximately 3 1/2 months, compared with 9-11 months two years ago. It is now one of the shortest periods anywhere in the world. I believe that Mr Cadman should be informed of the adjusted figures and the limitations on the use of the figures in measuring interest in family reunion'. I seek leave, Mr Speaker, to incorporate a number of supporting tables, provided to the Minister by Mr McKinnon. I make the further point that the Opposition made no effort to consult the Minister before obtaining the figures. Having obtained them, it made no attempt to discuss the matter with the Minister, notwithstanding the Government's citation of other statistics which argued a contrary trend. Given the sensitivity of these issues, one might have expected a little extra care to be shown, a little more time to be spent, a little more effort to be invested, before bipartisanship and national consensus were put at risk by public political attacks based on false premises. Put simply, the Opposition's case is based upon inaccurate statistics, improperly used. It has at its heart the false allegation that the Government has somehow sought to deter migration from Europe. Mr McKinnon's statement refutes that allegations-if it ever needed to be refuted-when he says, and I repeat. 'I would like to give you my unqualified assurance that no policy or operational instructions have been promulgated which would inhibit migration from traditional source countries.' For several days now, the Opposition has vilified my colleague, the Minister for Immigration and Ethnic Affairs, who has steadfastly and honestly set out the facts to this House regarding the trend in Australia's migration flow. He has been completely vindicated by the information released today. The Government has throughout emphasised the importance of a bipartisan position on this crucial issue. For its part, the Opposition has paid lip service to the concept of bipartisanship but claims that it no longer exists as a result of Government policies. It is not enough for the Opposition to assert that it seeks bipartisanship and then by its behaviour to undermine it. The Opposition's behaviour in this place in recent days has diminished the dignity, decorum and reason which ought to surround this issue. As the Sydney Morning Herald said this morning: 'The Opposition's claim that the Government has departed from bipartisan immigration policy by running a ''pro-Asian and anti-British'' policy is nonsense . . . it is the Oppoisition and not the Government that is seeking to depart from bipartisan policy . . . it seems that Mr Peacock does not want a constructive debate. The Opposition just wants to make a quick killing'. It is not too late to restore decency and commonsense to discussion of this issue. At this point, Mr Speaker, I repeat the call which I made to the Leader of the Opposition in the House on 8 May to put an end to this debate as a party political dispute and in particular to dampen down the racial overtones which it can so easily assume. I said that it would be to the great service of this country and all its citizens, and to our relations with countries in this area, if we did not allow this very dangerous issue to be raised and to become something that is in the forefront of political debate. As Senator Chipp said in the statement to which I referred earlier, the rhetoric which is surrounding the debate does not match the facts and the danger is that the consequences of the rhetoric will be to fan those underground elements of racism and prejudice. A bipartisan policy in this area is of crucial national importance-splitting the debate along political and partisan lines would only serve to cause wholly undesirable divisions within our society. Is there anyone in this place who wants to see discrimination reintroduced into our Immigration Policies, with all the tragic social damage and conflict which that would bring to this great country? Does anyone here want to see Australia turn its back on those in our region who have known anguish and human suffering? Do we want to see Australia lose its reputation as a tolerant, open-hearted country, which can hold its head high in the world? I know where the Government stands on this matter. I would like to believe that the Opposition stands with us. FAMILY MIGRATION Applications preselected in(1) by country of last residence (cases)(2)-total of family migration categories A, B and C. Updated figures as of 9 May 1984. Figures in brackets are the totals of those supplied to Mr A. Cadman, M.P., on 5 April 1984 1982-83 July-Dec. 1983 Abu Dhabi 59 (0) 30 (21) Algeria 2 (2) . . (0) Austria 132 (109) 40 (41) Bahrain 29 (24) 8 (4) Bangladesh 24 (23) 8 (9) Belgrade 1,008 (750) 485 (552) Buenos Aires 413 (341) 198 (205) Burma 56 (48) 22 (18) Canada 615 (591) 269 ( 337) Chile 300 (204) 127 (116) China 272 (227) 88 (112) Cyprus 119 (109) 76 ( 75) Denmark 53 (49) 38 (48) Egypt 286 (254) 151 (139) Fiji 435 (428) 208 (225 ) France 239 (223) 130 (158) G.D.R. 5 (5) 1 (1) Germany 700 (602) 299 (339) Greece 502 (468) 261 (306) Hong Kong 1,700 (1,327) 844 (903) India 1,052 (813 ) 391 (363) Indonesia 383 (321) 153 (184) Iran 44 (31) 43 (30) Ireland 200 ( 174) 108 (129) Israel 148 (142) 45 (48) Italy 391 (352) 164 (187) Jamaica 28 (25) 11 (11) Japan 90 (86) 51 (68) Kiribati 4 (4) 2 (2) Korea 311 (285) 210 ( 166) Kuwait 31 (29) 14 (12) Malawi . . (0) . . (3) Malaysia 746 (671) 393 ( 353) Malta 204 (197) 101 (125) Mexico 27 (24) 12 (17) Nairobi 470 (420) 94 ( 61) Nauru 2 (2) . . (0) Netherlands 402 (384) 160 (178) New Caledonia 14 (9) 17 (18) New Zealand 157 (151) 66 (79) Pakistan 118 (116) 56 (54) Papua New Guinea 96 (80) 55 (52) Philippines 2,599 (2,380) 1,221 (1,488) Portugal 178 (170) 82 (100) Saudi Arabia 72 (56) 24 (15) Singapore 450 (334) 174 (177) Solomon Islands 9 (9) 6 (7) South Africa 875 (710) 365 (377) Spain 138 (133) 43 (56) Sri Lanka 204 (192) 841 (868) Sweden 112 (102) 65 (80) Switzerland 154 (129) 48 (56) Syria 809 (726) 580 (662) Thailand 196 (183) 94 (139) Tonga 7 ( 0) 5 (9) Turkey 830 (676) 303 (366) United Kingdom 6,254 (5,340) 2,541 (3,054) U.S.A. 1,242 (1,122) 567 (784) U.S.S.R. 17 (8) 4 (4) Vanuatu 4 (4) 5 (5) Vietnam 662 (654) 669 (1,003) Warsaw 227 (206) 300 (362) Western Samoa 21 (17) 9 (8) Zambia 11 (9) 10 (10) The following countries were omitted from the December table: Laos 1 0 Tanzania 11 3 (1) Preselected in=prima facie eligible applications only. (2) Cases=applications. A single application may cover one or more members of the family unit. FAMILY MIGRATION(a)-APPLICATIONS PRESELECTED IN AND VISAS ISSUED BY REGION ( PERSONS) 1980-81 1981-82 1982-83 1983-84(b) Region Number % Number % Number % Number % UK & Ireland- Applications n.a. n.a. 13,534 24.9 6,591 18.5 Visaed 6,046 30.7 6,917 30.6 6,178 24.1 5,971 25.2 Europe- Applications n.a. n.a. 8,627 15.9 5,440 15.3 Visaed 4,115 20.9 3,817 16.9 2,628 14.5 4,129 17.5 Asia- Applications n.a. n.a. 17,220 31.7 14.533 40.8 Visaed 5,071 25.7 6,425 28. 5 5,039 27.8 7,607 32.1 Other- Applications n.a. n.a. 14,909 27.5 9,022 25.4 Visaed 4,480 22.7 5,411 24.0 4,276 23.6 5,955 25.2 Total- Applications n.a. n.a 54,290 100.0 35,586 100.0 Visaed 19,712 100.0 22,570 100.0 18,121 100.0 23,662 100.0 (a) The definition of Family Migration has changed during the period 1980-81 to 1983-84. (b) 1 July 1983 to 31 March 1984. n.a.=not available. Source: DIEA manual statistics for 1980-81 and 1981-82 and MPMS data from 1982- 83 onwards. MPMS data are preliminary and subject to revision. ALL MIGRATION*-APPLICATIONS (M47) AND PERSONS VISAED BY REGION 1983-84 to 1980-81 1981-82 1982-83 Mar. 31 1984 Region Number % Number % Number % Number % UK & Ireland- Applications 137,112 (39.6) 105,011 (31.6) 53,057 (18.1) 13,202 (10.7) Visas 35,602 (43.6) 39,711 (41.9) 25,822 (38.1) 8,794 (25.6) Europe- Applications 93,500 (27.0) 104,597 (31.5) 77,087 (26.3) 35,631 (28.8) Visas 21,826 (26.7) 26,584 (28.1) 15,763 (23.2) 6,728 (19.6) Asia- Applications 54,242 (15.7) 47,963 (14.4) 67,827 (23.1) 35,301 (28.5) Visas 10 ,970 (13.4) 13,155 (13.9) 12,882 (19.0) 10,970 (32.0) Other- Applications 61,124 (17.7) 74,524 (22.4) 95,580 (32.6) 39,711 (32.1) Visas 13 ,225 (16.2) 15,319 (16.2) 13,366 (19.7) 7,807 (22.8) Total- Applications 345,978 (100.0) 332,095 (100.0) 293,551 (100.0) 123,845 (100.0) Visas 81,623 (100.0) 94,769 (100.0) 67,833 (100.0) 34,299 (100.0) * excluding refugees. Senator MARTIN(Queensland)(5.30) —by leave-I move: That the Senate take note of the paper. This statement was given by the Prime Minister (Mr Hawke) in the House of Representatives earlier this afternoon. Yesterday we had a debate in the Senate on the Australian Citizenship Amendment Bill and there were some attempts by some honourable senators to debate immigration policy. At the time I resisted those attempts on the grounds that immigration policy should not be debated under the heading of citizenship. He said that when the debate arose in the Senate the Opposition would respond to it here. This afternoon I will respond only briefly to some sections of the statement. I am sure the statement will be further debated by the Senate at another time and we will go more fully into our reaction to the statement of the Prime Minister at that time. The Prime Minister in his statement essentially attacked the Opposition, specifically the Leader of the Opposition (Mr Peacock) and also the honourable member for Mitchell (Mr Cadman). I said that the Opposition had broken down the spirit of bipartisanship in immigration policy and that the honourable member for Mitchell had given misleading information to the House of Representatives in a speech he made in that House on 7 May. In responding I am going to confine myself essentially to the factual nature of the Prime Minister's statement and point out where it is wrong. The opinions that are expressed there will be debated at another time. On page 12 of the statement the Prime Minister said: It is not enough for the Opposition to assert that it seeks bipartisanship and then by its behaviour to undermine it. Further in his speech the Prime Minister appealed for bipartisanship. I recommend the Prime Minister's own words to him and the Government. It is not good enough for the Government to assert that it seeks bipartisanship and then by its behaviour to undermine it. Bipartisanship is not an unquestioning me- tooism, an attitude that whatever the Government does it can do no wrong and that if we question it at all we have broken down bipartisanship. Oppositions have a right and a duty to question any policy, action, or intention of any government. The present Government asked questions about the former Government's immigration policy, and it did it quite rightly. The matter of immigration policies has been debated on a number of occasions in the House of Representatives this week and the Leader of the Opposition and other Opposition speakers have stated the Opposition's case, but they continue to be misrepresented. I want to refer to a couple of the statements that have been made about the Opposition's policies on immigration, its attitudes towards immigration, as well as its attitudes towards this Government's immigration policy and the action of the Minister for Immigration and Ethnic Affairs (Mr West). On 8 May, when referring to the Fraser Government's immigration policy, Mr Peacock said: The elements of our successful policy should be understood by the Government. They were a balanced migrant intake, an emphasis on family reunion and refugee settlement and on an increasing recognition that in future more and more immigrants would come from non-European sources. We have said it time and again. But the nub of the matter in seeking bipartisanship is that that community support must not be lost as it has been in record time, a little over 12 months, by this Minister. At another stage the Leader of the Opposition said: In my view there are two essential elements to be addressed in a migration policy such as this if we are truly to carry the community with us. We have to recognise the fragility of the concept of community acceptance. Those elements are the people who come here, and the great contributions they make, and the people who were already here. The main charge we have made against the Minister for Immigration and Ethnic Affairs (Mr West) is that an imbalance has occurred over the last 12 months. He denies it; we affirm it. It was under the Fraser Government that the great Indo-Chinese refugee problem arose. That Government embarked on, I believe, a courageous policy, a policy that had some inherent dangers in it which everybody, both Government and Opposition, would have recognised. It was in a spirit of good will, not only from the Government and the Opposition but also from the community, that those people came here and they have successfully settled. In that context the Opposition has frequently given full credit to the then Opposition, now the Government, and specifically to its then spokesman, Mr Mick Young. However, the situation is changing a little. In raising questions about the method of implementation of its immigration policy, as well as details of its immigration policy, the Opposition has now attracted the charge of racism. In May last year a statement on the Government's immigration policy was tabled in the Senate after having been made by the Minister in the House of Representatives the day before. I responded to it on behalf of the Opposition on that occasion and I criticised elements in the shift of emphasis in the Government's policy. Senator Robertson, senator for the Northern Territory, replied. That was an amicable debate. We disagreed with one another, but in essence there was not anything different between the debate last year on the Minister's statement and the warnings we gave about the implications of the shift that that designated and the debate that has gone on recently. Nevertheless, it has blown up; it has become a fire. It is not my intention this afternoon to stir it along. I hope that appeals for bipartisanship by both the Prime Minister and the Leader of the Opposition are followed, that the debate cools down. That does not mean it will go away, because there are some aspects of the Government's immigration policy which ought to be questioned. They were questioned 12 months ago, and rightly so. The Prime Minister in his speech-I am referring to page 8-repeated some statements that have been made consistently as a charge against the Opposition in the last few days. I will quote the statement on the balance or the mix of immigrants. This afternoon the Prime Minister said: This Government does not consider that a 'balance' or 'mix' in our migration program determined on racial grounds can have any place in our society. It categorically rejects the discriminatory concept of quotas, which is implicit in what the Leader of the Opposition has said-- at least that is what the Prime Minister alleges; I do not agree with it- in recent days about increasing the number of European migrants. So the Prime Minister at that stage of his speech rejected the concept of a balance or a mix. But just a little further down, in the next paragraph he stated: We of course acknowledge the need to ensure that our migration program does not threaten the stability and fabric of Australian society. But in working towards this end the Government considers that not only is the size and composition or our intake important, but also the programs within our community to promote the integration of migrants into our society . . . The Opposition agrees with that statement by the Prime Minister. I suggest that when he says composition is important he is saying nothing different from what the Opposition has been saying. In referring in recent times and for quite some time to concern about the mix in the immigration program there has been a vicious attack on the Opposition alleging racism, specifically directed to the Leader of the Opposition and the shadow Minister for Immigration and Ethnic Affairs. I refer once again to the words of the Leader of the Opposition in the House of Representatives on 8 May: All members on this side will dissociate themselves from racist groups and have no truck with them. There is not a member here who will not put such groups down , but there is not a member here who does not have the right to say there has been a change in the balance of the migrant intake. The Prime Minister made some further statements which I suggest were not correct in fact. Again I refer to page 8 of his statement where he said: In the past few days, the Leader of the Opposition has supported his criticism of the Government's Immigration Policy by reference to statistics which he describes as official Government statistics. The basis for his claims has caused some puzzlement to the Government because my colleague, the Minister for Immigration and Ethnic Affairs, has received no request from the Opposition for up-to-date immigration statistics. Further on, on page 10 he stated: I make the further point that the Opposition made no effort to consult the Minister before obtaining the figures. On the one hand we are told that no request for information was made but on the other we have a criticism in relation to figures the Opposition has obtained. I quote from the Hansard of Senate Estimates Committee B on 30 April 1984, when the Department of Immigration and Ethnic Affairs gave evidence to that Committee . Senator Walters asked the following question of Mr Woodward, who holds the position of Deputy Secretary-a very senior official-in that Department: Could you give me the number of applications and the number of approved migrants for the United Kingdom and Ireland, for each country separately in Europe and Asia, and in North America and South America? That was a request for figures. The Minister knows of no such request. Mr Woodward replied: We have the information but it would take a fair time to try to extract it for the countries that you have mentioned. That just does not sit at all with the Prime Minister's statement. The request was made by Senator Walters. We all know that when questions are raised at Estimates committees and information is sought, Ministers are notified of them. Somebody is not doing his job if the Minister for Immigration and Ethnic Affairs truly did not know that that request was made at the beginning of last week by a member of the Senate. Mr Woodward indicated that it could be done but that it would be difficult. It has, of course, been done, in a form-a form that is the attachment to the Prime Minister's statement, a letter from one W. A. McKinnon, Secretary to the Department of Immigration and Ethnic Affairs. The Prime Minister said: Enquiries have now revealed that some figures were in fact obtained by the Hon. Member for Mitchell directly from a junior officer in the Department of Immigration and Ethnic Affairs. . . . . It emerges that the Opposition's figures are in fact wrong and that even these figures have been used in a statistically unsound manner. My colleague, Mr West, has today written to the Hon. Member for Mitchell pointing out this error and giving him revised figures which confirm the Government's consistent advice that the trend of family reunion applications to migrate to Australia from traditional sources in Europe is in fact declining. Mr McKinnon said of Mr Cadman in his letter: Mr Cadman's office approached the Department direct by telephone. The figures supplied are derived from the Migration Program Management System. In the debate this afternoon the honourable member for Mitchell produced for the House a letter signed by one Phillip Richards, Immigration Policy Branch, Central Office. That is the source of his figures. The figures were in writing and they were official. Senator Withers —Not a junior officer. Senator MARTIN —No, not a junior officer and also from the Central Office, which has to be the ultimate authoritative source. That attack on Mr Cadman was quite wrong. I believe that the Prime Minister believed what he said but he was given incorrect information. Senator Dame Margaret Guilfoyle —You think so? Senator MARTIN —At this stage, in the absence of better information I am prepared to make that statement. In conclusion I wish to say a few more things about the letter. As I said at the outset my concern this afternoon is to place on record a number of factual matters or to point out that there were some things in the Prime Minister's statement which are stated as fact but which are wide open to question. The letter I referred to from Mr McKinnon makes a number of points about the statistics in question, statistics on family reunion and origin. A number of tables are also included. It is possible that with longer time to look at those tables and to study the figures extracted from them by Mr McKinnon, I might understand how the figures, particularly those on page 2, depend on the tables that are attached. I cannot see it. I am not suggesting that Mr McKinnon has not given correct figures. I am saying that, interesting though the attached tables are, they do not show us how the figures given on page 2 of his letter are derived. They are used to negative Mr Cadman. The conclusion is not something that I can extract from the information that Mr McKinnon gave. In relation to Mr Cadman's statement Mr McKinnon said: The figures are wrong. The data included in MPMS, which is still being developed, are notoriously unreliable. He said that the Department had done: A complete re-run of the figures, including recourse to the basic data . . . The revised results are attached. You will note that they considerably alter the picture portrayed by Mr Cadman. I hope at some time in the future we will be told why the re-run is more reliable than the original run and why we would be expected to accept that this re-run is necessarily right and that Mr Cadman is necessarily wrong. If the figures are unreliable in relation to Mr Cadman, they are unreliable in relation to the Prime Minister's statement. The second point that Mr Mckinnon makes is that the figures are seasonal and should not be treated by doubling a half-year figure. Because Mr Cadman in his speech on 7 May did double a half-year figure Mr McKinnon said: Thus a doubling of the figures for July-December in any category runs the risk of grossly under or over-estimating the annual rate. The inference throughout the debate today-and in recent days-is that by taking the January-June 1983 figures and doubling them, Mr Cadman was doing something that was misleading people. Mr Cadman said at the time that they were six- monthly figures and he realised there could be an error in doubling them. What is even more important in relation to this is that the figures he does not have- the figures that are given by Mr McKinnon-show that the figures for the half- year that are missing are likely to be larger. Mr McKinnon himself says that there is a risk of grossly under-estimating or over-estimating. The attack on Mr Cadman has been based on an assumption that they were an over-estimate. They could as easily be an under-estimate. I leave my remarks on behalf of the Opposition there for this afternoon. I am sure that the Senate will want to come back to the debate at some future time. There are a number of matters in relation to policy that I would seek to put on behalf of the Opposition. I think it is possible that there might be some other speakers this afternoon who also wish to respond to the statement. I am going to seek leave to continue my remarks so that I can speak at another time but I indicate that I do so not to deny any other senator the right to speak. I seek leave to continue my remarks later. The ACTING DEPUTY PRESIDENT(Senator Colston) —Is leave granted? Senator Tate —Well- The ACTING DEPUTY PRESIDENT —Did I hear an honourable senator say that leave was not granted? Senator Tate —Mr Acting Deputy President, I was just seeking to clarify the situation. Senator MARTIN —Mr Acting Deputy President, if I may for Senator Tate's benefit; I am aware that Senator Harradine wants to speak briefly this afternoon. I do not just want to sit down because then I lose my right to come back and say some other things I want to say when the debate comes up again. I have sought leave to continue my remarks later. That would normally automatically adjourn the debate, but Senator Harradine now seeks leave. Leave granted; debate adjourned. Senator HARRADINE(Tasmania) —by leave-It is my considered view that this debate on immigration has gone too far and it is now time for us to reflect on where we are and to act as leaders of this nation on a matter which is of fundamental importance and which is very sensitive in character. I believe it is time to stop recriminations about this issue, not to consider whether the consensus, as it were, has been broken by reason of the fact that the current Minister for Immigration and Ethnic Affairs (Mr West) has not adequately brought into consultation members of the Opposition, or whether the Opposition started the attack in the first place. I believe that the call of the Prime Minister (Mr Hawke) for a return to a bipartisan attitude and a bipartisan policy on this question warrants the support of all members of the Parliament. I understand that as late as today the Leader of the Opposition (Mr Peacock) has given support to that view. I did not hear all of Senator Chipp's speech yesterday, but I heartily approved of what I heard. I think it was a timely speech. I happen to be of the opinion that, far from the Government being imbalanced in its attitude towards bringing people from Asia, Australia does have a capacity to receive a greater number of refugees than Australia is receiving at present from the troubled areas of South East Asia. I congratulate the previous Government for its humanitarian approach to this issue. I am sure that calm and wiser counsel should prevail. As Senator Chipp said yesterday, how can one open one's door to refugees in one year and then close the door, particularly to their immediate families, their spouses and their children, the next year? I believe that that is not and has never been the attitude of the current Opposition in government. I believe it is not really the attitude of the combined Opposition at present. It is important that we give reaffirmation to a humanitarian policy and to the policy of family reunion. I, therefore, will not say any more, but I do hope that between now and the next time we meet in the Senate chamber the leaders of the parties will get together with the Minister and his Opposition number and discuss this whole issue so that we can restore to Australia a bipartisan, tripartisan, quadripartisan or non-partisan party consensus on this issue. If not, by the time we return to the Senate I suppose the Government will then have to rely on the numbers in this chamber and the other chamber-if that is necessary, so be it-to indicate to the people of Australia what the Parliament as a whole feels about the matter. I hope that that will not be necessary. I sincerely hope that when we meet in a fortnight's time there will have been a restoration of the non-partisan consensus on this issue. Senator GARETH EVANS(Victoria-Attorney-General) —I seek leave to make a statement, being the Government's response to the report of the Senate Standing Committee on Constitutional and Legal Affairs on the National Crime Authority legislation. Leave granted. Senator GARETH EVANS —I seek leave to incorporate the statement in Hansard. I also seek leave to incorporate the two documents that accompany it, namely, the list of all recommendations by reference to the three groups mentioned and a document headed 'Text of All Recommendations and the Government's Response to Each'. Leave granted. The documents read as follows: Ministerial Statement On 1 May 1984, the Senate Standing Committee on Constitutional and Legal Affairs delivered its Report on its reference concerning the National Crime Authority Bill 1983 and the National Crime Authority (Consequential Amendments) Bill 1983. The Report is a particularly helpful and constructive document, showing a keen awareness of the difficulties confronting executive governments in dealing with organised crime, and I am pleased to say that the Government, after discussing the matter with State and Territory Police Ministers and Attorneys-General on 4 May, has decided to accept in very large part the Committee's recommendations. To implement these recommendations will not, in the view of the Government, undermine the essential framework of the Bill or the effectiveness of the Authority. the proposed amendments that I will today circulate will, if accepted , implement the great majority of the Committee's recommendations. Of the total of 49 recommendations of the Committee, 31 are supported wholly or without any significant change, and 8 are supported with some modifications. There are only 10 recommendations which, after very careful consideration and discussions with State Ministers, the Government has decided that it would not be able to support. Included in the first group of recommendations that the Government will support without significant change, are the following: the Authority should be able to recommend the granting to it of references. The general functions of the Authority, in situations when it has not received a particular reference, should be more explicitly stated. the Authority should have the power to arrange for and co-ordinate (if not actually 'create') joint task forces. The Authority should be given access to information held by the Commonwealth agencies not-withstanding statutory secrecy provisions (subject to limited exclusions, to be scheduled or prescribed). ALL hearings of the Authority should be private (thus making the proposed special exception to defamation law in relation to public hearings no longer necessary). Self-incrimination should not be an excuse for failure to produce business records, but should be an excuse in relation to personal records. The period for appointment of members of the Authority should be a fixed term of 4 years with no renewal (but with the ability to make shorter initial appointments). Provision should be made for summary applications to a Federal Court judge by persons aggrieved by decisions of the Authority, and legal aid should extend to such matters. A number of additional matters should be included in the Annual Report of the Authority. (The Government proposes that the Inter Governmental Committee (the ' IGC') should be able to comment on the Report, with these comments being tabled in Parliament). Explicit provision should be made for transfer of all material held by the Costigan Commission to the Authority. The second group of recommendations, that the Government will support with modifications, include the following: The Committee affirmed that self-incrimination should be an excuse for refusal by a natural person to answer questions before the Authority, but this excuse may be removed by an indemnity as to use of the evidence in later prosecutions, provided the indemnity also applied not only to evidence given before the Authority, but also evidence obtained as a direct or indirect consequence of such evidence. The Government accepts this, but believes, (and was strongly supported by State Ministers in this regard) that such indemnities should be given not by the Authority itself but by the DPP or relevant State Attorney-General or DPP. The Committee proposed that the definition of 'relevant offence' be rewritten so as to broaden very significantly the jurisdiction of the Authority. The Government's view, strongly supported by State Ministers, is that while the section can be re-drafted to accommodate some of the Committee's concerns, the jurisdiction of the Authority should continue to be as precisely defined and limited as possible. The Committee recommended that the Authority be empowered to set out in its annual report any matters on which it had sought references including those rejected. The Government agrees, with State Ministers, that rejections should be included only if the IGC, rather that the Authority, is satisfied that to do so would not affect the safety or reputation of persons, or prejudice the operations of law enforcement agencies or fair trial. The Committee recommended that when the Authority executed a search warrant it could seize not only things connected with the Authority's investigations but also things which might assist further investigations by other law enforcement agencies. The Government takes the view that this is an unjustifiable extension, but seizure of things providing evidence for civil remedies by the Crown arising out of the Authority's investigations should be permissible. The Committee recommended that the Minister be precluded from giving directions in relation to a particular case. The Government's view, again supported by the States, is that the Minister should be able to give a direction or guideline as to a particular case, so long as it has the unanimous support of the IGC and that direction is tabled in the Parliament. The Committee recommended that the law be clarified in relation to access by the Authority to tax information in tax-related matters, and further, that the Authority ought to have general access to tax records in carrying out investigations pursuant to a reference, and that it have a general capacity to pass such information to other agencies for investigative and prosecution purposes. The Government agrees that certain aspects of the existing law enabling information to be communicated should be clarified, and that the Authority should have some specific capacity to pass on tax information for investigative and tax prosecution purposes. But given the wide potential jurisdiction of the Authority-much wider than existing Royal Commissions-the Government wishes to retain the pre-requisite of a judicial warrant before tax information is required to be passed by the Commissioner to the Authority. Despite the Government's strongly affirmative response to the great bulk of the Committee Report, there remains a number of recommendations that the Government finds itself unable to accept. The most significant of them are as follows: The Committee recommends that, where only a Commonwealth reference is involved, the approval of the IGC not be required, although it should be consulted. State Ministers, while acknowledging that the issue was not likely to be of great practical significance, asserted that this would substantially undermine the co-operative nature of the whole scheme and the Commonwealth could not expect to be put in a special position. The Commonwealth, for its part, recognises that, for the National Crime Authority to be truly effective and able to achieve the desired objectives, there must be full co-operation between the Commonwealth and all States-indeed to date a remarkable degree of consensus has been achieved. In the Government's judgment, the Committee's proposal, limited as it is to matters involving only references by the Commonwealth (and not extending even to 'mixed' Commonwealth and State references, which are likely to be the norm) is more of presentational than substantive significance, and that, in the interests of maintaining harmony and co-operation, it should not be supported. The Committee proposed that withdrawal of a Commonwealth reference should require an affirmative resolution of both Houses. The Government's view is that this is an unjustifiable restriction on the role of the Executive. It is proposed, however, that the Minister should be required to publish in the Gazette, and table, any such withdrawal. The Committee recommended that, when conducting a hearing, the Authority must be constituted by at least 2 members. In the Government's view, this would impose a severe and unnecessary restriction on the Authority's ability to operate efficiently and expenditiously . The Committee proposed that the requirements for a judicial audit of the operations of the Authority at no more than 3 year intervals, and the application of the Ombudsman Act should be removed. In the Government's view, this would remove very important safeguards, and the States were generally supportive of this approach. The Committee proposed that the name of the Authority should be the 'Australian Crime Commission'. the Government's view, unanimously supported by the States, is that the name should remain the 'National Crime Authority' in order to emphasise the difference from traditional Royal Commissions and United States-style Crime Commissions. In the foregoing I have not dealt with a number of somewhat less significant recommendations. Accompanying this statement is a list of all the Senate Committee recommendations by reference to the 3 groupings discussed above. There has also been prepared a further document setting out the text of each recommendation together with a short statement of the Government's response to that recommendation. I seek leave to incorporate these documents in Hansard. I will also circulate today the amendments that I shall move to give effect to the decisions explained above, to enable Senators to have as much time as possible to study them before debate resumes on the Bill in the week commencing 28 May. Having regard to the very limited time available to the Government to prepare these amendments, it may be necessary to refine them in some respect before the Bill comes on for debate. The changes that the Government is prepared to make in response to the Senate Committee will not affect the essential framework of the existing Bill, nor will they prejudice the general effectiveness of the Authority and its ability to discharge its functions. Nor do we believe that they undermine the careful balance struck in the original Bill between the needs of law enforcement on the one hand, and the need on the other to respect the civil liberties of individuals to ensure that there are no unjustifiable intrusions on those liberties. The Government thanks the Committee once again for the care, speed and sensitivity of its work, and readily accepts that the adoption of its recommendations, subject to the modifications and qualifications set out in this response, will improve the legislation now before the Parliament. List of all Recommendations by Reference to the Three Groups Mentioned RECOMMENDATIONS ACCEPTED WITHOUT SUBSTANTIAL CHANGE 1, 4, 5, 6, 7*, 8, 9, 11, 12*, 13, 14*, 16, 18, 21(a), 23, 24, 26, 27*, 28*, 30 (a), 32, 32, 34*, 35, 39*, 40*, 41, 44, 45*, 46, 47, 48 RECOMMENDATIONS ACCEPTED WITH MODIFICATION 2, 3, 10, 21(b), 22, 25, 29, 30(b), 42 RECOMMENDATIONS REJECTED 15, 17, 19*, 20*, 31*, 36, 37, 38, 43, 49 (*) Indicates recommendations of a less significant nature not specifically referred to above. Text of all Recommendations and the Government's Response to Each (references to amendments are references to amendments to the National Crime Authority Bill unless otherwise indicated) 1. (a) The Bills should be explicitly framed to clearly set out the function, powers and abilities of the Authority at both its ordinary and special levels of operation. (b) The Bills should lay down a clear mechanism by which there can be a transition from the exercise of powers and functions at the ordinary level to their exercise at the special level of operations, including an ability in the Authority, of its own volition, to recommend such transition (paragraph 1.19). Accepted: In so fare as the recommendation urges differentiation between the functions, powers and abilities of the Authority at the 2 levels, this is only clarification of the existing Bill. In so fare as the recommendation proposes that the Authority may recommend transition from one level to another, that is, recommend that a reference be granted to it, the Government, with the support of State Ministers, agrees. (As to paragraph (a) of the recommendation see proposed amendment (9), as to paragraph (b) see proposed amendment (8)). 2. Paragraph (c) of the definition of 'relevant offence' should be deleted ( paragraph 2.7). 3. (a) The definition of 'relevant offence' should be redrafted so as to require the National crime Authority to direct its activities to offences which appear to be connected with one another, involve several offenders, substantial planning and organisation and the use of sophisticated methods and techniques. (b) The Authority should be required to then give particular consideration to types of offences, similar to those set out in paragraph (a) of the definition of 'relevant offence'. These should be set out in an illustrative, not exhaustive, manner (paragraph 2.9). Accepted: The Committee's proposal would result in the definition of 'relevant offence' being rewritten so as to broaden very significantly the jurisdiction of the Authority. The Government's view, which was strongly supported by State Ministers, is that while the section could be redrafted to accommodate some of the Committee's concerns, the jurisdiction of the Authority should continue to be as precisely defined and limited as possible (see proposed amendment (2)). 4. Clause 10 of the Bill should be redrafted to ensure that when the Authority is investigating relevant criminal activities, whether or not under a term of reference, it has the responsibility for ensuring the collection and assembly of admissible evidence (paragraph 2.22). Accepted: This function was previously restricted to the stage when the Authority had been given a reference and the Authority was specifically instructed to exercise this function. State Ministers did not object to the extension which will add to the effectiveness of the Authority (see proposed amendment (9)). 5. The Bill should be redrafted to set down the Authority's ordinary functions and to provide the necessary specific power for it to perform those functions ( paragraph 3.9). Accepted: This represents a clarification of this aspect of the existing Bill ( see proposed amendment (9)). 6. The Bill should be redrafted to enable the Authority as an ordinary function and of its own volition to investigate matters and to collect and analyse information and intelligence relating to relevant criminal activity (paragraph 3 .11). Accepted: This represents a clarification of this aspect of the existing Bill ( see proposed amendment (9)). 7. The ABCI should not be subsumed within the Authority at this stage. The Committee strongly urges co-operation, consultation and, where provided under their respective charters, exchange of intelligence between the two bodies ( paragraph 3.14). Accepted: This recommendation which merely confirms the existing provisions was strongly supported by State Ministers (see proposed amendment (9)). 8. The Bill should be redrafted to provide: (a) that it is a function of the Authority to create Federal task forces and to co-ordinate and supervise investigations by such task forces into 'relevant criminal activity'; (b) with the concurrence of the States concerned, for the creation and co- ordination of joint Federal and State or multi-State task forces (paragraph 3.20 ). Accepted (with minor modification): The Committee's recommendation, if literally applied, would seriously override the responsibilities of Police Commissioners and other persons responsible for participants in Task Forces. The Government proposes therefore that the function in relation to Federal Task Forces would be limited to 'arranging for' and co-ordinating Task Forces (see proposed amendment (9)). 9. The Bill should be amended to empower the Authority to require the transfer to it of information held by any other Commonwealth agency (paragraph 3.22). 10. (a) In the light of the secrecy provision contained in clause 43, which protects the regime of secrecy attaching to necessarily confidential information held by Commonwealth agencies, the Bill should be amended to provide that the various secrecy provisions in Commonwealth legislation preventing the disclosure of information held by Commonwealth agencies should be subsumed within the secrecy provision governing the Authority; (b) provision should be made for a strictly limited range of exemptions in such areas as defence and security, to be listed in a Schedule to the Act; and (c) there should be further provision for the exemptions in the Schedule to be waived by order of the Executive Council, when the Authority is operating under a term of reference and can satisfy the Executive Council that it needs exempt information (paragraph 3.26). Accepted (with minor modification): The Committee's proposal if taken literally would present problems in implementation; for example, the role proposed to be given the Executive Council would not be appropriate for that body. The Government proposes- that the authority may issue summons or notices to Commonwealth agencies requiring them to produce documents or information subject to reasonable excuse (which would encompass matters such as prejudice to security and would thus avoid the need to spell out the equivalent detailed provisions of the FOI Act); and that this provision would prevail over the secrecy provision of existing Acts except such provisions as were scheduled or subsequently prescribed (see proposed amendment (13)). 11. The Bill should be redrafted to provide for the Authority, in exercising its ordinary functions and powers, to receive from the Commissioner of Taxation information relevant to taxation or tax-related offence (paragraph 3.31). Accepted (with minor modifications): The legislation should not go beyond existing law as to what information could be given to Authority in so far as it was enforcing taxation law or protecting the revenue (see National Crime Authority (Consequential Amendments) Bill proposed amendment (1)). 12. The Bill should be redrafted to provide the Authority with the power necessary to enter into arrangements with State instrumentalities, private institutions and persons to receive information from them (paragraph 3.34). Accepted: State Ministers wished any arrangements to be made with State Governments rather than with agencies of those Governments and the Government agrees to this minor modification (see proposed amendment (13)). 13. The Authority should retain a law reform function in the terms of the Bill, which limits proposals on reform to the range of matters arising out of the performance of its other functions (paragraph 3.38). Accepted (see proposed amendment (9)). 14. Recognising the force of the constitutional and practical constraints which favour the involvement of the States with the Federal Government in combatting relevant criminal activity, the Committee recommends the continuation of an Inter-Governmental Committee (paragraph 4.9). Accepted (no amendment required). 15. Clause 11 of the Bill should be amended to require consultation with the Inter-Governmental committee, rather than its approval, before the Commonwealth Minister refers to the Authority a matter relating to a relevant offence against a law of the Commonwealth or of a Territory (paragraph 4.11). Not accepted: The Committee recommends that where only a Commonwealth reference is involved the approval of the IGC would not be required but it should be consulted; the Ministers' meetings was strongly opposed to such a change; State Ministers, while acknowledging that the issue was not likely to be of great practical significance, asserted that it would substantially undermine the co- operative nature of the whole scheme and the Commonwealth could not expect to be put in a special position; the Government recognises that, for the National Crime Authority to be truly effective and able to achieve the desired objectives , there must be full cooperation between the Commonwealth and all States and indeed to date a reasonable degree of consensus has been achieved between Governments. In the Government's judgment, the Committee's recommendation, limited as it is to matters involving only references by the Commonwealth, is merely of academic or hypothetical significance and in all the circumstances the Government has concluded that the recommendation should not be implemented (no amendment). 16. The Bill should be redrafted to make it clear that the effect of a State refusal to concur in the grant of a reference is limited to impending investigation of relevant State criminal activity wholly occurring within that State's jurisdiction (paragraph 4.14). Accepted: This represents clarification of the existing Bill) see amendment (7) ). 17. The withdrawal of a Commonwealth reference before it is competed should only be allowed upon the passing of an affirmative resolution of both Houses of the Federal Parliament (paragraph 4.18). Not Accepted: State Ministers supported the Commonwealth view that this was an unjustifiable restriction on the role of the Executive; the Minister will however be required to publish in the Gazette and table any withdrawal (see amendment (10)). 18. (a) The States should be encouraged as a matter of urgency to enact legislation conferring on the Authority a range of coercive powers available for the investigation of State offences under terms of reference similar to those coercive powers available for the investigation of Commonwealth offences conferred by the Bill on the Authority. (b) The enactment of such reciprocal legislation should not be a precondition for the establishment and functioning of the Authority (paragraph 4.22). Accepted: This represents the Commonwealth's view that, for the Authority to exercise coercive powers in relation to State offences, State underpinning legislation will be required. State Ministers on 4 May sought Commonwealth assistance in the preparation of such legislation (no amendment involved). 19. Clause 9(2) should be redrafted to provide that the Inter-Governmental Committee, before approving reference of a matter to the Authority, shall take into account whether ordinary police methods of investigation into the matter are likely to be effective (paragraph 4.28). Not accepted. The existing Bill requires Inter-Governmental Committee to be satisfied that ordinary police methods of investigation are not likely to be effective. Ministers on 4 May concluded that this is an essential requirement which in appropriate cases would be satisfied with no real difficulty (no amendment). 20. (a) The operation of sub-clauses 8(7), which provides for electronic voting by members of the Inter-Governmental Committee should be limited to cases of urgency or unanimity. (b) Sub-clauses 8(2) and 8(3) should be amended to provide that the Minister, the member of the Inter-Governmental Committee, can attend through a ministerial colleague whom he delegates, rather than, as is presently provided, through any person (paragraph 4.33). Not accepted. Commonwealth and State Ministers on 4 May concluded that the existing provisions of the Bill met a real practical need having regard to the exigencies of Ministerial life. In any event, the suggested restriction as to electronic voting to cases of urgency was almost meaningless because the majority of those voting would determine whether a matter was urgent (no amendment). 21 (a) The Bill should be amended to specifically empower the National Crime Authority to request a meeting of the Inter-Governmental Committee to seek a reference on an area of relevant criminal activity. Clause 46(6) should be amended so as to allow the Authority in this context to put before the Inter- Governmental Committee such information as it considers necessary to argue the case for a reference. (b) Provision should be made for the Authority to set out in its annual report any matters on which it has sought references from the Inter-Governmental Committee, including those which were rejected. Such information should be so set out, however, only if the Authority is satisfied that to do so will not affect the safety or reputation of persons, or prejudice the operations of law enforcement agencies or the fair trial of a person who may be charged with an offence (paragraph 4.39). Accepted as to (a). As to (b) modification is required. As to (a): It is reasonable that the Authority would be able to request a meeting of the IGC to seek a reference and in so doing put forward matter that, contrary to sub-clause 46(6) of the Bill in its present form, would prejudice the reputation of persons, but the IGC would not publish the matter further (see amendment (8)). As to (b): Ministers on 4 May concluded that the IGC rather than the Authority should determine whether disclosure of the matters would affect the safety or reputation of persons or prejudice operations of law enforcement agencies or a fair trial (amendments (57) and (58)). 22. Clause 24(2) of the Bill should be amended: (a) by deleting paragraph (b), which requires the Authority to set out as far as reasonably practicable the general nature of the matters in relation to which it intends to question a person; (b) by deleting the proviso to sub-clause (2) which allows the Authority to question a person called as a witness in relation to any other matter that the Authority is authorised by a reference to investigate (paragraph 5.9). Accepted: The Government accepts that para 24(2)(b) will need to be rewritten to make clear that it is for the guidance of the Authority only and will not be the basis for technical legal objections. This would appear to meet the substance of the Committee's concern (see amendments (30) and (31)). 23. Where a witness properly claims that the answer to a question or the production of a document or thing may incriminate him, the Authority itself should expeditiously determine whether it will require that answer, document or thing, but where it does abrogate a properly made claim of privilege the appropriate indemnity should operate. A person aggrieved by a decision of the Authority should be granted an adjournment to seek judicial review of the existence of reasonable grounds for the recognition of the privilege (paragraph 5.16). Accepted: In so far as it proposed that an indemnity would abrogate an objection on the grounds of self incrimination, it is consistent with the existing Bill (see amendments (44) and (45)). 24. The privilege against self-incrimination should be recognised only if claimed by natural persons (paragraph 5.22). Accepted: Consistent with existing Bill (see amendment (44)). 25. In the case of oral testimony by natural persons, the privilege against self-recrimiantion should be recognised. A discretion to abrogate the privilege and compel the giving of answers should be vested in the Authority. Such abrogation should be accompanied by the grant to the witness of a use derivative use indemnity in relation to the use of such evidence in any criminal proceedings against him. The abrogation should carry no indemnity in relation to civil proceedings (paragraph 5.34). Accepted with modification: In so far as the recommendation is that an indemnity to abrogate the exercise of self-incrimination should be granted by the Authority, the Government differs from the Committee. A decision as to grant of indemnity should be made by a high officer outside the Authority able to take into account wider considerations. In the case of Commonwealth offences, this should be the DPP; in all State offences the relevant State Attorney-General ( see amendments (35) to (43)). 26. The Bill should define the concepts of 'record of a business' and 'record of a financial institution' and require natural persons who are subpoenaed to produce such records in their pissession, without recognition of any claim based on the privilege against self-incrimination (paragraph 5.41). Accepted (see amendments (1) and (44)). 27. The Bill should be amended to provide for a notice to produce procedure, requiring a witness to produce relevant documents to a designated officer of the Authority at a time and place specified in the notice (paragraph 5.45). Accepted: Provided the witness is entitled to the same privileges and excuses as would be available to him if he produced the documents to the Authority in the course of a hearing, the procedure has merit (see amendment (13)). 28. A section should be inserted in the National Crime Authority Bill in similar terms to section 6A (3) of the Royal Commissions Act 1902, which provides in effect that, once a person has been charged with an offence and that offence has not been finally disposed of, that person may refuse to produce a document or thing or to answer a question on the ground of self-incrimination ( paragraph 5.49). Accepted: This will be consistent with section 6A (3) of the Royal Commissions Act (see amendment (44)). 29. The Authority should have access to taxation records for the purpose of carrying out investigations under a reference. This access should be obtained in the same manner as applies to Commonwealth agencies and Royal Commissions already designated in s.16 of the Income Tax Assessment Act for the purpose of administering their laws. The information so obtained should be able to be further passed over for use in the preparation of prosecutions and civil remedies claims (paragraph 5.60). Accepted with modification: The existing Bill provides for access by the Authority to taxation information under a warrant granted by a judicial officer. This represents a necessary safeguard having regard to the implications, so far as the privacy of individuals is concerned, of access to taxation information. While the Government will adjust the existing provisions of the Bill to remove a practical difficulty identified in consultations with the Committee, it does not believe that it should remove the requirement for a judicial warrant or the existing requirement that taxation information should be usable only for criminal intelligence and not as evidence for prosecutions. It will, however, amend the Bill to enable the Authority to pass the taxation information to other law enforcement agencies for criminal intelligence purposes (see National Crime Authority (Consequential Amendments) Bill amendment (1)). 30. (a) Clause 18 (1) (a) should be amended to provide that, where the Authority has reasonable grounds for suspecting that at that time, or at some definite future time within the one month life of the warrant, there is likely to be upon any land or upon or in any premises, vessel, aircraft or vehicle etc some relevant thing, it may apply to a judge for a warrant. (b) The provision should be further strengthened by providing in sub-clause 18 (6) that the Authority can deliver to the Attorney-General, or to law enforcement agencies, seized evidentary material, not only which may afford evidence for a prosecution or the taking of civil remedies, but also which may assist in further investigations by these agencies (paragraph 5.65). As to (a) accepted. As to (b) accepted with modification: In the Government's view (which was strongly supported by State Ministers), it would be oppressive to permit seizure of material merely relevant to inquiries by other law enforcement agencies. The Government will, however, extend the existing provision to seizure evidence for civil remedies arising out of the Authority's investigations (see amendments (14 ) to (17)). 31. The Authority should be empowered to apply to a judicial officer for an order to arrest a person where there are reasonable grounds for believing that the person is about to leave Australia to avoid giving evidence to the Authority (paragraph 5.72). Not accepted: The Government believes that the existing provisions of clause 20 enabling the seizure of the passport of a witness suspected of intending to leave Australia are sifficient and the moe draconian procedure sugggested by the Committee cannot be justified. The State Ministers supported this view (no amendment). 32. The Bill should be amended to provide that all hearing of the National Crime Authority should be held in private (paragraph 6.15). Accepted: This is not essentially inconsistent with the theme of the existing Bill. State Ministers were generally supportive (see amendments (19) to (21)). 33. Clause 21 (15) of the Bill should be deleted from the Bill and the traditional defence of fair and accurate report of proceedings should be allowed if public hearings are permitted (paragraph 6.20). Accepted: Having regard to the Government's decision as to recommendation 32, the provisions referred to in this recommendation are unnecessary (see amendment (26)). 34. When the Authority has ordered that evidence be held in confidence, a trial judge may, in his discretion if he considers that a finding as to the guilt or innocence of the accused may turn on that evidence, direct the Authority to make the evidence available (paragraph 6.26). Accepted: State Ministers agreed (see amendment (24)). 35. Clause 29 (1) should be amended to provide for fixed terms of four years for members of the National Crime Authority with no provision for renewal. In addition, provision should be made upon the Authority's establishment to stagger the terms of office of members, so as to enable continuity of experience and leadership (paragraph 7.10). Accepted: The provision will permit initial appointments of up to 4 years so that appointments of all 3 members do not terminate at the same time (see amendment (48)). 36. Clause 21 (2) should be amended to require that when conducting hearings the Authority should be constituted by at least two members (paragraph 7.16). Not accepted: This would represent a serious and unnecessary impediment to the effective and expeditious working of the Authority. It means that the Authority could only have one hearing at a time throughout Australia. State Ministers were strongly of the same mind (no amendment). 37. Clause 47, which provides for a judicial audit of the Authority, should be deleted from the Bill (paragraph 8.7). Not accepted: The Government believes that judicial audit is a necessary and effective safeguard. State Ministers were of the same mind (no amendment). 38. Clause 44, which provides for the Ombudsman Act 1976 to apply to the National Crime Authority, should be deleted (paragraph 8.12). Not accepted: The Ombudsman is another effective safeguard against unjustifiable and oppressive intrusions on citizens' rights. State Ministers were supportive (no amendment). 39. Clause 48 (2) (b) should be amended to include after the words ' a description' the words, 'including by way of statistics . . .' (paragraph 8.16). Accepted (see amendment (56)). 40. A new paragraph 48 (2) (f) should be added to the Bill, requiring the Authority's annual report to detail the number and outcome of appeals and other judicial proceedings concerning the Authority (paragraph 8.18). Accepted: While accepting the recommendations, State Ministers urged (and the Commonwealth agreed) that the IGC should have an opportunity to comment on the Report and that these comments should be tabled together with the Report (see amendment (55)). 41. The National Crime Authority should be empowered to recommend the tabling of its report on a reference in the Parliament (paragraph 8.22). Accepted (see amendment (53)). 42. (a) Clause 16 should be amended so as to make it clear that, in furnishing guidelines or giving directions to the Authority, the Minister is precluded from so doing in relation to a particular case. (b) Sub-clause (3) of clause 16 should be amended so as to require the Minister to table a copy of the directions or guidelines in the Parliament within 15 sitting days of their publication in the Gazette (paragraph 8.30). Accepted with modifications: The Government's view, strongly supported by the States, was that there could be exceptional cases where the Minister could appropriately give a direction to the Authority in a particular case. To provide for this, the Government will amend the existing provision to require the unanimous support of the IGC before the Minister gives a direction in a particular case (see amendment (12)). 43. Clause 46 (1), (2) and (3) should be amended to remove the ability of the Minister of the Commonwealth or of a State to require the Authority to provide information concerning a specific matter in relation to its operations, where the provision of such information could prejudice the safety, or reputation or fair trial of persons, or the operations of law enforcement agencies (paragraph 8.32). Not accepted: The view of the Government and of the Ministers is that such a provision would diminish the requisite Ministerial control (no amendment). 44. (a) The Bill should be amended to provide a person aggrieved by a decision of the Authority with a right of summary application to a judge of the Federal Court or of a State Supreme Court for redress of his grievance. It should be specified in the Bill that this remedy will replace an existing right to remedy under the Administrative Decisions (Judicial Review) Act 1977. (b) If there is a dispute as to the Authority's right to have subpoenaed documents in its possession, the Bill should provide for them to be sealed and placed in the custody of the appropriate court official, pending the outcome of any application for a remedy against the Authority (paragraph 8.39). Accepted (see amendment (50)). 45. The Bill should authorise the Commonwealth Attorney-General or the Special Minister of State to make agreements similar to those provided under the United States Organised Crime Control Act for the protection of witnesses (paragraph 9. 2). Accepted (see amendment (47)). 46. (a) The provision of the Bill relating to legal professional privilege in clause 25 (3) should be maintained, but it should be made clear that the privilege is to operate on the narrow basis set down in the recent High Court decisions in Baker v Campbell and Grant v Downs. (b) Disputes as to the existence of a claim to legal professional privilege should be settled by way of summary application to a judge of the Federal Court or of a State Supreme Court. During the hearing of such applications, any documents the subject of dispute should be sealed and placed in the custody of the appropriate court official pending the outcome of the application (paragraph 9.8). Accepted: As to (a) while accepting that legal professional privilege should be maintained, the Government does not think it appropriate to define the privilege which has been fully explained in recent High Court decisions (as to (b) see amendment (45)). 47. Clause 23 should be amended to widen the range of tribunals in respect of appearances before which financial or legal assistance may be granted by the Attorney-General (paragraph 9.12). Accepted (see amendment (27)). 48. Provision should be made in the Bill for the transfer to the National Crimes Authority of all materials and information held by the Royal Commission into the Activities of the Federated Painters and Dockers Union and of criminal intelligence gathering by the Office of Special Prosecutor Redlich (paragraph 9. 19). Accepted (see amendment (49)). 49. The title of the agency to be established under the Bill should be the ' Australian Crime Commission' (paragraph 9.23). Not accepted: The meeting of Ministers unanimously concluded that the name should remain the National Crime Authority in order to emphasize the difference from traditional Royal Commissions and United States Crimes Commissions (no amendment). Senator GARETH EVANS —I also table a total of five other documents, all of which will be circulated immediately to honourable senators in their offices. They are : Amendments and new clauses to be moved by the Government to the National Crime Authority Bill; an explanatory memorandum on those amendments and new clauses; a document entitled 'Amendments to be moved to the National Crime Authority ( Consequential Amendments) Bill; an explanatory memorandum about that; and, finally, a black letter memorandum to assist honourable senators in fighting their way through the jungle. Some of the latter documents have only just come to hand but they will be circulated immediately to honourable senators. I seek leave to table all the documents. Leave granted. Senator GARETH EVANS —I move: That the Senate take note of the statement. Senator CHIPP(Victoria-Leader of the Australian Democrats) —by leave-I will not break the harmony of the day, but I do want to make a brief point. I do not know whether it is the Government's fault, but the Government will realise that it was given leave by the Opposition, the Australian Democrats and by Senator Harradine in the last hour or two to bring in at this late stage on this Thursday afternoon statements on four extraordinarily important matters: Immigration, the strategic basis paper, education and the National Crime Authority. Really it is just not good enough to ask the Opposition, the Australian Democrats and Senator Harradine at this stage of the game to make a concerted, cohesive, sensible and sensitive approach to these extraordinarily important matters. I do not know whether it could have been avoided, but I just want to raise the Australian Democrats' objection to it. Senator GARETH EVANS —(Victoria-Attorney-General)-by leave-I have been responsible for two of these statements. One of them-the one on the National Crime Authority-was absolutely unavoidable because enormously complex responses were involved and the drafting and the material that has been presented to the Senate was literally complete only a few minutes ago. It was simply not possible to do otherwise. In any event, this matter will be the subject of a full debate in the Committee stage of the Bill as soon as we resume. I apologise for the lateness of the strategic basis paper, for which I also assume some responsibility. It was the Government's intention to have it in first thing this morning, but it came to me in a most incomplete form when I arrived in my office this morning. As a result, it was not possible to put it down in that form. I do apologise to the Senate because I fully appreciate the point that Senator Chipp is making. Senator DURACK(Western Australia)(5.57) —I rise to speak to the motion moved by the Attorney-General (Senator Gareth Evans) that the Senate take note of the statement, which incorporates the rest of the material that he has tabled. I associate myself with the remarks of Senator Chipp and also the remarks made by Senator Chaney earlier today about the way in which all these major statements by the Government have been brought in at the end of this two-week sitting period. I hope that the Attorney-General will take note that some of the material he has tabled-that is, the amendments that the Government will move to the National Crime Authority Bill in the form in which I understand they are going to be-will be printed, which will mean that it will be much easier for us to read it, and that the material will be made available to us early next week and not when we come back here in two weeks time. I believe that the Government's response to the report of the Senate Standing Committee on Constitutional and Legal Affairs on the National Crime Authority legislation is very disappointing. It is very surprising in the light of the Attorney's own response to the Committee's report when it was first tabled in this Senate about a week ago. His initial response seemed to indicate more or less a total acceptance of the Senate Committee's report. Senator Gareth Evans —The general thrust. Senator DURACK —The Attorney-General says he accepted the general thrust of it. We will see how far he has observed the general thrust of it. Certainly it was a very sympathetic response. It seems to me that the Attorney, his colleagues in Cabinet, or his colleagues in Caucus have succeeded in virtually emasculating the major thrust of the report. This ministerial statement, which I will deal with in a minute, refuses to accept several of the key recommendations of that report. That is why I say that the Government has made a very surprising volte- face since the Attorney spoke a week ago. I remind him that I asked him whether the education, which he seemed to think many people had had as a result of the Senate Committee report, would extend to his colleagues. It seems pretty clear from this response that it certainly has not done so. I commend the Attorney, and the Government for that matter, for the prompt way in which they have responded to this report. The Senate Committee report is a long and detailed one and has a total of 49 recommendations. Certainly it is an area which, in some cases, is quite technical. It has been a very major task for the Government to process it and respond to it in the way it has. Of course, the Government has been working on this whole area now for over 12 months. It brought in an inadequate Bill in the first place. Preferably, if it had simply gone on with the Fraser Government's National Crimes Commission Act which had already been passed by this Parliament, this whole problem would have been resolved many months ago. But because of the dithering and the watering down of that Fraser legislation and because of the great conflicts that emerged in the Labor Caucus in particular, and between the Government and some of the Labor State governments, we have seen this pathetic exercise which went on month after month last year and finally gave birth to the National Crime Authority Bill which is now the subject of the report of the Senate Committee. This afternoon we are debating the Government's response to that report. I cannot help recalling that, in one of the many debates we had last year, I referred to a statement of the Attorney in respect of these seemingly endless discussions that were going on over those months last year where he said, in answer to a question from a journalist: 'We will get something'. I regret to say that that seems to be the attitude of the Attorney and the Government to this most important and vital problem. The Attorney said in his statement today: Of the total of 49 recommendations of the Committee, 31 are supported wholly or without any significant change, and 8 are supported with some modifications. There are only 10 recommendations which . . . the Government has decided that it would not be able to support. But one cannot evaluate a response just in terms of statistics. One has to look to see what are the recommendations that are accepted, what are the recommendations that have to be modified and, most important of all, what are the recommendations that will be rejected. It is to those that I turn first of all. In my view-I would be surprised if the Committee would not agree with me- the Committee's most important recommendation is: The Committee recommends that, where only a Commonwealth reference is involved- - that is, a reference about a Commonwealth investigation or desired investigation into the National Crime Authority-- the approval of the IGC should not be required-- That was one of the major criticisms of the legislation-that, under this great bureaucratic superstructure the Government had created in the Bill, the Commonwealth's ability to refer a matter for investigation within Commonwealth law only could be vetoed by the inter-governmental committee. The Senate Committee, very wisely and most importantly, recommended that that veto power should be removed. The Opposition thoroughly agrees with that view. Now we find that this is the first item, certainly it is the most important item, that the Government says it will not accept. That is a most disappointing and very serious matter indeed. Even if that was the only matter rejected by the Government-the Attorney could have the statistic of only one rejection out of 49 recommendations-it would still be a major one indeed. It greatly tarnishes the Attorney's claim that the Government has accepted the general thrust of the Senate Committee report. The Committee also recommended several other important matters, namely: . . . withdrawal of a Commonwealth reference should require an affirmative resolution of both Houses. That was rejected by the Government. The Committee recommended: . . . that the requirements for a judicial audit . . . and the application of the Ombudsman Act should be removed. That has also been rejected by the Government. I am just giving examples of the importance of the matters. When I say 'the importance of the matters' I mean the importance with which the Government should view them in order to ensure that this Crime Authority will be able to act fearlessly, effectively and independently. These are terribly important matters which were recommended by the Committee with those purposes in mind. They have now been rejected by the Government. I refer to another important modification of one of the Senate Committee's references-I do not intend to go through all of them in detail-which states: The Committee proposed that the definition of 'relevant offence'-- that is, offences that the Authority would have the power to investigate- be rewritten so as to broaden very significantly the jurisdiction of the Authority. Again, this is a very important restriction on the Authority which is written into the National Crime Authority Bill. I was very pleased to see that the Senate Committee had recommended much widening of this definition. I agree that there could be debate about how it could be done. The Government, stated in its response: The Government's view, strongly supported by State Ministers-- I can understand that- is that while the section can be re-drafted to accommodate some of the Committee 's concerns, the jurisdiction of the Authority should continue to be as precisely defined and limited as possible. There is probably no matter in this whole question which will trammel the Authority more and make it more likely to be challenged by these crime bosses with vast sums of money and prevent it going forward as expeditiously and efficiently as possible. I believe that the Government, far from having accepted the general thrust of the Committee's report, is emasculating the Senate Committee's response. It is making a mockery of its professed resolve to fight organised crime. As I have said, crime bosses will sleep much easier as a result of this Government's weak- kneed rejection of the many excellent recommendations of the Senate Committee. There is no possible justification for the Government's rejection of the Committee's recommendation that the approval of the inter-governmental committee should not be required where only a reference under Commonwealth law is proposed . The removal of the State veto on purely Commonwealth investigations is absolutely central, as I said, to the Committee's findings. The veto power in the Government's Bill was a major point of criticism by expert witnesses who appeared at the inquiry. I have had some opportunity over the last week also to give some study to the Committee's recommendations. But at this stage the Opposition has been awaiting the Government's response before it considers what its response will be and I am able to speak only in the general terms in which I have been speaking. Senator Missen —There is no response to my report either. Senator DURACK —I am coming to that. I would not dream of overlooking the honourable senator's report. I regard Senator Missen's report as a most valuable one. Opposition senators-Hear, hear! Senator DURACK —I am glad to find that obviously I will have some votes from my Party if I recommend the acceptence of some of Senator Missen's recommendations. I believe that his dissenting report shows a very good understanding of the practical necessities of criminal investigation and the needs of this new body which we would prefer to call a national crimes commission. I know that the name is somewhat embarrassing for the Labor Party because of the initials NCC. But I think the Committee made a good suggestion to overcome that problem. I assure Senator Missen that I personally and the Opposition will be giving very sympathetic consideration to all his recommendations. Whether they will all be accepted is another matter but certainly I believe that they show a very real understanding of the problems and the way to overcome them. The Opposition will be giving them very sympathetic consideration in the next fortnight. As I have said, I am most disappointed by the Government's response. I would not have been surprised if it had not been for the response that the Attorney- General made himself the other day when he spoke initially. I refer to the Government's record in relation to this vital matter and all the shilly- shallying which went on all through last year. I have some sympathy for the Attorney-General because I believe he has been anxious to have a more effective body than has been thrust upon him by his colleagues here and in the States. This response is in line with the general weak-kneed approach to this matter by the Government. The Prime Minister (Mr Hawke) made a promise in his usual flamboyant style in this chamber at the opening of the National Crime Commission conference. We learnt, as we have learnt in so many other matters, that there is a great gulf between the promise and the performance of this Prime Minister. Senator MISSEN(Victoria)(6.14) —I want to say only a few words on this matter. Having seen this document for the first time a few minutes ago I have done no more than scan it briefly. I have not seen the amendments. I thank Senator Durack for his kind remarks about my minority report which does not get the slightest mention, as far as I can see, in the document of the Attorney-General (Senator Gareth Evans). No doubt he does not want to have any of the strengthening measures in the National Crime Authority Bill which I have suggested are necessary. When one gets up, as the Attorney-General does and cites the number of recommendations that the Government has accepted, the number it has partly accepted and the small number, only 10, that have been rejected, one gets suspicious straight away. One has only to read the 10 at the end to realise that the important things which the Committee is recommending have been rejected. I have plenty of criticism for the weakness of many of the recommendations but most of them were valuable. Consequently, it will be very interesting to see the attitude of the Australian Democrats who have already gone to water so far as the Committee is concerned, in my opinion. It will be very interesting to see whether they are prepared to swallow this further insult by the reduction further by the Attorney-General and his Party of recommendations of the Committee. I feel greatly strengthened by what I see as the continued erosion of the determination of the Government. I am strengthened in thinking that we on this side should be able to put a very strong case against this and, I hope, take it to the people to ensure that at some time we will be in a position to have a crime commission which will do something effective and will not mislead and defeat the purposes of the Australian public by allowing organised crime to continue to run rampant in the community. We will study this matter very closely over the next couple of weeks before it comes on for debate. Senator Gareth Evans —I hope you do, preferably before you open your mouth again . Senator MISSEN —The Attorney-General should not tell me about opening my mouth. He has the widest mouth in the Parliament. He shoots from the hip all the time. He should not criticise someone for opening his mouth. Senator Gareth Evans —You could not even get the Committee to agree with you, let alone anyone else. Senator MISSEN —I am not very unhappy about not getting the Committee to agree. I do not feel any weakness by reason of the fact that others have not seen it as clearly as I have. All I need to do is get my party colleagues, when they make a decision, to agree. It is pretty obvious that they agree that this is a highly inadequate document and a highly inadequate Bill. Unless we have a decent and strong Bill it is not worth putting it through and deceiving the Australian people. I look forward to the debate on this matter in a fortnight, more than ever when I see the weakness and the idiocy of the Government's response. Debate (on motion by Senator Robertson) adjourned. The ACTING DEPUTY PRESIDENT(Senator Townley) —I inform the Senate that Mr President has received a letter from the Leader of the Opposition in the Senate requesting that Senator Durack be discharged from further attendance on the Standing Committee on Regulations and Ordinances and nominating Senator Archer to be a member of that Committee. Mr President has also received letters nominating Senators Harradine and Zakharov to be members of the Committee in accordance with the resolution of the Senate this day. Motion (by Senator Walsh)-by leave-agreed to: That Senator Archer, having been duly nominated in accordance with Standing Order 36A, and Senators Harradine and Zakharov, having been duly nominated in accordance with Resolution of the Senate dated 10 May 1984, be appointed members of the Standing Committee on Regulations and Ordinances. Bill received from the House of Representatives. Ordered that the Bill may be taken through all its stages without delay. Bill (on motion by Senator Walsh) read a first time. Senator WALSH(Western Australia-Minister for Resources and Energy)(6.20) —I move: That the Bill be now read a second time. I seek leave to have the second reading speech incorporated in Hansard. Leave granted. The speech read as follows- On 7 September 1983 the Attorney-General introduced into this chamber a Bill indentical in all respects with this Bill. That Bill was a revision of an earlier Bill which my colleague the Minister for Veterans' Affairs introduced on 31 May 1983. Honourable senators will recall that both those Bills were defeated in this place on a tied vote. The Bill I am now introducing is designed, as indeed was the Bill introduced on 7 September 1983, to give effect to this government's election undertaking to recover personal tax avoided by former owners of companies that were the subject of bottom of the harbour schemes. In addition, the Bill proposes to strengthen and improve in several identified areas the legislation introduced by the opposition parties in 1982 to recoup company tax that was evaded by the use of those schemes. Mr President, as I have said, the present Bill does not vary from its progenitor and I think it will suffice if I draw honourable senator's attention to the Attorney-General's second reading speech on introduction of that Bill for an explanation of the main features of this Bill. In that second reading speech the Attorney-General also referred to an amendment of an evidentiary provision in the recoupment tax law that was being made for reasons connected with a constitutional challenge in the High Court to the validity of the legislation. The amendment proposed to vary the evidentiary provision so that a certificate by the Commissioner of Taxation specifying the amount of a company's liability to company tax would be prima facie, rather than conclusive, evidence. Honourable senators will be aware that the High Court recently held unanimously that the substantive provisions of the recoupment tax legislation are constitutionally valid. All members of the court, however, expressed views that the existing conclusive evidence provision might, at least in part, be invalid. The proposed amendment will ensure that the evidentiary provision is constitutionally valid in all respects. Mr President, by re-presenting the measures contained in the earlier Bill, the Government again demonstrates its determination to make every effort to give effect to its election commitments in relation to 'bottom of the harbour' schemes. I now give notice that the Government is resolved to press this matter in this chamber and intends that the opposition parties should stand and be counted by the Australian public for their obstructive attitude on anti-tax avoidance legislation. The measures contained in the bill are estimated to yield $270m in total, and they deserve to be given the approval of the Parliament. As is usual with amendments of the taxation laws, an explanatory memorandum giving technical details of the amendments contained in the Bill is being circulated to honourable senators. I commend the Bill to the Senate. Debate (on motion by Senator Reid) adjourned. Bill received from the House of Representatives. . Ordered that the Bill may be taken through all its stages without delay. Bill (on motion by Senator Walsh) read a first time. Senator WALSH(Western Australia-Minister for Resources and Energy)(6.20) —I move: That the Bill be now read a second time. I seek leave to have the second reading speech incorporated in Hansard. Leave granted. The speech read as follows- This Bill, like the one I have just introduced, is identical with the earlier Bill by the same title. That Bill was not, following defeat of the amending assessment Bill to which it related, proceeded with in this chamber. This Bill will formally impose a tax, to be called dividend recoupment tax, on the dividend amount determined in accordance with the rules being inserted in the recoupment tax legislation by the amending assessment Bill. The underlying purpose of the amendments is to recover personal income tax escaped by individual former owners of stripped companies. That will be done in a direct manner wherever possible. However, in cases where former owners held their shares through interposed companies or trusts recovery may in certain circumstances be by way of imposing on one or more of the interposed companies or trusts a tax equivalent to the maximum personal rate of tax applying in the year of income in which the shares in the stripped company were sold. This Bill will impose that tax. I commend the Bill to the Senate. Debate (on motion by Senator Reid) adjourned. Senator WALSH(Western Australia-Minister for Resources and Energy) —I table the report of the Tertiary Education Commission and seek leave to incorporate in Hansard a tabling statement on behalf of the Minister for Education and Youth Affairs, Senator Ryan. Leave granted. The statement read as follows- For the information of honourable senators, I present the report of the Commonwealth Tertiary Education Commission for the 1985-87 Triennium, Volume 1. The Report consists of five parts: Part 1 contains the Commission's recommendations for the development of tertiary education during the next three years; Part 2 is appendixes which provide supporting material for Part 1; Parts 3 to 5 are the Advices of the three councils. The Report deals with the needs and priorities of tertiary education over the next triennium, including the level and direction of growth, policies on specific issues referred to the Commission by the Government in its Guidelines Statement in July 1983, and the allocation of resources among the three sectors. Honourable senators will recall that the Guidelines, which I announced on 28 July, 1983, formed a central part of the implementation of the Goverment's policies for education. The Guidelines sought advice on general recurrent and capital funding for tertiary education with particular regard to the following: the effectiveness of the Commission's tertiary education prorams in terms of improved participation rates and equity, and further measures to improve participation. the future supply and demand for higher education. the relative roles and funding responsibilities of the various parties in the professional development of teachers. the relationship between the three tertiary sectors. the future of special research centres. equality of access to tertiary education. a number of matters relating to Technical and Further Education including: Adult literacy TAFE-Industry Cooperation Country TAFE Facilities options for the future of Basic Nurse Education. Arts education and training. and other items as detailed in the Guidelines. The Commission's Report puts forward a number of options for the future. The Government will consider the report in detail in formulating its Guidelines for the 1985-87 triennium and will announce its decisions as soon as possible. Senator Sir JOHN CARRICK(New South Wales)(6.22) —I move: That the Senate take note of the papers. One hour and 20 minutes ago I was given six volumes of documents, containing 1, 059 pages, which comprise the important report of the Commonwealth Tertiary Education Commission, and a tabling statement. The statement by the Minister for Education and Youth Affairs, Senator Ryan, is illuminating. With regard to those six documents, it states: The Commission's Report puts foward a number of options for the future. That is what the Senate is invited to take from a tabling statement or a report which consists of 1,059 pages. I put aside the fact that the ordinary courtesies were not shown. The documents and the tabling statement should have been made available at least two hours before they were tabled. That may not have been possible; I do not know. What should have happened is that within the tabling statement some clues ought to have been given as to the nature of the report. Instead, the tabling statement directs itself to the guidelines set by the Minister, but everyone in the Senate knew that the Minister had directed to the Commission the guidelines for the report. It is quite outrageous that one should receive a most important 1,059-page document in this way. It is a grave discourtesy on the Minister's part that she saw the Senate in such contemptuous terms that, in her statement on the report, she said: The Commission's Report puts forward a number of options for the future. That is a disgrace. In view of its condition of disrepair, it has not been possible to peruse the document or even the summaries. I therefore seek leave to continue my remarks later. Leave granted; debate adjourned. Motion (by Senator Walsh) proposed: That the Senate do now adjourn. Senator MESSNER(South Australia)(6.25) —I raise a matter in connection with events which occurred at the Victorian special State Conference on Uranium, held in Melbourne on 28 November last year. It concerns the Attorney-General (Senator Gareth Evans), and I had hoped that he would have been present in the chamber during my remarks. He may not have reached the chamber yet, by virtue of the fact that the adjournment debate began a little earlier than usual. The matter to which I refer is one which has been the subject of a couple of questions from me in the course of the last day or two. It concerns the alleged sale of stolen Commonwealth property in the course of a meeting which was held in Melbourne at that time. The matter came to my attention as a result of representations from a constituent in Adelaide, who had seen a television program on Nationwide on Monday, 28 November. The program showed, in the course of its discussion of the uranium issue, the presence of certain Hawke Government Ministers at that special conference and mentioned also activities which took place at that conference and members who were present at the presentation and display of signs which had been stolen from the Pine Gap defence facility establishment in the course of a march which took place there a week or two before the conference. As a result of the representations, I wrote first to the Minister for Administrative Services, Mr John Brown, on 14 December 1983, setting out my constituent's complaints about this matter and asking whether action was proposed to be taken by the Government against those who had undertaken the alleged sale of the stolen Commonwealth property. I received a reply from the Minister on 20 January 1984 to the effect that it was not a matter which he could deal with and that he was fowarding that correspondence to the Minister for Defence, Mr Scholes, for his attention. Subsequently I received a letter dated 20 February 1984 from Mr Scholes, who indicated that he had forwarded the matter to the Special Minister of State (Mr Young), for the attention of the Australian Federal Police to see what should be done about the matter. Although I did not know that Mr Brown had also forwarded my correspondence to the Attorney-General, I did receive a letter from the Attorney-General dated 10 February 1984 which also indicated that he had forwarded the correspondence to the Special Minister of State for the attention of the Australian Federal Police . Three months later, I have received no reply from the Special Minister of State as to what action the Federal Police may be taking on this matter. As a result, since it had been a reasonable time since the last period of correspondence, I deemed it necessary to raise the matter in the Parliament to determine what the Government intended to do in relation to the matter. Yesterday I asked a question of the Attorney-General as to whether there had been an auction sale at an Australian Labor Party meeting in Melbourne on or about 28 November 1983-a meeting at which he was either invited to be present or, indeed, was present. I asked the Attorney-General what he would do in order to pursue the matter and he indicated that he would seek further information to find out what had happened at that meeting. I should point out that in my question yesterday I referred to the auction of Commonwealth Government property allegedly stolen from Pine Gap. It has now come to my attention that the correct word would have been 'raffled'. Today, I addressed a question to the Minister for Education and Youth Affairs, Senator Ryan, as the Minister representing the Minister for Communications (Mr Duffy). I am told that Mr Duffy was also present at the meeting last November. Senator Gareth Evans —What meeting was that-a State conference? Senator MESSNER —It was a State special conference. Senator Robert Ray —You don't get invited to those. Senator MESSNER —Senator Ray was present also. The media, however, was invited. Senator Gareth Evans —So were about 450 other people. What are you saying? Senator MESSNER —If Senator Evans would care to listen to the case, perhaps he might be able to give us an intelligent reply. The point of my question today was to discover- Senator Gareth Evans —When did the raffle take place? Senator MESSNER —Would Senator Evans please shut up and just listen for a time. He might learn something. The point of the question today was to determine whether we could obtain a copy of a transcript of the Nationwide program I spoke of earlier setting out the circumstances of the meeting in Melbourne and, indeed , who was present and, in fact, what took place at the meeting. The Minister replied that she would seek to obtain that information from the Minister for Communications who, I have just indicated, was also present at the meeting in Melbourne on that day. Subsequent to my question-it has now prompted me to raise the matter during the adjournment debate-a transcript of the Nationwide television program has come into my hands which sets down the circumstances of that meeting. I seek leave to have the transcript incorporated in Hansard. Leave granted. The transcript read as follows- TRANSCRIPT OF A.B.C. NATIONWIDE-28 NOVEMBER 1983 Uranium RICHARD CARLETON: From assets testing to an asset of Australia, at least in some people's eyes, uranium. Uranium is a sore that just won't heal for Labor. Now reminiscent of earlier damaging brawls in the Party, the Queensland Branch has referred to the all-powerful National Executive, the question of the Hawke Government's uranium policy. The Queensland Branch has asked the National Executive to rule whether the Caucus decision of a few weeks ago is contrary to Labor's written policy. In effect, Queensland is asking Labor's outside National Executive to rule on a decision of the Party's elected Parliamentarians. This has happened and caused great problems in times gone by. This will come up at the National Executive meeting today week. But last weekend Labor's Victorian Branch held a special State Conference on Uranium and the result was no surprise-condemnation of the Government's new policy. But given all the sound and the fury at the Melbourne meeting what difference does it make. David Ransom was there. UNIDENTIFIED MAN: ''It seems to me that in issuing the sternest warning which State Conference can to the highest levels of the Parliamentary party, we are not promoting division, it is they that have done it-we are promoting unity . . .'' DAVID RANSOM: Even aside from domestic politics, for uranium conference it couldn't have been more timely. The Americans have started putting their new missiles in Europe, the Russians had responded with warnings of nuclear war. Also on the international stage was the Australian Prime Minister. He had just lent weight to an Arms Race Protest blessed by Commonwealth Heads of Government meeting in India. But the Prime Minister's concerns about things nuclear didn't rate with many of those who turned up at Melbourne's Collingwood Town Hall yesterday. They were much too riled by Bob Hawke's support for uranium mining. At yesterday's conference the Victorian Branch's dominant Socialist Left Faction was out in force. People like Joe Camileri, State MP Jim Simmons, and old identities like Bill Hartley. The Faction had Caucussed earlier in the week and was confident of success. Eighteen motions were listed. The brunt of the attack was a repudiation of Federal Caucus's decision on Roxby Downs and a censure of all Victorian Labor MPs who voted in favour of it. But from the start it was obvious that Bob Hawke's Centre Unity Group was to put up a fight. They had a powerful force led by Attorney-General, Gareth Evans and including MPs Clyde Holding and Senator Robert Ray with Michael Duffy from the Independent Group. On display like trophies from a medieval battle were the relics of the female fracas at Pine Gap. Commonwealth property it may have been but here it was being raffled in aid of the anti-uranium cause. JOAN COXSEDGE: ''An anti-nuclear policy today is not merely justified . . .'' Then Socialist Left MP, Joan Coxsedge spoke to the first motion and the political fur started flying. JOAN COXSEDGE: ''. . . is the only way that people can live with their consciences and yet we find unscrupulous people including members of our own Party hell-bent on breaking this policy and to add to the overpowering pressures of the world's nuclear arms race.'' CLYDE HOLDING: ''And if you are talking about phasing out tomorrow, well that's alright. We'll tell Gordon Scholes we won't go on with the frigates down at Williamstown and you can explain to the Metal Workers Union what is going to happen if they don't have those frigates on line. It's not as bloody easy as you think.'' Centre Unity member, Clyde Holding had attempted to counter with an amendment. The move was to have the Federal Executive decide the illegitimacy of the Caucus decision but it didn't work. Then Gareth Evans presented a warning. GARETH EVANS: ''By undertaking as you are proposing to do on some of the rest of these motions to campaign against this Government, you are throwing the credibility of the capacity of this Government on the line, you are destabilising this Government and you are creating a situation-whether you believe it or not, or whether you want to or not-whereby you are guaranteeing that the certainty of the continuation of uranium mining in this country. Don't set this party on a course of public self-immolation and don't set this party and this Government on a course to destruction.'' But the smoke cleared to reveal all the Left's motions passed with hardly an amendment, although often only narrowly. But just as interesting was the confusion over whether the ALP has an anti-uranium policy or not. An observer at the Conference was a lecturer in politics at Victoria's Philip Institute of Technology, Mark Considine. MARK CONSIDINE: ''A number of speakers who came before the Conference today on both sides were arguing that in fact existing policy supported their position. So we have got the amazing if not ridiculous proposition put before us that in fact the present ALP National Policy supports both the continuation of the present contracts and their repudiation. Now I think that ambiguity was at the base of a lot of the acrimonious exchanges today and it is one of the reasons why this issue is going to burn on and bubble on for a good time to come.'' But how serious a business is a Branch censure of Federal Parliamentary members . MARK CONSIDINE: ''I think it is an indication that that whole tension between the Party in office and the Party out of office has never really been resolved. It is not clear for example whether the Government of the day, a Labor Government of the day, has a direct responsibility to continue supporting Party policy or whether as a Government it has a right to look beyond the Party to some wider electorate.'' So what will all this mean to the Prime Minister and the way he runs his Government. The National Correspondent for the Sydney Morning Herald, Peter Bowers. PETER BOWERS: ''I suspect very little, I believe he will ignore this resolution today, just as he ignores all resolutions that he doesn't like taken by the Victorian Party.'' UNIDENTIFIED WOMAN: ''It may not have any influence on the way he runs his Government but I think where it will have an interesting influence is that perhaps the pressure of these resolutions may force some Federal Politicians to take a view that was expressed by a couple at the Conference. For instance we will go into the Parliament and we will support a resolution as we must because we are bound by Caucus but elsewhere we are not going to support it. So that you are actually getting politicians now who are saying 'well I will say one thing in the Parliament but I am going to say something else and very strongly elsewhere.' Now how can you have a Federal Government and continue to have support for a Federal Government when members take clearly opposite positions like that. It is a duplicity that I think the electorate won't tolerate.'' The Socialist Left sees yesterday's victory as a forerunner to a stronger anti- uranium vote at the National Conference next year. Another view is that such a hard line might frighten off some anti-uranium supporters and leave the Left isolated. But on the consequences of a stronger antiuranium vote, Peter Bowers again: PETER BOWERS: ''If the National Conference reverses its policy and particularly the policy on Roxby Downs it almost certainly will mean the defeat of the South Australian Government because that was the issue on which the last election was fought and Roxby Downs was a key factor in that election. As for whether Hawke could survive it, it would be a very serious blow to his personal standing and it is worth remembering that Hawke's personal popularity is a big factor and one of the, perhaps the most important factor that the Labor Party has going for it. If you asked me to pick, say, what is going to happen in the Labor Party in nine months time, I would expect that Hawke will have the numbers.'' ANNOUNCER: David Ransom with that report from Melbourne. Senator MESSNER —The transcript was provided by the Parliamentary Library. I shall quote paragraphs 3 and 4 of page 2 which indicate in the first place that certain people were present at that meeting and also refer to actions that took place in regard to the stolen government property. Paragraphs 3 and 4 read: But from the start it was obvious that Bob Hawke's Centre Unity Group was to put up a fight. They had a powerful force led by Attorney-General, Gareth Evans and including MPs Clyde Holding and Senator Robert Ray with Michael Duffy from the Independent Group. On display like trophies from a medieval battle were the relics of the female fracas at Pine Gap. Commonwealth property it may have been but here it was being raffled in aid of the anti-uranium cause. That brings me to the major point I wanted to make in the course of my remarks. Although it can be acknowledged that those remarks in the transcript do not say that the Attorney-General or any of the other members of the Australian Labor Party were present or knew, in fact, of the existence of the stolen property at that meeting, there is pretty clear circumstantial evidence that, in fact, they did know that that property was in the building in which they were present in the course of the meeting. In fact, I believe that it would have been painfully obvious to them that that was so. The question has to be asked whether they knew that that property was stolen. I suspect that there is absolutely no doubt that they know that that indeed had happened in the light of publicity given to the activities of the female demonstration at Pine Gap a week or two earlier. The next point I would like to make is that it is surely for the Attorney-General, then, to give an explanation as to whether he knew of the presence of that stolen property at that meeting. I would like to hear him on that point. To further muddy the waters on the issue, in the letter I received from the Attorney-General dated 10 February 1984 he said, in the course of referring the matter to the Special Minister of State that in fact he had no personal knowledge of the matters to which I was referring in my original letter to Mr John Brown. I could understand if the Attorney-General, pedantic as always, chose to draw the distinction between an auction of stolen government property and a raffle. It is quite possible that he could have taken that position, and quite legitimately so. Irrespective of the morals of the situation, he having such an incisive legal mind might very well be capable of drawing distinctions in that circumstance. I would like to hear his explanation now as to whether or not he had personal knowledge of those events. I think that we in this Parliament need to be able to draw a conclusion as to whether the Nationwide program was a truthful account of what happened in the course of that meeting and, indeed, whether those Ministers and those members of parliament knew about it. If they did know about it-and it has to be said that the evidence is fairly strongly in favour of their knowing about it-why is it that the Attorney-General did not see fit to take a stronger line of action against those who had stolen Commonwealth property? His role in this chamber is both as Attorney-General, as first law officer of the land, and as Minister representing the Special Minister of State and consequently having direct responsbilitity for the administration of the Australian Federal Police. Is the Attorney simply pursuing his normal course, that is, having referred the matter to the Special Minister of State, is awaiting a reply from him as to what action is going to be taken by the police? Or is it just a lack of diligence on his part which we have become accustomed to in this chamber over the last 12 or 15 months since he has been in office in regard to his approach to matters of what he might regard as fairly minor details of administration? I believe that that question needs to be answered. I believe that the Attorney- General would do us all proud by making clear his own understanding and knowledge of the events that took place at that convention, and if he also, at the very least, would please hasten his activities in connection with the Special Minister of State to see whether he can obtain some action from the police force and obtain a report for us as promptly as possible. Senator GARETH EVANS(Victoria-Attorney-General)(6.38) —Jeremy Bentham used to say that there are two different kinds of nonsense: There is plain, ordinary, common and garden nonsense and there is nonsense on stilts. We have had a classic exposition tonight of nonsense on stilts- the extraordinary suggestion that somehow, sometime and some place I have, it appears, been guilty of aiding and abetting either the commission of a crime or its subsequent concealment, the stealing of Commonwealth Government property. The allegation is really so bizarre as to barely justify a reply. Nonetheless, let me try. It appears that the nub of the allegation is my unquestioned presence at the conference of the Australian Labor Party in November of last year. At that conference there was not just the Minister for Communications, Michael Duffy, Senator Robert Ray or me. There were over 450 other participants with God knows how many Press people and goodness knows how many visitors thronging about. Now that Senator Messner lets me into the secret, I have a vague recollection, to which I will readily confess, that amid all the paraphernalia of an Australian Labor Party Conference, and I appreciate that Senator Messner's conferences are not nearly as lively as ours, I might have seen peering out from among posters-I will not describe what sorts of posters they were-some material satisfying this description. There was certainly an awful lot of material about Pine Gap. As I recall, there were posters everywhere one looked. It is a common phenomenon at ALP conferences. But I have not more precise recollection than that. I certainly had no knowledge that I can recall then or subsequently of the material in question. I am not even sure to what it is that Senator Messner is referring-some sign, it appears, having been stolen, although it may have been self-evidently of that kind of origin, had I stopped to take any notice of it. I have no knowledge, nor did I at any stage have any knowledge-I am quite confident about this-of the material in question being the subject of an auction , a raffle or anything else. I certainly was not in the business, nor am I now, of making pedantic distinctions of that kind. Some sort of raffle of that kind may have been going on, along with all the chook raffles, duck raffles, china plate raffles, Bob Hawke bust raffles, and everything else that happens at an ALP conference. I do not know whether the Liberals are still flogging Malcolm Fraser busts or whether they will ever contemplate flogging Andrew Peacock busts . Be that as it may, Senator Messner must be familiar with the kind of surge of activity of this sort that goes on. I have no knowledge whatsoever and certainly no recollection of any such activity. Since Senator Messner is keen to make a production number of it, I repeat, as I said yesterday in completely good faith, that I am perfectly happy to follow up the matter with the Special Minister of State (Mr Young) and find out from him what the progress of the investigation has been. But I really think that there are matters of larger moment that ought to be occupying the honourable senator's time. He seems utterly unable to appreciate, given his own preoccupation with these things, that someone attending a conference of that kind, which was one of very considerable moment, might just conceivably have had his mind on things other than what sorts of decorations might have been around the hall. I appreciate that it has been something of a triumphant- Senator Messner —So long as you tell my constituent this, that is all right. Senator GARETH EVANS —I appreciate that Senator Messner feels that he has had something of a forensic triumph here this evening. I am certainly happy enough to accommodate him in his concern that there should not be offences overtly committed against Commonwealth law and certainly that no comfort should be given to those who commit such offences, for whatever motivation. I have no desire to conceal the commission of such an offence, if that did, indeed, occur, or any subsequent events in relation to it. I shall do my best to find out what, if anything, the police have been able to find out and notify Senator Messner accordingly. Senator ROBERT RAY(Victoria)(6.42) —I shall not delay the Senate for long. I was at the conference. I should like to back up what the Attorney-General, Senator Gareth Evans, has said. Inferentially from what Senator Messner has said , one would believe that we were at a function-he did not, first, say ' conference' or 'meeting'-attended by four or five Federal people and that some sort of illegal act occurred that we would undoubtedly have noticed. I point out that there were 450 delegates, out of a potential 470, at the meeting. There were 150 observers, and there were 50 representatives of the Press. All this took place, by the way, in Collingwood Town Hall, in cramped, uncomfortable conditions. I have no memory or knowledge of a raffle being run raffling anything on that day. However, if there was such a raffle and if it was something to do with Pine Gap, the last people who would be approached to buy a ticket would be Senator Gareth Evans, myself, Mr Duffy and Mr Holding. The whole idea of the conference being put on was to give the Federal Labor Caucus a bit of a boot. That certainly happened. Although we won the argument, we just did not have the numbers on the day. Senator Chaney —I know exactly how you feel. I am glad that it happens to you. Senator ROBERT RAY —That's life. Occasionally we feel empathy when we perceive that as the situation. I left the meeting 10 minutes before it ended, as did most of the people of my political outlook. We had debated and voted on 12 items . There were five with foreign affairs implications, which I think we had all conceded might as well go through. I cannot say whether some announcement about a raffle or something was made then. All I can say is that it was not obvious to me as a conference delegate, a person who participated in the debate and who organised speakers, that a raffle for something was going on illegally. I just make the point in defence of Senator Gareth Evans that I do not think that he could have known. I do not deny that it may have occurred, but I sincerely say that it would not have been obvious. It was a conference of very high tension, very high emotion and very high involvement. It was not like the normal conference, at which half of the people attending are in the conference room and the other half are circulating outside it-where one does pick up all these things. Everyone was inside, listening and barracking for one point of view or another. What the Attorney-General has said tonight fits in with my own memory. I cannot deny that maybe some stolen property was auctioned, raffled or something else. All I am saying is that it would not have been obvious to any member of the conference, especially any member who shares the views of the Attorney-General and me. Senator CHANEY —Western Australia-Leader of the Opposition) (6.45)-I wish to raise a number of matters with the Minister for Resources and Energy (Senator Walsh). I thank him for being in the chamber in the adjournment debate for that purpose. The Minister made a very important announcement about a greenfields resource rent tax. He made that announcement on 18 April after the Government had been working for about a year on a proposition which has been Australian Labor Party policy for I think, about five years, so it is something which has a long history to it. Part of the announcement was to impose a new form of tax on Fortescue oil, but for the future Senator Walsh indicated that there would be a resource rent tax, and his paper provided a couple of forms of that tax and he sought industry comment. I am critical of the time which the Minister has permitted for industry comment . I note that he made this announcement on 18 April and requested comments by 8 May. Between those dates there has been the Easter-Anzac Day confluence, so there has been a relatively small number of working days in that period. The Government, through both Senator Walsh's Department and the Treasury, has been working on this matter for a long time. It is complicated. There are still a large number of unknowns in the proposition. Senator Walsh has sought comment on some of those points from the industry; but it appears to have been a relatively short period, and I understand that some people have had difficulty in meeting the deadline, although I believe that some have met it. I want from the Minister some public comment on what timetable he is maintaining, whether he is allowing an extension of time for people who have not been able to comply with his timetable, and in what way he intends to deal with the submissions which have been received. I understand, of course, that the Minister will be having discussions with industry following his call for submissions, but I should like to know whether, following the receipt of submissions and the discussions that he will be holding, it will be the Government's intention to provide industry with a further indication of the Government's then intention, with some further time to comment on any proposal before the Government really goes firm on it. I raise these matters because I am a little puzzled as to why the matter needs to be rushed. We have two or three sitting weeks ahead of us, but I would be surprised if Senator Walsh expects to legislate in the time available. If he proposes to have a tax commencing on 1 July, I could understand why he would want the details to be as complete as possible before the commencement of the new financial year. But it seems unlikely that the new tax would be relevant to any producing field for at least some time. It appears to the Opposition that there is no need for the matter to be dealt with in quite the rushed way in which the Minister is tackling it at present. Another matter that I wish to raise is the extent to which the work currently being done on the greenfields resource rent tax should be regarded as being relevant to any possible extension of a resource rent tax to other sections of the resource industries. We know that the Government is interested in the tax on a wider basis. The original indication, rather than a firm statement, was that the tax might be applied to coal and to oil. The retreat to greenfields off- shore oil is in part occasioned by the difficulties of dealing with the States which are involved on-shore and the very real difficulties of applying a totally new tax arrangement to existing and producing fields. Unless Senator Walsh is prepared to say, and I would be interested to know what he will say, that this is the extent of the Government's ambitions in resource rent tax, I think it is important to clarify for the industry and for the public the extent to which the parameters of any resource rent tax on greenfields oil would be regarded as relevant in establishing the parameters for a resource rent tax on some other sector of the industry. I do not suppose it is for the Opposition to adopt a final position on this, but I would suggest that the considerations that apply to large pools of off- shore oil will not necessarily be the same considerations that apply to, say, on -shore coal fields or, indeed, any other mineral which might become the target of the Government in this area. I think it important that there be some clarity in this field because if the attention of the public and the industry is focused solely on the conditions which are likely to apply with respect to a greenfields oil field, in particular conditions which might apply to Jabiru if that field lives up to some of the expectations that have been expressed by comentators, one could get parameters-I refer here both to thresholds and to tax rates-which could in my view be totally inappropriate for other forms of minerals and for different conditions of development. In the interests of getting a sensible appreciation of what the Government is doing at the moment, I would like, either now or at some later time if there is anything the Minister does not wish to respond to now, an indication from the Minister of the extent to which this relatively narrow proposal is to be regarded in terms of the parameters which the Government might establish as being necessarily applicable to any other resource or any other sector of the resouce industries to which the Government might subsequently seek to apply a resource rent tax. Senator KILGARIFF(Northern Territory)(6.52) —I listened with considerable interest to Senator Messner and Senator Gareth Evans in regard to the matter that Senator Messner brought up, that is, the sale or raffling at an Australian Labor Party meeting of signs from Pine Gap. Senator Gareth Evans said that the allegations were bizarre, but the thing that really astonished me in the brief debate that has taken place is that he and others have told the Senate-they have squared off-that they did not know what was going on while this meeting was taking place. The incredible thing is that Federal property has been stolen from Pine Gap near Alice Springs and apparently taken back to Victoria by the women and others who demonstrated there. It appears from what Joan Coxsedge, who is a member of the Victorian Parliament has said that this stolen property, bought with taxpayers' funds-taxpayers' property-was taken to Victoria and used for raising funds for this organisation that demonstrated at Pine Gap. Senator Walsh —Didn't you ever pinch an apple over the fence? Senator KILGARIFF —That is an interesting interjection from Senator Walsh. I suppose that an apple is worth 10c. Would the honourable senator like to look at the cost of these signs that were stolen from the roadway at Pine Gap and say whether that is allowable? In Victoria obviously that is a thing that can be done by the left wing. But if this sign had been taken by a resident of Alice Springs I am damn sure that that resident of Alice Springs would have been hauled before the courts for stealing and selling government property. I think the whole thing is absolutely incredible that here in the Senate, which is supposed to be the Federal law-making body of Australia, people associated with making the law can treat it as a joke that government property has been taken to Victoria and Miss Joan Coxsedge, a member of parliament, and others can be allowed to get off. The ACTING DEPUTY PRESIDENT(Senator Colston) —Order! Senator Kilgariff, you are referring to a member of another Parliament and you are making personal reflections on that member of parliament. Under standing order 418 that is not permitted, and I ask you to withdraw your remarks about the member of parliament in Victoria and continue your remarks without transgressing standing order 418. Senator KILGARIFF —Mr Acting Deputy President, I will withdraw those remarks, having in mind too that Senator Messner and I have referred to the transcript of the Australian Broadcasting Corporation program Nationwide in which this person' s name and the signs are mentioned. But, as I said, I withdraw the name. The only thing I want to say-- The ACTING DEPUTY PRESIDENT —Senator Kilgariff, that is not quite the point. I did not ask you to withdraw the name. I asked you to withdraw your personal reflections against that member of parliament. Senator KILGARIFF —I will withdraw the reflections on this person. I do that without any qualification, if that is the wish of the Chair. All I wish to say in my brief discussion of this point is that I also have been referring to the transcripts of the ABC program Nationwide on 28 November 1983. To clear up this matter as far as I am concerned, I ask: Why have the Australian Federal Police not taken action? The Federal Police must obviously realise- Senator Coleman —Ask the Federal Police. Senator KILGARIFF —It is a Federal Police matter, senator. Senator Coleman —Ask them. Senator KILGARIFF —We have. Senator Messner has asked them. We are asking the Government now to ask the Federal Police why they have not taken action. This is a matter of principle and I hope that principles, even in relation to matters such as this, will receive some attention from government authorities. I turn to the matter about which I actually want to speak. I noted that yesterday in the House of Representatives the Government introduced the Cocos ( Keeling) Islands Self-Determination (Consequential Amendments) Bill by which various Federal Acts are to be amended, including the Northern Territory (Self- Government) Act, and which will allow the Cocos (Keeling) Islands and later, I guess Christmas Island to be incorporated into the Northern Territory for electoral and referenda purposes. As the Territory is to be involved in the Cocos (Keeling) Islands and Christmas Island, I noted in the West Australian of Wednesday, 9 May a report that the Government has given an ultimatum on the closure of the phosphate operation on Christmas Island. The article says: The Federal Government sent a blunt warning to Christmas Island yesterday, that unless enough workers were willing to quit the island, the entire operation would have to fold. A further media report is headed: 'Mining chief quits and blames Government'. The Cocos and Christmas Islands are much in the news, and I asked questions the other night in the adjournment debate-I was unable to ask them in Question Time- about the government attitude in relation to the Northern Territory, possible self-government, and all of those matters associated with the possibility of Cocos and Christmas Islands coming under the Northern Territory government. I would like the Government to answer those questions when it is convenient. I hope that will be some time in the near future. Because this matter seems to be of interest not only to the people of Christmas and Cocos Islands but also to the people of Australia and the Northern Territory in particular, I ask the Minister for Veterans' Affairs (Senator Gietzelt), as Minister representing the Minister for Territorties and Local Government (Mr Uren), a further set of questions. I refer the Minister to the Government's stated intention to close the Phosphate Mining Company of Christmas Island Ltd if sufficient numbers of workers do not resign from the company. I ask: What actions have been taken so far by the Government and the Phosphate Mining Company with regard to the closure of the company? What actions does the Government intend to take if a sufficient number of employees have not voluntarily resigned by the deadline date, 1 October? Is it the Government's intention to provide jobs on the Australian mainland for any worker prepared to move from Christmas Island to the mainland? In the event that the Company is forced by the Government to close, will the Government help to relocate the islanders and provide them with employment? What is the future for the economy of Christmas Island, firstly, if the mine remains in operation; and secondly, if the mine is closed? Does the Government envisage any role for the Northern Territory in this matter? Senator TEAGUE(South Australia)(7.02) —I wish to raise a matter concerning Medicare, and its administration, and in particular about gap insurance and the inability so far for Medicare officers to tell Medicare cardholders when they exceed the limit for personal payments, for which there is provision in the legislation. The Opposition has highlighted dozens of principles for its opposition to the whole system of Medicare-its bureaucratic treatment, its evasion of market-place principles, its trespass upon the civil liberties of ordinary Australians, its inefficiencies, and its inevitable trend to higher costs. However, one of the matters we have criticised in the Medicare arrangements is gap insurance. It is well known-I think it is the only thing that is well known-about gap insurance that if a medical item costs a patient $ 10, Medicare will reimburse only $8.50 of that cost and $1.50 must be borne by the patient. So the personal cost is usually 15 per cent of the schedule fee of any item of medical procedure. The first objection which the Opposition has made many times in the Parliament is that the Government's legislation makes it illegal to take out insurance to cover the gap. In Australia it is impossible to take out insurance to cover these 15 per cent payments. When the Government was under some pressure because of that prohibition, the Minister for Health (Dr Blewett) said: 'We will introduce a $150 per annum limit for all of these individual gap payments and if any individual Australian has personal costs exceeding $150 in a year, all the additional amounts will be paid by Medicare'. The Opposition objects to even this because it is determined by bureaucracy without reference to the market- place. The Government is acting autocratically. It is taking a figure off a shelf and saying: '$150 is the limit, and only when you exceed that will Medicare pick up the full cost'. The Opposition's second objection is that this limit has not been accurately publicised in the community. It is still the case that the majority of Australians understand that when a family has personal costs exceeding $150 in a year Medicare will pick up all of those gap payments, but that is not so. The $ 150 limit applies to every individual in the family. Therefore, instead of the $ 150 relating to a husband, a wife and two children, they must in fact incur $600 worth of gap payments in a year-$150 for each individual-before Medicare picks up the full cost of medical items. The cost of this gap insurance for a family of four is effectively $600, and that is about the cost of private insurance in the former schemes for the whole family to be covered for all costs. It is very apparent that this limit, decided bureaucratically, is excessive and is in no way generous to individual Australians. However, this misunderstanding remains in Australia, and Medicare officers have not sought to publicise that there is this burden of the $150 limit on every individual. With regard to the present financial year, because Medicare was introduced from 1 February there is a $62.50 limit for the five months from 1 February to 30 June. In the next full financial year the limit, presumably, will be $150 or, if the Government is honest, it will be indexed to some higher amount. If an individual Australian incurs personal payments to meet gaps in these five months that exceed $62.50, he can claim that Medicare should pay the full schedule fee for any other item incurred by him. I have a third objection that I want to highlight tonight and that is that Medicare officers are not telling Medicare cardholders-the individuals, the Australians, the customers-as they come into the Medicare office when that limit has been exceeded. It is quite possible, indeed unless an individual is alert it would be the normal case, that the personal payments of the gap will go on and on beyond the $62.50 in the remaining five months of this financial year. This past week a case was brought to my attention of a constituent in South Australia-it is one of a number of which I know where a mother was admitted to hospital early in February and, in connection with this admission for surgery, at least eight Medicare claims have been made in the past two months. The gap involved in these several claims has exceeded $62.50 but it had exceeded it quite considerably before the family realised that it was eligible for Medicare to pay all of the costs. When Medicare is confronted with situations like this it says: 'It is your responsibility to do your own accounting. We do not have written into our computer an automatic calculation of when that ceiling is reached'. My request to the Government and to the Minister for Resources and Energy ( Senator Walsh) who is in the chamber, is that the Government give urgent consideration to requiring Medicare officers to use the computing facilities available to write in a program so that any individual Medicare card holder will be alerted by the Medicare office when that $62.50 is exceeded, and in the normal case, $150. I believe that government would be more open and more honest and would be providing a service to individual Australians, which is what we would expect of an administration such as Medicare. Senator PETER RAE(Tasmania)(7.11) —I shall be relatively brief on a matter which I hope can be processed to an early result. This matter concerns the tertiary education assistance scheme allowance and combined degrees. The Australian National University-I am a Senate representative on the University Council-has expressed concern, as have some other universities, in relation to the recognition for the purposes of TEAS allowances of certain combined degrees. The University is pressing for the recognition of the combined Bachelor of Science-Bachelor of Economics degrees and also for the combined Bachelor of Science-Bachelor of Commerce degrees for the purpose of the TEAS allowance. The position has been that the University introduced the combined Bachelor of Science-Bachelor of Economics degrees in 1980 and sought its recognition for the purpose of TEAS allowance. Concurrently introduced were the combined Bachelor of Science-Bachelor of Laws degrees and the combined Bachelor of Science (Forestry) -Bachelor of Economics degrees. The combined Bachelor of Science-Bachelor of Commerce degrees were introduced this year upon the inauguration of the Bachelor of Commerce degree. The combined Bachelor of Science-Bachelor of Laws degrees and the combined Bachelor of Science (Forestry)-Bachelor of Economics degrees were promptly recognised by the Department of Education and Youth Affairs for the purpose of TEAS. But the combined Bachelor of Science-Bachelor of Economics degrees were not. Likewise the combined Bachelor of Laws-Bachelor of Commerce degrees were promptly recognised this year, but a decision on the combined Bachelor of Science-Bachelor of Commerce degrees has been deferred. This is not a matter in which any politics are involved. It is a matter which has continued during varying governments. It is a matter which I wish to raise, to put on record and to seek to have redressed, with better consideration of the problem. The combined programs should be of a type already approved for TEAS. What has happened is that the criterion has been applied inconsistently. The combined Bachelor of Science (Forestry)-Bachelor of Economics degrees were approved without precedent from any other university. As well this criterion militates against innovation in education which ought to be regarded as a desirable attitude. The combined degree program combines two specialist courses. One cannot validly make such generalisations from the names of degrees. For example, a science degree can be broadly based or specialised, as can an economics degree, a law degree or an arts degree. Moreover, should such a criterion be relevant for the purposes of TEAS recognition at all? The time saving from the combined program is not substantial as compared with taking two degrees end-on. However, the time saving would normally be one year, as for the other combined degree programs offered by the University. The actual time saved will vary somewhat according to the particular subjects undertaken. I further comment that the combined degrees are not essential to the pursuit of any one particular career. This criterion has not been consistently applied, as probably none of the approved combined courses is necessary for any particular career. Neither are most first degrees necessary for particular careers. All science-based industries need managers who have a science degree combined with economics, commerce, law or business administration. The development of high technology industries in Australia is partly dependent upon companies being able to hire staff with such expertise. The science task force of the Royal Commission on Australian Government Administration in its report entitled ' Towards Diversity and Adaptability' referred to the continuing need for scientifically trained administrators in the Public Service. Enrolments in science-economics degrees have been good from the outset. In 1984 at the Australia National University there are 74 students in the combined program. As well, there are 15 students in the combined science-commerce program . The Australian National University offers a range of combined degree programs. There programs are: Bachelor of Arts-Bachelor of Laws, Bachelor of Arts (Applied Science)-Bachelor of Laws, Bachelor of Arts (Applied Sciences)-Bachelor of Economics, Bachelor of Commerce-Bachelor of Laws, Bachelor of Commerce-Bachelor of Science, Bachelor of Economics-Bachelor of Laws, Bachelor of Economics- Bachelor of Science, Bachelor of Economics-Bachelor of Science (Forestry), and Bachelor of Science-Bachelor of Laws. All these programs are recognised for TEAS , except for the combined science-economics and science-commerce programs. Their exclusion appears to be totally and absolutely anomalous. Likewise all the graduate diploma programs, and the bachelor of literature programs offered by the University are recognised for TEAS purposes. I find it quite amazing that this distinction has been made at a time when, as a result of the rate of technological change, at a time when never before in the history of the world, has it been more necessary that there be an understanding of the communication between science and economics, between what is called at the University of Stirling in Scotland, technological economics, and at a time when never before has there been a greater need for some new method of communication, the one area that would assist in that communication has been excluded from TEAS. I take this opportunity to ask the Minister to refer to the Minister for Education and Youth Affairs (Senator Ryan) and to the Department of Education and Youth Affairs the matters which I have raised and placed on the record tonight. I hope to be able to report to the Council meeting of the Australian National University tomorrow that this matter has been raised in the Senate tonight. Senator Walsh —What time? Senator PETER RAE —The Council meets at 9.30 tomorrow morning. I simply wish to be able to report that the matter has been raised. It is a matter which I have raised previously in the Senate and on the Council. As I set out, it has now reached the stage where recognition of a whole cross-section of combined degrees has been given, but recognition of the degrees that are probably the most essential has not been given. The absurdity, the incongruity and the anomalous nature of it is something which I find extraordinary. I ask the Minister to forward on to the relevant Minister and Department the matters I have raised tonight. I thank the Senate for the opportunity of so doing. Senator WALSH(Western Australia-Minister for Resources and Energy)(7.19) —I will not pretend that I understood all that Senator Rae had to say. I did get the general drift that there appears to be an anomaly in the payment of tertiary education assistance scheme allowances. I will see that that is brought to the attention of the Minister for Education and Youth Affairs (Sentor Ryan). I will do likewise for the matter Senator Teague raised. I think it is incongruous that Senator Kilgariff should have displayed such sanctimonious outrage at what would appear to be a bit of petty theft, when he does not have the same view of those who have diddled the Commissioner of Taxation, and thereby their fellow citizens , of hundreds of millions of dollars. If one wants to take a really self- righteous view of petty theft I think it is possible at least that those members of parliament who have glasses from the bar in their offices could also be deemed to be guilty of petty theft; there might even be one or two who have parliamentary glasses in their homes. Perhaps that is deplorable too, but it is hardly an outrage. As to the more serious matter raised by Senator Kilgariff about Christmas Island I will seek an answer from the Minister for Territories and Local Government (Mr Uren) on that. The Leader of the Opposition, Senator Chaney, asked for some facts about rent tax and for some opinions; I will give him both. I mention firstly the facts. The Government, as Senator Chaney stated, had asked the companies to forward to the Government by 8 May their responses to our policy statement. We recognise that that was a shorter time period than we would have liked to have made available and, for a number of reasons, it has in fact been extended. The meeting with the companies is scheduled for 18 May, that is tomorrow week, and submissions received at any time up to 18 May will be considered, though I think I should add that those that are received on 17 May, if any, will not be considered very thoroughly. We did receive an approach from one important company to delay that meeting until, I think, 4 June. That view was not shared by another important company which would have preferred not to have it on 18 May but did not want to leave it as late as 4 June. So one cannot please everyone. Senator Chaney correctly divined that the reason that we do want to hold the meeting reasonably early is that it is still the Government's intention to announce the details on or before 1 July even though it is unlikely that any tax or revenue would actually be collected in the next financial year; indeed, I think it is probably impossible that it would be. Senator Chaney asked whether the Government had intentions of extending the rent tax principle into other areas. He referred to previous statements from me and other members of the Government about coal. If it is to be extended, the highly profitable coal mines are an area where there is potential for the application of that sort of taxation. There would be nothing to stop the Government-not if it had the numbers in both Houses, anyway-imposing a rent tax on coal tomorrow. Legalistically, the impediment is that for a number of coal mines at least the economic rents at the moment are probably negative. By the time the States are finished with the others there is little rent left to collect or negative rents left to collect. However, the Broken Hill mine does provide a very good practical demonstration of the faults and the economic damage done by what is a fairly sophisticated royalty system or rather more sophisticated royalty system than most. Some discussions have been held between this Government and the New South Wales Government regarding an attempt to at least modify that royalty system. Broken Hill and the specifics there is an excellent demonstration of the economic damage which can be done by the royalty system which could not possibly be done if the tax system were based upon economic rent. I think the present dispute, shoot-out or whatever it is between the Queensland Premier and the coal producers in Queensland provides another example of the deficiencies of the present largely production based system of taxing the minerals industry. The extension of a rent tax to, say, the coal mining industry or in a Broken Hill type situation or any other situation is primarily a matter for the States. It is the Commonwealth's hope that the practical demonstration of a working model and a rent tax will encourage States to move in that direction. It probably will not be an actual matter for Commonwealth legislation, but Senator Chaney asked me for some opinions about whether the parameters which have been drawn by the Government for a rent tax would be applicable to other industries in precisely the same form. I think the answer is no and I say that for this reason: In the petroleum exploration area, and probably even more so in the off-shore petroleum exploration area, the risk and the magnitude of investment are heavily concentrated at the exploration stage. There is little risk beyond the exploration stage and for the industry in total-not, of course, for every particular field which may be discovered-the investment in exploration probably exceeds the investment in all other areas. That is not the situation which normally applies with exploration for other minerals where exploration costs are a relatively low proportion of total investment costs and exploration risks, I think, generally would be significantly lower, at least for large expenditures, than they are in off-shore areas. Therefore, because of the riskiness of off-shore oil exploration, the Government has put a proposal as an option that there be an exploration subsidy offset. I believe that at the very least there is a much weaker case in conventional mining for an exploration subsidy offset and, on balance, I suspect no case at all. Question resolved in the affirmative. Senate adjourned at 7.25 p.m. until 2 p.m. on Tuesday, 29 May 1984, unless otherwise called together in accordance with the Sessional Orders. The following papers were presented: Defence Amendment Act-Interim Determinations-Statutory Rules 1984 Nos 73, 74, 75. The following answers to questions were circulated: (Question No. 666) Senator Jones asked the Minister representing the Minister for Housing and Construction, upon notice, on 29 February 1984: (1) How many cases of fraud has the Department of Housing and Construction detected in relation to the first home owners scheme? (2) How many cases of overpayment have been detected? (3) Can the Minister for Housing and Construction provide details of any such cases? (4) What are the penalties involved for these offences, and under what Act are they covered? Senator Grimes —The Minister for Housing and Construction has provided the following answer to the honourable senator's question: (1) None, although my Department is investigating a number of cases in which it appears there may have been some attempt to defraud the Commonwealth. (2) None, however to date 10 cases of possible unlawful payment have been identified and are being referred to the appropriate authorities for possible prosecution. (3) No. It would not be appropriate to divulge information on investigations in progress. (4) The First Home Owners Act 1983 provides a range of penalties of up to $2, 000 and/or imprisonment for 12 months, with provision also for repayment of any amount unlawfully received. (Question No. 685) Senator Kilgariff asked the Minister representing the Minister for Home Affairs and Environment, upon notice, on 6 March 1984: (1) What plans does the Government have for the development of Kakadu National Park. (2) What funding will be invested in the park. (3) What plans does the Government have for providing accommodation facilities at Kakadu. (4) What form will promotion of the tourist facilities in Kakadu take and what does the Government anticipate it will spend on promotion. Senator Ryan —The Minister for Home Affairs and Environment has provided the following answer to the honourable senator's question: (1) Kakadu (Stage 2) National Park was proclaimed on 28 February 1984. On 13 March 1984 the Director of National Parks and Wildlife issued a notice of intent to prepare a report recommending declaration of Gimbat and Goodparla pastoral leases as part of Kakadu National Park. A notice of intent to prepare a plan of management for the whole of Kakadu National Park will be issued shortly and it is anticipated that the management plan will be completed by the end of 1985. The Government has agreed that an accelerated program of development of visitor facilities and park infrastructure be undertaken for Kakadu. (2) In November 1983 the Prime Minister, in announcing the accelerated program of development of visitor facilities and park infrastructure, stated that, subject to negotiations with the Northern Territory Government and Aboriginal groups, an additional expenditure of the order of $36m over six years was envisaged. This amount would be additional to that provided for basic operational and capital costs. Investment by the private sector is expected to supplement Government expenditure. (3) Accommodation facilities are identified within the existing plan of management. The provision of additional accommodation facilities will be addressed in the discussion on the details of the accelerated development program and in the next management plan. (4) Promotional material is already available and includes maps, brochures, posters and interpretative displays. At this stage it is not possible to specify the form of future promotion or the amount the Government will spend on promotion. (Question No. 796) Senator Missen asked the Minister representing the Minister for Home Affairs and Environment, upon notice, on 3 April 1984: (1) Is the practice of culling kangaroos normally designed to achieve the removal of old or non-breeding animals from the kangaroo population. (2) What evidence does the Government have that any genuine practice of culling is used by kangaroo shooters. (3) Are professional kangaroo shooters making no attempt to cull less fit animals. (4) Has the South Australian Government recently directed shooters to concentrate on female kangaroos and young animals. (5) Has this policy also led to a drastic reduction of the number of larger, healthier breeding male kangaroos and to a doubling of the South Australian quota. Senator Ryan —The Minister for Home Affairs and Environment has provided the following answer to the honourable senator's question: (1) To the extent practicable, kangaroo shooters generally select larger animals to maximise returns. Culling is not necessarily the removal of old or non-breeding animals from the population; the Concise Oxford Dictionary defines culling as the selection and killing of surplus animals. (2) See (1) above. (3) See (1) above. (4) The South Australian National Parks and Wildlife Service has advised that the answer is no. (5) The South Australian National Parks and Wildlife Service has advised that the policy referred to does not exist. The South Australian quota for Red and Western Grey kangaroos and euros in 1984 is 143,000, reduced from 300,000 in 1983. (Question No. 812) Senator Peter Baume asked the Minister for Veterans' Affairs, upon notice, on 5 April 1984: How are pharmacists to know whether the cheques they receive from the Department of Veterans' Affairs reflect accurately what is due to them for the issue of drugs, if they have no way of knowing what the unit price of each of these drugs is supposed to be, as the booklet entitled 'Repatriation Schedule of Pharmaceutical Benefits' does not list prices payable to pharmacists for the issue of drugs to veterans. Senator Gietzelt —The answer to the honourable senator's question is as follows: Pharmacists who have received approval to supply drugs under the repatriation pharmaceutical benefits scheme are provided with a reconciliation statement relating to each claim for payment submitted. This statement lists each item contained in the claim identifying the item by the serial number allocated by the pharmacist making the claim, the code number for the particular drug supplied and the price paid for that supply. The prices payable by the Department are derived from an audited file of wholesale prices, provided for the purpose, by the Pharmacy Guild of Australia. This file is subject to monthly updating and is the source of all pricing documents published by the Guild and provided to pharmacists. There are, therefore, no discrepancies between the price paid by the Department and the payment which the pharmacist would, as a result of consulting his or her standard pricing references, expect to receive. In view of the above it is considered not economically justifiable to print prices in the Repatriation Schedule as their regular updating would incur additional printing costs in duplicating information readily available to pharmacists. Senator Walsh —On 29 March 1984 (Hansard, page 870) Senator Chaney asked me a number of questions without notice concerning the marketing of Australian uranium, which I undertook to refer to the Minister for Trade. The Minister for Trade has provided the following answer to the honourable senator's questions: The two existing uranium producers, Energy Resources of Australia Ltd and Queensland Mines Limited, currently hold determinations in respect of the United States market and they are free to enter into negotiations for new uranium sales contracts in that market which is where the main sales prospects exist in the near term. The Government decided in November last year, however, that pending the outcome of an inquiry by the Australian Science and Technology Council into Australia's role in the nuclear fuel cycle, no new contracts for the export of uranium would be approved, with the exception of two contracts already negotiated. In fact, no applications for approval of additional uranium sales contracts have been submitted since the Government's decisions of last November. As the honourable senator has noted, the spot price is not a reliable indicator of prices likely to prevail under long term contracts. Spot market volume currently accounts for only 5 to 10 per cent of all uranium traded and reflects short term influences on the market. At any point in time spot prices do not necessarily reflect the cost of production, including an adequate return on investment, which is fundamental to long term supply viability. The current low spot price is nevertheless indicative of the present situation of oversupply of uranium which is inhibiting contracting for long term supply as well as seriously affecting contracting for short term supply.